Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP028341 Bifidobacterium adolescentis strain 1-11 chromosome, complete genome 1 crisprs DEDDh,WYL,csa3 1 0 2 0

Results visualization

1. CP028341
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028341_1 350350-350486 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP028341_4 4.1|1676086|36|CP028341|CRISPRCasFinder 1676086-1676121 36 CP028341.1 1226631-1226666 0 1.0

1. spacer 4.1|1676086|36|CP028341|CRISPRCasFinder matches to position: 1226631-1226666, mismatch: 0, identity: 1.0

aacatgccggccgtccgccggcgtatccaagaaaag	CRISPR spacer
aacatgccggccgtccgccggcgtatccaagaaaag	Protospacer
************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 832340 : 838597 13 Bifidobacterium_phage(50.0%) NA NA
DBSCAN-SWA_2 843007 : 855295 14 Propionibacterium_phage(41.67%) portal,terminase,protease,capsid,head NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage