Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP027363 Escherichia coli strain 88-3001 chromosome, complete genome 7 crisprs NA 0 3 0 0
CP027364 Escherichia coli strain 88-3001 plasmid unnamed, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. CP027363
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027363_1 665342-665432 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027363_2 690561-690644 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027363_3 1109973-1110093 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027363_4 2404769-2404881 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027363_5 2657963-2658078 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027363_6 3513929-3514077 Orphan I-F
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027363_7 3746059-3746150 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP027363_5 5.1|2657994|54|CP027363|CRISPRCasFinder 2657994-2658047 54 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 165411-165464 1 0.981
CP027363_7 7.1|3746085|40|CP027363|CRISPRCasFinder 3746085-3746124 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 1 0.975
CP027363_4 4.1|2404797|57|CP027363|CRISPRCasFinder 2404797-2404853 57 NZ_CP044307 Escherichia coli strain C27A plasmid pC27A-2, complete sequence 15004-15060 11 0.807
CP027363_5 5.1|2657994|54|CP027363|CRISPRCasFinder 2657994-2658047 54 NZ_CP048385 Citrobacter freundii strain 62 plasmid p6_C, complete sequence 72431-72484 12 0.778
CP027363_4 4.1|2404797|57|CP027363|CRISPRCasFinder 2404797-2404853 57 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 12104-12160 13 0.772
CP027363_4 4.1|2404797|57|CP027363|CRISPRCasFinder 2404797-2404853 57 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 3364-3420 16 0.719
CP027363_4 4.1|2404797|57|CP027363|CRISPRCasFinder 2404797-2404853 57 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 3363-3419 16 0.719
CP027363_4 4.1|2404797|57|CP027363|CRISPRCasFinder 2404797-2404853 57 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 3363-3419 16 0.719
CP027363_4 4.1|2404797|57|CP027363|CRISPRCasFinder 2404797-2404853 57 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 3363-3419 16 0.719

1. spacer 5.1|2657994|54|CP027363|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 1, identity: 0.981

gaatgccggatgcgctttgcttatccggcctacaaaatcgcagcgtgtaggcca	CRISPR spacer
caatgccggatgcgctttgcttatccggcctacaaaatcgcagcgtgtaggcca	Protospacer
 *****************************************************

2. spacer 7.1|3746085|40|CP027363|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 1, identity: 0.975

acagcacagcggggggaatttcaagaatgacccgcagcgc	CRISPR spacer
acagcacagcgggggtaatttcaagaatgacccgcagcgc	Protospacer
*************** ************************

3. spacer 4.1|2404797|57|CP027363|CRISPRCasFinder matches to NZ_CP044307 (Escherichia coli strain C27A plasmid pC27A-2, complete sequence) position: , mismatch: 11, identity: 0.807

-acaataacagcattgcctgatgcgacgctcgcgcgtcttatcaggcctacgagttca	CRISPR spacer
aacaattacca-ggtgcctgatgcgacgctggcgcgtcttatcatgcctacgagcccg	Protospacer
 ***** ** . . **************** ************* *********..*.

4. spacer 5.1|2657994|54|CP027363|CRISPRCasFinder matches to NZ_CP048385 (Citrobacter freundii strain 62 plasmid p6_C, complete sequence) position: , mismatch: 12, identity: 0.778

gaatgccggatgcgctttgcttatccggcctacaaaatcgc-----agcgtgtaggcca	CRISPR spacer
tactgccggatgcgctttgcttatccggcctacaataccgcgaattaatttgta-----	Protospacer
 * ******************************** *.***     *.. ****     

5. spacer 4.1|2404797|57|CP027363|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 13, identity: 0.772

-----acaataacagcattgcctgatgcgacgctcgcgcgtcttatcaggcctacgagtt	CRISPR spacer
ctccgacgtt-----cggtgcctgatgcgacgctggcgcgtcttatcaggcctacgagtc	Protospacer
     **. *     *. **************** ************************.

6. spacer 4.1|2404797|57|CP027363|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 16, identity: 0.719

acaataacagcat-----tgcctgatgcgacgctcgcgcgtcttatcaggcctacgagtt	CRISPR spacer
-----agttgtacgcaggtgcctgatgcgacgctggcgcgtcttatcatgcctacgagcc	Protospacer
     *.. *.*.     **************** ************* *********..

7. spacer 4.1|2404797|57|CP027363|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 16, identity: 0.719

acaataacagcat-----tgcctgatgcgacgctcgcgcgtcttatcaggcctacgagtt	CRISPR spacer
-----agttgtacgcaggtgcctgatgcgacgctggcgcgtcttatcatgcctacgagcc	Protospacer
     *.. *.*.     **************** ************* *********..

8. spacer 4.1|2404797|57|CP027363|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 16, identity: 0.719

acaataacagcat-----tgcctgatgcgacgctcgcgcgtcttatcaggcctacgagtt	CRISPR spacer
-----agttgtacgcaggtgcctgatgcgacgctggcgcgtcttatcatgcctacgagcc	Protospacer
     *.. *.*.     **************** ************* *********..

9. spacer 4.1|2404797|57|CP027363|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 16, identity: 0.719

acaataacagcat-----tgcctgatgcgacgctcgcgcgtcttatcaggcctacgagtt	CRISPR spacer
-----agttgtacgcaggtgcctgatgcgacgctggcgcgtcttatcatgcctacgagcc	Protospacer
     *.. *.*.     **************** ************* *********..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage