Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP027573 Escherichia coli strain 2013C-4081 chromosome, complete genome 7 crisprs NA 0 8 0 0
CP027576 Escherichia coli strain 2013C-4081 plasmid unnamed3, complete sequence 0 crisprs NA 0 0 0 0
CP027575 Escherichia coli strain 2013C-4081 plasmid unnamed2 0 crisprs NA 0 0 0 0
CP027574 Escherichia coli strain 2013C-4081 plasmid unnamed1, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. CP027573
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027573_1 302294-302417 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027573_2 1211332-1211423 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027573_3 1538915-1539059 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027573_4 2350687-2350819 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027573_5 3858629-3858746 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027573_6 4318928-4319322 Orphan I-E
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027573_7 4345024-4345296 Orphan I-E
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP027573_2 2.1|1211358|40|CP027573|CRISPRCasFinder 1211358-1211397 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 0 1.0
CP027573_4 4.1|2350704|42|CP027573|PILER-CR 2350704-2350745 42 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141085-141126 0 1.0
CP027573_1 1.1|302337|38|CP027573|CRISPRCasFinder 302337-302374 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
CP027573_4 4.2|2350763|40|CP027573|PILER-CR 2350763-2350802 40 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141028-141067 2 0.95
CP027573_7 7.4|4345236|32|CP027573|PILER-CR,CRISPRCasFinder,CRT 4345236-4345267 32 NZ_CP050442 Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence 41503-41534 6 0.812
CP027573_6 6.6|4319262|32|CP027573|CRISPRCasFinder,CRT 4319262-4319293 32 MK814759 Gordonia phage Reyja, complete genome 4467-4498 8 0.75
CP027573_7 7.2|4345114|32|CP027573|PILER-CR,CRISPRCasFinder,CRT 4345114-4345145 32 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 292180-292211 9 0.719
CP027573_7 7.2|4345114|32|CP027573|PILER-CR,CRISPRCasFinder,CRT 4345114-4345145 32 NZ_CP020740 [Pseudomonas] mesoacidophila strain ATCC 31433 plasmid pATCC31433, complete sequence 20747-20778 9 0.719
CP027573_7 7.3|4345175|32|CP027573|PILER-CR,CRISPRCasFinder,CRT 4345175-4345206 32 LT599585 Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid 32377-32408 9 0.719

1. spacer 2.1|1211358|40|CP027573|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgctgcgggtcattcttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
****************************************

2. spacer 4.1|2350704|42|CP027573|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 0, identity: 1.0

tgtcacacgcagataaatccaactttcaatattgttaagttc	CRISPR spacer
tgtcacacgcagataaatccaactttcaatattgttaagttc	Protospacer
******************************************

3. spacer 1.1|302337|38|CP027573|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

4. spacer 4.2|2350763|40|CP027573|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 2, identity: 0.95

catcgcgtagcaaaaagaaattttcaatattgctttatgg	CRISPR spacer
catggcgtagaaaaaagaaattttcaatattgctttatgg	Protospacer
*** ****** *****************************

5. spacer 7.4|4345236|32|CP027573|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050442 (Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

cggctatggaatttatggagaagtttggtttt	CRISPR spacer
ctcctatggaatttatgcagaagtttagtaat	Protospacer
*  ************** ********.**  *

6. spacer 6.6|4319262|32|CP027573|CRISPRCasFinder,CRT matches to MK814759 (Gordonia phage Reyja, complete genome) position: , mismatch: 8, identity: 0.75

gagcctgacgagactactgaggccgttctgtc-	CRISPR spacer
aagcctgacgaggctactggggcca-gcggtgg	Protospacer
.***********.******.****.  * **  

7. spacer 7.2|4345114|32|CP027573|PILER-CR,CRISPRCasFinder,CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 9, identity: 0.719

ccgaggccgcagaacgccgtgatattgcgttc	CRISPR spacer
gcggcgccgaaaaacgccgtgatattgccgat	Protospacer
 **. **** *.****************   .

8. spacer 7.2|4345114|32|CP027573|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020740 ([Pseudomonas] mesoacidophila strain ATCC 31433 plasmid pATCC31433, complete sequence) position: , mismatch: 9, identity: 0.719

ccgaggccgcagaacgccgtgatattgcgttc	CRISPR spacer
gcggcgccgaagaacgccgtgatgttgccggt	Protospacer
 **. **** *************.****   .

9. spacer 7.3|4345175|32|CP027573|PILER-CR,CRISPRCasFinder,CRT matches to LT599585 (Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid) position: , mismatch: 9, identity: 0.719

atcaggtaatcgagacacctgtcagcactctc	CRISPR spacer
ccaaggtaatcgagagacctgccagcaaagcc	Protospacer
 . ************ *****.*****   .*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage