Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP027351 Escherichia coli strain 2014C-3655 chromosome, complete genome 2 crisprs NA 0 8 0 0
CP027350 Escherichia coli strain 2014C-3655 plasmid unnamed 0 crisprs NA 0 0 0 0

Results visualization

1. CP027351
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027351_1 4693017-4693290 Orphan I-E
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027351_2 4720303-4720637 Orphan I-E
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP027351_2 2.2|4720393|32|CP027351|CRT 4720393-4720424 32 CP054922 Streptomyces sp. NA03103 plasmid unnamed2, complete sequence 68158-68189 6 0.812
CP027351_2 2.3|4720454|32|CP027351|CRT 4720454-4720485 32 MH389777 Dickeya phage vB_DsoM_JA11, complete genome 116689-116720 6 0.812
CP027351_2 2.3|4720454|32|CP027351|CRT 4720454-4720485 32 MH460462 Dickeya phage vB_DsoM_JA33, complete genome 116679-116710 6 0.812
CP027351_1 1.2|4693108|31|CP027351|CRISPRCasFinder,CRT 4693108-4693138 31 NZ_AP022602 Mycobacterium gallinarum strain JCM 6399 plasmid pJCM6399 61999-62029 7 0.774
CP027351_1 1.6|4693109|31|CP027351|PILER-CR 4693109-4693139 31 NZ_AP022602 Mycobacterium gallinarum strain JCM 6399 plasmid pJCM6399 61999-62029 7 0.774
CP027351_2 2.8|4720454|33|CP027351|CRISPRCasFinder 4720454-4720486 33 MH389777 Dickeya phage vB_DsoM_JA11, complete genome 116689-116721 7 0.788
CP027351_2 2.8|4720454|33|CP027351|CRISPRCasFinder 4720454-4720486 33 MH460462 Dickeya phage vB_DsoM_JA33, complete genome 116679-116711 7 0.788
CP027351_1 1.1|4693047|31|CP027351|CRISPRCasFinder,CRT 4693047-4693077 31 NZ_CP026601 Clostridiaceae bacterium 14S0207 plasmid unnamed1, complete sequence 97057-97087 8 0.742
CP027351_1 1.5|4693048|31|CP027351|PILER-CR 4693048-4693078 31 NZ_CP026601 Clostridiaceae bacterium 14S0207 plasmid unnamed1, complete sequence 97057-97087 8 0.742
CP027351_2 2.12|4720577|28|CP027351|PILER-CR 4720577-4720604 28 HG796329 Uncultured bacterium plasmid pRGI00478 3104-3131 8 0.714
CP027351_1 1.2|4693108|31|CP027351|CRISPRCasFinder,CRT 4693108-4693138 31 NZ_CP026242 Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-eb27, complete sequence 168728-168758 9 0.71
CP027351_1 1.2|4693108|31|CP027351|CRISPRCasFinder,CRT 4693108-4693138 31 NZ_CP009883 Pantoea sp. PSNIH1 plasmid pPSP-a3e, complete sequence 5480-5510 9 0.71
CP027351_1 1.2|4693108|31|CP027351|CRISPRCasFinder,CRT 4693108-4693138 31 NZ_CP010380 Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-328.905kb, complete sequence 100872-100902 9 0.71
CP027351_1 1.2|4693108|31|CP027351|CRISPRCasFinder,CRT 4693108-4693138 31 NZ_CP026171 Leclercia sp. LSNIH1 plasmid pLEC-1cb1, complete sequence 69668-69698 9 0.71
CP027351_1 1.2|4693108|31|CP027351|CRISPRCasFinder,CRT 4693108-4693138 31 NZ_CP026196 Enterobacteriaceae bacterium ENNIH1 plasmid pENT-1f0b, complete sequence 140212-140242 9 0.71
CP027351_1 1.2|4693108|31|CP027351|CRISPRCasFinder,CRT 4693108-4693138 31 NZ_AP021845 Azospira sp. I09 plasmid pAZI09, complete sequence 335649-335679 9 0.71
CP027351_1 1.2|4693108|31|CP027351|CRISPRCasFinder,CRT 4693108-4693138 31 CP009869 Pantoea sp. PSNIH2 plasmid pPSP-75c, complete sequence 51817-51847 9 0.71
CP027351_1 1.2|4693108|31|CP027351|CRISPRCasFinder,CRT 4693108-4693138 31 NZ_CP042479 Citrobacter freundii strain C50 plasmid pC50_001, complete sequence 136820-136850 9 0.71
CP027351_1 1.2|4693108|31|CP027351|CRISPRCasFinder,CRT 4693108-4693138 31 NZ_CP026208 Escherichia coli strain ECONIH5 plasmid pECO-109b, complete sequence 50052-50082 9 0.71
CP027351_1 1.2|4693108|31|CP027351|CRISPRCasFinder,CRT 4693108-4693138 31 NZ_CP032179 Citrobacter freundii strain AR_0116 plasmid unnamed1, complete sequence 65507-65537 9 0.71
CP027351_1 1.2|4693108|31|CP027351|CRISPRCasFinder,CRT 4693108-4693138 31 NZ_CP026391 Leclercia sp. LSNIH3 plasmid pLEC-7c0d, complete sequence 6461-6491 9 0.71
CP027351_1 1.2|4693108|31|CP027351|CRISPRCasFinder,CRT 4693108-4693138 31 NZ_CP029142 Klebsiella michiganensis strain AR375 plasmid unnamed2, complete sequence 256680-256710 9 0.71
CP027351_1 1.2|4693108|31|CP027351|CRISPRCasFinder,CRT 4693108-4693138 31 NZ_CP031135 Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence 47915-47945 9 0.71
CP027351_1 1.2|4693108|31|CP027351|CRISPRCasFinder,CRT 4693108-4693138 31 NZ_CP011635 Klebsiella oxytoca strain CAV1374 plasmid pKPC_CAV1374, complete sequence 9471-9501 9 0.71
CP027351_1 1.2|4693108|31|CP027351|CRISPRCasFinder,CRT 4693108-4693138 31 NZ_CP044111 Klebsiella michiganensis strain FDAARGOS_647 plasmid unnamed2 384418-384448 9 0.71
CP027351_1 1.6|4693109|31|CP027351|PILER-CR 4693109-4693139 31 NZ_CP026242 Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-eb27, complete sequence 168728-168758 9 0.71
CP027351_1 1.6|4693109|31|CP027351|PILER-CR 4693109-4693139 31 NZ_CP009883 Pantoea sp. PSNIH1 plasmid pPSP-a3e, complete sequence 5480-5510 9 0.71
CP027351_1 1.6|4693109|31|CP027351|PILER-CR 4693109-4693139 31 NZ_CP010380 Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-328.905kb, complete sequence 100872-100902 9 0.71
CP027351_1 1.6|4693109|31|CP027351|PILER-CR 4693109-4693139 31 NZ_CP026171 Leclercia sp. LSNIH1 plasmid pLEC-1cb1, complete sequence 69668-69698 9 0.71
CP027351_1 1.6|4693109|31|CP027351|PILER-CR 4693109-4693139 31 NZ_CP026196 Enterobacteriaceae bacterium ENNIH1 plasmid pENT-1f0b, complete sequence 140212-140242 9 0.71
CP027351_1 1.6|4693109|31|CP027351|PILER-CR 4693109-4693139 31 NZ_AP021845 Azospira sp. I09 plasmid pAZI09, complete sequence 335649-335679 9 0.71
CP027351_1 1.6|4693109|31|CP027351|PILER-CR 4693109-4693139 31 CP009869 Pantoea sp. PSNIH2 plasmid pPSP-75c, complete sequence 51817-51847 9 0.71
CP027351_1 1.6|4693109|31|CP027351|PILER-CR 4693109-4693139 31 NZ_CP042479 Citrobacter freundii strain C50 plasmid pC50_001, complete sequence 136820-136850 9 0.71
CP027351_1 1.6|4693109|31|CP027351|PILER-CR 4693109-4693139 31 NZ_CP026208 Escherichia coli strain ECONIH5 plasmid pECO-109b, complete sequence 50052-50082 9 0.71
CP027351_1 1.6|4693109|31|CP027351|PILER-CR 4693109-4693139 31 NZ_CP032179 Citrobacter freundii strain AR_0116 plasmid unnamed1, complete sequence 65507-65537 9 0.71
CP027351_1 1.6|4693109|31|CP027351|PILER-CR 4693109-4693139 31 NZ_CP026391 Leclercia sp. LSNIH3 plasmid pLEC-7c0d, complete sequence 6461-6491 9 0.71
CP027351_1 1.6|4693109|31|CP027351|PILER-CR 4693109-4693139 31 NZ_CP029142 Klebsiella michiganensis strain AR375 plasmid unnamed2, complete sequence 256680-256710 9 0.71
CP027351_1 1.6|4693109|31|CP027351|PILER-CR 4693109-4693139 31 NZ_CP031135 Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence 47915-47945 9 0.71
CP027351_1 1.6|4693109|31|CP027351|PILER-CR 4693109-4693139 31 NZ_CP011635 Klebsiella oxytoca strain CAV1374 plasmid pKPC_CAV1374, complete sequence 9471-9501 9 0.71
CP027351_1 1.6|4693109|31|CP027351|PILER-CR 4693109-4693139 31 NZ_CP044111 Klebsiella michiganensis strain FDAARGOS_647 plasmid unnamed2 384418-384448 9 0.71
CP027351_2 2.3|4720454|32|CP027351|CRT 4720454-4720485 32 NZ_CP039965 Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence 712830-712861 9 0.719

1. spacer 2.2|4720393|32|CP027351|CRT matches to CP054922 (Streptomyces sp. NA03103 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

gtgaccgtcggtgttacgctgaactgctgaaa--	CRISPR spacer
gtgaccgtcggtgttccggtgaa--gcggaaggc	Protospacer
*************** ** ****  ** ***.  

2. spacer 2.3|4720454|32|CP027351|CRT matches to MH389777 (Dickeya phage vB_DsoM_JA11, complete genome) position: , mismatch: 6, identity: 0.812

aatatttgcaacacccgcaagaacatcaacgc	CRISPR spacer
tttacctgcaacacctgcaagcacatcaacgc	Protospacer
  **..*********.***** **********

3. spacer 2.3|4720454|32|CP027351|CRT matches to MH460462 (Dickeya phage vB_DsoM_JA33, complete genome) position: , mismatch: 6, identity: 0.812

aatatttgcaacacccgcaagaacatcaacgc	CRISPR spacer
tttacctgcaacacctgcaagcacatcaacgc	Protospacer
  **..*********.***** **********

4. spacer 1.2|4693108|31|CP027351|CRISPRCasFinder,CRT matches to NZ_AP022602 (Mycobacterium gallinarum strain JCM 6399 plasmid pJCM6399) position: , mismatch: 7, identity: 0.774

tacaggaa---agaatccgccaacggcgacaggg	CRISPR spacer
---atgcacccagaatccgccaccggcgaccggg	Protospacer
   * * *   *********** ******* ***

5. spacer 1.6|4693109|31|CP027351|PILER-CR matches to NZ_AP022602 (Mycobacterium gallinarum strain JCM 6399 plasmid pJCM6399) position: , mismatch: 7, identity: 0.774

tacaggaa---agaatccgccaacggcgacaggg	CRISPR spacer
---atgcacccagaatccgccaccggcgaccggg	Protospacer
   * * *   *********** ******* ***

6. spacer 2.8|4720454|33|CP027351|CRISPRCasFinder matches to MH389777 (Dickeya phage vB_DsoM_JA11, complete genome) position: , mismatch: 7, identity: 0.788

aatatttgcaacacccgcaagaacatcaacgcc	CRISPR spacer
tttacctgcaacacctgcaagcacatcaacgct	Protospacer
  **..*********.***** **********.

7. spacer 2.8|4720454|33|CP027351|CRISPRCasFinder matches to MH460462 (Dickeya phage vB_DsoM_JA33, complete genome) position: , mismatch: 7, identity: 0.788

aatatttgcaacacccgcaagaacatcaacgcc	CRISPR spacer
tttacctgcaacacctgcaagcacatcaacgct	Protospacer
  **..*********.***** **********.

8. spacer 1.1|4693047|31|CP027351|CRISPRCasFinder,CRT matches to NZ_CP026601 (Clostridiaceae bacterium 14S0207 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

tcacgcgctgttacccagtccctttttttca	CRISPR spacer
tcttataatgttatccagtacctttttttca	Protospacer
** .... *****.***** ***********

9. spacer 1.5|4693048|31|CP027351|PILER-CR matches to NZ_CP026601 (Clostridiaceae bacterium 14S0207 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

tcacgcgctgttacccagtccctttttttca	CRISPR spacer
tcttataatgttatccagtacctttttttca	Protospacer
** .... *****.***** ***********

10. spacer 2.12|4720577|28|CP027351|PILER-CR matches to HG796329 (Uncultured bacterium plasmid pRGI00478) position: , mismatch: 8, identity: 0.714

gcgttgaaagcgcgagcgcgttagctga	CRISPR spacer
tttcaacaagcgcaagcgcgttagctga	Protospacer
 . . . ******.**************

11. spacer 1.2|4693108|31|CP027351|CRISPRCasFinder,CRT matches to NZ_CP026242 (Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-eb27, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

12. spacer 1.2|4693108|31|CP027351|CRISPRCasFinder,CRT matches to NZ_CP009883 (Pantoea sp. PSNIH1 plasmid pPSP-a3e, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

13. spacer 1.2|4693108|31|CP027351|CRISPRCasFinder,CRT matches to NZ_CP010380 (Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-328.905kb, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

14. spacer 1.2|4693108|31|CP027351|CRISPRCasFinder,CRT matches to NZ_CP026171 (Leclercia sp. LSNIH1 plasmid pLEC-1cb1, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

15. spacer 1.2|4693108|31|CP027351|CRISPRCasFinder,CRT matches to NZ_CP026196 (Enterobacteriaceae bacterium ENNIH1 plasmid pENT-1f0b, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

16. spacer 1.2|4693108|31|CP027351|CRISPRCasFinder,CRT matches to NZ_AP021845 (Azospira sp. I09 plasmid pAZI09, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

17. spacer 1.2|4693108|31|CP027351|CRISPRCasFinder,CRT matches to CP009869 (Pantoea sp. PSNIH2 plasmid pPSP-75c, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

18. spacer 1.2|4693108|31|CP027351|CRISPRCasFinder,CRT matches to NZ_CP042479 (Citrobacter freundii strain C50 plasmid pC50_001, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

19. spacer 1.2|4693108|31|CP027351|CRISPRCasFinder,CRT matches to NZ_CP026208 (Escherichia coli strain ECONIH5 plasmid pECO-109b, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

20. spacer 1.2|4693108|31|CP027351|CRISPRCasFinder,CRT matches to NZ_CP032179 (Citrobacter freundii strain AR_0116 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

21. spacer 1.2|4693108|31|CP027351|CRISPRCasFinder,CRT matches to NZ_CP026391 (Leclercia sp. LSNIH3 plasmid pLEC-7c0d, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

22. spacer 1.2|4693108|31|CP027351|CRISPRCasFinder,CRT matches to NZ_CP029142 (Klebsiella michiganensis strain AR375 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

23. spacer 1.2|4693108|31|CP027351|CRISPRCasFinder,CRT matches to NZ_CP031135 (Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

24. spacer 1.2|4693108|31|CP027351|CRISPRCasFinder,CRT matches to NZ_CP011635 (Klebsiella oxytoca strain CAV1374 plasmid pKPC_CAV1374, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

25. spacer 1.2|4693108|31|CP027351|CRISPRCasFinder,CRT matches to NZ_CP044111 (Klebsiella michiganensis strain FDAARGOS_647 plasmid unnamed2) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

26. spacer 1.6|4693109|31|CP027351|PILER-CR matches to NZ_CP026242 (Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-eb27, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

27. spacer 1.6|4693109|31|CP027351|PILER-CR matches to NZ_CP009883 (Pantoea sp. PSNIH1 plasmid pPSP-a3e, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

28. spacer 1.6|4693109|31|CP027351|PILER-CR matches to NZ_CP010380 (Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-328.905kb, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

29. spacer 1.6|4693109|31|CP027351|PILER-CR matches to NZ_CP026171 (Leclercia sp. LSNIH1 plasmid pLEC-1cb1, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

30. spacer 1.6|4693109|31|CP027351|PILER-CR matches to NZ_CP026196 (Enterobacteriaceae bacterium ENNIH1 plasmid pENT-1f0b, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

31. spacer 1.6|4693109|31|CP027351|PILER-CR matches to NZ_AP021845 (Azospira sp. I09 plasmid pAZI09, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

32. spacer 1.6|4693109|31|CP027351|PILER-CR matches to CP009869 (Pantoea sp. PSNIH2 plasmid pPSP-75c, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

33. spacer 1.6|4693109|31|CP027351|PILER-CR matches to NZ_CP042479 (Citrobacter freundii strain C50 plasmid pC50_001, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

34. spacer 1.6|4693109|31|CP027351|PILER-CR matches to NZ_CP026208 (Escherichia coli strain ECONIH5 plasmid pECO-109b, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

35. spacer 1.6|4693109|31|CP027351|PILER-CR matches to NZ_CP032179 (Citrobacter freundii strain AR_0116 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

36. spacer 1.6|4693109|31|CP027351|PILER-CR matches to NZ_CP026391 (Leclercia sp. LSNIH3 plasmid pLEC-7c0d, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

37. spacer 1.6|4693109|31|CP027351|PILER-CR matches to NZ_CP029142 (Klebsiella michiganensis strain AR375 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

38. spacer 1.6|4693109|31|CP027351|PILER-CR matches to NZ_CP031135 (Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

39. spacer 1.6|4693109|31|CP027351|PILER-CR matches to NZ_CP011635 (Klebsiella oxytoca strain CAV1374 plasmid pKPC_CAV1374, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

40. spacer 1.6|4693109|31|CP027351|PILER-CR matches to NZ_CP044111 (Klebsiella michiganensis strain FDAARGOS_647 plasmid unnamed2) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

41. spacer 2.3|4720454|32|CP027351|CRT matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

aatatttgcaacacccgcaagaacatcaacgc	CRISPR spacer
agccagttcagcaccagcaagaacatcaacga	Protospacer
*..   * **.**** *************** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage