Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP027332 Escherichia coli strain 2013C-3277 plasmid unnamed1 0 crisprs NA 0 0 0 0
CP027334 Escherichia coli strain 2013C-3277 plasmid unnamed3 0 crisprs NA 0 0 0 0
CP027333 Escherichia coli strain 2013C-3277 plasmid unnamed2 0 crisprs NA 0 0 0 0
CP027331 Escherichia coli strain 2013C-3277 chromosome, complete genome 4 crisprs NA 0 7 0 0

Results visualization

1. CP027331
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027331_1 1184209-1184332 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027331_2 2695291-2695563 Orphan I-E
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027331_3 2721265-2721842 Orphan I-E
9 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027331_4 4501602-4501748 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP027331_1 1.1|1184252|38|CP027331|CRISPRCasFinder 1184252-1184289 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
CP027331_2 2.1|2695320|32|CP027331|PILER-CR,CRISPRCasFinder,CRT 2695320-2695351 32 NZ_CP050442 Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence 41503-41534 6 0.812
CP027331_3 3.1|2721294|32|CP027331|CRISPRCasFinder 2721294-2721325 32 KR080197 Mycobacterium phage FlagStaff, complete genome 15476-15507 7 0.781
CP027331_3 3.1|2721294|32|CP027331|CRISPRCasFinder 2721294-2721325 32 NZ_CP014600 Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence 15418-15449 8 0.75
CP027331_3 3.2|2721355|32|CP027331|CRISPRCasFinder 2721355-2721386 32 MK814759 Gordonia phage Reyja, complete genome 4467-4498 8 0.75
CP027331_3 3.9|2721782|32|CP027331|CRISPRCasFinder 2721782-2721813 32 NC_012852 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132504, complete sequence 256608-256639 8 0.75
CP027331_2 2.3|2695442|32|CP027331|PILER-CR,CRISPRCasFinder,CRT 2695442-2695473 32 LT599585 Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid 32377-32408 9 0.719
CP027331_3 3.1|2721294|32|CP027331|CRISPRCasFinder 2721294-2721325 32 NZ_CP009292 Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence 139210-139241 9 0.719
CP027331_3 3.4|2721477|32|CP027331|CRISPRCasFinder 2721477-2721508 32 NZ_CP030074 Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence 224876-224907 9 0.719
CP027331_3 3.9|2721782|32|CP027331|CRISPRCasFinder 2721782-2721813 32 NZ_CP050094 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence 196778-196809 9 0.719
CP027331_3 3.9|2721782|32|CP027331|CRISPRCasFinder 2721782-2721813 32 NZ_CP050101 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b6, complete sequence 151768-151799 9 0.719
CP027331_3 3.9|2721782|32|CP027331|CRISPRCasFinder 2721782-2721813 32 NZ_CP050106 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence 508685-508716 9 0.719
CP027331_3 3.9|2721782|32|CP027331|CRISPRCasFinder 2721782-2721813 32 NZ_CP025016 Rhizobium leguminosarum strain Norway plasmid pRLN4, complete sequence 133778-133809 9 0.719
CP027331_3 3.9|2721782|32|CP027331|CRISPRCasFinder 2721782-2721813 32 NC_008379 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL9, complete sequence 180274-180305 9 0.719
CP027331_3 3.9|2721782|32|CP027331|CRISPRCasFinder 2721782-2721813 32 NZ_CP053442 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence 151061-151092 9 0.719
CP027331_3 3.9|2721782|32|CP027331|CRISPRCasFinder 2721782-2721813 32 NZ_CP018233 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence 21422-21453 9 0.719
CP027331_3 3.9|2721782|32|CP027331|CRISPRCasFinder 2721782-2721813 32 NZ_CP025506 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence 499023-499054 9 0.719
CP027331_3 3.9|2721782|32|CP027331|CRISPRCasFinder 2721782-2721813 32 NZ_CP016293 Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence 106143-106174 9 0.719
CP027331_3 3.9|2721782|32|CP027331|CRISPRCasFinder 2721782-2721813 32 NZ_CP050111 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence 508869-508900 9 0.719
CP027331_3 3.9|2721782|32|CP027331|CRISPRCasFinder 2721782-2721813 32 NZ_CP048283 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248c, complete sequence 130036-130067 9 0.719
CP027331_3 3.9|2721782|32|CP027331|CRISPRCasFinder 2721782-2721813 32 NZ_CP030763 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence 172635-172666 9 0.719
CP027331_3 3.9|2721782|32|CP027331|CRISPRCasFinder 2721782-2721813 32 NZ_CP022668 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence 387130-387161 9 0.719
CP027331_3 3.9|2721782|32|CP027331|CRISPRCasFinder 2721782-2721813 32 NZ_CP022569 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK05, complete sequence 4795-4826 9 0.719
CP027331_3 3.9|2721782|32|CP027331|CRISPRCasFinder 2721782-2721813 32 NZ_CP050088 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence 158950-158981 9 0.719
CP027331_3 3.1|2721294|32|CP027331|CRISPRCasFinder 2721294-2721325 32 NZ_CP012383 Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence 14130-14161 10 0.688

1. spacer 1.1|1184252|38|CP027331|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

2. spacer 2.1|2695320|32|CP027331|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050442 (Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

aaaaccaaacttctccataaattccatagccg	CRISPR spacer
attactaaacttctgcataaattccataggag	Protospacer
*  **.******** **************  *

3. spacer 3.1|2721294|32|CP027331|CRISPRCasFinder matches to KR080197 (Mycobacterium phage FlagStaff, complete genome) position: , mismatch: 7, identity: 0.781

aacatcggaaacggcttcgcggcggcggcgtc	CRISPR spacer
aacccggcgaacggcatcgcggcgccggcgtc	Protospacer
*** . * .****** ******** *******

4. spacer 3.1|2721294|32|CP027331|CRISPRCasFinder matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75

aacatcggaaacggcttcgcggcggcggcgtc	CRISPR spacer
ggctgtggaaagggctgcgcggcggcggcgac	Protospacer
..*  .***** **** ************* *

5. spacer 3.2|2721355|32|CP027331|CRISPRCasFinder matches to MK814759 (Gordonia phage Reyja, complete genome) position: , mismatch: 8, identity: 0.75

-gacagaacggcctcagtagtctcgtcaggctc	CRISPR spacer
ccaccg-ctggccccagtagcctcgtcaggctt	Protospacer
  ** *  .****.******.***********.

6. spacer 3.9|2721782|32|CP027331|CRISPRCasFinder matches to NC_012852 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132504, complete sequence) position: , mismatch: 8, identity: 0.75

actactgtcggtagctgggaggatgaggagat	CRISPR spacer
ggtgctgtcgggagcggggaggatgagagaat	Protospacer
. *.******* *** ***********...**

7. spacer 2.3|2695442|32|CP027331|PILER-CR,CRISPRCasFinder,CRT matches to LT599585 (Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid) position: , mismatch: 9, identity: 0.719

gagagtgctgacaggtgtctcgattacctgat	CRISPR spacer
ggctttgctggcaggtctctcgattaccttgg	Protospacer
*.   *****.***** ************ . 

8. spacer 3.1|2721294|32|CP027331|CRISPRCasFinder matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 9, identity: 0.719

aacatcggaaacggcttcgcggcggcggcgtc	CRISPR spacer
cccgggaaaaacgggttcgcggcggcggcttc	Protospacer
  *.  ..****** ************** **

9. spacer 3.4|2721477|32|CP027331|CRISPRCasFinder matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

ggcatagccaggctgatccggcgacggcctta	CRISPR spacer
gcagcagaccggctgatccggcgacggccccg	Protospacer
*  ..** * *******************...

10. spacer 3.9|2721782|32|CP027331|CRISPRCasFinder matches to NZ_CP050094 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence) position: , mismatch: 9, identity: 0.719

actactgtcggtagctgggaggatgaggagat	CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat	Protospacer
. ..******* *** ***********...**

11. spacer 3.9|2721782|32|CP027331|CRISPRCasFinder matches to NZ_CP050101 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b6, complete sequence) position: , mismatch: 9, identity: 0.719

actactgtcggtagctgggaggatgaggagat	CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat	Protospacer
. ..******* *** ***********...**

12. spacer 3.9|2721782|32|CP027331|CRISPRCasFinder matches to NZ_CP050106 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence) position: , mismatch: 9, identity: 0.719

actactgtcggtagctgggaggatgaggagat	CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat	Protospacer
. ..******* *** ***********...**

13. spacer 3.9|2721782|32|CP027331|CRISPRCasFinder matches to NZ_CP025016 (Rhizobium leguminosarum strain Norway plasmid pRLN4, complete sequence) position: , mismatch: 9, identity: 0.719

actactgtcggtagctgggaggatgaggagat	CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat	Protospacer
. ..******* *** ***********...**

14. spacer 3.9|2721782|32|CP027331|CRISPRCasFinder matches to NC_008379 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL9, complete sequence) position: , mismatch: 9, identity: 0.719

actactgtcggtagctgggaggatgaggagat	CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat	Protospacer
. ..******* *** ***********...**

15. spacer 3.9|2721782|32|CP027331|CRISPRCasFinder matches to NZ_CP053442 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence) position: , mismatch: 9, identity: 0.719

actactgtcggtagctgggaggatgaggagat	CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat	Protospacer
. ..******* *** ***********...**

16. spacer 3.9|2721782|32|CP027331|CRISPRCasFinder matches to NZ_CP018233 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719

actactgtcggtagctgggaggatgaggagat	CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat	Protospacer
. ..******* *** ***********...**

17. spacer 3.9|2721782|32|CP027331|CRISPRCasFinder matches to NZ_CP025506 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence) position: , mismatch: 9, identity: 0.719

actactgtcggtagctgggaggatgaggagat	CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat	Protospacer
. ..******* *** ***********...**

18. spacer 3.9|2721782|32|CP027331|CRISPRCasFinder matches to NZ_CP016293 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719

actactgtcggtagctgggaggatgaggagat	CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat	Protospacer
. ..******* *** ***********...**

19. spacer 3.9|2721782|32|CP027331|CRISPRCasFinder matches to NZ_CP050111 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence) position: , mismatch: 9, identity: 0.719

actactgtcggtagctgggaggatgaggagat	CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat	Protospacer
. ..******* *** ***********...**

20. spacer 3.9|2721782|32|CP027331|CRISPRCasFinder matches to NZ_CP048283 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248c, complete sequence) position: , mismatch: 9, identity: 0.719

actactgtcggtagctgggaggatgaggagat	CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat	Protospacer
. ..******* *** ***********...**

21. spacer 3.9|2721782|32|CP027331|CRISPRCasFinder matches to NZ_CP030763 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719

actactgtcggtagctgggaggatgaggagat	CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat	Protospacer
. ..******* *** ***********...**

22. spacer 3.9|2721782|32|CP027331|CRISPRCasFinder matches to NZ_CP022668 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence) position: , mismatch: 9, identity: 0.719

actactgtcggtagctgggaggatgaggagat	CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat	Protospacer
. ..******* *** ***********...**

23. spacer 3.9|2721782|32|CP027331|CRISPRCasFinder matches to NZ_CP022569 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK05, complete sequence) position: , mismatch: 9, identity: 0.719

actactgtcggtagctgggaggatgaggagat	CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat	Protospacer
. ..******* *** ***********...**

24. spacer 3.9|2721782|32|CP027331|CRISPRCasFinder matches to NZ_CP050088 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence) position: , mismatch: 9, identity: 0.719

actactgtcggtagctgggaggatgaggagat	CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat	Protospacer
. ..******* *** ***********...**

25. spacer 3.1|2721294|32|CP027331|CRISPRCasFinder matches to NZ_CP012383 (Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence) position: , mismatch: 10, identity: 0.688

aacatcggaaacggcttcgcggcggcggcgtc	CRISPR spacer
gaggacggaagcggcttcgccgcggcgggcaa	Protospacer
.* . *****.********* *******    

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage