Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP027373 Escherichia coli strain 05-3629 chromosome, complete genome 9 crisprs NA 0 12 0 0
CP027375 Escherichia coli strain 05-3629 plasmid unnamed2, complete sequence 0 crisprs NA 0 0 0 0
CP027374 Escherichia coli strain 05-3629 plasmid unnamed1, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. CP027373
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027373_1 223446-223537 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027373_2 365495-365643 Orphan I-F
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027373_3 757675-757771 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027373_4 922195-922339 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027373_5 1051301-1051394 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027373_6 2711005-2711122 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027373_7 3104892-3105530 Orphan I-E
10 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027373_8 3131234-3131689 Orphan I-E
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027373_9 4341800-4341923 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP027373_1 1.1|223472|40|CP027373|CRISPRCasFinder 223472-223511 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 0 1.0
CP027373_5 5.1|1051331|34|CP027373|CRISPRCasFinder 1051331-1051364 34 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 9856-9889 0 1.0
CP027373_9 9.1|4341843|38|CP027373|CRISPRCasFinder 4341843-4341880 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
CP027373_4 4.1|922240|55|CP027373|CRISPRCasFinder 922240-922294 55 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229180-229234 7 0.873
CP027373_4 4.1|922240|55|CP027373|CRISPRCasFinder 922240-922294 55 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229281-229335 7 0.873
CP027373_4 4.1|922240|55|CP027373|CRISPRCasFinder 922240-922294 55 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239674-239728 7 0.873
CP027373_4 4.1|922240|55|CP027373|CRISPRCasFinder 922240-922294 55 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239775-239829 7 0.873
CP027373_4 4.1|922240|55|CP027373|CRISPRCasFinder 922240-922294 55 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230586-230640 7 0.873
CP027373_4 4.1|922240|55|CP027373|CRISPRCasFinder 922240-922294 55 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230687-230741 7 0.873
CP027373_4 4.1|922240|55|CP027373|CRISPRCasFinder 922240-922294 55 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211556-211610 7 0.873
CP027373_4 4.1|922240|55|CP027373|CRISPRCasFinder 922240-922294 55 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211657-211711 7 0.873
CP027373_4 4.1|922240|55|CP027373|CRISPRCasFinder 922240-922294 55 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229382-229436 8 0.855
CP027373_4 4.1|922240|55|CP027373|CRISPRCasFinder 922240-922294 55 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239876-239930 8 0.855
CP027373_4 4.1|922240|55|CP027373|CRISPRCasFinder 922240-922294 55 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230788-230842 8 0.855
CP027373_4 4.1|922240|55|CP027373|CRISPRCasFinder 922240-922294 55 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211758-211812 8 0.855
CP027373_5 5.1|1051331|34|CP027373|CRISPRCasFinder 1051331-1051364 34 NZ_CP010866 Marinovum algicola DG 898 plasmid pMaD11, complete sequence 5770-5803 8 0.765
CP027373_7 7.3|3105043|32|CP027373|CRISPRCasFinder,CRT,PILER-CR 3105043-3105074 32 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 1007613-1007644 8 0.75
CP027373_7 7.3|3105043|32|CP027373|CRISPRCasFinder,CRT,PILER-CR 3105043-3105074 32 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 795297-795328 8 0.75
CP027373_7 7.3|3105043|32|CP027373|CRISPRCasFinder,CRT,PILER-CR 3105043-3105074 32 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 1337086-1337117 8 0.75
CP027373_7 7.7|3105287|32|CP027373|CRISPRCasFinder,CRT,PILER-CR 3105287-3105318 32 NZ_CP030360 Salinibacter ruber strain SP38 plasmid pSR76, complete sequence 4393-4424 8 0.75
CP027373_8 8.4|3131446|32|CP027373|PILER-CR,CRISPRCasFinder,CRT 3131446-3131477 32 LN610585 Pseudomonas phage vB_PaeS_PAO1_Ab20, complete genome 18296-18327 8 0.75
CP027373_8 8.4|3131446|32|CP027373|PILER-CR,CRISPRCasFinder,CRT 3131446-3131477 32 KU356689 Pseudomonas phage ZC01, complete genome 18147-18178 8 0.75
CP027373_8 8.4|3131446|32|CP027373|PILER-CR,CRISPRCasFinder,CRT 3131446-3131477 32 NC_042115 Pseudomonas phage vB_PaeS_PAO1_Ab19, complete genome 18298-18329 8 0.75
CP027373_8 8.4|3131446|32|CP027373|PILER-CR,CRISPRCasFinder,CRT 3131446-3131477 32 NC_026594 Pseudomonas phage vB_PaeS_PAO1_Ab18, complete genome 18307-18338 8 0.75
CP027373_4 4.1|922240|55|CP027373|CRISPRCasFinder 922240-922294 55 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 87169-87223 9 0.836
CP027373_4 4.1|922240|55|CP027373|CRISPRCasFinder 922240-922294 55 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 158418-158472 9 0.836
CP027373_7 7.1|3104921|32|CP027373|CRISPRCasFinder,CRT 3104921-3104952 32 NZ_CP018001 Rhizobium sp. Y9 plasmid pY9, complete sequence 144663-144694 9 0.719
CP027373_7 7.1|3104921|32|CP027373|CRISPRCasFinder,CRT 3104921-3104952 32 NZ_CP012899 Burkholderia sp. CCGE1001 plasmid pCCGE1001a, complete sequence 350528-350559 9 0.719
CP027373_7 7.1|3104921|32|CP027373|CRISPRCasFinder,CRT 3104921-3104952 32 NC_010627 Paraburkholderia phymatum STM815 plasmid pBPHY02, complete sequence 519584-519615 9 0.719
CP027373_7 7.1|3104921|32|CP027373|CRISPRCasFinder,CRT 3104921-3104952 32 NC_018696 Paraburkholderia phenoliruptrix BR3459a plasmid pSYMBR3459, complete sequence 715230-715261 9 0.719
CP027373_7 7.5|3105165|32|CP027373|CRISPRCasFinder,CRT,PILER-CR 3105165-3105196 32 NZ_CP024314 Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence 2299206-2299237 9 0.719
CP027373_7 7.7|3105287|32|CP027373|CRISPRCasFinder,CRT,PILER-CR 3105287-3105318 32 NZ_CP049158 Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence 1739097-1739128 9 0.719
CP027373_7 7.7|3105287|32|CP027373|CRISPRCasFinder,CRT,PILER-CR 3105287-3105318 32 NZ_CP049318 Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence 1743765-1743796 9 0.719
CP027373_8 8.7|3131629|32|CP027373|PILER-CR,CRISPRCasFinder,CRT 3131629-3131660 32 NZ_CP026601 Clostridiaceae bacterium 14S0207 plasmid unnamed1, complete sequence 97056-97087 9 0.719
CP027373_4 4.1|922240|55|CP027373|CRISPRCasFinder 922240-922294 55 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229079-229133 10 0.818
CP027373_4 4.1|922240|55|CP027373|CRISPRCasFinder 922240-922294 55 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239573-239627 10 0.818
CP027373_4 4.1|922240|55|CP027373|CRISPRCasFinder 922240-922294 55 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230485-230539 10 0.818
CP027373_4 4.1|922240|55|CP027373|CRISPRCasFinder 922240-922294 55 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211455-211509 10 0.818
CP027373_7 7.3|3105043|32|CP027373|CRISPRCasFinder,CRT,PILER-CR 3105043-3105074 32 NC_023284 Streptomyces sp. F2 plasmid pFRL4, complete sequence 13692-13723 10 0.688
CP027373_7 7.3|3105043|32|CP027373|CRISPRCasFinder,CRT,PILER-CR 3105043-3105074 32 NC_023285 Streptomyces sp. F8 plasmid pFRL5, complete sequence 13709-13740 10 0.688
CP027373_7 7.5|3105165|32|CP027373|CRISPRCasFinder,CRT,PILER-CR 3105165-3105196 32 NZ_CP030830 Neorhizobium sp. NCHU2750 plasmid pNCHU2750c, complete sequence 129036-129067 10 0.688
CP027373_7 7.7|3105287|32|CP027373|CRISPRCasFinder,CRT,PILER-CR 3105287-3105318 32 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 809565-809596 10 0.688
CP027373_7 7.8|3105348|32|CP027373|CRISPRCasFinder,CRT,PILER-CR 3105348-3105379 32 NZ_CP046163 Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence 1832829-1832860 10 0.688
CP027373_7 7.8|3105348|32|CP027373|CRISPRCasFinder,CRT,PILER-CR 3105348-3105379 32 NZ_CP046066 Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence 168421-168452 10 0.688
CP027373_7 7.8|3105348|32|CP027373|CRISPRCasFinder,CRT,PILER-CR 3105348-3105379 32 NZ_CP045356 Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence 1592387-1592418 10 0.688
CP027373_4 4.1|922240|55|CP027373|CRISPRCasFinder 922240-922294 55 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 194092-194146 11 0.8
CP027373_4 4.1|922240|55|CP027373|CRISPRCasFinder 922240-922294 55 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 204586-204640 11 0.8
CP027373_4 4.1|922240|55|CP027373|CRISPRCasFinder 922240-922294 55 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 195420-195474 11 0.8
CP027373_4 4.1|922240|55|CP027373|CRISPRCasFinder 922240-922294 55 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 176375-176429 11 0.8
CP027373_4 4.1|922240|55|CP027373|CRISPRCasFinder 922240-922294 55 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 27377-27431 11 0.8
CP027373_4 4.1|922240|55|CP027373|CRISPRCasFinder 922240-922294 55 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 14103-14157 11 0.8
CP027373_8 8.3|3131385|32|CP027373|PILER-CR,CRISPRCasFinder,CRT 3131385-3131416 32 NC_015708 Pseudoalteromonas sp. SANK 73390 plasmid pTML1 carrying thiomarinol biosynthesis cluster 33648-33679 11 0.656
CP027373_4 4.1|922240|55|CP027373|CRISPRCasFinder 922240-922294 55 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 194185-194239 12 0.782
CP027373_4 4.1|922240|55|CP027373|CRISPRCasFinder 922240-922294 55 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 194278-194332 12 0.782
CP027373_4 4.1|922240|55|CP027373|CRISPRCasFinder 922240-922294 55 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 204679-204733 12 0.782
CP027373_4 4.1|922240|55|CP027373|CRISPRCasFinder 922240-922294 55 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 204772-204826 12 0.782
CP027373_4 4.1|922240|55|CP027373|CRISPRCasFinder 922240-922294 55 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 195513-195567 12 0.782
CP027373_4 4.1|922240|55|CP027373|CRISPRCasFinder 922240-922294 55 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 195606-195660 12 0.782
CP027373_4 4.1|922240|55|CP027373|CRISPRCasFinder 922240-922294 55 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 176468-176522 12 0.782
CP027373_4 4.1|922240|55|CP027373|CRISPRCasFinder 922240-922294 55 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 176561-176615 12 0.782
CP027373_4 4.1|922240|55|CP027373|CRISPRCasFinder 922240-922294 55 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 27278-27332 12 0.782

1. spacer 1.1|223472|40|CP027373|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgctgcgggtcattcttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
****************************************

2. spacer 5.1|1051331|34|CP027373|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 0, identity: 1.0

cgcaccgcttttctccctctccccaaaggagcct	CRISPR spacer
cgcaccgcttttctccctctccccaaaggagcct	Protospacer
**********************************

3. spacer 9.1|4341843|38|CP027373|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

4. spacer 4.1|922240|55|CP027373|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 7, identity: 0.873

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
tgcgcacgactgccggatgcggcgtgaacgccttatccggcctacggatggcgcg	Protospacer
 ********************************************.  * ** *.

5. spacer 4.1|922240|55|CP027373|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 7, identity: 0.873

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
tgcgcacgactgccggatgcggcgtgaacgccttatccggcctacgggtggcgcg	Protospacer
 ********************************************.  * ** *.

6. spacer 4.1|922240|55|CP027373|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 7, identity: 0.873

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
tgcgcacgactgccggatgcggcgtgaacgccttatccggcctacggatggcgcg	Protospacer
 ********************************************.  * ** *.

7. spacer 4.1|922240|55|CP027373|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 7, identity: 0.873

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
tgcgcacgactgccggatgcggcgtgaacgccttatccggcctacgggtggcgcg	Protospacer
 ********************************************.  * ** *.

8. spacer 4.1|922240|55|CP027373|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 7, identity: 0.873

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
tgcgcacgactgccggatgcggcgtgaacgccttatccggcctacggatggcgcg	Protospacer
 ********************************************.  * ** *.

9. spacer 4.1|922240|55|CP027373|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 7, identity: 0.873

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
tgcgcacgactgccggatgcggcgtgaacgccttatccggcctacgggtggcgcg	Protospacer
 ********************************************.  * ** *.

10. spacer 4.1|922240|55|CP027373|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 7, identity: 0.873

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
tgcgcacgactgccggatgcggcgtgaacgccttatccggcctacggatggcgcg	Protospacer
 ********************************************.  * ** *.

11. spacer 4.1|922240|55|CP027373|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 7, identity: 0.873

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
tgcgcacgactgccggatgcggcgtgaacgccttatccggcctacgggtggcgcg	Protospacer
 ********************************************.  * ** *.

12. spacer 4.1|922240|55|CP027373|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.855

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
tgcgcacgactgccggatgcggcgtaaacgccttatccggcctacggatggcgcg	Protospacer
 ************************.*******************.  * ** *.

13. spacer 4.1|922240|55|CP027373|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.855

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
tgcgcacgactgccggatgcggcgtaaacgccttatccggcctacggatggcgcg	Protospacer
 ************************.*******************.  * ** *.

14. spacer 4.1|922240|55|CP027373|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.855

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
tgcgcacgactgccggatgcggcgtaaacgccttatccggcctacggatggcgcg	Protospacer
 ************************.*******************.  * ** *.

15. spacer 4.1|922240|55|CP027373|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.855

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
tgcgcacgactgccggatgcggcgtaaacgccttatccggcctacggatggcgcg	Protospacer
 ************************.*******************.  * ** *.

16. spacer 5.1|1051331|34|CP027373|CRISPRCasFinder matches to NZ_CP010866 (Marinovum algicola DG 898 plasmid pMaD11, complete sequence) position: , mismatch: 8, identity: 0.765

cgca-ccgcttttctccctctccccaaaggagcct	CRISPR spacer
-gcacccgcttttctccctcgccacaaagccggac	Protospacer
 *** *************** ** *****  *  .

17. spacer 7.3|3105043|32|CP027373|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75

ttttgccggaccatttggtctggcctgatgcg	CRISPR spacer
gaatgccggaacaattggtctggccttcttcg	Protospacer
   ******* ** ************  * **

18. spacer 7.3|3105043|32|CP027373|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75

ttttgccggaccatttggtctggcctgatgcg	CRISPR spacer
gaatgccggaacaattggtctggccttcttcg	Protospacer
   ******* ** ************  * **

19. spacer 7.3|3105043|32|CP027373|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 8, identity: 0.75

ttttgccggaccatttggtctggcctgatgcg	CRISPR spacer
gaatgccggaacaattggtctggccttcttcg	Protospacer
   ******* ** ************  * **

20. spacer 7.7|3105287|32|CP027373|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030360 (Salinibacter ruber strain SP38 plasmid pSR76, complete sequence) position: , mismatch: 8, identity: 0.75

ccggac---actaccgaacgacagcggcggcgggc	CRISPR spacer
---ggctcgccttccgaacgacagtggcggcggcc	Protospacer
   *.*    ** ***********.******** *

21. spacer 8.4|3131446|32|CP027373|PILER-CR,CRISPRCasFinder,CRT matches to LN610585 (Pseudomonas phage vB_PaeS_PAO1_Ab20, complete genome) position: , mismatch: 8, identity: 0.75

ccatcatatgaacccaggcacggcacgcgctc	CRISPR spacer
ccatcatctgaacccaggcgcgggtgcagccc	Protospacer
******* ***********.***     **.*

22. spacer 8.4|3131446|32|CP027373|PILER-CR,CRISPRCasFinder,CRT matches to KU356689 (Pseudomonas phage ZC01, complete genome) position: , mismatch: 8, identity: 0.75

ccatcatatgaacccaggcacggcacgcgctc	CRISPR spacer
ccatcatctgaacccaggcgcgggtgcagccc	Protospacer
******* ***********.***     **.*

23. spacer 8.4|3131446|32|CP027373|PILER-CR,CRISPRCasFinder,CRT matches to NC_042115 (Pseudomonas phage vB_PaeS_PAO1_Ab19, complete genome) position: , mismatch: 8, identity: 0.75

ccatcatatgaacccaggcacggcacgcgctc	CRISPR spacer
ccatcatctgaacccaggcgcgggtgcagccc	Protospacer
******* ***********.***     **.*

24. spacer 8.4|3131446|32|CP027373|PILER-CR,CRISPRCasFinder,CRT matches to NC_026594 (Pseudomonas phage vB_PaeS_PAO1_Ab18, complete genome) position: , mismatch: 8, identity: 0.75

ccatcatatgaacccaggcacggcacgcgctc	CRISPR spacer
ccatcatctgaacccaggcgcgggtgcagccc	Protospacer
******* ***********.***     **.*

25. spacer 4.1|922240|55|CP027373|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.836

ggcgca-cgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca--	CRISPR spacer
-gtgcaccgaatgccggatgcggcgtgaacgccttatccgtcctacaat--gcctgat	Protospacer
 *.*** *** ***************************** ****** *  ***..  

26. spacer 4.1|922240|55|CP027373|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.836

ggcgcacgactgccggatgcggcgtgaacgccttatccggc--ctacacttcgccca	CRISPR spacer
ggcgcacaattgccggatgcggcgtgaacgccttatccgcctaccgaactgcgcc--	Protospacer
*******.*.***************************** *  *.. *** ****  

27. spacer 7.1|3104921|32|CP027373|CRISPRCasFinder,CRT matches to NZ_CP018001 (Rhizobium sp. Y9 plasmid pY9, complete sequence) position: , mismatch: 9, identity: 0.719

gggacatcgccagccgatttgatgagggtgac	CRISPR spacer
ccgacatcggcagccgatttcatgatattcat	Protospacer
  ******* ********** **** . * *.

28. spacer 7.1|3104921|32|CP027373|CRISPRCasFinder,CRT matches to NZ_CP012899 (Burkholderia sp. CCGE1001 plasmid pCCGE1001a, complete sequence) position: , mismatch: 9, identity: 0.719

gggacatcgccagccgatttgatgagggtgac	CRISPR spacer
gtgagatcgcgagccgatttgatgacacaatc	Protospacer
* ** ***** ************** .  . *

29. spacer 7.1|3104921|32|CP027373|CRISPRCasFinder,CRT matches to NC_010627 (Paraburkholderia phymatum STM815 plasmid pBPHY02, complete sequence) position: , mismatch: 9, identity: 0.719

gggacatcgccagccgatttgatgagggtgac	CRISPR spacer
gtgagatcgcgagccgatttgatgacacaatc	Protospacer
* ** ***** ************** .  . *

30. spacer 7.1|3104921|32|CP027373|CRISPRCasFinder,CRT matches to NC_018696 (Paraburkholderia phenoliruptrix BR3459a plasmid pSYMBR3459, complete sequence) position: , mismatch: 9, identity: 0.719

gggacatcgccagccgatttgatgagggtgac	CRISPR spacer
gtgagatcgcgagccgatttgatgacacaatc	Protospacer
* ** ***** ************** .  . *

31. spacer 7.5|3105165|32|CP027373|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 9, identity: 0.719

actatcgcggactgctgaaatcaaccggcgac	CRISPR spacer
cgtcgcgcggactgccgaattcaaccggctcg	Protospacer
  *  **********.*** *********   

32. spacer 7.7|3105287|32|CP027373|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 9, identity: 0.719

ccggacactaccgaacgacagcggcggcgggc	CRISPR spacer
acgcgagtaaccgcacggcagcggcggcgggc	Protospacer
 ** . .. **** ***.**************

33. spacer 7.7|3105287|32|CP027373|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 9, identity: 0.719

ccggacactaccgaacgacagcggcggcgggc	CRISPR spacer
acgcgagtaaccgcacggcagcggcggcgggc	Protospacer
 ** . .. **** ***.**************

34. spacer 8.7|3131629|32|CP027373|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026601 (Clostridiaceae bacterium 14S0207 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

ctgaaaaaaagggactgggtaacagcgcgtga	CRISPR spacer
atgaaaaaaaggtactggataacattataaga	Protospacer
 *********** *****.***** .... **

35. spacer 4.1|922240|55|CP027373|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 10, identity: 0.818

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ccagcacgactgccggatgcggcgtgaacgccttatccggcctacggatggcgtg	Protospacer
   ******************************************.  * ** ..

36. spacer 4.1|922240|55|CP027373|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 10, identity: 0.818

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ccagcacgactgccggatgcggcgtgaacgccttatccggcctacggatggcgtg	Protospacer
   ******************************************.  * ** ..

37. spacer 4.1|922240|55|CP027373|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 10, identity: 0.818

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ccagcacgactgccggatgcggcgtgaacgccttatccggcctacggatggcgtg	Protospacer
   ******************************************.  * ** ..

38. spacer 4.1|922240|55|CP027373|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 10, identity: 0.818

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ccagcacgactgccggatgcggcgtgaacgccttatccggcctacggatggcgtg	Protospacer
   ******************************************.  * ** ..

39. spacer 7.3|3105043|32|CP027373|CRISPRCasFinder,CRT,PILER-CR matches to NC_023284 (Streptomyces sp. F2 plasmid pFRL4, complete sequence) position: , mismatch: 10, identity: 0.688

ttttgccggaccatttggtctggcctgatgcg	CRISPR spacer
gattgccggaccattcggtctggccctcgctc	Protospacer
  *************.*********.    . 

40. spacer 7.3|3105043|32|CP027373|CRISPRCasFinder,CRT,PILER-CR matches to NC_023285 (Streptomyces sp. F8 plasmid pFRL5, complete sequence) position: , mismatch: 10, identity: 0.688

ttttgccggaccatttggtctggcctgatgcg	CRISPR spacer
gattgccggaccattcggtccggccttcgctc	Protospacer
  *************.****.*****    . 

41. spacer 7.5|3105165|32|CP027373|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030830 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750c, complete sequence) position: , mismatch: 10, identity: 0.688

actatcgcggactgctgaaatcaaccggcgac	CRISPR spacer
tgaagggcagactgctgaaatcatccggcagg	Protospacer
   *  **.************** *****.. 

42. spacer 7.7|3105287|32|CP027373|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 10, identity: 0.688

ccggacactaccgaacgacagcggcggcgggc	CRISPR spacer
aaacgcgctgccgaaccacagcggcggcggca	Protospacer
  . .*.**.****** *************  

43. spacer 7.8|3105348|32|CP027373|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046163 (Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence) position: , mismatch: 10, identity: 0.688

ggcgaatacaaacgctggcgcaacgagtccta	CRISPR spacer
agcaaaaacaaacgctggcgcaactggcaaat	Protospacer
.**.** ***************** .*.    

44. spacer 7.8|3105348|32|CP027373|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046066 (Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence) position: , mismatch: 10, identity: 0.688

ggcgaatacaaacgctggcgcaacgagtccta	CRISPR spacer
agcaaaaacaaacgctggcgcaactggcaaat	Protospacer
.**.** ***************** .*.    

45. spacer 7.8|3105348|32|CP027373|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045356 (Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence) position: , mismatch: 10, identity: 0.688

ggcgaatacaaacgctggcgcaacgagtccta	CRISPR spacer
agcaaaaacaaacgctggcgcaactggcaaat	Protospacer
.**.** ***************** .*.    

46. spacer 4.1|922240|55|CP027373|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 11, identity: 0.8

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ttgtcaccattgccggatgcggcgtgaacgccttatccggcctacgaatggcgca	Protospacer
    *** *.***********************************.  * ** **

47. spacer 4.1|922240|55|CP027373|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 11, identity: 0.8

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ttgtcaccattgccggatgcggcgtgaacgccttatccggcctacgaatggcgca	Protospacer
    *** *.***********************************.  * ** **

48. spacer 4.1|922240|55|CP027373|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 11, identity: 0.8

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ttgtcaccattgccggatgcggcgtgaacgccttatccggcctacgaatggcgca	Protospacer
    *** *.***********************************.  * ** **

49. spacer 4.1|922240|55|CP027373|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 11, identity: 0.8

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ttgtcaccattgccggatgcggcgtgaacgccttatccggcctacgaatggcgca	Protospacer
    *** *.***********************************.  * ** **

50. spacer 4.1|922240|55|CP027373|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 11, identity: 0.8

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ggcgcacaaccgccggatgcggcgtgaacgccttatccggcctacgggtgagtgc	Protospacer
*******.**.**********************************.  * . .  

51. spacer 4.1|922240|55|CP027373|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 11, identity: 0.8

-ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
aggcgt-tgattgccggatgcggcgtaaacgccttatccggcctacattcggcaag	Protospacer
 ****. .**.***************.********************.*. **  .

52. spacer 8.3|3131385|32|CP027373|PILER-CR,CRISPRCasFinder,CRT matches to NC_015708 (Pseudoalteromonas sp. SANK 73390 plasmid pTML1 carrying thiomarinol biosynthesis cluster) position: , mismatch: 11, identity: 0.656

acttacgcaacaaatcccgcctaaacaaccac	CRISPR spacer
gtaatcgcaacaaatgccgcctaagcaattcg	Protospacer
..   ********** ********.***..  

53. spacer 4.1|922240|55|CP027373|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.782

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ttgccaccactgccggatgcggcgtggacgccttatccggcctacgagtggcgcg	Protospacer
    *** ******************.******************.  * ** *.

54. spacer 4.1|922240|55|CP027373|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.782

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ttgtcaccattgccggatgcggcgtgaacgccttatccggcctacgagtggcgcg	Protospacer
    *** *.***********************************.  * ** *.

55. spacer 4.1|922240|55|CP027373|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.782

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ttgccaccactgccggatgcggcgtggacgccttatccggcctacgagtggcgcg	Protospacer
    *** ******************.******************.  * ** *.

56. spacer 4.1|922240|55|CP027373|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.782

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ttgtcaccattgccggatgcggcgtgaacgccttatccggcctacgagtggcgcg	Protospacer
    *** *.***********************************.  * ** *.

57. spacer 4.1|922240|55|CP027373|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.782

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ttgccaccactgccggatgcggcgtggacgccttatccggcctacgagtggcgcg	Protospacer
    *** ******************.******************.  * ** *.

58. spacer 4.1|922240|55|CP027373|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.782

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ttgtcaccattgccggatgcggcgtgaacgccttatccggcctacgagtggcgcg	Protospacer
    *** *.***********************************.  * ** *.

59. spacer 4.1|922240|55|CP027373|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.782

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ttgccaccactgccggatgcggcgtggacgccttatccggcctacgagtggcgcg	Protospacer
    *** ******************.******************.  * ** *.

60. spacer 4.1|922240|55|CP027373|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.782

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ttgtcaccattgccggatgcggcgtgaacgccttatccggcctacgagtggcgcg	Protospacer
    *** *.***********************************.  * ** *.

61. spacer 4.1|922240|55|CP027373|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 12, identity: 0.782

ggcgcacgactgccggatgcggcgtgaacgccttatccggcctacacttcgccca	CRISPR spacer
ggtacacaaccgccggatgcggcgtgaacgccttatccggcctacgggtgagcac	Protospacer
**..***.**.**********************************.  * . *  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage