Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP027555 Escherichia coli strain 2013C-3513 chromosome, complete genome 5 crisprs NA 0 11 0 0
CP027554 Escherichia coli strain 2013C-3513 plasmid unnamed1 0 crisprs NA 0 0 0 0
CP027556 Escherichia coli strain 2013C-3513 plasmid unnamed2 0 crisprs NA 0 0 0 0

Results visualization

1. CP027555
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027555_1 1501397-1501541 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027555_2 2335249-2335381 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027555_3 3879477-3879594 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027555_4 4288711-4289288 Orphan I-E
9 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027555_5 4314989-4315505 Orphan I-E
8 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP027555_2 2.1|2335266|42|CP027555|PILER-CR 2335266-2335307 42 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141085-141126 0 1.0
CP027555_2 2.2|2335325|40|CP027555|PILER-CR 2335325-2335364 40 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141028-141067 2 0.95
CP027555_5 5.8|4315445|32|CP027555|PILER-CR,CRISPRCasFinder,CRT 4315445-4315476 32 NZ_CP050442 Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence 41503-41534 6 0.812
CP027555_4 4.9|4289228|32|CP027555|CRISPRCasFinder,CRT 4289228-4289259 32 KR080197 Mycobacterium phage FlagStaff, complete genome 15476-15507 7 0.781
CP027555_4 4.1|4288740|32|CP027555|CRISPRCasFinder,CRT 4288740-4288771 32 NC_012852 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132504, complete sequence 256608-256639 8 0.75
CP027555_4 4.8|4289167|32|CP027555|CRISPRCasFinder,CRT 4289167-4289198 32 MK814759 Gordonia phage Reyja, complete genome 4467-4498 8 0.75
CP027555_4 4.9|4289228|32|CP027555|CRISPRCasFinder,CRT 4289228-4289259 32 NZ_CP014600 Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence 15418-15449 8 0.75
CP027555_5 5.4|4315201|32|CP027555|PILER-CR,CRISPRCasFinder,CRT 4315201-4315232 32 NZ_CP030355 Novosphingobium sp. P6W plasmid pP6W2, complete sequence 141173-141204 8 0.75
CP027555_4 4.1|4288740|32|CP027555|CRISPRCasFinder,CRT 4288740-4288771 32 NZ_CP050094 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence 196778-196809 9 0.719
CP027555_4 4.1|4288740|32|CP027555|CRISPRCasFinder,CRT 4288740-4288771 32 NZ_CP050101 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b6, complete sequence 151768-151799 9 0.719
CP027555_4 4.1|4288740|32|CP027555|CRISPRCasFinder,CRT 4288740-4288771 32 NZ_CP050106 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence 508685-508716 9 0.719
CP027555_4 4.1|4288740|32|CP027555|CRISPRCasFinder,CRT 4288740-4288771 32 NZ_CP025016 Rhizobium leguminosarum strain Norway plasmid pRLN4, complete sequence 133778-133809 9 0.719
CP027555_4 4.1|4288740|32|CP027555|CRISPRCasFinder,CRT 4288740-4288771 32 NC_008379 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL9, complete sequence 180274-180305 9 0.719
CP027555_4 4.1|4288740|32|CP027555|CRISPRCasFinder,CRT 4288740-4288771 32 NZ_CP053442 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence 151061-151092 9 0.719
CP027555_4 4.1|4288740|32|CP027555|CRISPRCasFinder,CRT 4288740-4288771 32 NZ_CP018233 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence 21422-21453 9 0.719
CP027555_4 4.1|4288740|32|CP027555|CRISPRCasFinder,CRT 4288740-4288771 32 NZ_CP025506 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence 499023-499054 9 0.719
CP027555_4 4.1|4288740|32|CP027555|CRISPRCasFinder,CRT 4288740-4288771 32 NZ_CP016293 Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence 106143-106174 9 0.719
CP027555_4 4.1|4288740|32|CP027555|CRISPRCasFinder,CRT 4288740-4288771 32 NZ_CP050111 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence 508869-508900 9 0.719
CP027555_4 4.1|4288740|32|CP027555|CRISPRCasFinder,CRT 4288740-4288771 32 NZ_CP048283 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248c, complete sequence 130036-130067 9 0.719
CP027555_4 4.1|4288740|32|CP027555|CRISPRCasFinder,CRT 4288740-4288771 32 NZ_CP030763 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence 172635-172666 9 0.719
CP027555_4 4.1|4288740|32|CP027555|CRISPRCasFinder,CRT 4288740-4288771 32 NZ_CP022668 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence 387130-387161 9 0.719
CP027555_4 4.1|4288740|32|CP027555|CRISPRCasFinder,CRT 4288740-4288771 32 NZ_CP022569 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK05, complete sequence 4795-4826 9 0.719
CP027555_4 4.1|4288740|32|CP027555|CRISPRCasFinder,CRT 4288740-4288771 32 NZ_CP050088 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence 158950-158981 9 0.719
CP027555_4 4.6|4289045|32|CP027555|CRISPRCasFinder,CRT 4289045-4289076 32 NZ_CP030074 Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence 224876-224907 9 0.719
CP027555_4 4.9|4289228|32|CP027555|CRISPRCasFinder,CRT 4289228-4289259 32 NZ_CP009292 Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence 139210-139241 9 0.719
CP027555_5 5.3|4315140|32|CP027555|PILER-CR,CRISPRCasFinder,CRT 4315140-4315171 32 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 292180-292211 9 0.719
CP027555_5 5.3|4315140|32|CP027555|PILER-CR,CRISPRCasFinder,CRT 4315140-4315171 32 NZ_CP020740 [Pseudomonas] mesoacidophila strain ATCC 31433 plasmid pATCC31433, complete sequence 20747-20778 9 0.719
CP027555_5 5.6|4315323|32|CP027555|PILER-CR,CRISPRCasFinder,CRT 4315323-4315354 32 LT599585 Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid 32377-32408 9 0.719
CP027555_4 4.9|4289228|32|CP027555|CRISPRCasFinder,CRT 4289228-4289259 32 NZ_CP012383 Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence 14130-14161 10 0.688
CP027555_5 5.2|4315079|32|CP027555|PILER-CR,CRISPRCasFinder,CRT 4315079-4315110 32 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 903982-904013 10 0.688
CP027555_5 5.4|4315201|32|CP027555|PILER-CR,CRISPRCasFinder,CRT 4315201-4315232 32 MF417892 Uncultured Caudovirales phage clone 2F_2, partial genome 39822-39853 10 0.688
CP027555_5 5.2|4315079|32|CP027555|PILER-CR,CRISPRCasFinder,CRT 4315079-4315110 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1467285-1467316 11 0.656

1. spacer 2.1|2335266|42|CP027555|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 0, identity: 1.0

tgtcacacgcagataaatccaactttcaatattgttaagttc	CRISPR spacer
tgtcacacgcagataaatccaactttcaatattgttaagttc	Protospacer
******************************************

2. spacer 2.2|2335325|40|CP027555|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 2, identity: 0.95

catcgcgtagcaaaaagaaattttcaatattgctttatgg	CRISPR spacer
catggcgtagaaaaaagaaattttcaatattgctttatgg	Protospacer
*** ****** *****************************

3. spacer 5.8|4315445|32|CP027555|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050442 (Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

cggctatggaatttatggagaagtttggtttt	CRISPR spacer
ctcctatggaatttatgcagaagtttagtaat	Protospacer
*  ************** ********.**  *

4. spacer 4.9|4289228|32|CP027555|CRISPRCasFinder,CRT matches to KR080197 (Mycobacterium phage FlagStaff, complete genome) position: , mismatch: 7, identity: 0.781

gacgccgccgccgcgaagccgtttccgatgtt	CRISPR spacer
gacgccggcgccgcgatgccgttcgccgggtt	Protospacer
******* ******** ******. * . ***

5. spacer 4.1|4288740|32|CP027555|CRISPRCasFinder,CRT matches to NC_012852 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132504, complete sequence) position: , mismatch: 8, identity: 0.75

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcacc	Protospacer
**...*********** *** *******.* .

6. spacer 4.8|4289167|32|CP027555|CRISPRCasFinder,CRT matches to MK814759 (Gordonia phage Reyja, complete genome) position: , mismatch: 8, identity: 0.75

gagcctgacgagactactgaggccgttctgtc-	CRISPR spacer
aagcctgacgaggctactggggcca-gcggtgg	Protospacer
.***********.******.****.  * **  

7. spacer 4.9|4289228|32|CP027555|CRISPRCasFinder,CRT matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75

gacgccgccgccgcgaagccgtttccgatgtt	CRISPR spacer
gtcgccgccgccgcgcagccctttccacagcc	Protospacer
* ************* **** *****.  *..

8. spacer 5.4|4315201|32|CP027555|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030355 (Novosphingobium sp. P6W plasmid pP6W2, complete sequence) position: , mismatch: 8, identity: 0.75

gaaactgaatcatcattgattacccgcgaaga	CRISPR spacer
aattcacgatcatctttgattatccgcgaaga	Protospacer
.*  *  .****** *******.*********

9. spacer 4.1|4288740|32|CP027555|CRISPRCasFinder,CRT matches to NZ_CP050094 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence) position: , mismatch: 9, identity: 0.719

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

10. spacer 4.1|4288740|32|CP027555|CRISPRCasFinder,CRT matches to NZ_CP050101 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b6, complete sequence) position: , mismatch: 9, identity: 0.719

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

11. spacer 4.1|4288740|32|CP027555|CRISPRCasFinder,CRT matches to NZ_CP050106 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence) position: , mismatch: 9, identity: 0.719

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

12. spacer 4.1|4288740|32|CP027555|CRISPRCasFinder,CRT matches to NZ_CP025016 (Rhizobium leguminosarum strain Norway plasmid pRLN4, complete sequence) position: , mismatch: 9, identity: 0.719

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

13. spacer 4.1|4288740|32|CP027555|CRISPRCasFinder,CRT matches to NC_008379 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL9, complete sequence) position: , mismatch: 9, identity: 0.719

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

14. spacer 4.1|4288740|32|CP027555|CRISPRCasFinder,CRT matches to NZ_CP053442 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence) position: , mismatch: 9, identity: 0.719

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

15. spacer 4.1|4288740|32|CP027555|CRISPRCasFinder,CRT matches to NZ_CP018233 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

16. spacer 4.1|4288740|32|CP027555|CRISPRCasFinder,CRT matches to NZ_CP025506 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence) position: , mismatch: 9, identity: 0.719

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

17. spacer 4.1|4288740|32|CP027555|CRISPRCasFinder,CRT matches to NZ_CP016293 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

18. spacer 4.1|4288740|32|CP027555|CRISPRCasFinder,CRT matches to NZ_CP050111 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence) position: , mismatch: 9, identity: 0.719

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

19. spacer 4.1|4288740|32|CP027555|CRISPRCasFinder,CRT matches to NZ_CP048283 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248c, complete sequence) position: , mismatch: 9, identity: 0.719

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

20. spacer 4.1|4288740|32|CP027555|CRISPRCasFinder,CRT matches to NZ_CP030763 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

21. spacer 4.1|4288740|32|CP027555|CRISPRCasFinder,CRT matches to NZ_CP022668 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence) position: , mismatch: 9, identity: 0.719

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

22. spacer 4.1|4288740|32|CP027555|CRISPRCasFinder,CRT matches to NZ_CP022569 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK05, complete sequence) position: , mismatch: 9, identity: 0.719

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

23. spacer 4.1|4288740|32|CP027555|CRISPRCasFinder,CRT matches to NZ_CP050088 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence) position: , mismatch: 9, identity: 0.719

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

24. spacer 4.6|4289045|32|CP027555|CRISPRCasFinder,CRT matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

taaggccgtcgccggatcagcctggctatgcc	CRISPR spacer
cggggccgtcgccggatcagccggtctgctgc	Protospacer
...******************* * **..  *

25. spacer 4.9|4289228|32|CP027555|CRISPRCasFinder,CRT matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 9, identity: 0.719

gacgccgccgccgcgaagccgtttccgatgtt	CRISPR spacer
gaagccgccgccgcgaacccgtttttcccggg	Protospacer
** ************** ******..  .*  

26. spacer 5.3|4315140|32|CP027555|PILER-CR,CRISPRCasFinder,CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 9, identity: 0.719

ccgaggccgcagaacgccgtgatattgcgttc	CRISPR spacer
gcggcgccgaaaaacgccgtgatattgccgat	Protospacer
 **. **** *.****************   .

27. spacer 5.3|4315140|32|CP027555|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020740 ([Pseudomonas] mesoacidophila strain ATCC 31433 plasmid pATCC31433, complete sequence) position: , mismatch: 9, identity: 0.719

ccgaggccgcagaacgccgtgatattgcgttc	CRISPR spacer
gcggcgccgaagaacgccgtgatgttgccggt	Protospacer
 **. **** *************.****   .

28. spacer 5.6|4315323|32|CP027555|PILER-CR,CRISPRCasFinder,CRT matches to LT599585 (Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid) position: , mismatch: 9, identity: 0.719

atcaggtaatcgagacacctgtcagcactctc	CRISPR spacer
ccaaggtaatcgagagacctgccagcaaagcc	Protospacer
 . ************ *****.*****   .*

29. spacer 4.9|4289228|32|CP027555|CRISPRCasFinder,CRT matches to NZ_CP012383 (Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence) position: , mismatch: 10, identity: 0.688

gacgccgccgccgcgaagccgtttccgatgtt	CRISPR spacer
ttgcccgccgcggcgaagccgcttccgtcctc	Protospacer
    ******* *********.***** . *.

30. spacer 5.2|4315079|32|CP027555|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.688

gtccatggcctgacgaagctcgtaatattttg	CRISPR spacer
gcgcatgtcctgacgaagctcgtgatgcaaga	Protospacer
*. **** ***************.**..   .

31. spacer 5.4|4315201|32|CP027555|PILER-CR,CRISPRCasFinder,CRT matches to MF417892 (Uncultured Caudovirales phage clone 2F_2, partial genome) position: , mismatch: 10, identity: 0.688

gaaactgaatcatcattgattacccgcgaaga	CRISPR spacer
tgggctgcatcatcattgattacctgcaactg	Protospacer
 ...*** ****************.**.*  .

32. spacer 5.2|4315079|32|CP027555|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656

gtccatggcctgacgaagctcgtaatattttg	CRISPR spacer
ccgcatgtcctgacgaagctcgtgatgcaaga	Protospacer
 . **** ***************.**..   .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage