Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP027345 Escherichia coli strain 2014C-3946 plasmid unnamed1 0 crisprs NA 0 0 0 0
CP027344 Escherichia coli strain 2014C-3946 chromosome, complete genome 5 crisprs NA 0 6 0 0
CP027346 Escherichia coli strain 2014C-3946 plasmid unnamed2 0 crisprs NA 0 0 0 0

Results visualization

1. CP027344
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027344_1 882032-882155 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027344_2 1736607-1736698 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027344_3 2059836-2059980 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027344_4 4853994-4854387 Orphan I-E
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027344_5 4880085-4880357 Orphan I-E
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP027344_2 2.1|1736633|40|CP027344|CRISPRCasFinder 1736633-1736672 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 0 1.0
CP027344_1 1.1|882075|38|CP027344|CRISPRCasFinder 882075-882112 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
CP027344_5 5.4|4880297|32|CP027344|PILER-CR,CRISPRCasFinder,CRT 4880297-4880328 32 NZ_CP050442 Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence 41503-41534 6 0.812
CP027344_4 4.6|4854327|32|CP027344|CRISPRCasFinder,CRT 4854327-4854358 32 MK814759 Gordonia phage Reyja, complete genome 4467-4498 8 0.75
CP027344_5 5.2|4880175|32|CP027344|PILER-CR,CRISPRCasFinder,CRT 4880175-4880206 32 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 292180-292211 9 0.719
CP027344_5 5.2|4880175|32|CP027344|PILER-CR,CRISPRCasFinder,CRT 4880175-4880206 32 NZ_CP020740 [Pseudomonas] mesoacidophila strain ATCC 31433 plasmid pATCC31433, complete sequence 20747-20778 9 0.719
CP027344_5 5.3|4880236|32|CP027344|PILER-CR,CRISPRCasFinder,CRT 4880236-4880267 32 LT599585 Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid 32377-32408 9 0.719

1. spacer 2.1|1736633|40|CP027344|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgctgcgggtcattcttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
****************************************

2. spacer 1.1|882075|38|CP027344|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

3. spacer 5.4|4880297|32|CP027344|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050442 (Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

cggctatggaatttatggagaagtttggtttt	CRISPR spacer
ctcctatggaatttatgcagaagtttagtaat	Protospacer
*  ************** ********.**  *

4. spacer 4.6|4854327|32|CP027344|CRISPRCasFinder,CRT matches to MK814759 (Gordonia phage Reyja, complete genome) position: , mismatch: 8, identity: 0.75

gagcctgacgagactactgaggccgttctgtc-	CRISPR spacer
aagcctgacgaggctactggggcca-gcggtgg	Protospacer
.***********.******.****.  * **  

5. spacer 5.2|4880175|32|CP027344|PILER-CR,CRISPRCasFinder,CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 9, identity: 0.719

ccgaggccgcagaacgccgtgatattgcgttc	CRISPR spacer
gcggcgccgaaaaacgccgtgatattgccgat	Protospacer
 **. **** *.****************   .

6. spacer 5.2|4880175|32|CP027344|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020740 ([Pseudomonas] mesoacidophila strain ATCC 31433 plasmid pATCC31433, complete sequence) position: , mismatch: 9, identity: 0.719

ccgaggccgcagaacgccgtgatattgcgttc	CRISPR spacer
gcggcgccgaagaacgccgtgatgttgccggt	Protospacer
 **. **** *************.****   .

7. spacer 5.3|4880236|32|CP027344|PILER-CR,CRISPRCasFinder,CRT matches to LT599585 (Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid) position: , mismatch: 9, identity: 0.719

atcaggtaatcgagacacctgtcagcactctc	CRISPR spacer
ccaaggtaatcgagagacctgccagcaaagcc	Protospacer
 . ************ *****.*****   .*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage