Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP027311 Escherichia coli strain 2014C-4135 plasmid unnamed, complete sequence 0 crisprs NA 0 0 0 0
CP027310 Escherichia coli strain 2014C-4135 chromosome, complete genome 5 crisprs NA 0 4 0 0

Results visualization

1. CP027310
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027310_1 1941653-1941904 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027310_2 2436460-2436732 Orphan I-E
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027310_3 2452233-2452871 Orphan I-E
10 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027310_4 3072443-3072534 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027310_5 4863186-4863282 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP027310_4 4.1|3072469|40|CP027310|CRISPRCasFinder 3072469-3072508 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 1 0.975
CP027310_3 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT 2452262-2452293 32 NZ_CP019314 Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-2, complete sequence 71972-72003 6 0.812
CP027310_3 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT 2452262-2452293 32 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 66681-66712 7 0.781
CP027310_3 3.11|2452384|31|CP027310|CRISPRCasFinder,CRT 2452384-2452414 31 AP014927 Ralstonia phage RSF1 DNA, complete genome 171005-171035 8 0.742
CP027310_2 2.4|2436672|32|CP027310|CRISPRCasFinder,CRT 2436672-2436703 32 MK249151 Blackfly microvirus SF02 isolate 049, complete genome 1908-1939 9 0.719
CP027310_3 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT 2452262-2452293 32 NZ_CP020898 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRetBra5b, complete sequence 46007-46038 9 0.719
CP027310_3 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT 2452262-2452293 32 NZ_CP013555 Rhizobium phaseoli strain N931 plasmid pRphaN931c, complete sequence 125777-125808 9 0.719
CP027310_3 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT 2452262-2452293 32 NZ_CP020950 Rhizobium sp. CIAT894 plasmid pRheCIAT894c, complete sequence 134655-134686 9 0.719
CP027310_3 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT 2452262-2452293 32 NZ_CP013587 Rhizobium phaseoli strain N161 plasmid pRphaN161b, complete sequence 68724-68755 9 0.719
CP027310_3 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT 2452262-2452293 32 NZ_CP043499 Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence 166140-166171 9 0.719
CP027310_3 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT 2452262-2452293 32 NZ_CP013598 Rhizobium sp. N741 plasmid pRspN741c, complete sequence 103164-103195 9 0.719
CP027310_3 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT 2452262-2452293 32 NZ_CP013578 Rhizobium phaseoli strain N671 plasmid pRphaN671d, complete sequence 125386-125417 9 0.719
CP027310_3 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT 2452262-2452293 32 NZ_CP013544 Rhizobium phaseoli strain R620 plasmid pRphaR620b, complete sequence 36015-36046 9 0.719
CP027310_3 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT 2452262-2452293 32 NZ_CP013566 Rhizobium phaseoli strain N831 plasmid pRphaN831c, complete sequence 125777-125808 9 0.719
CP027310_3 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT 2452262-2452293 32 NZ_CP013502 Rhizobium esperanzae strain N561 plasmid pRspN561b, complete sequence 103085-103116 9 0.719
CP027310_3 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT 2452262-2452293 32 NZ_CP013508 Rhizobium sp. N1341 plasmid pRspN1341c, complete sequence 103164-103195 9 0.719
CP027310_3 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT 2452262-2452293 32 NZ_CP013519 Rhizobium sp. N113 plasmid pRspN113b, complete sequence 103163-103194 9 0.719
CP027310_3 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT 2452262-2452293 32 NZ_CP013572 Rhizobium phaseoli strain N771 plasmid pRphaN671d, complete sequence 125386-125417 9 0.719
CP027310_3 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT 2452262-2452293 32 NZ_CP013492 Rhizobium sp. N6212 plasmid pRspN6212b, complete sequence 103161-103192 9 0.719
CP027310_3 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT 2452262-2452293 32 NZ_CP013497 Rhizobium sp. N621 plasmid pRspN621b, complete sequence 103161-103192 9 0.719
CP027310_3 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT 2452262-2452293 32 NZ_CP013592 Rhizobium sp. N871 plasmid pRspN871b, complete sequence 103085-103116 9 0.719
CP027310_3 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT 2452262-2452293 32 CP007643 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803b, complete sequence 92301-92332 9 0.719
CP027310_3 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT 2452262-2452293 32 NC_010996 Rhizobium etli CIAT 652 plasmid pB, complete sequence 100863-100894 9 0.719
CP027310_3 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT 2452262-2452293 32 NZ_CP034999 Rhizobium acidisoli strain FH23 plasmid pRapFH23a, complete sequence 97248-97279 9 0.719
CP027310_2 2.4|2436672|32|CP027310|CRISPRCasFinder,CRT 2436672-2436703 32 NZ_CP038854 Pantoea vagans strain LMG 24199 plasmid unnamed1, complete sequence 450688-450719 10 0.688
CP027310_3 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT 2452262-2452293 32 NZ_CP040452 Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence 1679246-1679277 10 0.688

1. spacer 4.1|3072469|40|CP027310|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 1, identity: 0.975

acagcacagcggggggaatttcaagaatgacccgcagcgc	CRISPR spacer
acagcacagcgggggtaatttcaagaatgacccgcagcgc	Protospacer
*************** ************************

2. spacer 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019314 (Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-2, complete sequence) position: , mismatch: 6, identity: 0.812

ccaccgttttcgcccaccagggcgcacaaccc-	CRISPR spacer
gcaccgttctcgcccaacagggcg-acaatctc	Protospacer
 *******.******* ******* ****.*. 

3. spacer 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781

ccaccgttttcgcccaccagggcgcacaaccc-	CRISPR spacer
ccaccgtcttcgccgaccagggca-acgtcctc	Protospacer
*******.****** ********. **. **. 

4. spacer 3.11|2452384|31|CP027310|CRISPRCasFinder,CRT matches to AP014927 (Ralstonia phage RSF1 DNA, complete genome) position: , mismatch: 8, identity: 0.742

gcgcaccgttgcgtcgaaaaggcgctggaga	CRISPR spacer
cagacccgtttcgtcgaacaggcgctggcgt	Protospacer
  *  ***** ******* ********* * 

5. spacer 2.4|2436672|32|CP027310|CRISPRCasFinder,CRT matches to MK249151 (Blackfly microvirus SF02 isolate 049, complete genome) position: , mismatch: 9, identity: 0.719

cgcgagagccagcaaaacgccagggcacaaaa	CRISPR spacer
gccatgtcccaacaaaacgccagggaacaaat	Protospacer
  *. *  ***.************* ***** 

6. spacer 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020898 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRetBra5b, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

7. spacer 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013555 (Rhizobium phaseoli strain N931 plasmid pRphaN931c, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

8. spacer 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020950 (Rhizobium sp. CIAT894 plasmid pRheCIAT894c, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

9. spacer 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013587 (Rhizobium phaseoli strain N161 plasmid pRphaN161b, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

10. spacer 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
gcaccgttttcgccgatcagggcggtgacctt	Protospacer
 ************* *.*******   * *..

11. spacer 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013598 (Rhizobium sp. N741 plasmid pRspN741c, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

12. spacer 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013578 (Rhizobium phaseoli strain N671 plasmid pRphaN671d, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

13. spacer 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013544 (Rhizobium phaseoli strain R620 plasmid pRphaR620b, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

14. spacer 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013566 (Rhizobium phaseoli strain N831 plasmid pRphaN831c, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

15. spacer 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013502 (Rhizobium esperanzae strain N561 plasmid pRspN561b, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

16. spacer 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013508 (Rhizobium sp. N1341 plasmid pRspN1341c, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

17. spacer 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013519 (Rhizobium sp. N113 plasmid pRspN113b, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

18. spacer 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013572 (Rhizobium phaseoli strain N771 plasmid pRphaN671d, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

19. spacer 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013492 (Rhizobium sp. N6212 plasmid pRspN6212b, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

20. spacer 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013497 (Rhizobium sp. N621 plasmid pRspN621b, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

21. spacer 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013592 (Rhizobium sp. N871 plasmid pRspN871b, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

22. spacer 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT matches to CP007643 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803b, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

23. spacer 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT matches to NC_010996 (Rhizobium etli CIAT 652 plasmid pB, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

24. spacer 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034999 (Rhizobium acidisoli strain FH23 plasmid pRapFH23a, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

25. spacer 2.4|2436672|32|CP027310|CRISPRCasFinder,CRT matches to NZ_CP038854 (Pantoea vagans strain LMG 24199 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

cgcgagagccagcaaaacgccagggcacaaaa	CRISPR spacer
ggaaggagcctgcaaagcgccagggcaccggt	Protospacer
 * ..***** *****.*********** .. 

26. spacer 3.1|2452262|32|CP027310|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040452 (Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
ccaccgtattcgccaaccagggcggcagggaa	Protospacer
******* ****** *********   ..   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage