Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP027582 Escherichia coli strain 2013C-4538 chromosome, complete genome 8 crisprs NA 1 12 0 0
CP027583 Escherichia coli strain 2013C-4538 plasmid unnamed 0 crisprs NA 0 0 0 0

Results visualization

1. CP027582
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027582_1 1189593-1189716 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027582_2 1856218-1856421 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027582_3 2138289-2138380 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027582_4 2625414-2625558 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027582_5 3467360-3467492 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027582_6 5052602-5052719 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027582_7 5449636-5450213 Orphan I-E
9 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027582_8 5475914-5476126 Orphan I-E
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP027582_2 2.2|1856355|58|CP027582|PILER-CR 1856355-1856412 58 CP027582.1 508810-508867 1 0.983

1. spacer 2.2|1856355|58|CP027582|PILER-CR matches to position: 508810-508867, mismatch: 1, identity: 0.983

tgggtatatacaggtgggaaagtgggcaattatgtttcaattttgttaaattccccac	CRISPR spacer
tgggtatatacaggtgggaaagtgggtaattatgtttcaattttgttaaattccccac	Protospacer
**************************.*******************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP027582_3 3.1|2138315|40|CP027582|CRISPRCasFinder 2138315-2138354 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 0 1.0
CP027582_5 5.1|3467377|42|CP027582|PILER-CR 3467377-3467418 42 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141085-141126 0 1.0
CP027582_1 1.1|1189636|38|CP027582|CRISPRCasFinder 1189636-1189673 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
CP027582_5 5.2|3467436|40|CP027582|PILER-CR 3467436-3467475 40 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141028-141067 2 0.95
CP027582_8 8.5|5476066|32|CP027582|CRT 5476066-5476097 32 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 246937-246968 3 0.906
CP027582_8 8.2|5476005|31|CP027582|PILER-CR 5476005-5476035 31 NZ_CP050442 Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence 41503-41533 6 0.806
CP027582_8 8.4|5476005|32|CP027582|CRISPRCasFinder,CRT 5476005-5476036 32 NZ_CP050442 Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence 41503-41534 6 0.812
CP027582_7 7.9|5450153|32|CP027582|CRISPRCasFinder,CRT 5450153-5450184 32 KR080197 Mycobacterium phage FlagStaff, complete genome 15476-15507 7 0.781
CP027582_8 8.5|5476066|32|CP027582|CRT 5476066-5476097 32 NZ_CP015038 Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence 112768-112799 7 0.781
CP027582_7 7.1|5449665|32|CP027582|CRISPRCasFinder,CRT 5449665-5449696 32 NC_012852 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132504, complete sequence 256608-256639 8 0.75
CP027582_7 7.7|5450031|32|CP027582|CRISPRCasFinder,CRT 5450031-5450062 32 MK814759 Gordonia phage Reyja, complete genome 4467-4498 8 0.75
CP027582_7 7.8|5450092|32|CP027582|CRISPRCasFinder,CRT 5450092-5450123 32 MK814759 Gordonia phage Reyja, complete genome 4467-4498 8 0.75
CP027582_7 7.9|5450153|32|CP027582|CRISPRCasFinder,CRT 5450153-5450184 32 NZ_CP014600 Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence 15418-15449 8 0.75
CP027582_8 8.5|5476066|32|CP027582|CRT 5476066-5476097 32 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 1428097-1428128 8 0.75
CP027582_7 7.1|5449665|32|CP027582|CRISPRCasFinder,CRT 5449665-5449696 32 NZ_CP050094 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence 196778-196809 9 0.719
CP027582_7 7.1|5449665|32|CP027582|CRISPRCasFinder,CRT 5449665-5449696 32 NZ_CP050101 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b6, complete sequence 151768-151799 9 0.719
CP027582_7 7.1|5449665|32|CP027582|CRISPRCasFinder,CRT 5449665-5449696 32 NZ_CP050106 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence 508685-508716 9 0.719
CP027582_7 7.1|5449665|32|CP027582|CRISPRCasFinder,CRT 5449665-5449696 32 NZ_CP025016 Rhizobium leguminosarum strain Norway plasmid pRLN4, complete sequence 133778-133809 9 0.719
CP027582_7 7.1|5449665|32|CP027582|CRISPRCasFinder,CRT 5449665-5449696 32 NC_008379 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL9, complete sequence 180274-180305 9 0.719
CP027582_7 7.1|5449665|32|CP027582|CRISPRCasFinder,CRT 5449665-5449696 32 NZ_CP053442 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence 151061-151092 9 0.719
CP027582_7 7.1|5449665|32|CP027582|CRISPRCasFinder,CRT 5449665-5449696 32 NZ_CP018233 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence 21422-21453 9 0.719
CP027582_7 7.1|5449665|32|CP027582|CRISPRCasFinder,CRT 5449665-5449696 32 NZ_CP025506 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence 499023-499054 9 0.719
CP027582_7 7.1|5449665|32|CP027582|CRISPRCasFinder,CRT 5449665-5449696 32 NZ_CP016293 Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence 106143-106174 9 0.719
CP027582_7 7.1|5449665|32|CP027582|CRISPRCasFinder,CRT 5449665-5449696 32 NZ_CP050111 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence 508869-508900 9 0.719
CP027582_7 7.1|5449665|32|CP027582|CRISPRCasFinder,CRT 5449665-5449696 32 NZ_CP048283 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248c, complete sequence 130036-130067 9 0.719
CP027582_7 7.1|5449665|32|CP027582|CRISPRCasFinder,CRT 5449665-5449696 32 NZ_CP030763 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence 172635-172666 9 0.719
CP027582_7 7.1|5449665|32|CP027582|CRISPRCasFinder,CRT 5449665-5449696 32 NZ_CP022668 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence 387130-387161 9 0.719
CP027582_7 7.1|5449665|32|CP027582|CRISPRCasFinder,CRT 5449665-5449696 32 NZ_CP022569 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK05, complete sequence 4795-4826 9 0.719
CP027582_7 7.1|5449665|32|CP027582|CRISPRCasFinder,CRT 5449665-5449696 32 NZ_CP050088 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence 158950-158981 9 0.719
CP027582_7 7.5|5449909|32|CP027582|CRISPRCasFinder,CRT 5449909-5449940 32 NZ_CP030074 Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence 224876-224907 9 0.719
CP027582_7 7.9|5450153|32|CP027582|CRISPRCasFinder,CRT 5450153-5450184 32 NZ_CP009292 Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence 139210-139241 9 0.719
CP027582_8 8.5|5476066|32|CP027582|CRT 5476066-5476097 32 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 141278-141309 9 0.719
CP027582_7 7.9|5450153|32|CP027582|CRISPRCasFinder,CRT 5450153-5450184 32 NZ_CP012383 Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence 14130-14161 10 0.688

1. spacer 3.1|2138315|40|CP027582|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgctgcgggtcattcttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
****************************************

2. spacer 5.1|3467377|42|CP027582|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 0, identity: 1.0

tgtcacacgcagataaatccaactttcaatattgttaagttc	CRISPR spacer
tgtcacacgcagataaatccaactttcaatattgttaagttc	Protospacer
******************************************

3. spacer 1.1|1189636|38|CP027582|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

4. spacer 5.2|3467436|40|CP027582|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 2, identity: 0.95

catcgcgtagcaaaaagaaattttcaatattgctttatgg	CRISPR spacer
catggcgtagaaaaaagaaattttcaatattgctttatgg	Protospacer
*** ****** *****************************

5. spacer 8.5|5476066|32|CP027582|CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 3, identity: 0.906

ggcgcactggatgcgatgatggatatcactta	CRISPR spacer
gacgcactggatgcgatgatggacatcacttg	Protospacer
*.*********************.*******.

6. spacer 8.2|5476005|31|CP027582|PILER-CR matches to NZ_CP050442 (Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.806

cggctatggaatttatggagaagtttggttt	CRISPR spacer
ctcctatggaatttatgcagaagtttagtaa	Protospacer
*  ************** ********.**  

7. spacer 8.4|5476005|32|CP027582|CRISPRCasFinder,CRT matches to NZ_CP050442 (Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

cggctatggaatttatggagaagtttggtttt	CRISPR spacer
ctcctatggaatttatgcagaagtttagtaat	Protospacer
*  ************** ********.**  *

8. spacer 7.9|5450153|32|CP027582|CRISPRCasFinder,CRT matches to KR080197 (Mycobacterium phage FlagStaff, complete genome) position: , mismatch: 7, identity: 0.781

gacgccgccgccgcgaagccgtttccgatgtt	CRISPR spacer
gacgccggcgccgcgatgccgttcgccgggtt	Protospacer
******* ******** ******. * . ***

9. spacer 8.5|5476066|32|CP027582|CRT matches to NZ_CP015038 (Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence) position: , mismatch: 7, identity: 0.781

ggcgcactggatgcgatgatggat-atcactta	CRISPR spacer
ggcgcactggctgcgatgaaggacgatcaacc-	Protospacer
********** ******** ***. **** .. 

10. spacer 7.1|5449665|32|CP027582|CRISPRCasFinder,CRT matches to NC_012852 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132504, complete sequence) position: , mismatch: 8, identity: 0.75

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcacc	Protospacer
**...*********** *** *******.* .

11. spacer 7.7|5450031|32|CP027582|CRISPRCasFinder,CRT matches to MK814759 (Gordonia phage Reyja, complete genome) position: , mismatch: 8, identity: 0.75

gagcctgacgagactactgaggccgttctgtc-	CRISPR spacer
aagcctgacgaggctactggggcca-gcggtgg	Protospacer
.***********.******.****.  * **  

12. spacer 7.8|5450092|32|CP027582|CRISPRCasFinder,CRT matches to MK814759 (Gordonia phage Reyja, complete genome) position: , mismatch: 8, identity: 0.75

gagcctgacgagactactgaggccgttctgtc-	CRISPR spacer
aagcctgacgaggctactggggcca-gcggtgg	Protospacer
.***********.******.****.  * **  

13. spacer 7.9|5450153|32|CP027582|CRISPRCasFinder,CRT matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75

gacgccgccgccgcgaagccgtttccgatgtt	CRISPR spacer
gtcgccgccgccgcgcagccctttccacagcc	Protospacer
* ************* **** *****.  *..

14. spacer 8.5|5476066|32|CP027582|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.75

ggcgcactggatgcgatgatggata---tcactta	CRISPR spacer
ggcgcactggaagcggtgatggaggggcgcac---	Protospacer
*********** ***.******* .    ***   

15. spacer 7.1|5449665|32|CP027582|CRISPRCasFinder,CRT matches to NZ_CP050094 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence) position: , mismatch: 9, identity: 0.719

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

16. spacer 7.1|5449665|32|CP027582|CRISPRCasFinder,CRT matches to NZ_CP050101 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b6, complete sequence) position: , mismatch: 9, identity: 0.719

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

17. spacer 7.1|5449665|32|CP027582|CRISPRCasFinder,CRT matches to NZ_CP050106 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence) position: , mismatch: 9, identity: 0.719

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

18. spacer 7.1|5449665|32|CP027582|CRISPRCasFinder,CRT matches to NZ_CP025016 (Rhizobium leguminosarum strain Norway plasmid pRLN4, complete sequence) position: , mismatch: 9, identity: 0.719

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

19. spacer 7.1|5449665|32|CP027582|CRISPRCasFinder,CRT matches to NC_008379 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL9, complete sequence) position: , mismatch: 9, identity: 0.719

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

20. spacer 7.1|5449665|32|CP027582|CRISPRCasFinder,CRT matches to NZ_CP053442 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence) position: , mismatch: 9, identity: 0.719

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

21. spacer 7.1|5449665|32|CP027582|CRISPRCasFinder,CRT matches to NZ_CP018233 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

22. spacer 7.1|5449665|32|CP027582|CRISPRCasFinder,CRT matches to NZ_CP025506 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence) position: , mismatch: 9, identity: 0.719

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

23. spacer 7.1|5449665|32|CP027582|CRISPRCasFinder,CRT matches to NZ_CP016293 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

24. spacer 7.1|5449665|32|CP027582|CRISPRCasFinder,CRT matches to NZ_CP050111 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence) position: , mismatch: 9, identity: 0.719

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

25. spacer 7.1|5449665|32|CP027582|CRISPRCasFinder,CRT matches to NZ_CP048283 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248c, complete sequence) position: , mismatch: 9, identity: 0.719

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

26. spacer 7.1|5449665|32|CP027582|CRISPRCasFinder,CRT matches to NZ_CP030763 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

27. spacer 7.1|5449665|32|CP027582|CRISPRCasFinder,CRT matches to NZ_CP022668 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence) position: , mismatch: 9, identity: 0.719

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

28. spacer 7.1|5449665|32|CP027582|CRISPRCasFinder,CRT matches to NZ_CP022569 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK05, complete sequence) position: , mismatch: 9, identity: 0.719

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

29. spacer 7.1|5449665|32|CP027582|CRISPRCasFinder,CRT matches to NZ_CP050088 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence) position: , mismatch: 9, identity: 0.719

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

30. spacer 7.5|5449909|32|CP027582|CRISPRCasFinder,CRT matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

taaggccgtcgccggatcagcctggctatgcc	CRISPR spacer
cggggccgtcgccggatcagccggtctgctgc	Protospacer
...******************* * **..  *

31. spacer 7.9|5450153|32|CP027582|CRISPRCasFinder,CRT matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 9, identity: 0.719

gacgccgccgccgcgaagccgtttccgatgtt	CRISPR spacer
gaagccgccgccgcgaacccgtttttcccggg	Protospacer
** ************** ******..  .*  

32. spacer 8.5|5476066|32|CP027582|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 9, identity: 0.719

ggcgcactggatgcgatgatggatatcactta	CRISPR spacer
ggcgcactggaaccgatgatggatgcgatgag	Protospacer
***********  ***********.. *.  .

33. spacer 7.9|5450153|32|CP027582|CRISPRCasFinder,CRT matches to NZ_CP012383 (Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence) position: , mismatch: 10, identity: 0.688

gacgccgccgccgcgaagccgtttccgatgtt	CRISPR spacer
ttgcccgccgcggcgaagccgcttccgtcctc	Protospacer
    ******* *********.***** . *.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage