1. spacer 2.1|675999|24|CP027452|PILER-CR matches to NC_049946 (Escherichia virus Lambda_4A7 genome assembly, chromosome: 1) position: , mismatch: 0, identity: 1.0
cgcctttacctgatttgggtaaac CRISPR spacer
cgcctttacctgatttgggtaaac Protospacer
************************
2. spacer 2.1|675999|24|CP027452|PILER-CR matches to LR595861 (Escherichia virus Lambda_4C10 genome assembly, chromosome: 1) position: , mismatch: 0, identity: 1.0
cgcctttacctgatttgggtaaac CRISPR spacer
cgcctttacctgatttgggtaaac Protospacer
************************
3. spacer 2.2|676046|25|CP027452|PILER-CR matches to NC_049946 (Escherichia virus Lambda_4A7 genome assembly, chromosome: 1) position: , mismatch: 0, identity: 1.0
tttacctctttcaggtaaactttat CRISPR spacer
tttacctctttcaggtaaactttat Protospacer
*************************
4. spacer 2.2|676046|25|CP027452|PILER-CR matches to LR595861 (Escherichia virus Lambda_4C10 genome assembly, chromosome: 1) position: , mismatch: 0, identity: 1.0
tttacctctttcaggtaaactttat CRISPR spacer
tttacctctttcaggtaaactttat Protospacer
*************************
5. spacer 4.17|3159474|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038506 (Escherichia coli strain 28Eco12 plasmid p28Eco12, complete sequence) position: , mismatch: 0, identity: 1.0
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt Protospacer
********************************
6. spacer 4.17|3159474|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019283 (Escherichia coli strain 13P484A plasmid p13P484A-3, complete sequence) position: , mismatch: 0, identity: 1.0
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt Protospacer
********************************
7. spacer 4.17|3159474|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to CP042641 (Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-3, complete sequence) position: , mismatch: 0, identity: 1.0
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt Protospacer
********************************
8. spacer 4.17|3159474|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034821 (Salmonella sp. SSDFZ54 plasmid pTB502, complete sequence) position: , mismatch: 0, identity: 1.0
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt Protospacer
********************************
9. spacer 4.17|3159474|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027443 (Escherichia coli strain 2013C-3252 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt Protospacer
********************************
10. spacer 4.17|3159474|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027575 (Escherichia coli strain 2013C-4081 plasmid unnamed2) position: , mismatch: 0, identity: 1.0
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt Protospacer
********************************
11. spacer 4.17|3159474|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027223 (Escherichia coli strain 2015C-3101 plasmid unnamed2) position: , mismatch: 0, identity: 1.0
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt Protospacer
********************************
12. spacer 4.17|3159474|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030188 (Salmonella enterica strain SA20094620 plasmid pSA20094620.3, complete sequence) position: , mismatch: 0, identity: 1.0
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt Protospacer
********************************
13. spacer 4.17|3159474|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027590 (Escherichia coli strain 2014C-3011 plasmid unnamed2) position: , mismatch: 0, identity: 1.0
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt Protospacer
********************************
14. spacer 4.17|3159474|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039862 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.2, complete sequence) position: , mismatch: 0, identity: 1.0
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt Protospacer
********************************
15. spacer 4.17|3159474|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033632 (Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence) position: , mismatch: 0, identity: 1.0
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt Protospacer
********************************
16. spacer 4.17|3159474|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP018798 (Escherichia coli strain E2855 plasmid pE2855-2, complete sequence) position: , mismatch: 0, identity: 1.0
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt Protospacer
********************************
17. spacer 4.17|3159474|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to CP012494 (Escherichia coli strain CFSAN004177 plasmid pCFSAN004177G_03, complete sequence) position: , mismatch: 0, identity: 1.0
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt Protospacer
********************************
18. spacer 4.17|3159474|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to CP027320 (Escherichia coli strain 2014C-3084 plasmid unnamed1) position: , mismatch: 0, identity: 1.0
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt Protospacer
********************************
19. spacer 4.17|3159474|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NC_013370 (Escherichia coli O111:H- str. 11128 plasmid pO111_2, complete sequence) position: , mismatch: 0, identity: 1.0
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt Protospacer
********************************
20. spacer 4.17|3159474|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026475 (Escherichia coli strain KBN10P04869 plasmid pKBN10P04869B, complete sequence) position: , mismatch: 0, identity: 1.0
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt Protospacer
********************************
21. spacer 4.17|3159474|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to MN510445 (Escherichia coli strain JIE250 plasmid pJIE250_3, complete sequence) position: , mismatch: 0, identity: 1.0
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt Protospacer
********************************
22. spacer 4.17|3159474|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to MN510447 (Escherichia coli strain TZ20_1P plasmid pTZ20_1P, complete sequence) position: , mismatch: 0, identity: 1.0
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt Protospacer
********************************
23. spacer 4.17|3159474|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012491 (Escherichia coli strain CFSAN004176 plasmid pCFSAN004176P_03, complete sequence) position: , mismatch: 0, identity: 1.0
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt Protospacer
********************************
24. spacer 4.17|3159474|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to MH422554 (Escherichia phage P1, complete genome) position: , mismatch: 0, identity: 1.0
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt Protospacer
********************************
25. spacer 4.17|3159474|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NC_050152 (Enterobacteria phage P7, complete genome) position: , mismatch: 0, identity: 1.0
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt Protospacer
********************************
26. spacer 4.17|3159474|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to MH445380 (Escherichia virus P1 isolate transconjugant 2(L-II), complete genome) position: , mismatch: 0, identity: 1.0
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt Protospacer
********************************
27. spacer 4.17|3159474|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NC_031129 (Salmonella phage SJ46, complete genome) position: , mismatch: 0, identity: 1.0
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt Protospacer
********************************
28. spacer 4.17|3159474|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to MH445381 (Escherichia virus P1, complete genome) position: , mismatch: 0, identity: 1.0
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacggtctgaaccgacattcatgt Protospacer
********************************
29. spacer 1.1|173683|40|CP027452|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 1, identity: 0.975
gcgctgcgggtcatttttgaaattacccccgctgtgctgt CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt Protospacer
***************.************************
30. spacer 2.1|675999|24|CP027452|PILER-CR matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 1, identity: 0.958
cgcctttacctgatttgggtaaac CRISPR spacer
tgcctttacctgatttgggtaaac Protospacer
.***********************
31. spacer 2.2|676046|25|CP027452|PILER-CR matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 1, identity: 0.96
tttacctctttcaggtaaactttat CRISPR spacer
tttacctctttaaggtaaactttat Protospacer
*********** *************
32. spacer 4.17|3159474|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KP453775 (Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence) position: , mismatch: 2, identity: 0.938
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtgaaaacacgttctgaaccgacattcatgt Protospacer
***.******** *******************
33. spacer 4.17|3159474|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017632 (Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence) position: , mismatch: 2, identity: 0.938
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtgaaaacacgttctgaaccgacattcatgt Protospacer
***.******** *******************
34. spacer 4.17|3159474|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030285 (Escherichia coli strain E308 plasmid pLKSZ04, complete sequence) position: , mismatch: 2, identity: 0.938
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacggtctaaaccgtcattcatgt Protospacer
****************.***** *********
35. spacer 4.17|3159474|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP036204 (Escherichia coli strain L725 plasmid punnamed2, complete sequence) position: , mismatch: 2, identity: 0.938
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacggtctaaaccgtcattcatgt Protospacer
****************.***** *********
36. spacer 4.17|3159474|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to MN510446 (Escherichia coli strain SvETEC plasmid pSvP1_F, complete sequence) position: , mismatch: 2, identity: 0.938
ggtaaaaacacggtctgaaccgacattcatgt CRISPR spacer
ggtaaaaacacgttatgaaccgacattcatgt Protospacer
************ * *****************
37. spacer 6.1|4222911|38|CP027452|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947
cggacgcaggatggtgcgttcaattggactcgaaccaa CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa Protospacer
*.*******.****************************
38. spacer 2.2|676046|25|CP027452|PILER-CR matches to NZ_CP015341 (Lactobacillus brevis strain 100D8 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.84
tttacctctttcaggtaaactttat CRISPR spacer
ggtatctcattcaggtaaactttat Protospacer
**.*** ****************
39. spacer 4.1|3158498|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022140 (Salmonella enterica subsp. salamae serovar 55:k:z39 str. 1315K plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812
cattgaa-aacattgcctttattttattttttg CRISPR spacer
-attaaatcacattccctctattttattttttc Protospacer
***.** ***** ***.*************
40. spacer 4.6|3158803|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to MN694288 (Marine virus AFVG_250M340, complete genome) position: , mismatch: 7, identity: 0.781
acaccccgctatctgcgcggctttacgagata- CRISPR spacer
ataccctgcaatctgcgcggcttta-gcggcac Protospacer
*.****.** *************** * *..*
41. spacer 4.6|3158803|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to MN694316 (Marine virus AFVG_250M341, complete genome) position: , mismatch: 7, identity: 0.781
acaccccgctatctgcgcggctttacgagata- CRISPR spacer
ataccctgcaatctgcgcggcttta-gcggcac Protospacer
*.****.** *************** * *..*
42. spacer 4.6|3158803|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to MN694631 (Marine virus AFVG_250M342, complete genome) position: , mismatch: 7, identity: 0.781
acaccccgctatctgcgcggctttacgagata- CRISPR spacer
ataccctgcaatctgcgcggcttta-gcggcac Protospacer
*.****.** *************** * *..*
43. spacer 3.1|3132342|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to MK448716 (Streptococcus phage Javan249, complete genome) position: , mismatch: 8, identity: 0.75
acgtaacaaaacaacagcaaaatattatcgac CRISPR spacer
taataacaaaacgacagcaaaagattatagtt Protospacer
.*********.********* ***** * .
44. spacer 3.4|3132525|32|CP027452|CRISPRCasFinder,CRT matches to NZ_LT904880 (Salmonella enterica subsp. enterica serovar Typhi strain ty3-193 genome assembly, plasmid: 3) position: , mismatch: 8, identity: 0.75
aatgattgatataaatctgtgtacggtgtccg CRISPR spacer
aatgattgttataagtctgtgtagcgttgttg Protospacer
******** *****.******** ** ..*
45. spacer 3.4|3132525|32|CP027452|CRISPRCasFinder,CRT matches to NZ_LT904895 (Salmonella enterica subsp. enterica serovar Typhi strain ERL12960 genome assembly, plasmid: 2) position: , mismatch: 8, identity: 0.75
aatgattgatataaatctgtgtacggtgtccg CRISPR spacer
aatgattgttataagtctgtgtagcgttgttg Protospacer
******** *****.******** ** ..*
46. spacer 3.4|3132525|32|CP027452|CRISPRCasFinder,CRT matches to NZ_CP012254 (Cronobacter sakazakii strain NCTC 8155 plasmid pCS1, complete sequence) position: , mismatch: 8, identity: 0.75
aatgattgatataaatctgtgtacggtgtccg CRISPR spacer
aatgattgttataagtctgtgtagcgttatca Protospacer
******** *****.******** ** .*.
47. spacer 3.4|3132525|32|CP027452|CRISPRCasFinder,CRT matches to NZ_CP029647 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 plasmid pHCM2, complete sequence) position: , mismatch: 8, identity: 0.75
aatgattgatataaatctgtgtacggtgtccg CRISPR spacer
aatgattgttataagtctgtgtagcgttgttg Protospacer
******** *****.******** ** ..*
48. spacer 3.4|3132525|32|CP027452|CRISPRCasFinder,CRT matches to NZ_LT904853 (Salmonella enterica subsp. enterica serovar Typhi strain TY585 genome assembly, plasmid: 2) position: , mismatch: 8, identity: 0.75
aatgattgatataaatctgtgtacggtgtccg CRISPR spacer
aatgattgttataagtctgtgtagcgttgttg Protospacer
******** *****.******** ** ..*
49. spacer 3.4|3132525|32|CP027452|CRISPRCasFinder,CRT matches to NC_003385 (Salmonella enterica subsp. enterica serovar Typhi str. CT18 plasmid pHCM2, complete sequence) position: , mismatch: 8, identity: 0.75
aatgattgatataaatctgtgtacggtgtccg CRISPR spacer
aatgattgttataagtctgtgtagcgttgttg Protospacer
******** *****.******** ** ..*
50. spacer 3.4|3132525|32|CP027452|CRISPRCasFinder,CRT matches to NZ_CP029859 (Salmonella enterica subsp. enterica serovar Typhi strain 343077_285138 plasmid pHCM2, complete sequence) position: , mismatch: 8, identity: 0.75
aatgattgatataaatctgtgtacggtgtccg CRISPR spacer
aatgattgttataagtctgtgtagcgttgttg Protospacer
******** *****.******** ** ..*
51. spacer 3.4|3132525|32|CP027452|CRISPRCasFinder,CRT matches to NZ_CP029847 (Salmonella enterica subsp. enterica serovar Typhi strain 343078_273110 plasmid pHCM2, complete sequence) position: , mismatch: 8, identity: 0.75
aatgattgatataaatctgtgtacggtgtccg CRISPR spacer
aatgattgttataagtctgtgtagcgttgttg Protospacer
******** *****.******** ** ..*
52. spacer 3.4|3132525|32|CP027452|CRISPRCasFinder,CRT matches to NZ_CP029916 (Salmonella enterica subsp. enterica serovar Typhi strain 343076_202113 plasmid pHCM2, complete sequence) position: , mismatch: 8, identity: 0.75
aatgattgatataaatctgtgtacggtgtccg CRISPR spacer
aatgattgttataagtctgtgtagcgttgttg Protospacer
******** *****.******** ** ..*
53. spacer 3.4|3132525|32|CP027452|CRISPRCasFinder,CRT matches to NZ_CP029893 (Salmonella enterica subsp. enterica serovar Typhi strain 343076_252143 plasmid pHCM2, complete sequence) position: , mismatch: 8, identity: 0.75
aatgattgatataaatctgtgtacggtgtccg CRISPR spacer
aatgattgttataagtctgtgtagcgttgttg Protospacer
******** *****.******** ** ..*
54. spacer 3.4|3132525|32|CP027452|CRISPRCasFinder,CRT matches to NZ_CP029876 (Salmonella enterica subsp. enterica serovar Typhi strain 343076_227128 plasmid pHCM2, complete sequence) position: , mismatch: 8, identity: 0.75
aatgattgatataaatctgtgtacggtgtccg CRISPR spacer
aatgattgttataagtctgtgtagcgttgttg Protospacer
******** *****.******** ** ..*
55. spacer 3.4|3132525|32|CP027452|CRISPRCasFinder,CRT matches to NZ_CP029884 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_268186 plasmid pHCM2, complete sequence) position: , mismatch: 8, identity: 0.75
aatgattgatataaatctgtgtacggtgtccg CRISPR spacer
aatgattgttataagtctgtgtagcgttgttg Protospacer
******** *****.******** ** ..*
56. spacer 3.4|3132525|32|CP027452|CRISPRCasFinder,CRT matches to NZ_CP029961 (Salmonella enterica subsp. enterica serovar Typhi strain 343078_251131 plasmid pHCM2, complete sequence) position: , mismatch: 8, identity: 0.75
aatgattgatataaatctgtgtacggtgtccg CRISPR spacer
aatgattgttataagtctgtgtagcgttgttg Protospacer
******** *****.******** ** ..*
57. spacer 3.4|3132525|32|CP027452|CRISPRCasFinder,CRT matches to NZ_CP029849 (Salmonella enterica subsp. enterica serovar Typhi strain 343078_211126 plasmid pHCM2, complete sequence) position: , mismatch: 8, identity: 0.75
aatgattgatataaatctgtgtacggtgtccg CRISPR spacer
aatgattgttataagtctgtgtagcgttgttg Protospacer
******** *****.******** ** ..*
58. spacer 3.4|3132525|32|CP027452|CRISPRCasFinder,CRT matches to NZ_CP029857 (Salmonella enterica subsp. enterica serovar Typhi strain 343077_286126 plasmid pHCM2, complete sequence) position: , mismatch: 8, identity: 0.75
aatgattgatataaatctgtgtacggtgtccg CRISPR spacer
aatgattgttataagtctgtgtagcgttgttg Protospacer
******** *****.******** ** ..*
59. spacer 3.4|3132525|32|CP027452|CRISPRCasFinder,CRT matches to NZ_CP029929 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_216103 plasmid pHCM2, complete sequence) position: , mismatch: 8, identity: 0.75
aatgattgatataaatctgtgtacggtgtccg CRISPR spacer
aatgattgttataagtctgtgtagcgttgttg Protospacer
******** *****.******** ** ..*
60. spacer 3.4|3132525|32|CP027452|CRISPRCasFinder,CRT matches to NZ_CP029865 (Salmonella enterica subsp. enterica serovar Typhi strain 343077_228157 plasmid pHCM2, complete sequence) position: , mismatch: 8, identity: 0.75
aatgattgatataaatctgtgtacggtgtccg CRISPR spacer
aatgattgttataagtctgtgtagcgttgttg Protospacer
******** *****.******** ** ..*
61. spacer 3.4|3132525|32|CP027452|CRISPRCasFinder,CRT matches to NZ_LT883154 (Salmonella enterica subsp. enterica serovar Typhi strain ERL12148 genome assembly, plasmid: 2) position: , mismatch: 8, identity: 0.75
aatgattgatataaatctgtgtacggtgtccg CRISPR spacer
aatgattgttataagtctgtgtagcgttgttg Protospacer
******** *****.******** ** ..*
62. spacer 3.4|3132525|32|CP027452|CRISPRCasFinder,CRT matches to NZ_CP029905 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_231186 plasmid pHCM2, complete sequence) position: , mismatch: 8, identity: 0.75
aatgattgatataaatctgtgtacggtgtccg CRISPR spacer
aatgattgttataagtctgtgtagcgttgttg Protospacer
******** *****.******** ** ..*
63. spacer 3.4|3132525|32|CP027452|CRISPRCasFinder,CRT matches to NZ_CP029851 (Salmonella enterica subsp. enterica serovar Typhi strain 343078_203125 plasmid pHCM2, complete sequence) position: , mismatch: 8, identity: 0.75
aatgattgatataaatctgtgtacggtgtccg CRISPR spacer
aatgattgttataagtctgtgtagcgttgttg Protospacer
******** *****.******** ** ..*
64. spacer 3.4|3132525|32|CP027452|CRISPRCasFinder,CRT matches to NZ_CP040567 (Salmonella enterica subsp. enterica serovar Typhimurium strain SAP17-7299 plasmid pCFSAN059543, complete sequence) position: , mismatch: 8, identity: 0.75
aatgattgatataaatctgtgtacggtgtccg CRISPR spacer
aatgattgttataagtctgtgtagcgttgttg Protospacer
******** *****.******** ** ..*
65. spacer 3.4|3132525|32|CP027452|CRISPRCasFinder,CRT matches to NZ_CP029889 (Salmonella enterica subsp. enterica serovar Typhi strain 343076_294172 plasmid pHCM2, complete sequence) position: , mismatch: 8, identity: 0.75
aatgattgatataaatctgtgtacggtgtccg CRISPR spacer
aatgattgttataagtctgtgtagcgttgttg Protospacer
******** *****.******** ** ..*
66. spacer 3.4|3132525|32|CP027452|CRISPRCasFinder,CRT matches to NZ_CP029891 (Salmonella enterica subsp. enterica serovar Typhi strain 343076_253155 plasmid pHCM2, complete sequence) position: , mismatch: 8, identity: 0.75
aatgattgatataaatctgtgtacggtgtccg CRISPR spacer
aatgattgttataagtctgtgtagcgttgttg Protospacer
******** *****.******** ** ..*
67. spacer 3.4|3132525|32|CP027452|CRISPRCasFinder,CRT matches to NZ_CP029898 (Salmonella enterica subsp. enterica serovar Typhi strain 343077_213147 plasmid pHCM2, complete sequence) position: , mismatch: 8, identity: 0.75
aatgattgatataaatctgtgtacggtgtccg CRISPR spacer
aatgattgttataagtctgtgtagcgttgttg Protospacer
******** *****.******** ** ..*
68. spacer 3.4|3132525|32|CP027452|CRISPRCasFinder,CRT matches to NZ_CP029951 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_205186 plasmid pHCM2, complete sequence) position: , mismatch: 8, identity: 0.75
aatgattgatataaatctgtgtacggtgtccg CRISPR spacer
aatgattgttataagtctgtgtagcgttgttg Protospacer
******** *****.******** ** ..*
69. spacer 3.4|3132525|32|CP027452|CRISPRCasFinder,CRT matches to NZ_CP029867 (Salmonella enterica subsp. enterica serovar Typhi strain 343077_228140 plasmid pHCM2, complete sequence) position: , mismatch: 8, identity: 0.75
aatgattgatataaatctgtgtacggtgtccg CRISPR spacer
aatgattgttataagtctgtgtagcgttgttg Protospacer
******** *****.******** ** ..*
70. spacer 3.4|3132525|32|CP027452|CRISPRCasFinder,CRT matches to NZ_CP029901 (Salmonella enterica subsp. enterica serovar Typhi strain 343076_232188 plasmid pHCM2, complete sequence) position: , mismatch: 8, identity: 0.75
aatgattgatataaatctgtgtacggtgtccg CRISPR spacer
aatgattgttataagtctgtgtagcgttgttg Protospacer
******** *****.******** ** ..*
71. spacer 3.4|3132525|32|CP027452|CRISPRCasFinder,CRT matches to NZ_CP029921 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_282186 plasmid pHCM2, complete sequence) position: , mismatch: 8, identity: 0.75
aatgattgatataaatctgtgtacggtgtccg CRISPR spacer
aatgattgttataagtctgtgtagcgttgttg Protospacer
******** *****.******** ** ..*
72. spacer 4.1|3158498|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KP453775 (Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence) position: , mismatch: 8, identity: 0.75
cattgaaaacattgcctttattttattttttg CRISPR spacer
tcgctaaaacattggctttatttaatttttta Protospacer
. . ********* ******** *******.
73. spacer 4.9|3158986|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to MN961670 (Pseudomonas putida strain 420352 plasmid p420352-IMP, complete sequence) position: , mismatch: 8, identity: 0.75
cgggcgactggggcgggtttgttaatctcatg CRISPR spacer
ccgaaaaatggggctggtttgttaatctgatc Protospacer
* *. .* ****** ************* **
74. spacer 4.11|3159108|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 8, identity: 0.75
gactatcgcggactgctgaaatcaaccggcga CRISPR spacer
gcgtcgcgcggactgccgaattcaaccggctc Protospacer
* * **********.*** *********
75. spacer 3.1|3132342|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044347 (Escherichia coli strain P225M plasmid pP225M-CTX-M-55, complete sequence) position: , mismatch: 9, identity: 0.719
acgtaacaaaacaacagcaaaatattatcgac CRISPR spacer
taagaacaaaacaagagcgaaatattatgcat Protospacer
. ********** ***.********* *.
76. spacer 3.1|3132342|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032533 (Bacillus megaterium NCT-2 plasmid pNCT2_5, complete sequence) position: , mismatch: 9, identity: 0.719
acgtaacaaaacaacagcaaaatattatcgac CRISPR spacer
atgtaacaaaaaaacagtaaaatatggtgaga Protospacer
*.********* *****.******* .* ..
77. spacer 3.5|3132586|32|CP027452|CRISPRCasFinder,CRT,PILER-CR matches to AP014399 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C110A-MedDCM-OCT-S26-C20, *** SEQUENCING IN PROGRESS ***, 2 ordered pieces) position: , mismatch: 9, identity: 0.719
ctaggataaattaaaagacaaaattgcagcaa CRISPR spacer
gtcagataaattaaaagagataattgcaaatt Protospacer
* .************** * *******.
78. spacer 3.5|3132586|32|CP027452|CRISPRCasFinder,CRT,PILER-CR matches to AP013383 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G15, isolate: uvMED-CGR-C110A-MedDCM-OCT-S24-C13) position: , mismatch: 9, identity: 0.719
ctaggataaattaaaagacaaaattgcagcaa CRISPR spacer
gtcagataaattaaaagagataattgcaaatt Protospacer
* .************** * *******.
79. spacer 3.6|3132647|32|CP027452|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021994 (Cryobacterium sp. LW097 plasmid unnamed1) position: , mismatch: 9, identity: 0.719
gagcgaccagtatcaagatcgacaggttttgc CRISPR spacer
gagcgaccagcagcaagatcgaccagacctca Protospacer
**********.* ********** .* ..*
80. spacer 4.1|3158498|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011404 (Lactobacillus salivarius str. Ren plasmid pR1, complete sequence) position: , mismatch: 9, identity: 0.719
cattgaaaacattgcctttattttattttttg CRISPR spacer
tttaataaacattgccttaattttattattaa Protospacer
. * . ************ ******** ** .
81. spacer 4.1|3158498|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020859 (Lactobacillus salivarius strain ZLS006 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cattgaaaacattgcctttattttattttttg CRISPR spacer
tttaataaacattgccttaattttattattaa Protospacer
. * . ************ ******** ** .
82. spacer 4.1|3158498|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020859 (Lactobacillus salivarius strain ZLS006 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cattgaaaacattgcctttattttattttttg CRISPR spacer
tttaataaacattgccttaattttattattaa Protospacer
. * . ************ ******** ** .
83. spacer 4.1|3158498|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017108 (Lactobacillus salivarius strain CICC23174 plasmid pLS_1 sequence) position: , mismatch: 9, identity: 0.719
cattgaaaacattgcctttattttattttttg CRISPR spacer
tttaataaacattgccttaattttattattaa Protospacer
. * . ************ ******** ** .
84. spacer 4.1|3158498|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017110 (Lactobacillus salivarius strain CICC23174 plasmid pLS_3, complete sequence) position: , mismatch: 9, identity: 0.719
cattgaaaacattgcctttattttattttttg CRISPR spacer
tttaataaacattgccttaattttattattaa Protospacer
. * . ************ ******** ** .
85. spacer 4.1|3158498|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029460 (Clostridium novyi strain 150557 plasmid pCN2, complete sequence) position: , mismatch: 9, identity: 0.719
cattgaaaacattgcctttattttattttttg CRISPR spacer
aaaaaagaacattgtatttattttatttttaa Protospacer
* .*.*******. ************** .
86. spacer 4.6|3158803|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to MN694106 (Marine virus AFVG_250M510, complete genome) position: , mismatch: 9, identity: 0.719
acaccccgctatctgcgcggctttacgagata CRISPR spacer
ataccctgcaatctgcgcggctttagcggcgc Protospacer
*.****.** *************** .*
87. spacer 4.11|3159108|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030830 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750c, complete sequence) position: , mismatch: 9, identity: 0.719
gactatcgcggactgctgaaatcaaccggcga CRISPR spacer
gtgaagggcagactgctgaaatcatccggcag Protospacer
* * **.************** *****..
88. spacer 3.1|3132342|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045561 (Acinetobacter nosocomialis strain AC1530 plasmid pAC1530, complete sequence) position: , mismatch: 10, identity: 0.688
acgtaacaaaacaacagcaaaatattatcgac CRISPR spacer
taataaaaaaacaacagcaaaattttgaaaat Protospacer
.*** **************** **. .*.
89. spacer 3.1|3132342|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014478 (Acinetobacter pittii strain AP_882 plasmid pNDM-AP_882, complete sequence) position: , mismatch: 10, identity: 0.688
acgtaacaaaacaacagcaaaatattatcgac CRISPR spacer
taataaaaaaacaacagcaaaattttgaaaat Protospacer
.*** **************** **. .*.
90. spacer 3.7|3132708|32|CP027452|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024940 (Paraburkholderia hospita strain mHSR1 plasmid pmHSR1_P, complete sequence) position: , mismatch: 10, identity: 0.688
atcgatatgtacgttagcgaggggatcacgca CRISPR spacer
ggcgatatttacgttagcgacgggactgacct Protospacer
. ****** *********** ****... *
91. spacer 4.1|3158498|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NC_018511 (Bacillus thuringiensis HD-789 plasmid pBTHD789-5, complete sequence) position: , mismatch: 10, identity: 0.688
cattgaaaacattgcctttattttattttttg CRISPR spacer
tcgttcttacatttcttttattttattttttt Protospacer
. * ***** *.***************
92. spacer 4.1|3158498|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NC_001446 (Bacillus thuringiensis sv israelensis HI4 plasmid pTX14-3, complete sequence) position: , mismatch: 10, identity: 0.688
cattgaaaacattgcctttattttattttttg CRISPR spacer
tcgttcttacatttcttttattttattttttt Protospacer
. * ***** *.***************
93. spacer 4.1|3158498|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009345 (Bacillus thuringiensis HD1002 plasmid 6, complete sequence) position: , mismatch: 10, identity: 0.688
cattgaaaacattgcctttattttattttttg CRISPR spacer
tcgttcttacatttcttttattttattttttt Protospacer
. * ***** *.***************
94. spacer 4.1|3158498|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053657 (Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence) position: , mismatch: 10, identity: 0.688
cattgaaaacattgcctttattttattttttg CRISPR spacer
accttaaaacatttcctttgttttatttagat Protospacer
.* ******** *****.********
95. spacer 4.7|3158864|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031468 (Paraburkholderia caffeinilytica strain CF1 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688
cgatcggtgaagaggtccgcgaaatactcact CRISPR spacer
taatcggtgacgacgtccgcgaaatcggagat Protospacer
..******** ** *********** . *
96. spacer 4.7|3158864|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014580 (Burkholderia sp. OLGA172 plasmid pOLGA1, complete sequence) position: , mismatch: 10, identity: 0.688
cgatcggtgaagaggtccgcgaaatactcact CRISPR spacer
taatcggtgacgacgtccgcgaaatcggagat Protospacer
..******** ** *********** . *
97. spacer 4.15|3159352|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041048 (Citrobacter sp. CF971 plasmid pBM527-2, complete sequence) position: , mismatch: 11, identity: 0.656
agttgagcgtctaccagttgattcgggatatt CRISPR spacer
cattgagcgtctaccaggtgatacgtcgccaa Protospacer
.*************** **** ** ..
98. spacer 4.15|3159352|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to MN783744 (Klebsiella oxytoca plasmid pFDL-VIM, complete sequence) position: , mismatch: 11, identity: 0.656
agttgagcgtctaccagttgattcgggatatt CRISPR spacer
cattgagcgtctaccaggtgatacgtcgccaa Protospacer
.*************** **** ** ..
99. spacer 4.15|3159352|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NC_012885 (Aeromonas hydrophila plasmid pRA1, complete sequence) position: , mismatch: 11, identity: 0.656
agttgagcgtctaccagttgattcgggatatt CRISPR spacer
cattgagcgtctaccaggtgatacgtcgccaa Protospacer
.*************** **** ** ..
100. spacer 4.15|3159352|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042536 (Citrobacter freundii strain E51 plasmid pE51_002, complete sequence) position: , mismatch: 11, identity: 0.656
agttgagcgtctaccagttgattcgggatatt CRISPR spacer
cattgagcgtctaccaggtgatacgtcgccaa Protospacer
.*************** **** ** ..
101. spacer 4.15|3159352|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042479 (Citrobacter freundii strain C50 plasmid pC50_001, complete sequence) position: , mismatch: 11, identity: 0.656
agttgagcgtctaccagttgattcgggatatt CRISPR spacer
cattgagcgtctaccaggtgatacgtcgccaa Protospacer
.*************** **** ** ..
102. spacer 4.15|3159352|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034714 (Salmonella enterica subsp. enterica serovar Mikawasima strain RSE15 plasmid pRSE15, complete sequence) position: , mismatch: 11, identity: 0.656
agttgagcgtctaccagttgattcgggatatt CRISPR spacer
cattgagcgtctaccaggtgatacgtcgccaa Protospacer
.*************** **** ** ..
103. spacer 4.15|3159352|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012168 (Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-239.973kb, complete sequence) position: , mismatch: 11, identity: 0.656
agttgagcgtctaccagttgattcgggatatt CRISPR spacer
cattgagcgtctaccaggtgatacgtcgccaa Protospacer
.*************** **** ** ..
104. spacer 4.15|3159352|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to MN783743 (Escherichia coli plasmid pGA_VIM, complete sequence) position: , mismatch: 11, identity: 0.656
agttgagcgtctaccagttgattcgggatatt CRISPR spacer
cattgagcgtctaccaggtgatacgtcgccaa Protospacer
.*************** **** ** ..
105. spacer 4.15|3159352|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034084 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-VIM, complete sequence) position: , mismatch: 11, identity: 0.656
agttgagcgtctaccagttgattcgggatatt CRISPR spacer
cattgagcgtctaccaggtgatacgtcgccaa Protospacer
.*************** **** ** ..
106. spacer 4.15|3159352|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH220284 (Aeromonas sp. pRIVM0001_VIM-1 plasmid pRIVM0001_VIM-1_171012_B12, complete sequence) position: , mismatch: 11, identity: 0.656
agttgagcgtctaccagttgattcgggatatt CRISPR spacer
cattgagcgtctaccaggtgatacgtcgccaa Protospacer
.*************** **** ** ..
107. spacer 4.15|3159352|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG228427 (Kluyvera cryocrescens strain BO64W plasmid pKC-BO-N1-VIM, complete sequence) position: , mismatch: 11, identity: 0.656
agttgagcgtctaccagttgattcgggatatt CRISPR spacer
cattgagcgtctaccaggtgatacgtcgccaa Protospacer
.*************** **** ** ..
108. spacer 4.15|3159352|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG550958 (Escherichia coli strain G3216 plasmid pG3216.2, complete sequence) position: , mismatch: 11, identity: 0.656
agttgagcgtctaccagttgattcgggatatt CRISPR spacer
cattgagcgtctaccaggtgatacgtcgccaa Protospacer
.*************** **** ** ..
109. spacer 4.15|3159352|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH325469 (Enterobacter hormaechei strain Ec13 plasmid pEc13, complete sequence) position: , mismatch: 11, identity: 0.656
agttgagcgtctaccagttgattcgggatatt CRISPR spacer
cattgagcgtctaccaggtgatacgtcgccaa Protospacer
.*************** **** ** ..
110. spacer 4.15|3159352|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH325468 (Enterobacter hormaechei strain Ec09 plasmid pEc09, complete sequence) position: , mismatch: 11, identity: 0.656
agttgagcgtctaccagttgattcgggatatt CRISPR spacer
cattgagcgtctaccaggtgatacgtcgccaa Protospacer
.*************** **** ** ..
111. spacer 4.15|3159352|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH594478 (Citrobacter freundii strain AA593 plasmid pIBAC_Incx3_A/C, complete sequence) position: , mismatch: 11, identity: 0.656
agttgagcgtctaccagttgattcgggatatt CRISPR spacer
cattgagcgtctaccaggtgatacgtcgccaa Protospacer
.*************** **** ** ..
112. spacer 4.15|3159352|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH594477 (Citrobacter freundii strain AA535 plasmid pIBAC_IncA/C, complete sequence) position: , mismatch: 11, identity: 0.656
agttgagcgtctaccagttgattcgggatatt CRISPR spacer
cattgagcgtctaccaggtgatacgtcgccaa Protospacer
.*************** **** ** ..
113. spacer 4.15|3159352|32|CP027452|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG053108 (Citrobacter freundii strain 33587 plasmid pCf587, complete sequence) position: , mismatch: 11, identity: 0.656
agttgagcgtctaccagttgattcgggatatt CRISPR spacer
cattgagcgtctaccaggtgatacgtcgccaa Protospacer
.*************** **** ** ..
