Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP027378 Escherichia coli strain 2013C-4404 plasmid unnamed2 0 crisprs NA 0 0 0 0
CP027379 Escherichia coli strain 2013C-4404 plasmid unnamed3, complete sequence 1 crisprs NA 0 1 0 0
CP027376 Escherichia coli strain 2013C-4404 chromosome, complete genome 7 crisprs NA 0 13 0 0
CP027377 Escherichia coli strain 2013C-4404 plasmid unnamed1, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. CP027379
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027379_1 15458-15549 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 CP027379 Escherichia coli strain 2013C-4404 plasmid unnamed3, complete sequence 15483-15524 0 1.0
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP031903 Escherichia coli O104:H4 strain FWSEC0009 plasmid unnamed18, complete sequence 76350-76391 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP013224 Salmonella enterica subsp. enterica serovar Anatum strain GT-38 plasmid PDM04, complete sequence 73966-74007 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 MF679144 Escherichia coli plasmid pBJ114-78, complete sequence 10131-10172 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_KU355874 Escherichia coli strain FAM22871 plasmid pFAM22871_2, complete sequence 40765-40806 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_KX452392 Escherichia coli strain JB10 plasmid pJB10, complete sequence 52015-52056 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NC_015965 Salmonella enterica subsp. enterica serovar Typhimurium plasmid R621a, complete sequence 35383-35424 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP018625 Escherichia coli strain FORC_044 plasmid pFORC44_1, complete sequence 69366-69407 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP045763 Salmonella enterica subsp. enterica serovar Heidelberg str. 41578 plasmid p1CFSAN000318, complete sequence 64815-64856 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP014494 Escherichia coli strain MVAST0167 plasmid pMVAST0167_2, complete sequence 25358-25399 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NC_022267 Salmonella enterica subsp. enterica serovar Enteritidis strain S1400/94 plasmid pS1400_89, complete sequence 32577-32618 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP018116 Escherichia coli strain MRSN346638 plasmid pMRSN346638_119.3, complete sequence 63562-63603 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP018110 Escherichia coli strain MRSN346595 plasmid pMRSN346595_120.3, complete sequence 64634-64675 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP014622 Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1727 isolate SAN1261-1 plasmid pSAN1-1727, complete sequence 32038-32079 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_LS992187 Escherichia coli isolate Escherichia coli str. 3426 plasmid 3, complete sequence 75193-75234 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP045523 Shigella flexneri strain 5908.2 plasmid p5908-2 61801-61842 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP033963 Klebsiella pneumoniae strain L482 plasmid p4_L382, complete sequence 45192-45233 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP034963 Escherichia coli strain WCHEC020032 plasmid pCMY42_020032, complete sequence 17167-17208 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_LS999562 Escherichia coli isolate EC-TO143 plasmid 3, complete sequence 49608-49649 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 MN007140 Escherichia coli strain 91 plasmid p91_CMY-42, complete sequence 28556-28597 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_EU418931 Escherichia coli strain JIE174 plasmid pJIE174, complete sequence 39397-39438 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_EU418923 Escherichia coli strain JIE113 plasmid pJIE113, complete sequence 34994-35035 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_EU418926 Escherichia coli strain JIE139 plasmid pJIE139, complete sequence 32909-32950 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP044402 Escherichia coli strain NMBU-W10C18 plasmid pNMBU-W10C18_02, complete sequence 27837-27878 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP048295 Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-3, complete sequence 53647-53688 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NC_013120 Escherichia coli plasmid pEK204, complete sequence 34489-34530 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP026726 Escherichia coli strain 266917_2 plasmid p266917_2_03, complete sequence 26061-26102 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 MN915010 Escherichia coli strain TJ-33 plasmid pNDM-TJ33, complete sequence 140373-140414 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 MN915012 Escherichia coli strain GD-33 plasmid pNDM33-2, complete sequence 30039-30080 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 MN915013 Escherichia coli strain TD-33 plasmid pNDM-TD33, complete sequence 67822-67863 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP028315 Salmonella enterica subsp. enterica serovar Typhimurium var. 5- strain CFSAN067217 plasmid pSC-31-1, complete sequence 44990-45031 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP032524 Shigella sonnei strain AR_0030 plasmid unnamed1, complete sequence 30027-30068 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP054943 Escherichia coli strain MS6192 plasmid pMS6192C, complete sequence 47015-47056 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 LT985289 Escherichia coli strain B4-75 genome assembly, plasmid: RCS80_p 32356-32397 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NC_018995 Escherichia coli plasmid pHUSEC41-1, complete sequence 24964-25005 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP022064 Salmonella enterica strain FDAARGOS_312 plasmid unnamed4, complete sequence 57709-57750 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP021841 Escherichia coli strain EC974 plasmid pEC974-1, complete sequence 58792-58833 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP027374 Escherichia coli strain 05-3629 plasmid unnamed1, complete sequence 91494-91535 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 CM019852 Escherichia coli strain CVM N17EC0326 plasmid pN17EC0326-2, complete sequence, whole genome shotgun sequence 240-281 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NC_018659 Escherichia coli O104:H4 str. 2011C-3493 plasmid pESBL-EA11, complete sequence 68403-68444 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP038417 Escherichia coli O157:H7 strain 3-5-1 plasmid pGM351-2, complete sequence 32987-33028 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP014662 Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1783 plasmid pSAN1-2010K-2577, complete sequence 48569-48610 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP044183 Salmonella enterica subsp. enterica serovar Heidelberg strain AR-0404 plasmid pAR-0404-2, complete sequence 24116-24157 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP045756 Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000752 plasmid p2CFSAN000752, complete sequence 89516-89557 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP025239 Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1928 plasmid pSNE2-1928, complete sequence 40088-40129 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 CP034252 Salmonella enterica subsp. enterica serovar Derby strain Sa64 plasmid pSa64-96, complete sequence 50229-50270 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP030000 Salmonella enterica subsp. enterica serovar Brandenburg strain SA20113174 plasmid pSA20113174.1, complete sequence 43954-43995 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP042618 Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-3_MCR3, complete sequence 48140-48181 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NC_024975 Escherichia coli strain E17.16 plasmid pE17.16, complete sequence 45834-45875 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NC_024976 Escherichia coli strain ESBL117 plasmid pESBL-117, complete sequence 33777-33818 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NC_024977 Escherichia coli strain ESBL-12 plasmid pESBL-12, complete sequence 39408-39449 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_LT985295 Escherichia coli strain 650 genome assembly, plasmid: RCS64_pII 34994-35035 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP040548 Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-p3, complete sequence 42030-42071 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NC_019043 Escherichia coli plasmid pND11_107, complete sequence 48574-48615 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NC_019044 Escherichia coli plasmid pND12_96, complete sequence 32226-32267 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 CP030839 Salmonella enterica subsp. enterica serovar Napoli strain LC0541/17 plasmid pLC0541_17, complete sequence 28696-28737 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP021693 Escherichia coli strain AR_0151 plasmid tig00001252, complete sequence 28727-28768 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP030232 Salmonella enterica strain SA20043041 plasmid pSA20043041.1, complete sequence 33606-33647 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 KY463221 Escherichia coli plasmid pCMY-42, complete sequence 29669-29710 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 CP052382 Klebsiella pneumoniae strain D16KP0008 plasmid pD16KP0008-1, complete sequence 33970-34011 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP053867 Salmonella enterica subsp. enterica serovar Typhimurium strain SL7207 plasmid pSL7202-2a, complete sequence 31923-31964 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP053868 Salmonella enterica subsp. enterica serovar Typhimurium strain SL7207 plasmid pSL7202-2b, complete sequence 31923-31964 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP040270 Escherichia coli strain 1500 plasmid pEc1500_CTX, complete sequence 33966-34007 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_LT985236 Escherichia coli strain 641 genome assembly, plasmid: RCS33_pI 33778-33819 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_LT985231 Escherichia coli strain 730 genome assembly, plasmid: RCS37_pII 59038-59079 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_LT985238 Escherichia coli strain 692 genome assembly, plasmid: RCS29_pI 33782-33823 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP039490 Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000752 plasmid pCFSAN000752, complete sequence 72200-72241 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP031615 Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C2, complete sequence 14524-14565 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_AP019190 Escherichia coli strain M217 plasmid pM217_I1, complete sequence 27587-27628 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP033160 Escherichia coli strain CM IVRI KOL-1 plasmid pESBL-EA11p1ESCUM 47719-47760 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP048373 Escherichia coli strain 164 plasmid pC-F-163_B, complete sequence 27114-27155 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP023387 Escherichia coli strain 1190 plasmid p86, complete sequence 24915-24956 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP023376 Escherichia coli strain 1283 plasmid p92, complete sequence 36152-36193 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP030234 Salmonella enterica strain SA20101045 plasmid pSA20101045.1, complete sequence 36483-36524 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 KU932026 Escherichia coli plasmid pEC14II_1, complete sequence 62089-62130 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 KU932027 Escherichia coli plasmid pEC14II_2, complete sequence 61907-61948 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 MG516908 Escherichia coli plasmid pEc42, complete sequence 56621-56662 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP030003 Salmonella enterica subsp. enterica serovar Brandenburg strain SA20064858 plasmid pSA20064858.1, complete sequence 58350-58391 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NC_025140 Escherichia coli plasmid pH1519-88, complete sequence 14628-14669 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NC_025147 Escherichia coli plasmid pV404, complete sequence 40473-40514 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP016533 Salmonella enterica subsp. enterica serovar Heidelberg strain SA01AB09084001 plasmid pSA01AB09084001_92, complete sequence 36164-36205 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP024146 Escherichia coli strain 14EC029 plasmid p14EC029e, complete sequence 14508-14549 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP030921 Escherichia coli strain KL53 plasmid pKL53-M, complete sequence 53312-53353 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NC_019123 Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH1148_107, complete sequence 51841-51882 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NC_019131 Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH146_87, complete sequence 30802-30843 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NC_019137 Salmonella enterica subsp. enterica serovar Derby plasmid pSD107, complete sequence 52227-52268 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NC_032100 Escherichia coli strain TF_2007-10-2348-1 plasmid pTF2, complete sequence 9120-9161 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_KJ406378 Shigella sonnei strain SS084469 plasmid pSH4469, complete sequence 34409-34450 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP030025 Salmonella enterica subsp. enterica serovar Ohio strain SA20120345 plasmid pSA20120345.1, complete sequence 41368-41409 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP016520 Salmonella enterica subsp. enterica serovar Heidelberg strain CE-R2-11-0435 plasmid pCE-R2-11-0435_92, complete sequence 36982-37023 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NC_017642 Escherichia coli UMNK88 plasmid pUMNK88_91, complete sequence 32215-32256 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 CP051282 Salmonella enterica subsp. enterica serovar Typhimurium strain OLF-FSR1_WB_Junco_ST-35 plasmid pST35-95663.1B, complete sequence 23403-23444 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP012936 Salmonella enterica subsp. enterica serovar Heidelberg strain N13-01290 plasmid pN13-01290_98, complete sequence 41777-41818 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NC_014234 Escherichia coli ETEC 1392/75 plasmid p746, complete sequence 44111-44152 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NC_019097 Escherichia coli plasmid Plm, complete sequence 35516-35557 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP012923 Salmonella enterica subsp. enterica serovar Heidelberg strain SA02DT10168701 plasmid pSA02DT10168701_99, complete sequence 41789-41830 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NC_011419 Escherichia coli SE11 plasmid pSE11-1, complete sequence 46721-46762 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP023957 Escherichia coli strain FDAARGOS_448 plasmid unnamed3, complete sequence 14923-14964 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP042886 Escherichia coli O10:H32 strain NMBU-W12E19 plasmid pNMBU-W12E19_02, complete sequence 33483-33524 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP012929 Salmonella enterica subsp. enterica serovar Heidelberg strain 12-4374 plasmid p12-4374_96, complete sequence 40779-40820 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP040542 Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-p3, complete sequence 42035-42076 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP023382 Escherichia coli strain 127 plasmid p95, complete sequence 36151-36192 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP025279 Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1913 plasmid pSLU-1913, complete sequence 34113-34154 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP021882 Escherichia coli strain AR_0137 plasmid tig00001287_pilon, complete sequence 28265-28306 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP023362 Escherichia coli strain 1943 plasmid p85, complete sequence 26045-26086 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP023356 Escherichia coli strain 746 plasmid p95, complete sequence 38655-38696 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP041679 Escherichia coli strain ESBL 15 plasmid unnamed1, complete sequence 33418-33459 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_KT868530 Salmonella enterica subsp. enterica serovar Enteritidis strain SE115 plasmid pSE115, complete sequence 27673-27714 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP025709 Escherichia coli strain YDC107 plasmid pYDC107_85 map unlocalized 41352-41393 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP029367 Escherichia coli strain WCHEC035148 plasmid pCMY42_035148, complete sequence 13040-13081 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP052880 Escherichia coli strain C21 plasmid pC21-3, complete sequence 28766-28807 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP019996 Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1781 plasmid pSAN1-08-1092, complete sequence 28769-28810 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 CP016585 Salmonella enterica subsp. enterica serovar Heidelberg strain SH14-009 plasmid pSH14-009_99, complete sequence 43658-43699 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP019215 Escherichia coli strain WCHEC050613 plasmid pI_050613, complete sequence 28361-28402 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_AP019762 Escherichia coli O111:H- strain 110512 plasmid pO111-110512_1, complete sequence 50508-50549 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP024292 Escherichia coli O178:H19 strain 2012C-4431 plasmid unnamed3, complete sequence 36767-36808 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP047610 Escherichia coli strain NMBU_ W06E18 plasmid pNMBU_W06E18_Str1_1, complete sequence 27837-27878 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP016522 Salmonella enterica subsp. enterica serovar Heidelberg strain SA02DT09004001 plasmid pSA02DT09004001_101, complete sequence 44502-44543 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 MN335639 Escherichia coli strain SFE059 plasmid pSFE059, complete sequence 49947-49988 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 MN335640 Escherichia coli strain OT-ESBL-0589 plasmid pOT-ESBL-0589, complete sequence 29983-30024 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NC_022885 Escherichia coli strain LK-NARMP plasmid pKPC-LKEc, complete sequence 28189-28230 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_AP018797 Escherichia coli strain E2855 plasmid pE2855-1, complete sequence 53880-53921 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 LC485173 Escherichia coli B1 plasmid pColBM-B1 DNA, complete sequence 28166-28207 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NC_016904 Escherichia coli KO11FL plasmid pEKO1101, complete sequence 29927-29968 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NC_017665 Escherichia coli W plasmid pRK1, complete sequence 3761-3802 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_LN890525 Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712385 plasmid 2, complete sequence 553-594 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP016865 Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2010K-1587 isolate USDA-ARS-USMARC-1908 plasmid pSTY2-2010K-1587, complete sequence 44042-44083 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP018104 Escherichia coli strain MRSN352231 plasmid pMR0716_tem1, complete sequence 152268-152309 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP032888 Escherichia coli strain SCEC020022 plasmid pCTXM14_020022, complete sequence 52540-52581 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP034804 Escherichia coli strain 2009C-3554 plasmid p2009C-3554-1, complete sequence 55571-55612 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NC_022742 Escherichia coli plasmid pHUSEC2011-1, complete sequence 32022-32063 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP019220 Klebsiella pneumoniae strain 1756 plasmid pKp1756, complete sequence 13472-13513 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP027415 Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_320 plasmid unnamed1, complete sequence 62191-62232 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP027409 Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_317 plasmid unnamed, complete sequence 148431-148472 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP029903 Salmonella enterica subsp. enterica serovar Typhi strain 311189_268103 plasmid pk88, complete sequence 32022-32063 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP050758 Salmonella enterica subsp. enterica serovar Indiana strain SI173 plasmid pSI173-1, complete sequence 31631-31672 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NC_023915 Salmonella enterica subsp. enterica serovar Typhimurium plasmid pSTM709 DNA, complete genome 41964-42005 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP028312 Salmonella enterica subsp. enterica serovar Heidelberg strain CFSAN067218 plasmid pSH-04-1, complete sequence 92848-92889 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP042936 Escherichia coli 042 plasmid p2-Ec-BERN-042, complete sequence 21525-21566 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP027395 Escherichia coli O104:H4 strain FDAARGOS_349 plasmid unnamed1 76275-76316 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_AP014805 Escherichia coli O119:H6 strain EC404/03 plasmid pEC404/03-2, complete sequence 28904-28945 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_LR213460 Shigella sonnei strain AUSMDU00008333 isolate AUSMDU00008333 plasmid 3 24865-24906 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 CP054413 Escherichia coli strain SCU-204 plasmid pSCU-204-2, complete sequence 30337-30378 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_LT985248 Escherichia coli strain 720 plasmid RCS48_pI, complete sequence 24192-24233 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP036203 Escherichia coli strain L725 plasmid punnamed1, complete sequence 2884-2925 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP041441 Escherichia coli strain YPE12 plasmid pYPE12-122k, complete sequence 64660-64701 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_LT985288 Escherichia coli strain 03-237 plasmid RCS73_p, complete sequence 31820-31861 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_LT985281 Escherichia coli strain B1-54 plasmid RCS71_p, complete sequence 33778-33819 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_LT985256 Escherichia coli strain 580 plasmid RCS49_p, complete sequence 24364-24405 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_LT985268 Escherichia coli strain 699 plasmid RCS58_p, complete sequence 62384-62425 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP031656 Escherichia coli strain UK_Dog_Liverpool plasmid pCARB35_03, complete sequence 24602-24643 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_MH674341 Escherichia coli strain EC07 plasmid pUR-EC07, complete sequence 48147-48188 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP041394 Escherichia coli strain ECOL-18-VL-LA-PA-Ryan-0026 plasmid p45407_2 123205-123246 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP041394 Escherichia coli strain ECOL-18-VL-LA-PA-Ryan-0026 plasmid p45407_2 127129-127170 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 MN262643 Escherichia coli strain EC009 plasmid pEC009.2, complete sequence 57628-57669 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_MG904995 Escherichia coli strain 15OD0495 plasmid p15ODAR, complete sequence 67295-67336 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_KY748189 Escherichia coli strain EC007 plasmid pEC007, complete sequence 49915-49956 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_KY865323 Escherichia coli strain SY286M plasmid pECM13, complete sequence 54357-54398 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_MH472638 Escherichia coli strain ESBL20160056 plasmid pESBL20160056, complete sequence 43944-43985 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_MH618673 Escherichia coli strain 838B plasmid p838B-R, complete sequence 28179-28220 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_MK416155 Escherichia coli strain AR24.2b plasmid pCMY-42, complete sequence 4151-4192 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_MG948330 Escherichia coli strain 2309 plasmid p2309, complete sequence 33621-33662 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_KY748188 Escherichia coli strain EC006 plasmid pEC006, complete sequence 49915-49956 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_MG825376 Escherichia coli strain 1108 plasmid p1108-CMY2, complete sequence 41172-41213 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_KY748190 Escherichia coli strain EC008 plasmid pEC008, complete sequence 67147-67188 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_MG948332 Escherichia coli strain 2411 plasmid p2411, complete sequence 33628-33669 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_MG948333 Escherichia coli strain 2454 plasmid p2454, complete sequence 31867-31908 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_MG948331 Escherichia coli strain 2319 plasmid p2319, complete sequence 33603-33644 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 MF554637 uncultured bacterium clone AA-100 plasmid pPIMMR, complete sequence 53123-53164 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP048361 Escherichia coli strain 53 plasmid p53_B, complete sequence 31951-31992 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 MN548042 Klebsiella pneumoniae strain QD23 plasmid pQD23-1, complete sequence 43683-43724 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP028611 Escherichia coli strain 142 plasmid pTA142-2, complete sequence 27172-27213 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP040536 Klebsiella pneumoniae strain CR-HvKP1 plasmid pCR-HvKP1-p3, complete sequence 42030-42071 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP028168 Escherichia coli strain CFSAN064036 plasmid pGMI17-004_1, complete sequence 48177-48218 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_KU043116 Escherichia coli strain Y5 plasmid pECY56, complete sequence 53704-53745 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_KU130396 Escherichia coli strain S68 plasmid pS68, complete sequence 41686-41727 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_KM052220 Escherichia coli strain H18 Hel20 TF1 plasmid pTF_H18 Hel20 TF1, complete sequence 88049-88090 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_KP789019 Escherichia coli strain WCHEC13-8 plasmid pCMY42, complete sequence 41899-41940 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NC_020991 Shigella sonnei 10188 plasmid pKHSB1 complete sequence 414-455 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP010130 Escherichia coli strain C9 plasmid A, complete genome 71668-71709 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP042631 Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-4, complete sequence 76336-76377 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP047882 Salmonella enterica subsp. enterica serovar Infantis strain 119944 plasmid pESI, complete sequence 232835-232876 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP049350 Escherichia coli strain 3R plasmid p3R-2, complete sequence 24824-24865 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP020511 Escherichia coli strain 165 plasmid unnamed2, complete sequence 60013-60054 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP020547 Escherichia coli strain ZJ3920 plasmid pZJ3920-2, complete sequence 92202-92243 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP010317 Escherichia coli strain 789 plasmid pAPEC-O78-2 34954-34995 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 CP054316 Escherichia coli strain SCU-483 plasmid pSCU-483-1 61694-61735 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP021845 Escherichia coli strain EC1515 plasmid pEC1515-1, complete sequence 46729-46770 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_LT838199 Escherichia coli isolate WI1 isolate plasmid pWI1-incI1, complete sequence 38122-38163 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP013221 Salmonella enterica subsp. enterica serovar Anatum strain GT-01 plasmid PDM02, complete sequence 38170-38211 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP015996 Escherichia coli strain S51 plasmid pS51_1, complete sequence 41155-41196 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP045189 Escherichia coli strain NT1F31 plasmid pNT1F31-96kb, complete sequence 10734-10775 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP024285 Escherichia albertii strain 2014C-4356 plasmid unnamed3, complete sequence 21645-21686 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP027327 Escherichia coli strain 2013C-4830 plasmid unnamed2, complete sequence 80885-80926 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP014966 Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2010K-1587 plasmid pSTY1-2010K-1587, complete sequence 160634-160675 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 CP049984 Salmonella enterica subsp. enterica serovar Saintpaul strain CVM N40391 plasmid pN40391-1, complete sequence 49089-49130 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP041413 Escherichia coli strain STEC719 plasmid pSTEC719_2, complete sequence 50350-50391 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP038347 Escherichia coli O157:H7 strain G5295 plasmid pG5295-2, complete sequence 6690-6731 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 CP019691 Shigella sonnei strain 75/02 plasmid p75-02_3, complete sequence 40063-40104 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP040923 Escherichia coli strain FC853_EC plasmid p853EC4, complete sequence 36167-36208 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 CP034251 Salmonella enterica subsp. enterica serovar Derby strain Sa64 plasmid pSa64T-188, complete sequence 2349-2390 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 CP031286 Escherichia fergusonii strain 40A plasmid p80_40A, complete sequence 41688-41729 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP034255 Escherichia coli strain IVRI Kol CP4 plasmid pESBL-EA11 3741-3782 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP034255 Escherichia coli strain IVRI Kol CP4 plasmid pESBL-EA11 45559-45600 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP021533 Escherichia coli strain AR_0149 plasmid tig00000220, complete sequence 4583-4624 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP022734 Escherichia coli strain SA186 plasmid pSA186_5, complete sequence 38723-38764 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NC_025180 Escherichia coli plasmid pC23-89, complete sequence 39746-39787 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP035469 Escherichia coli strain U12A plasmid pU12A_B, complete sequence 36526-36567 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 KU932021 Escherichia coli plasmid pEC3I, complete sequence 55943-55984 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 KU932029 Escherichia coli plasmid pEC15I_1, complete sequence 62914-62955 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 KU932030 Escherichia coli plasmid pEC15I_2, complete sequence 62870-62911 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP024152 Escherichia coli strain 14EC033 plasmid p14EC033e, complete sequence 39309-39350 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NC_014383 Escherichia coli plasmid pEC_Bactec, complete sequence 19427-19468 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NC_006856 Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67 plasmid pSC138, complete sequence 83090-83131 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP048312 Escherichia coli strain 32-4 plasmid p32-4_B, complete sequence 46601-46642 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP023900 Escherichia coli strain FDAARGOS_433 plasmid unnamed6, complete sequence 17221-17262 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP024238 Escherichia coli O15:H11 strain 90-9272 plasmid unnamed 1743-1784 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NC_021811 Salmonella enterica subsp. enterica serovar Heidelberg str. 41578 plasmid pSEEH1578_01, complete sequence 33182-33223 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 CP048298 Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL_SAL-A00527 plasmid pN1566-1, complete sequence 49087-49128 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP018975 Escherichia coli strain Ecol_545 plasmid pEC545_1, complete sequence 43837-43878 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP023365 Escherichia coli strain 144 plasmid p92, complete sequence 16597-16638 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP039475 Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000968 plasmid pCFSAN000968_2, complete sequence 77411-77452 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP035721 Escherichia coli strain U15A plasmid pU15A_A, complete sequence 36526-36567 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP039604 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014868 plasmid p12-6919.1, complete sequence 10434-10475 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP024253 Escherichia coli O182:H21 strain D181 plasmid unnamed4 1363-1404 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NC_021813 Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002069 plasmid pCFSAN002069_01, complete sequence 46502-46543 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP023534 Escherichia coli strain FDAARGOS_403 plasmid unnamed1, complete sequence 54567-54608 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NC_019111 Salmonella enterica subsp. enterica serovar Typhimurium plasmid pSal8934a, complete sequence 57304-57345 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP015838 Escherichia coli strain MS6198 plasmid pMS6198D, complete sequence 21162-21203 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP025339 Salmonella enterica subsp. enterica serovar Typhimurium strain BL10 plasmid p113k, complete sequence 61103-61144 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 MH430881 Salmonella enterica subsp. enterica serovar London strain 3-5 plasmid pSa44-CIP-CRO, complete sequence 38383-38424 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 MH884650 Salmonella sp. strain Sa21 plasmid pSa21-HP, complete sequence 37307-37348 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 MH884651 Salmonella sp. strain Sa21 plasmid pSa21-TC-CIP, complete sequence 37307-37348 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 MH884653 Salmonella sp. strain Sa27 plasmid pSa27-TC-CIP, complete sequence 195441-195482 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 MH884654 Salmonella sp. strain Sa27 plasmid pSa27-HP, complete sequence 57680-57721 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP021739 Escherichia coli strain AR_0150 plasmid tig00002897alt, complete sequence 21356-21397 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_MN241905 Salmonella enterica subsp. enterica serovar Typhimurium strain STM3224 plasmid pUY_STM96, complete sequence 58822-58863 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_MH430883 Salmonella enterica subsp. enterica serovar London strain 3-5 plasmid pSa44-CRO, complete sequence 38114-38155 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_MK238490 Salmonella enterica subsp. enterica strain 440915 plasmid pSPA440915, complete sequence 39856-39897 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_MN242251 Escherichia coli strain 5M plasmid pISV_IncI_CMY-42, complete sequence 2977-3018 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP027127 Escherichia coli strain AR_0374 plasmid unnamed2 1855-1896 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_MF078004 Escherichia coli strain ET20160881 plasmid pET20160881, complete sequence 66457-66498 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 CP022458 Shigella sonnei strain 2015C-3566 plasmid unnamed1, complete sequence 52168-52209 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NC_023326 Escherichia coli ACN001 plasmid pACN001-F, complete sequence 88740-88781 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP037994 Salmonella enterica subsp. enterica serovar Albany strain sg_wt5 plasmid psg_wt5 41076-41117 1 0.976
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_KX058576 Salmonella enterica strain SJTUF10584 plasmid pS10584, complete sequence 38879-38920 2 0.952
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NC_025198 Escherichia coli plasmid pJIE512b, complete sequence 36573-36614 2 0.952
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 AP017892 Escherichia coli plasmid pN23 DNA, complete sequence, strain: N23 2196-2237 2 0.952
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 AP017893 Escherichia coli plasmid pS11 DNA, complete sequence, strain: S11 2196-2237 2 0.952
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP024854 Escherichia coli strain AR_0006 plasmid tig00000311, complete sequence 41197-41238 2 0.952
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP023385 Escherichia coli strain 1223 plasmid p87, complete sequence 31508-31549 2 0.952
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP027451 Escherichia coli strain 2014C-3097 plasmid unnamed2, complete sequence 109798-109839 2 0.952
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP023144 Escherichia coli strain CFSAN061770 plasmid pEGY2, complete sequence 40900-40941 2 0.952
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 MN335919 Escherichia coli strain SD-2 plasmid pNDM-T2, complete sequence 47072-47113 2 0.952
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 MN335921 Escherichia coli strain SD-6 plasmid pNDM-T6, complete sequence 55991-56032 2 0.952
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_MN540570 Escherichia coli strain E.coli4feg plasmid pIV_IncI1, complete sequence 88258-88299 2 0.952
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 MN276083 Escherichia coli strain GZ7DS11 plasmid pHN7DS11,complete sequence 56393-56434 2 0.952
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_MG825375 Escherichia coli strain 1106 plasmid p1106-NDM, complete sequence 54459-54500 2 0.952
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_MG838206 Escherichia coli strain 92944 plasmid p92944-NDM, complete sequence 56709-56750 2 0.952
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_MG271839 Escherichia coli strain SDX5C138 plasmid pHNSD138-1, complete sequence 44280-44321 2 0.952
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_MG196294 Escherichia coli strain THSJ02 plasmid pHNTH02-1, complete sequence 59119-59160 2 0.952
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_MG545909 Escherichia coli strain EC013 plasmid pEC013, complete sequence 59547-59588 2 0.952
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_MG844436 Escherichia coli strain EC13 plasmid pCMY-136, complete sequence 34572-34613 2 0.952
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_MG601057 Escherichia coli strain EC1107 plasmid pEC1107-NDM-116K, complete sequence 56814-56855 2 0.952
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_KY964068 Escherichia coli strain LV23529 plasmid pLV23529-CTX-M-8, complete sequence 22049-22090 2 0.952
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 MN816371 Escherichia coli strain A117 plasmid pA117-CTX-M-8, complete sequence 2207-2248 2 0.952
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP019253 Escherichia coli strain 13KWH46 plasmid p13KWH46-3, complete sequence 47149-47190 2 0.952
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP044137 Escherichia coli O157 strain AR-0430 plasmid pAR-0430-1, complete sequence 45387-45428 2 0.952
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP027441 Escherichia coli strain 2012C-4502 plasmid unnamed, complete sequence 172395-172436 2 0.952
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP009566 Salmonella enterica subsp. enterica serovar Newport str. CVM 22462 plasmid pCVM22462, complete sequence 77963-78004 2 0.952
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP027372 Escherichia coli strain 2015C-3905 plasmid unnamed 1137-1178 2 0.952
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP044960 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.3, complete sequence 59766-59807 2 0.952
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP040455 Escherichia coli strain UPEC132 plasmid unnamed2, complete sequence 46444-46485 2 0.952
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_KY689635 Escherichia coli strain Mbl536 plasmid pMbl536, complete sequence 23719-23760 2 0.952
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_KY565558 Escherichia coli strain Mbl488 plasmid pMbl488, complete sequence 23258-23299 2 0.952
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NC_014843 Escherichia coli plasmid p3521, complete sequence 91754-91795 2 0.952
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 NZ_CP042880 Escherichia coli strain NMBU_W05E18 plasmid pNMBU-W05E18_02, complete sequence 27180-27221 2 0.952
CP027379_1 1.1|15483|42|CP027379|CRISPRCasFinder 15483-15524 42 CP031283 Escherichia fergusonii strain 40A plasmid p150_40A, complete sequence 119637-119678 3 0.929

1. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to CP027379 (Escherichia coli strain 2013C-4404 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttttcgcgctgatttggcaattgtgatgataaaat	Protospacer
******************************************

2. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP031903 (Escherichia coli O104:H4 strain FWSEC0009 plasmid unnamed18, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

3. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP013224 (Salmonella enterica subsp. enterica serovar Anatum strain GT-38 plasmid PDM04, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

4. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to MF679144 (Escherichia coli plasmid pBJ114-78, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

5. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_KU355874 (Escherichia coli strain FAM22871 plasmid pFAM22871_2, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

6. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_KX452392 (Escherichia coli strain JB10 plasmid pJB10, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

7. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NC_015965 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid R621a, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

8. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP018625 (Escherichia coli strain FORC_044 plasmid pFORC44_1, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

9. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP045763 (Salmonella enterica subsp. enterica serovar Heidelberg str. 41578 plasmid p1CFSAN000318, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

10. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP014494 (Escherichia coli strain MVAST0167 plasmid pMVAST0167_2, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

11. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NC_022267 (Salmonella enterica subsp. enterica serovar Enteritidis strain S1400/94 plasmid pS1400_89, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

12. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP018116 (Escherichia coli strain MRSN346638 plasmid pMRSN346638_119.3, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

13. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP018110 (Escherichia coli strain MRSN346595 plasmid pMRSN346595_120.3, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

14. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP014622 (Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1727 isolate SAN1261-1 plasmid pSAN1-1727, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

15. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_LS992187 (Escherichia coli isolate Escherichia coli str. 3426 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

16. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP045523 (Shigella flexneri strain 5908.2 plasmid p5908-2) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

17. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP033963 (Klebsiella pneumoniae strain L482 plasmid p4_L382, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

18. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP034963 (Escherichia coli strain WCHEC020032 plasmid pCMY42_020032, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

19. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_LS999562 (Escherichia coli isolate EC-TO143 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

20. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to MN007140 (Escherichia coli strain 91 plasmid p91_CMY-42, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

21. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_EU418931 (Escherichia coli strain JIE174 plasmid pJIE174, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

22. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_EU418923 (Escherichia coli strain JIE113 plasmid pJIE113, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

23. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_EU418926 (Escherichia coli strain JIE139 plasmid pJIE139, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

24. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP044402 (Escherichia coli strain NMBU-W10C18 plasmid pNMBU-W10C18_02, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

25. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP048295 (Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-3, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

26. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NC_013120 (Escherichia coli plasmid pEK204, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

27. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP026726 (Escherichia coli strain 266917_2 plasmid p266917_2_03, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

28. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to MN915010 (Escherichia coli strain TJ-33 plasmid pNDM-TJ33, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

29. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to MN915012 (Escherichia coli strain GD-33 plasmid pNDM33-2, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

30. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to MN915013 (Escherichia coli strain TD-33 plasmid pNDM-TD33, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

31. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP028315 (Salmonella enterica subsp. enterica serovar Typhimurium var. 5- strain CFSAN067217 plasmid pSC-31-1, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

32. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP032524 (Shigella sonnei strain AR_0030 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

33. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP054943 (Escherichia coli strain MS6192 plasmid pMS6192C, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

34. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to LT985289 (Escherichia coli strain B4-75 genome assembly, plasmid: RCS80_p) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

35. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NC_018995 (Escherichia coli plasmid pHUSEC41-1, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

36. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP022064 (Salmonella enterica strain FDAARGOS_312 plasmid unnamed4, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

37. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP021841 (Escherichia coli strain EC974 plasmid pEC974-1, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

38. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP027374 (Escherichia coli strain 05-3629 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

39. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to CM019852 (Escherichia coli strain CVM N17EC0326 plasmid pN17EC0326-2, complete sequence, whole genome shotgun sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

40. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NC_018659 (Escherichia coli O104:H4 str. 2011C-3493 plasmid pESBL-EA11, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

41. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP038417 (Escherichia coli O157:H7 strain 3-5-1 plasmid pGM351-2, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

42. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP014662 (Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1783 plasmid pSAN1-2010K-2577, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

43. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP044183 (Salmonella enterica subsp. enterica serovar Heidelberg strain AR-0404 plasmid pAR-0404-2, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

44. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP045756 (Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000752 plasmid p2CFSAN000752, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

45. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP025239 (Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1928 plasmid pSNE2-1928, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

46. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to CP034252 (Salmonella enterica subsp. enterica serovar Derby strain Sa64 plasmid pSa64-96, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

47. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP030000 (Salmonella enterica subsp. enterica serovar Brandenburg strain SA20113174 plasmid pSA20113174.1, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

48. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP042618 (Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-3_MCR3, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

49. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NC_024975 (Escherichia coli strain E17.16 plasmid pE17.16, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

50. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NC_024976 (Escherichia coli strain ESBL117 plasmid pESBL-117, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

51. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NC_024977 (Escherichia coli strain ESBL-12 plasmid pESBL-12, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

52. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_LT985295 (Escherichia coli strain 650 genome assembly, plasmid: RCS64_pII) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

53. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP040548 (Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-p3, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

54. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NC_019043 (Escherichia coli plasmid pND11_107, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

55. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NC_019044 (Escherichia coli plasmid pND12_96, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

56. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to CP030839 (Salmonella enterica subsp. enterica serovar Napoli strain LC0541/17 plasmid pLC0541_17, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

57. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP021693 (Escherichia coli strain AR_0151 plasmid tig00001252, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

58. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP030232 (Salmonella enterica strain SA20043041 plasmid pSA20043041.1, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

59. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to KY463221 (Escherichia coli plasmid pCMY-42, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

60. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to CP052382 (Klebsiella pneumoniae strain D16KP0008 plasmid pD16KP0008-1, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

61. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP053867 (Salmonella enterica subsp. enterica serovar Typhimurium strain SL7207 plasmid pSL7202-2a, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

62. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP053868 (Salmonella enterica subsp. enterica serovar Typhimurium strain SL7207 plasmid pSL7202-2b, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

63. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP040270 (Escherichia coli strain 1500 plasmid pEc1500_CTX, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

64. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_LT985236 (Escherichia coli strain 641 genome assembly, plasmid: RCS33_pI) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

65. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_LT985231 (Escherichia coli strain 730 genome assembly, plasmid: RCS37_pII) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

66. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_LT985238 (Escherichia coli strain 692 genome assembly, plasmid: RCS29_pI) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

67. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP039490 (Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000752 plasmid pCFSAN000752, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

68. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP031615 (Klebsiella pneumoniae strain ZYST1 plasmid pZYST1C2, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

69. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_AP019190 (Escherichia coli strain M217 plasmid pM217_I1, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

70. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP033160 (Escherichia coli strain CM IVRI KOL-1 plasmid pESBL-EA11p1ESCUM) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

71. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP048373 (Escherichia coli strain 164 plasmid pC-F-163_B, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

72. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP023387 (Escherichia coli strain 1190 plasmid p86, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

73. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP023376 (Escherichia coli strain 1283 plasmid p92, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

74. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP030234 (Salmonella enterica strain SA20101045 plasmid pSA20101045.1, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

75. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to KU932026 (Escherichia coli plasmid pEC14II_1, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

76. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to KU932027 (Escherichia coli plasmid pEC14II_2, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

77. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to MG516908 (Escherichia coli plasmid pEc42, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

78. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP030003 (Salmonella enterica subsp. enterica serovar Brandenburg strain SA20064858 plasmid pSA20064858.1, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

79. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NC_025140 (Escherichia coli plasmid pH1519-88, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

80. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NC_025147 (Escherichia coli plasmid pV404, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

81. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP016533 (Salmonella enterica subsp. enterica serovar Heidelberg strain SA01AB09084001 plasmid pSA01AB09084001_92, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

82. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP024146 (Escherichia coli strain 14EC029 plasmid p14EC029e, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

83. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP030921 (Escherichia coli strain KL53 plasmid pKL53-M, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

84. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NC_019123 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH1148_107, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

85. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NC_019131 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH146_87, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

86. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NC_019137 (Salmonella enterica subsp. enterica serovar Derby plasmid pSD107, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

87. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NC_032100 (Escherichia coli strain TF_2007-10-2348-1 plasmid pTF2, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

88. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_KJ406378 (Shigella sonnei strain SS084469 plasmid pSH4469, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

89. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP030025 (Salmonella enterica subsp. enterica serovar Ohio strain SA20120345 plasmid pSA20120345.1, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

90. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP016520 (Salmonella enterica subsp. enterica serovar Heidelberg strain CE-R2-11-0435 plasmid pCE-R2-11-0435_92, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

91. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NC_017642 (Escherichia coli UMNK88 plasmid pUMNK88_91, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

92. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to CP051282 (Salmonella enterica subsp. enterica serovar Typhimurium strain OLF-FSR1_WB_Junco_ST-35 plasmid pST35-95663.1B, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

93. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP012936 (Salmonella enterica subsp. enterica serovar Heidelberg strain N13-01290 plasmid pN13-01290_98, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

94. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NC_014234 (Escherichia coli ETEC 1392/75 plasmid p746, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

95. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NC_019097 (Escherichia coli plasmid Plm, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

96. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP012923 (Salmonella enterica subsp. enterica serovar Heidelberg strain SA02DT10168701 plasmid pSA02DT10168701_99, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

97. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NC_011419 (Escherichia coli SE11 plasmid pSE11-1, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

98. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP023957 (Escherichia coli strain FDAARGOS_448 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

99. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP042886 (Escherichia coli O10:H32 strain NMBU-W12E19 plasmid pNMBU-W12E19_02, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

100. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP012929 (Salmonella enterica subsp. enterica serovar Heidelberg strain 12-4374 plasmid p12-4374_96, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

101. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP040542 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-p3, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

102. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP023382 (Escherichia coli strain 127 plasmid p95, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

103. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP025279 (Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1913 plasmid pSLU-1913, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

104. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP021882 (Escherichia coli strain AR_0137 plasmid tig00001287_pilon, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

105. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP023362 (Escherichia coli strain 1943 plasmid p85, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

106. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP023356 (Escherichia coli strain 746 plasmid p95, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

107. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP041679 (Escherichia coli strain ESBL 15 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

108. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_KT868530 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE115 plasmid pSE115, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

109. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP025709 (Escherichia coli strain YDC107 plasmid pYDC107_85 map unlocalized) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

110. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP029367 (Escherichia coli strain WCHEC035148 plasmid pCMY42_035148, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

111. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP052880 (Escherichia coli strain C21 plasmid pC21-3, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

112. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP019996 (Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1781 plasmid pSAN1-08-1092, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

113. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to CP016585 (Salmonella enterica subsp. enterica serovar Heidelberg strain SH14-009 plasmid pSH14-009_99, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

114. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP019215 (Escherichia coli strain WCHEC050613 plasmid pI_050613, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

115. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_AP019762 (Escherichia coli O111:H- strain 110512 plasmid pO111-110512_1, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

116. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP024292 (Escherichia coli O178:H19 strain 2012C-4431 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

117. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP047610 (Escherichia coli strain NMBU_ W06E18 plasmid pNMBU_W06E18_Str1_1, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

118. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP016522 (Salmonella enterica subsp. enterica serovar Heidelberg strain SA02DT09004001 plasmid pSA02DT09004001_101, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

119. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to MN335639 (Escherichia coli strain SFE059 plasmid pSFE059, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

120. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to MN335640 (Escherichia coli strain OT-ESBL-0589 plasmid pOT-ESBL-0589, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

121. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NC_022885 (Escherichia coli strain LK-NARMP plasmid pKPC-LKEc, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

122. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_AP018797 (Escherichia coli strain E2855 plasmid pE2855-1, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

123. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to LC485173 (Escherichia coli B1 plasmid pColBM-B1 DNA, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

124. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NC_016904 (Escherichia coli KO11FL plasmid pEKO1101, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

125. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NC_017665 (Escherichia coli W plasmid pRK1, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

126. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_LN890525 (Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712385 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

127. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP016865 (Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2010K-1587 isolate USDA-ARS-USMARC-1908 plasmid pSTY2-2010K-1587, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

128. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP018104 (Escherichia coli strain MRSN352231 plasmid pMR0716_tem1, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

129. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP032888 (Escherichia coli strain SCEC020022 plasmid pCTXM14_020022, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

130. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP034804 (Escherichia coli strain 2009C-3554 plasmid p2009C-3554-1, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

131. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NC_022742 (Escherichia coli plasmid pHUSEC2011-1, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

132. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP019220 (Klebsiella pneumoniae strain 1756 plasmid pKp1756, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

133. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP027415 (Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_320 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

134. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP027409 (Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_317 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

135. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP029903 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_268103 plasmid pk88, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

136. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP050758 (Salmonella enterica subsp. enterica serovar Indiana strain SI173 plasmid pSI173-1, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

137. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NC_023915 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid pSTM709 DNA, complete genome) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

138. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP028312 (Salmonella enterica subsp. enterica serovar Heidelberg strain CFSAN067218 plasmid pSH-04-1, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

139. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP042936 (Escherichia coli 042 plasmid p2-Ec-BERN-042, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

140. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP027395 (Escherichia coli O104:H4 strain FDAARGOS_349 plasmid unnamed1) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

141. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_AP014805 (Escherichia coli O119:H6 strain EC404/03 plasmid pEC404/03-2, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

142. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_LR213460 (Shigella sonnei strain AUSMDU00008333 isolate AUSMDU00008333 plasmid 3) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

143. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to CP054413 (Escherichia coli strain SCU-204 plasmid pSCU-204-2, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

144. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_LT985248 (Escherichia coli strain 720 plasmid RCS48_pI, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

145. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP036203 (Escherichia coli strain L725 plasmid punnamed1, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

146. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP041441 (Escherichia coli strain YPE12 plasmid pYPE12-122k, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

147. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_LT985288 (Escherichia coli strain 03-237 plasmid RCS73_p, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

148. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_LT985281 (Escherichia coli strain B1-54 plasmid RCS71_p, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

149. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_LT985256 (Escherichia coli strain 580 plasmid RCS49_p, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

150. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_LT985268 (Escherichia coli strain 699 plasmid RCS58_p, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

151. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP031656 (Escherichia coli strain UK_Dog_Liverpool plasmid pCARB35_03, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

152. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_MH674341 (Escherichia coli strain EC07 plasmid pUR-EC07, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

153. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP041394 (Escherichia coli strain ECOL-18-VL-LA-PA-Ryan-0026 plasmid p45407_2) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

154. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP041394 (Escherichia coli strain ECOL-18-VL-LA-PA-Ryan-0026 plasmid p45407_2) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

155. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to MN262643 (Escherichia coli strain EC009 plasmid pEC009.2, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

156. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_MG904995 (Escherichia coli strain 15OD0495 plasmid p15ODAR, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

157. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_KY748189 (Escherichia coli strain EC007 plasmid pEC007, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

158. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_KY865323 (Escherichia coli strain SY286M plasmid pECM13, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

159. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_MH472638 (Escherichia coli strain ESBL20160056 plasmid pESBL20160056, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

160. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_MH618673 (Escherichia coli strain 838B plasmid p838B-R, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

161. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_MK416155 (Escherichia coli strain AR24.2b plasmid pCMY-42, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

162. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_MG948330 (Escherichia coli strain 2309 plasmid p2309, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

163. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_KY748188 (Escherichia coli strain EC006 plasmid pEC006, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

164. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_MG825376 (Escherichia coli strain 1108 plasmid p1108-CMY2, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

165. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_KY748190 (Escherichia coli strain EC008 plasmid pEC008, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

166. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_MG948332 (Escherichia coli strain 2411 plasmid p2411, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

167. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_MG948333 (Escherichia coli strain 2454 plasmid p2454, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

168. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_MG948331 (Escherichia coli strain 2319 plasmid p2319, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

169. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to MF554637 (uncultured bacterium clone AA-100 plasmid pPIMMR, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

170. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP048361 (Escherichia coli strain 53 plasmid p53_B, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

171. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to MN548042 (Klebsiella pneumoniae strain QD23 plasmid pQD23-1, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

172. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP028611 (Escherichia coli strain 142 plasmid pTA142-2, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

173. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP040536 (Klebsiella pneumoniae strain CR-HvKP1 plasmid pCR-HvKP1-p3, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

174. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP028168 (Escherichia coli strain CFSAN064036 plasmid pGMI17-004_1, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

175. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_KU043116 (Escherichia coli strain Y5 plasmid pECY56, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

176. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_KU130396 (Escherichia coli strain S68 plasmid pS68, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

177. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_KM052220 (Escherichia coli strain H18 Hel20 TF1 plasmid pTF_H18 Hel20 TF1, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

178. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_KP789019 (Escherichia coli strain WCHEC13-8 plasmid pCMY42, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

179. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NC_020991 (Shigella sonnei 10188 plasmid pKHSB1 complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

180. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP010130 (Escherichia coli strain C9 plasmid A, complete genome) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

181. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP042631 (Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-4, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

182. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP047882 (Salmonella enterica subsp. enterica serovar Infantis strain 119944 plasmid pESI, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

183. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP049350 (Escherichia coli strain 3R plasmid p3R-2, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

184. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP020511 (Escherichia coli strain 165 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

185. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP020547 (Escherichia coli strain ZJ3920 plasmid pZJ3920-2, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

186. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP010317 (Escherichia coli strain 789 plasmid pAPEC-O78-2) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

187. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to CP054316 (Escherichia coli strain SCU-483 plasmid pSCU-483-1) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

188. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP021845 (Escherichia coli strain EC1515 plasmid pEC1515-1, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

189. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_LT838199 (Escherichia coli isolate WI1 isolate plasmid pWI1-incI1, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

190. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP013221 (Salmonella enterica subsp. enterica serovar Anatum strain GT-01 plasmid PDM02, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

191. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP015996 (Escherichia coli strain S51 plasmid pS51_1, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

192. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP045189 (Escherichia coli strain NT1F31 plasmid pNT1F31-96kb, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

193. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP024285 (Escherichia albertii strain 2014C-4356 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

194. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP027327 (Escherichia coli strain 2013C-4830 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

195. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP014966 (Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2010K-1587 plasmid pSTY1-2010K-1587, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

196. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to CP049984 (Salmonella enterica subsp. enterica serovar Saintpaul strain CVM N40391 plasmid pN40391-1, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

197. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP041413 (Escherichia coli strain STEC719 plasmid pSTEC719_2, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

198. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP038347 (Escherichia coli O157:H7 strain G5295 plasmid pG5295-2, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

199. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to CP019691 (Shigella sonnei strain 75/02 plasmid p75-02_3, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

200. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP040923 (Escherichia coli strain FC853_EC plasmid p853EC4, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

201. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to CP034251 (Salmonella enterica subsp. enterica serovar Derby strain Sa64 plasmid pSa64T-188, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

202. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to CP031286 (Escherichia fergusonii strain 40A plasmid p80_40A, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

203. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP034255 (Escherichia coli strain IVRI Kol CP4 plasmid pESBL-EA11) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

204. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP034255 (Escherichia coli strain IVRI Kol CP4 plasmid pESBL-EA11) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

205. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP021533 (Escherichia coli strain AR_0149 plasmid tig00000220, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

206. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP022734 (Escherichia coli strain SA186 plasmid pSA186_5, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

207. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NC_025180 (Escherichia coli plasmid pC23-89, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

208. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP035469 (Escherichia coli strain U12A plasmid pU12A_B, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

209. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to KU932021 (Escherichia coli plasmid pEC3I, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

210. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to KU932029 (Escherichia coli plasmid pEC15I_1, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

211. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to KU932030 (Escherichia coli plasmid pEC15I_2, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

212. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP024152 (Escherichia coli strain 14EC033 plasmid p14EC033e, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

213. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NC_014383 (Escherichia coli plasmid pEC_Bactec, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

214. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NC_006856 (Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67 plasmid pSC138, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

215. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP048312 (Escherichia coli strain 32-4 plasmid p32-4_B, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

216. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP023900 (Escherichia coli strain FDAARGOS_433 plasmid unnamed6, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

217. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP024238 (Escherichia coli O15:H11 strain 90-9272 plasmid unnamed) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

218. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NC_021811 (Salmonella enterica subsp. enterica serovar Heidelberg str. 41578 plasmid pSEEH1578_01, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

219. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to CP048298 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL_SAL-A00527 plasmid pN1566-1, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

220. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP018975 (Escherichia coli strain Ecol_545 plasmid pEC545_1, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

221. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP023365 (Escherichia coli strain 144 plasmid p92, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

222. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP039475 (Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000968 plasmid pCFSAN000968_2, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

223. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP035721 (Escherichia coli strain U15A plasmid pU15A_A, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

224. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP039604 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014868 plasmid p12-6919.1, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

225. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP024253 (Escherichia coli O182:H21 strain D181 plasmid unnamed4) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

226. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NC_021813 (Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002069 plasmid pCFSAN002069_01, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

227. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP023534 (Escherichia coli strain FDAARGOS_403 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

228. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NC_019111 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid pSal8934a, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

229. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP015838 (Escherichia coli strain MS6198 plasmid pMS6198D, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

230. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP025339 (Salmonella enterica subsp. enterica serovar Typhimurium strain BL10 plasmid p113k, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

231. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to MH430881 (Salmonella enterica subsp. enterica serovar London strain 3-5 plasmid pSa44-CIP-CRO, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

232. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to MH884650 (Salmonella sp. strain Sa21 plasmid pSa21-HP, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

233. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to MH884651 (Salmonella sp. strain Sa21 plasmid pSa21-TC-CIP, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

234. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to MH884653 (Salmonella sp. strain Sa27 plasmid pSa27-TC-CIP, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

235. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to MH884654 (Salmonella sp. strain Sa27 plasmid pSa27-HP, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

236. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP021739 (Escherichia coli strain AR_0150 plasmid tig00002897alt, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

237. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_MN241905 (Salmonella enterica subsp. enterica serovar Typhimurium strain STM3224 plasmid pUY_STM96, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

238. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_MH430883 (Salmonella enterica subsp. enterica serovar London strain 3-5 plasmid pSa44-CRO, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

239. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_MK238490 (Salmonella enterica subsp. enterica strain 440915 plasmid pSPA440915, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

240. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_MN242251 (Escherichia coli strain 5M plasmid pISV_IncI_CMY-42, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

241. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP027127 (Escherichia coli strain AR_0374 plasmid unnamed2) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

242. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_MF078004 (Escherichia coli strain ET20160881 plasmid pET20160881, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

243. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to CP022458 (Shigella sonnei strain 2015C-3566 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

244. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NC_023326 (Escherichia coli ACN001 plasmid pACN001-F, complete sequence) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

245. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP037994 (Salmonella enterica subsp. enterica serovar Albany strain sg_wt5 plasmid psg_wt5) position: , mismatch: 1, identity: 0.976

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
********* ********************************

246. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_KX058576 (Salmonella enterica strain SJTUF10584 plasmid pS10584, complete sequence) position: , mismatch: 2, identity: 0.952

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgataataaaat	Protospacer
********* ************************.*******

247. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NC_025198 (Escherichia coli plasmid pJIE512b, complete sequence) position: , mismatch: 2, identity: 0.952

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgataataaaat	Protospacer
********* ************************.*******

248. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to AP017892 (Escherichia coli plasmid pN23 DNA, complete sequence, strain: N23) position: , mismatch: 2, identity: 0.952

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cgcttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
*.******* ********************************

249. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to AP017893 (Escherichia coli plasmid pS11 DNA, complete sequence, strain: S11) position: , mismatch: 2, identity: 0.952

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cgcttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
*.******* ********************************

250. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP024854 (Escherichia coli strain AR_0006 plasmid tig00000311, complete sequence) position: , mismatch: 2, identity: 0.952

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgataataaaat	Protospacer
********* ************************.*******

251. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP023385 (Escherichia coli strain 1223 plasmid p87, complete sequence) position: , mismatch: 2, identity: 0.952

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgataataaaat	Protospacer
********* ************************.*******

252. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP027451 (Escherichia coli strain 2014C-3097 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.952

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattatgatgataaaat	Protospacer
********* *******************.************

253. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP023144 (Escherichia coli strain CFSAN061770 plasmid pEGY2, complete sequence) position: , mismatch: 2, identity: 0.952

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcactgatttggcaattgtgatgataaaat	Protospacer
********* ****.***************************

254. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to MN335919 (Escherichia coli strain SD-2 plasmid pNDM-T2, complete sequence) position: , mismatch: 2, identity: 0.952

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcactgatttggcaattgtgatgataaaat	Protospacer
********* ****.***************************

255. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to MN335921 (Escherichia coli strain SD-6 plasmid pNDM-T6, complete sequence) position: , mismatch: 2, identity: 0.952

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcactgatttggcaattgtgatgataaaat	Protospacer
********* ****.***************************

256. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_MN540570 (Escherichia coli strain E.coli4feg plasmid pIV_IncI1, complete sequence) position: , mismatch: 2, identity: 0.952

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgataataaaat	Protospacer
********* ************************.*******

257. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to MN276083 (Escherichia coli strain GZ7DS11 plasmid pHN7DS11,complete sequence) position: , mismatch: 2, identity: 0.952

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcactgatttggcaattgtgatgataaaat	Protospacer
********* ****.***************************

258. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_MG825375 (Escherichia coli strain 1106 plasmid p1106-NDM, complete sequence) position: , mismatch: 2, identity: 0.952

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcactgatttggcaattgtgatgataaaat	Protospacer
********* ****.***************************

259. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_MG838206 (Escherichia coli strain 92944 plasmid p92944-NDM, complete sequence) position: , mismatch: 2, identity: 0.952

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcactgatttggcaattgtgatgataaaat	Protospacer
********* ****.***************************

260. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_MG271839 (Escherichia coli strain SDX5C138 plasmid pHNSD138-1, complete sequence) position: , mismatch: 2, identity: 0.952

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcactgatttggcaattgtgatgataaaat	Protospacer
********* ****.***************************

261. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_MG196294 (Escherichia coli strain THSJ02 plasmid pHNTH02-1, complete sequence) position: , mismatch: 2, identity: 0.952

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcactgatttggcaattgtgatgataaaat	Protospacer
********* ****.***************************

262. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_MG545909 (Escherichia coli strain EC013 plasmid pEC013, complete sequence) position: , mismatch: 2, identity: 0.952

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcactgatttggcaattgtgatgataaaat	Protospacer
********* ****.***************************

263. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_MG844436 (Escherichia coli strain EC13 plasmid pCMY-136, complete sequence) position: , mismatch: 2, identity: 0.952

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgataataaaat	Protospacer
********* ************************.*******

264. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_MG601057 (Escherichia coli strain EC1107 plasmid pEC1107-NDM-116K, complete sequence) position: , mismatch: 2, identity: 0.952

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcactgatttggcaattgtgatgataaaat	Protospacer
********* ****.***************************

265. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_KY964068 (Escherichia coli strain LV23529 plasmid pLV23529-CTX-M-8, complete sequence) position: , mismatch: 2, identity: 0.952

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cgcttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
*.******* ********************************

266. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to MN816371 (Escherichia coli strain A117 plasmid pA117-CTX-M-8, complete sequence) position: , mismatch: 2, identity: 0.952

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cgcttatttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
*.******* ********************************

267. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP019253 (Escherichia coli strain 13KWH46 plasmid p13KWH46-3, complete sequence) position: , mismatch: 2, identity: 0.952

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcactgatttggcaattgtgatgataaaat	Protospacer
********* ****.***************************

268. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP044137 (Escherichia coli O157 strain AR-0430 plasmid pAR-0430-1, complete sequence) position: , mismatch: 2, identity: 0.952

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgataataaaat	Protospacer
********* ************************.*******

269. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP027441 (Escherichia coli strain 2012C-4502 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.952

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattatgatgataaaat	Protospacer
********* *******************.************

270. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP009566 (Salmonella enterica subsp. enterica serovar Newport str. CVM 22462 plasmid pCVM22462, complete sequence) position: , mismatch: 2, identity: 0.952

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgataataaaat	Protospacer
********* ************************.*******

271. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP027372 (Escherichia coli strain 2015C-3905 plasmid unnamed) position: , mismatch: 2, identity: 0.952

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattatgatgataaaat	Protospacer
********* *******************.************

272. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP044960 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.3, complete sequence) position: , mismatch: 2, identity: 0.952

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtaatgataaaat	Protospacer
********* *********************.**********

273. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP040455 (Escherichia coli strain UPEC132 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.952

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattatgatgataaaat	Protospacer
********* *******************.************

274. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_KY689635 (Escherichia coli strain Mbl536 plasmid pMbl536, complete sequence) position: , mismatch: 2, identity: 0.952

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcactgatttggcaattgtgatgataaaat	Protospacer
********* ****.***************************

275. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_KY565558 (Escherichia coli strain Mbl488 plasmid pMbl488, complete sequence) position: , mismatch: 2, identity: 0.952

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcactgatttggcaattgtgatgataaaat	Protospacer
********* ****.***************************

276. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NC_014843 (Escherichia coli plasmid p3521, complete sequence) position: , mismatch: 2, identity: 0.952

-cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
acactt-tttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
 ***** *** ********************************

277. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to NZ_CP042880 (Escherichia coli strain NMBU_W05E18 plasmid pNMBU-W05E18_02, complete sequence) position: , mismatch: 2, identity: 0.952

-cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
tcactta-ttatcgcgctgatttggcaattgtgatgataaaat	Protospacer
 ****** ** ********************************

278. spacer 1.1|15483|42|CP027379|CRISPRCasFinder matches to CP031283 (Escherichia fergusonii strain 40A plasmid p150_40A, complete sequence) position: , mismatch: 3, identity: 0.929

cacttatttttcgcgctgatttggcaattgtgatgataaaat	CRISPR spacer
cacttatttatcgcgctgatttggcaattgtgatgataaata	Protospacer
********* ******************************  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP027376
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027376_1 798060-798151 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027376_2 1134602-1134747 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027376_3 1940373-1940505 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027376_4 3441702-3441819 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027376_5 3835874-3836328 Orphan I-E
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027376_6 3862046-3862625 Orphan I-E
9 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027376_7 4921532-4921655 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP027376_1 1.1|798086|40|CP027376|CRISPRCasFinder 798086-798125 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 0 1.0
CP027376_3 3.1|1940390|42|CP027376|PILER-CR 1940390-1940431 42 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141085-141126 0 1.0
CP027376_3 3.2|1940449|40|CP027376|PILER-CR 1940449-1940488 40 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141028-141067 0 1.0
CP027376_7 7.1|4921575|38|CP027376|CRISPRCasFinder 4921575-4921612 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
CP027376_5 5.6|3836208|32|CP027376|PILER-CR 3836208-3836239 32 CP054922 Streptomyces sp. NA03103 plasmid unnamed2, complete sequence 68158-68189 6 0.812
CP027376_5 5.13|3836207|32|CP027376|CRISPRCasFinder,CRT 3836207-3836238 32 CP054922 Streptomyces sp. NA03103 plasmid unnamed2, complete sequence 68158-68189 6 0.812
CP027376_6 6.7|3862443|32|CP027376|PILER-CR,CRISPRCasFinder,CRT 3862443-3862474 32 NZ_CP015609 Bacillus safensis strain U14-5 plasmid unnamed2, complete sequence 10946-10977 6 0.812
CP027376_6 6.7|3862443|32|CP027376|PILER-CR,CRISPRCasFinder,CRT 3862443-3862474 32 NZ_CP025188 Roseomonas mucosa strain AD2 plasmid p1-AD2, complete sequence 305380-305411 6 0.812
CP027376_6 6.8|3862504|32|CP027376|PILER-CR,CRISPRCasFinder,CRT 3862504-3862535 32 CP000662 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 649166-649197 6 0.812
CP027376_6 6.9|3862565|32|CP027376|PILER-CR,CRISPRCasFinder,CRT 3862565-3862596 32 NZ_CP050442 Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence 41503-41534 6 0.812
CP027376_6 6.8|3862504|32|CP027376|PILER-CR,CRISPRCasFinder,CRT 3862504-3862535 32 MT889371 Microbacterium phage DelaGarza, complete genome 35549-35580 8 0.75
CP027376_5 5.5|3836147|32|CP027376|PILER-CR 3836147-3836178 32 MN692948 Marine virus AFVG_117M19, complete genome 51093-51124 9 0.719
CP027376_5 5.12|3836146|32|CP027376|CRISPRCasFinder,CRT 3836146-3836177 32 MN692948 Marine virus AFVG_117M19, complete genome 51093-51124 9 0.719
CP027376_6 6.8|3862504|32|CP027376|PILER-CR,CRISPRCasFinder,CRT 3862504-3862535 32 NZ_CP044425 Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence 203634-203665 9 0.719
CP027376_5 5.2|3835964|32|CP027376|PILER-CR 3835964-3835995 32 NZ_CP044141 Escherichia coli O157 strain AR-0430 plasmid pAR-0430-4 25453-25484 10 0.688
CP027376_5 5.2|3835964|32|CP027376|PILER-CR 3835964-3835995 32 AP012531 Stx2-converting phage Stx2a_F422 proviral DNA, complete genome 62857-62888 10 0.688
CP027376_5 5.2|3835964|32|CP027376|PILER-CR 3835964-3835995 32 KP682385 Escherichia phage PA33, complete genome 62350-62381 10 0.688
CP027376_5 5.2|3835964|32|CP027376|PILER-CR 3835964-3835995 32 KP682382 Escherichia phage PA29, complete genome 62350-62381 10 0.688
CP027376_5 5.2|3835964|32|CP027376|PILER-CR 3835964-3835995 32 KP682389 Escherichia phage PA45, complete genome 64976-65007 10 0.688
CP027376_5 5.2|3835964|32|CP027376|PILER-CR 3835964-3835995 32 KP682383 Escherichia phage PA30, complete genome 62350-62381 10 0.688
CP027376_5 5.2|3835964|32|CP027376|PILER-CR 3835964-3835995 32 NC_000924 Enterobacteria phage 933W, complete genome 61274-61305 10 0.688
CP027376_5 5.2|3835964|32|CP027376|PILER-CR 3835964-3835995 32 NC_004914 Stx2 converting phage II DNA, complete genome 31530-31561 10 0.688
CP027376_5 5.2|3835964|32|CP027376|PILER-CR 3835964-3835995 32 KP682375 Escherichia phage PA11, complete genome 62350-62381 10 0.688
CP027376_5 5.2|3835964|32|CP027376|PILER-CR 3835964-3835995 32 KP682387 Escherichia phage PA42, complete genome 62350-62381 10 0.688
CP027376_5 5.2|3835964|32|CP027376|PILER-CR 3835964-3835995 32 AF125520 Bacteriophage 933W, complete genome 61274-61305 10 0.688
CP027376_5 5.2|3835964|32|CP027376|PILER-CR 3835964-3835995 32 KJ909655 Escherichia Stx1-converting recombinant phage HUN/2013, complete genome 22866-22897 10 0.688
CP027376_5 5.2|3835964|32|CP027376|PILER-CR 3835964-3835995 32 KU238068 Stx converting phage vB_EcoS_P32, complete genome 62146-62177 10 0.688
CP027376_5 5.2|3835964|32|CP027376|PILER-CR 3835964-3835995 32 KU238070 Stx converting phage vB_EcoS_ST2-8624, complete genome 62433-62464 10 0.688
CP027376_5 5.2|3835964|32|CP027376|PILER-CR 3835964-3835995 32 KP682384 Escherichia phage PA32, complete genome 62350-62381 10 0.688
CP027376_5 5.2|3835964|32|CP027376|PILER-CR 3835964-3835995 32 KP682386 Escherichia phage PA36, complete genome 63663-63694 10 0.688
CP027376_5 5.2|3835964|32|CP027376|PILER-CR 3835964-3835995 32 KP682376 Escherichia phage PA12, complete genome 61030-61061 10 0.688
CP027376_5 5.2|3835964|32|CP027376|PILER-CR 3835964-3835995 32 AP000422 Enterobacteria phage VT2-Sakai genomic DNA, prophage inserted region in Escherichia coli O157:H7 62899-62930 10 0.688
CP027376_5 5.2|3835964|32|CP027376|PILER-CR 3835964-3835995 32 KP682391 Escherichia phage PA51, complete genome 61030-61061 10 0.688
CP027376_5 5.2|3835964|32|CP027376|PILER-CR 3835964-3835995 32 KP682388 Escherichia phage PA44, complete genome 62350-62381 10 0.688
CP027376_5 5.2|3835964|32|CP027376|PILER-CR 3835964-3835995 32 AP004402 Stx2 converting phage I DNA, complete genome 31359-31390 10 0.688
CP027376_5 5.2|3835964|32|CP027376|PILER-CR 3835964-3835995 32 KP682372 Escherichia phage PA4, complete genome 62350-62381 10 0.688
CP027376_5 5.2|3835964|32|CP027376|PILER-CR 3835964-3835995 32 KP682377 Escherichia phage PA16, complete genome 62350-62381 10 0.688
CP027376_5 5.2|3835964|32|CP027376|PILER-CR 3835964-3835995 32 NC_000902 Enterobacteria phage VT2-Sakai, complete genome 60584-60615 10 0.688
CP027376_5 5.2|3835964|32|CP027376|PILER-CR 3835964-3835995 32 AP000363 Enterobacteria phage VT2-Sakai proviral DNA, complete genome 60584-60615 10 0.688
CP027376_5 5.2|3835964|32|CP027376|PILER-CR 3835964-3835995 32 KP682380 Escherichia phage PA27, complete genome 63663-63694 10 0.688
CP027376_5 5.2|3835964|32|CP027376|PILER-CR 3835964-3835995 32 AP005153 Stx1 converting phage DNA, complete genome 31530-31561 10 0.688
CP027376_5 5.2|3835964|32|CP027376|PILER-CR 3835964-3835995 32 KP682379 Escherichia phage PA21, complete genome 62350-62381 10 0.688
CP027376_5 5.2|3835964|32|CP027376|PILER-CR 3835964-3835995 32 KP682373 Escherichia phage PA5, complete genome 62350-62381 10 0.688
CP027376_5 5.2|3835964|32|CP027376|PILER-CR 3835964-3835995 32 NC_049923 Stx2-converting phage Stx2a_WGPS9 proviral DNA, complete genome 55835-55866 10 0.688
CP027376_5 5.2|3835964|32|CP027376|PILER-CR 3835964-3835995 32 KP682378 Escherichia phage PA18, complete genome 62350-62381 10 0.688
CP027376_5 5.2|3835964|32|CP027376|PILER-CR 3835964-3835995 32 KU238069 Stx converting phage vB_EcoS_P22, complete genome 61942-61973 10 0.688
CP027376_5 5.2|3835964|32|CP027376|PILER-CR 3835964-3835995 32 KP682390 Escherichia phage PA50, complete genome 62350-62381 10 0.688
CP027376_5 5.2|3835964|32|CP027376|PILER-CR 3835964-3835995 32 NC_010237 Enterobacteria phage Min27, complete genome 62975-63006 10 0.688
CP027376_5 5.2|3835964|32|CP027376|PILER-CR 3835964-3835995 32 KP682392 Escherichia phage PA52, complete genome 64976-65007 10 0.688
CP027376_5 5.2|3835964|32|CP027376|PILER-CR 3835964-3835995 32 AP012529 Stx2-converting phage Stx2a_F403 proviral DNA, complete genome 62973-63004 10 0.688
CP027376_5 5.5|3836147|32|CP027376|PILER-CR 3836147-3836178 32 MN693666 Marine virus AFVG_250M158, complete genome 33511-33542 10 0.688
CP027376_5 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT 3835963-3835994 32 NZ_CP044141 Escherichia coli O157 strain AR-0430 plasmid pAR-0430-4 25453-25484 10 0.688
CP027376_5 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT 3835963-3835994 32 AP012531 Stx2-converting phage Stx2a_F422 proviral DNA, complete genome 62857-62888 10 0.688
CP027376_5 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT 3835963-3835994 32 KP682385 Escherichia phage PA33, complete genome 62350-62381 10 0.688
CP027376_5 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT 3835963-3835994 32 KP682382 Escherichia phage PA29, complete genome 62350-62381 10 0.688
CP027376_5 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT 3835963-3835994 32 KP682389 Escherichia phage PA45, complete genome 64976-65007 10 0.688
CP027376_5 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT 3835963-3835994 32 KP682383 Escherichia phage PA30, complete genome 62350-62381 10 0.688
CP027376_5 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT 3835963-3835994 32 NC_000924 Enterobacteria phage 933W, complete genome 61274-61305 10 0.688
CP027376_5 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT 3835963-3835994 32 NC_004914 Stx2 converting phage II DNA, complete genome 31530-31561 10 0.688
CP027376_5 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT 3835963-3835994 32 KP682375 Escherichia phage PA11, complete genome 62350-62381 10 0.688
CP027376_5 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT 3835963-3835994 32 KP682387 Escherichia phage PA42, complete genome 62350-62381 10 0.688
CP027376_5 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT 3835963-3835994 32 AF125520 Bacteriophage 933W, complete genome 61274-61305 10 0.688
CP027376_5 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT 3835963-3835994 32 KJ909655 Escherichia Stx1-converting recombinant phage HUN/2013, complete genome 22866-22897 10 0.688
CP027376_5 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT 3835963-3835994 32 KU238068 Stx converting phage vB_EcoS_P32, complete genome 62146-62177 10 0.688
CP027376_5 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT 3835963-3835994 32 KU238070 Stx converting phage vB_EcoS_ST2-8624, complete genome 62433-62464 10 0.688
CP027376_5 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT 3835963-3835994 32 KP682384 Escherichia phage PA32, complete genome 62350-62381 10 0.688
CP027376_5 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT 3835963-3835994 32 KP682386 Escherichia phage PA36, complete genome 63663-63694 10 0.688
CP027376_5 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT 3835963-3835994 32 KP682376 Escherichia phage PA12, complete genome 61030-61061 10 0.688
CP027376_5 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT 3835963-3835994 32 AP000422 Enterobacteria phage VT2-Sakai genomic DNA, prophage inserted region in Escherichia coli O157:H7 62899-62930 10 0.688
CP027376_5 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT 3835963-3835994 32 KP682391 Escherichia phage PA51, complete genome 61030-61061 10 0.688
CP027376_5 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT 3835963-3835994 32 KP682388 Escherichia phage PA44, complete genome 62350-62381 10 0.688
CP027376_5 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT 3835963-3835994 32 AP004402 Stx2 converting phage I DNA, complete genome 31359-31390 10 0.688
CP027376_5 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT 3835963-3835994 32 KP682372 Escherichia phage PA4, complete genome 62350-62381 10 0.688
CP027376_5 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT 3835963-3835994 32 KP682377 Escherichia phage PA16, complete genome 62350-62381 10 0.688
CP027376_5 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT 3835963-3835994 32 NC_000902 Enterobacteria phage VT2-Sakai, complete genome 60584-60615 10 0.688
CP027376_5 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT 3835963-3835994 32 AP000363 Enterobacteria phage VT2-Sakai proviral DNA, complete genome 60584-60615 10 0.688
CP027376_5 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT 3835963-3835994 32 KP682380 Escherichia phage PA27, complete genome 63663-63694 10 0.688
CP027376_5 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT 3835963-3835994 32 AP005153 Stx1 converting phage DNA, complete genome 31530-31561 10 0.688
CP027376_5 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT 3835963-3835994 32 KP682379 Escherichia phage PA21, complete genome 62350-62381 10 0.688
CP027376_5 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT 3835963-3835994 32 KP682373 Escherichia phage PA5, complete genome 62350-62381 10 0.688
CP027376_5 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT 3835963-3835994 32 NC_049923 Stx2-converting phage Stx2a_WGPS9 proviral DNA, complete genome 55835-55866 10 0.688
CP027376_5 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT 3835963-3835994 32 KP682378 Escherichia phage PA18, complete genome 62350-62381 10 0.688
CP027376_5 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT 3835963-3835994 32 KU238069 Stx converting phage vB_EcoS_P22, complete genome 61942-61973 10 0.688
CP027376_5 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT 3835963-3835994 32 KP682390 Escherichia phage PA50, complete genome 62350-62381 10 0.688
CP027376_5 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT 3835963-3835994 32 NC_010237 Enterobacteria phage Min27, complete genome 62975-63006 10 0.688
CP027376_5 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT 3835963-3835994 32 KP682392 Escherichia phage PA52, complete genome 64976-65007 10 0.688
CP027376_5 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT 3835963-3835994 32 AP012529 Stx2-converting phage Stx2a_F403 proviral DNA, complete genome 62973-63004 10 0.688
CP027376_5 5.12|3836146|32|CP027376|CRISPRCasFinder,CRT 3836146-3836177 32 MN693666 Marine virus AFVG_250M158, complete genome 33511-33542 10 0.688
CP027376_6 6.7|3862443|32|CP027376|PILER-CR,CRISPRCasFinder,CRT 3862443-3862474 32 LN997844 Streptomyces reticuli genome assembly TUE45, plasmid : III 74068-74099 10 0.688

1. spacer 1.1|798086|40|CP027376|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgctgcgggtcattcttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
****************************************

2. spacer 3.1|1940390|42|CP027376|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 0, identity: 1.0

tgtcacacgcagataaatccaactttcaatattgttaagttc	CRISPR spacer
tgtcacacgcagataaatccaactttcaatattgttaagttc	Protospacer
******************************************

3. spacer 3.2|1940449|40|CP027376|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 0, identity: 1.0

catggcgtagaaaaaagaaattttcaatattgctttatgg	CRISPR spacer
catggcgtagaaaaaagaaattttcaatattgctttatgg	Protospacer
****************************************

4. spacer 7.1|4921575|38|CP027376|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

5. spacer 5.6|3836208|32|CP027376|PILER-CR matches to CP054922 (Streptomyces sp. NA03103 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

--tttcagcagttcagcgtaacaccgacggtcac	CRISPR spacer
gccttccgc--ttcaccggaacaccgacggtcac	Protospacer
  .*** **  **** ** ***************

6. spacer 5.13|3836207|32|CP027376|CRISPRCasFinder,CRT matches to CP054922 (Streptomyces sp. NA03103 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

--tttcagcagttcagcgtaacaccgacggtcac	CRISPR spacer
gccttccgc--ttcaccggaacaccgacggtcac	Protospacer
  .*** **  **** ** ***************

7. spacer 6.7|3862443|32|CP027376|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015609 (Bacillus safensis strain U14-5 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

gactcaaccgcgcttcccggcctcaccactgc	CRISPR spacer
gcggcaaccgcgcttcccggcctgaccaatcc	Protospacer
*   ******************* **** * *

8. spacer 6.7|3862443|32|CP027376|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025188 (Roseomonas mucosa strain AD2 plasmid p1-AD2, complete sequence) position: , mismatch: 6, identity: 0.812

gactcaaccgcgcttcccggcctcaccactgc	CRISPR spacer
gcggcaaccgcgcttcccggcctgaccaatcc	Protospacer
*   ******************* **** * *

9. spacer 6.8|3862504|32|CP027376|PILER-CR,CRISPRCasFinder,CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 6, identity: 0.812

gcaatttgttgtccgcgatccggtacgcgcgt	CRISPR spacer
tcagcttgttgtccgcgatgcggtacgcccgc	Protospacer
 **..************** ******** **.

10. spacer 6.9|3862565|32|CP027376|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050442 (Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

cggctatggaatttatggagaagtttggtttt	CRISPR spacer
ctcctatggaatttatgcagaagtttagtaat	Protospacer
*  ************** ********.**  *

11. spacer 6.8|3862504|32|CP027376|PILER-CR,CRISPRCasFinder,CRT matches to MT889371 (Microbacterium phage DelaGarza, complete genome) position: , mismatch: 8, identity: 0.75

gcaatttgttgtccgcgatccggtacgcgcgt	CRISPR spacer
ccgtgcggttgtccgcgatccggtaggcgcgc	Protospacer
 *.  . ****************** *****.

12. spacer 5.5|3836147|32|CP027376|PILER-CR matches to MN692948 (Marine virus AFVG_117M19, complete genome) position: , mismatch: 9, identity: 0.719

acgctgatttgatgggggctggtgcaggagat	CRISPR spacer
gtgaagctttgttgggggctggtgctggagga	Protospacer
..*  * **** ************* ****. 

13. spacer 5.12|3836146|32|CP027376|CRISPRCasFinder,CRT matches to MN692948 (Marine virus AFVG_117M19, complete genome) position: , mismatch: 9, identity: 0.719

acgctgatttgatgggggctggtgcaggagat	CRISPR spacer
gtgaagctttgttgggggctggtgctggagga	Protospacer
..*  * **** ************* ****. 

14. spacer 6.8|3862504|32|CP027376|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 9, identity: 0.719

------gcaatttgttgtccgcgatccggtacgcgcgt	CRISPR spacer
cgcggggc------ttggccgcgatccggtccgcgcga	Protospacer
      **      *** ************ ****** 

15. spacer 5.2|3835964|32|CP027376|PILER-CR matches to NZ_CP044141 (Escherichia coli O157 strain AR-0430 plasmid pAR-0430-4) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

16. spacer 5.2|3835964|32|CP027376|PILER-CR matches to AP012531 (Stx2-converting phage Stx2a_F422 proviral DNA, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

17. spacer 5.2|3835964|32|CP027376|PILER-CR matches to KP682385 (Escherichia phage PA33, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

18. spacer 5.2|3835964|32|CP027376|PILER-CR matches to KP682382 (Escherichia phage PA29, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

19. spacer 5.2|3835964|32|CP027376|PILER-CR matches to KP682389 (Escherichia phage PA45, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

20. spacer 5.2|3835964|32|CP027376|PILER-CR matches to KP682383 (Escherichia phage PA30, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

21. spacer 5.2|3835964|32|CP027376|PILER-CR matches to NC_000924 (Enterobacteria phage 933W, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

22. spacer 5.2|3835964|32|CP027376|PILER-CR matches to NC_004914 (Stx2 converting phage II DNA, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

23. spacer 5.2|3835964|32|CP027376|PILER-CR matches to KP682375 (Escherichia phage PA11, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

24. spacer 5.2|3835964|32|CP027376|PILER-CR matches to KP682387 (Escherichia phage PA42, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

25. spacer 5.2|3835964|32|CP027376|PILER-CR matches to AF125520 (Bacteriophage 933W, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

26. spacer 5.2|3835964|32|CP027376|PILER-CR matches to KJ909655 (Escherichia Stx1-converting recombinant phage HUN/2013, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

27. spacer 5.2|3835964|32|CP027376|PILER-CR matches to KU238068 (Stx converting phage vB_EcoS_P32, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

28. spacer 5.2|3835964|32|CP027376|PILER-CR matches to KU238070 (Stx converting phage vB_EcoS_ST2-8624, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

29. spacer 5.2|3835964|32|CP027376|PILER-CR matches to KP682384 (Escherichia phage PA32, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

30. spacer 5.2|3835964|32|CP027376|PILER-CR matches to KP682386 (Escherichia phage PA36, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

31. spacer 5.2|3835964|32|CP027376|PILER-CR matches to KP682376 (Escherichia phage PA12, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

32. spacer 5.2|3835964|32|CP027376|PILER-CR matches to AP000422 (Enterobacteria phage VT2-Sakai genomic DNA, prophage inserted region in Escherichia coli O157:H7) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

33. spacer 5.2|3835964|32|CP027376|PILER-CR matches to KP682391 (Escherichia phage PA51, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

34. spacer 5.2|3835964|32|CP027376|PILER-CR matches to KP682388 (Escherichia phage PA44, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

35. spacer 5.2|3835964|32|CP027376|PILER-CR matches to AP004402 (Stx2 converting phage I DNA, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

36. spacer 5.2|3835964|32|CP027376|PILER-CR matches to KP682372 (Escherichia phage PA4, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

37. spacer 5.2|3835964|32|CP027376|PILER-CR matches to KP682377 (Escherichia phage PA16, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

38. spacer 5.2|3835964|32|CP027376|PILER-CR matches to NC_000902 (Enterobacteria phage VT2-Sakai, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

39. spacer 5.2|3835964|32|CP027376|PILER-CR matches to AP000363 (Enterobacteria phage VT2-Sakai proviral DNA, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

40. spacer 5.2|3835964|32|CP027376|PILER-CR matches to KP682380 (Escherichia phage PA27, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

41. spacer 5.2|3835964|32|CP027376|PILER-CR matches to AP005153 (Stx1 converting phage DNA, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

42. spacer 5.2|3835964|32|CP027376|PILER-CR matches to KP682379 (Escherichia phage PA21, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

43. spacer 5.2|3835964|32|CP027376|PILER-CR matches to KP682373 (Escherichia phage PA5, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

44. spacer 5.2|3835964|32|CP027376|PILER-CR matches to NC_049923 (Stx2-converting phage Stx2a_WGPS9 proviral DNA, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

45. spacer 5.2|3835964|32|CP027376|PILER-CR matches to KP682378 (Escherichia phage PA18, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

46. spacer 5.2|3835964|32|CP027376|PILER-CR matches to KU238069 (Stx converting phage vB_EcoS_P22, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

47. spacer 5.2|3835964|32|CP027376|PILER-CR matches to KP682390 (Escherichia phage PA50, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

48. spacer 5.2|3835964|32|CP027376|PILER-CR matches to NC_010237 (Enterobacteria phage Min27, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

49. spacer 5.2|3835964|32|CP027376|PILER-CR matches to KP682392 (Escherichia phage PA52, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

50. spacer 5.2|3835964|32|CP027376|PILER-CR matches to AP012529 (Stx2-converting phage Stx2a_F403 proviral DNA, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

51. spacer 5.5|3836147|32|CP027376|PILER-CR matches to MN693666 (Marine virus AFVG_250M158, complete genome) position: , mismatch: 10, identity: 0.688

acgctgatttgatgggggctggtgcaggagat	CRISPR spacer
tcgctgatttgatggcggcgggtgggtaggtc	Protospacer
 ************** *** **** . ..* .

52. spacer 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT matches to NZ_CP044141 (Escherichia coli O157 strain AR-0430 plasmid pAR-0430-4) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

53. spacer 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT matches to AP012531 (Stx2-converting phage Stx2a_F422 proviral DNA, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

54. spacer 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT matches to KP682385 (Escherichia phage PA33, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

55. spacer 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT matches to KP682382 (Escherichia phage PA29, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

56. spacer 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT matches to KP682389 (Escherichia phage PA45, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

57. spacer 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT matches to KP682383 (Escherichia phage PA30, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

58. spacer 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT matches to NC_000924 (Enterobacteria phage 933W, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

59. spacer 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT matches to NC_004914 (Stx2 converting phage II DNA, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

60. spacer 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT matches to KP682375 (Escherichia phage PA11, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

61. spacer 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT matches to KP682387 (Escherichia phage PA42, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

62. spacer 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT matches to AF125520 (Bacteriophage 933W, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

63. spacer 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT matches to KJ909655 (Escherichia Stx1-converting recombinant phage HUN/2013, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

64. spacer 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT matches to KU238068 (Stx converting phage vB_EcoS_P32, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

65. spacer 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT matches to KU238070 (Stx converting phage vB_EcoS_ST2-8624, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

66. spacer 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT matches to KP682384 (Escherichia phage PA32, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

67. spacer 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT matches to KP682386 (Escherichia phage PA36, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

68. spacer 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT matches to KP682376 (Escherichia phage PA12, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

69. spacer 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT matches to AP000422 (Enterobacteria phage VT2-Sakai genomic DNA, prophage inserted region in Escherichia coli O157:H7) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

70. spacer 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT matches to KP682391 (Escherichia phage PA51, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

71. spacer 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT matches to KP682388 (Escherichia phage PA44, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

72. spacer 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT matches to AP004402 (Stx2 converting phage I DNA, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

73. spacer 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT matches to KP682372 (Escherichia phage PA4, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

74. spacer 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT matches to KP682377 (Escherichia phage PA16, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

75. spacer 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT matches to NC_000902 (Enterobacteria phage VT2-Sakai, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

76. spacer 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT matches to AP000363 (Enterobacteria phage VT2-Sakai proviral DNA, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

77. spacer 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT matches to KP682380 (Escherichia phage PA27, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

78. spacer 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT matches to AP005153 (Stx1 converting phage DNA, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

79. spacer 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT matches to KP682379 (Escherichia phage PA21, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

80. spacer 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT matches to KP682373 (Escherichia phage PA5, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

81. spacer 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT matches to NC_049923 (Stx2-converting phage Stx2a_WGPS9 proviral DNA, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

82. spacer 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT matches to KP682378 (Escherichia phage PA18, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

83. spacer 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT matches to KU238069 (Stx converting phage vB_EcoS_P22, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

84. spacer 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT matches to KP682390 (Escherichia phage PA50, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

85. spacer 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT matches to NC_010237 (Enterobacteria phage Min27, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

86. spacer 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT matches to KP682392 (Escherichia phage PA52, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

87. spacer 5.9|3835963|32|CP027376|CRISPRCasFinder,CRT matches to AP012529 (Stx2-converting phage Stx2a_F403 proviral DNA, complete genome) position: , mismatch: 10, identity: 0.688

gctatcgggtgtggataccgctttcgaggcgt	CRISPR spacer
gctatcgggtgcggagaccgcttatttgttca	Protospacer
***********.*** ******* .  * .  

88. spacer 5.12|3836146|32|CP027376|CRISPRCasFinder,CRT matches to MN693666 (Marine virus AFVG_250M158, complete genome) position: , mismatch: 10, identity: 0.688

acgctgatttgatgggggctggtgcaggagat	CRISPR spacer
tcgctgatttgatggcggcgggtgggtaggtc	Protospacer
 ************** *** **** . ..* .

89. spacer 6.7|3862443|32|CP027376|PILER-CR,CRISPRCasFinder,CRT matches to LN997844 (Streptomyces reticuli genome assembly TUE45, plasmid : III) position: , mismatch: 10, identity: 0.688

gactcaaccgcgcttcccggcctcaccactgc	CRISPR spacer
tgcgacaccgcgcttcccgggcgcaccacgca	Protospacer
 .*   ************** * ******   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage