Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP027347 Escherichia coli strain 2013C-4361 chromosome, complete genome 2 crisprs NA 0 4 0 0
CP027348 Escherichia coli strain 2013C-4361 plasmid unnamed 0 crisprs NA 0 0 0 0

Results visualization

1. CP027347
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027347_1 2914596-2914868 Orphan I-E
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027347_2 2940568-2940962 Orphan I-E
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP027347_1 1.1|2914625|32|CP027347|PILER-CR,CRISPRCasFinder,CRT 2914625-2914656 32 NZ_CP050442 Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence 41503-41534 6 0.812
CP027347_2 2.1|2940597|32|CP027347|CRISPRCasFinder 2940597-2940628 32 MK814759 Gordonia phage Reyja, complete genome 4467-4498 8 0.75
CP027347_1 1.2|2914686|32|CP027347|PILER-CR,CRISPRCasFinder,CRT 2914686-2914717 32 LT599585 Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid 32377-32408 9 0.719
CP027347_1 1.3|2914747|32|CP027347|PILER-CR,CRISPRCasFinder,CRT 2914747-2914778 32 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 292180-292211 9 0.719
CP027347_1 1.3|2914747|32|CP027347|PILER-CR,CRISPRCasFinder,CRT 2914747-2914778 32 NZ_CP020740 [Pseudomonas] mesoacidophila strain ATCC 31433 plasmid pATCC31433, complete sequence 20747-20778 9 0.719

1. spacer 1.1|2914625|32|CP027347|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050442 (Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

aaaaccaaacttctccataaattccatagccg	CRISPR spacer
attactaaacttctgcataaattccataggag	Protospacer
*  **.******** **************  *

2. spacer 2.1|2940597|32|CP027347|CRISPRCasFinder matches to MK814759 (Gordonia phage Reyja, complete genome) position: , mismatch: 8, identity: 0.75

-gacagaacggcctcagtagtctcgtcaggctc	CRISPR spacer
ccaccg-ctggccccagtagcctcgtcaggctt	Protospacer
  ** *  .****.******.***********.

3. spacer 1.2|2914686|32|CP027347|PILER-CR,CRISPRCasFinder,CRT matches to LT599585 (Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid) position: , mismatch: 9, identity: 0.719

gagagtgctgacaggtgtctcgattacctgat	CRISPR spacer
ggctttgctggcaggtctctcgattaccttgg	Protospacer
*.   *****.***** ************ . 

4. spacer 1.3|2914747|32|CP027347|PILER-CR,CRISPRCasFinder,CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 9, identity: 0.719

gaacgcaatatcacggcgttctgcggcctcgg	CRISPR spacer
atcggcaatatcacggcgtttttcggcgccgc	Protospacer
.   ****************.* **** .** 

5. spacer 1.3|2914747|32|CP027347|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020740 ([Pseudomonas] mesoacidophila strain ATCC 31433 plasmid pATCC31433, complete sequence) position: , mismatch: 9, identity: 0.719

gaacgcaatatcacggcgttctgcggcctcgg	CRISPR spacer
accggcaacatcacggcgttcttcggcgccgc	Protospacer
.   ****.************* **** .** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage