Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP027486 Staphylococcus aureus strain ST2594 isolate 004 chromosome, complete genome 9 crisprs cas3,DEDDh,DinG,csa3,RT,WYL 6 1 8 0
CP027494 Staphylococcus aureus strain ST2594 isolate 004 plasmid unnamed9 0 crisprs NA 0 0 0 0
CP027496 Staphylococcus aureus strain ST2594 isolate 004 plasmid unnamed1 0 crisprs csa3 0 0 0 0
CP027489 Staphylococcus aureus strain ST2594 isolate 004 plasmid unnamed4 0 crisprs NA 0 0 0 0
CP027493 Staphylococcus aureus strain ST2594 isolate 004 plasmid unnamed8 0 crisprs csa3 0 0 0 0
CP027488 Staphylococcus aureus strain ST2594 isolate 004 plasmid unnamed3 0 crisprs NA 0 0 0 0
CP027491 Staphylococcus aureus strain ST2594 isolate 004 plasmid unnamed6 0 crisprs NA 0 0 0 0
CP027492 Staphylococcus aureus strain ST2594 isolate 004 plasmid unnamed7 0 crisprs NA 0 0 0 0
CP027487 Staphylococcus aureus strain ST2594 isolate 004 plasmid unnamed2 0 crisprs NA 0 0 0 0
CP027495 Staphylococcus aureus strain ST2594 isolate 004 plasmid unnamed10 0 crisprs csa3 0 0 0 0
CP027490 Staphylococcus aureus strain ST2594 isolate 004 plasmid unnamed5 0 crisprs NA 0 0 0 0

Results visualization

1. CP027486
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027486_1 162543-162627 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027486_2 400586-400687 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027486_3 628773-628867 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027486_4 778761-778839 Unclear NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027486_6 827686-827764 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027486_7 1614575-1614659 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027486_8 1649231-1649427 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027486_9 2033633-2033714 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027486_10 2156440-2156520 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP027486_1 1.1|162569|33|CP027486|CRISPRCasFinder 162569-162601 33 CP027486.1 1344508-1344540 0 1.0
CP027486_4 4.1|778785|31|CP027486|CRISPRCasFinder 778785-778815 31 CP027486.1 285382-285412 0 1.0
CP027486_5 5.1|784252|25|CP027486|CRISPRCasFinder 784252-784276 25 CP027486.1 162527-162551 0 1.0
CP027486_5 5.1|784252|25|CP027486|CRISPRCasFinder 784252-784276 25 CP027486.1 285304-285328 0 1.0
CP027486_5 5.1|784252|25|CP027486|CRISPRCasFinder 784252-784276 25 CP027486.1 285414-285438 0 1.0
CP027486_5 5.1|784252|25|CP027486|CRISPRCasFinder 784252-784276 25 CP027486.1 613315-613339 0 1.0
CP027486_5 5.1|784252|25|CP027486|CRISPRCasFinder 784252-784276 25 CP027486.1 736911-736935 0 1.0
CP027486_5 5.1|784252|25|CP027486|CRISPRCasFinder 784252-784276 25 CP027486.1 1344408-1344432 0 1.0
CP027486_5 5.1|784252|25|CP027486|CRISPRCasFinder 784252-784276 25 CP027486.1 1614651-1614675 0 1.0
CP027486_5 5.1|784252|25|CP027486|CRISPRCasFinder 784252-784276 25 CP027486.1 1629182-1629206 0 1.0
CP027486_5 5.1|784252|25|CP027486|CRISPRCasFinder 784252-784276 25 CP027486.1 1931112-1931136 0 1.0
CP027486_9 9.1|2033657|34|CP027486|CRISPRCasFinder 2033657-2033690 34 CP027486.1 778760-778793 0 1.0
CP027486_9 9.1|2033657|34|CP027486|CRISPRCasFinder 2033657-2033690 34 CP027486.1 1133723-1133756 0 1.0
CP027486_1 1.1|162569|33|CP027486|CRISPRCasFinder 162569-162601 33 CP027486.1 827349-827381 1 0.97
CP027486_4 4.1|778785|31|CP027486|CRISPRCasFinder 778785-778815 31 CP027486.1 285327-285357 1 0.968
CP027486_5 5.1|784252|25|CP027486|CRISPRCasFinder 784252-784276 25 CP027486.1 285359-285383 1 0.96
CP027486_5 5.1|784252|25|CP027486|CRISPRCasFinder 784252-784276 25 CP027486.1 827398-827422 1 0.96
CP027486_5 5.1|784252|25|CP027486|CRISPRCasFinder 784252-784276 25 CP027486.1 896394-896418 1 0.96
CP027486_5 5.1|784252|25|CP027486|CRISPRCasFinder 784252-784276 25 CP027486.1 1649212-1649236 1 0.96
CP027486_7 7.1|1614601|33|CP027486|CRISPRCasFinder 1614601-1614633 33 CP027486.1 1344508-1344540 1 0.97
CP027486_1 1.1|162569|33|CP027486|CRISPRCasFinder 162569-162601 33 CP027486.1 1433108-1433140 2 0.939
CP027486_7 7.1|1614601|33|CP027486|CRISPRCasFinder 1614601-1614633 33 CP027486.1 827349-827381 2 0.939
CP027486_8 8.1|1649253|43|CP027486|PILER-CR 1649253-1649295 43 CP027486.1 361848-361890 2 0.953
CP027486_8 8.1|1649253|43|CP027486|PILER-CR 1649253-1649295 43 CP027486.1 1036720-1036762 2 0.953
CP027486_8 8.1|1649253|43|CP027486|PILER-CR 1649253-1649295 43 CP027486.1 1138098-1138140 2 0.953
CP027486_8 8.1|1649253|43|CP027486|PILER-CR 1649253-1649295 43 CP027486.1 1344466-1344508 2 0.953
CP027486_8 8.1|1649253|43|CP027486|PILER-CR 1649253-1649295 43 CP027486.1 1433140-1433182 2 0.953
CP027486_9 9.1|2033657|34|CP027486|CRISPRCasFinder 2033657-2033690 34 CP027486.1 1734857-1734890 2 0.941
CP027486_9 9.1|2033657|34|CP027486|CRISPRCasFinder 2033657-2033690 34 CP027486.1 1348881-1348914 2 0.941
CP027486_9 9.1|2033657|34|CP027486|CRISPRCasFinder 2033657-2033690 34 CP027486.1 2710026-2710059 2 0.941

1. spacer 1.1|162569|33|CP027486|CRISPRCasFinder matches to position: 1344508-1344540, mismatch: 0, identity: 1.0

tgggccccaacaaagagaaattggattcccaat	CRISPR spacer
tgggccccaacaaagagaaattggattcccaat	Protospacer
*********************************

2. spacer 4.1|778785|31|CP027486|CRISPRCasFinder matches to position: 285382-285412, mismatch: 0, identity: 1.0

ctgtgttggggccccgccaacttgcattgcc	CRISPR spacer
ctgtgttggggccccgccaacttgcattgcc	Protospacer
*******************************

3. spacer 5.1|784252|25|CP027486|CRISPRCasFinder matches to position: 162527-162551, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaattc	CRISPR spacer
cctgtagaatttcttttcgaaattc	Protospacer
*************************

4. spacer 5.1|784252|25|CP027486|CRISPRCasFinder matches to position: 285304-285328, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaattc	CRISPR spacer
cctgtagaatttcttttcgaaattc	Protospacer
*************************

5. spacer 5.1|784252|25|CP027486|CRISPRCasFinder matches to position: 285414-285438, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaattc	CRISPR spacer
cctgtagaatttcttttcgaaattc	Protospacer
*************************

6. spacer 5.1|784252|25|CP027486|CRISPRCasFinder matches to position: 613315-613339, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaattc	CRISPR spacer
cctgtagaatttcttttcgaaattc	Protospacer
*************************

7. spacer 5.1|784252|25|CP027486|CRISPRCasFinder matches to position: 736911-736935, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaattc	CRISPR spacer
cctgtagaatttcttttcgaaattc	Protospacer
*************************

8. spacer 5.1|784252|25|CP027486|CRISPRCasFinder matches to position: 1344408-1344432, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaattc	CRISPR spacer
cctgtagaatttcttttcgaaattc	Protospacer
*************************

9. spacer 5.1|784252|25|CP027486|CRISPRCasFinder matches to position: 1614651-1614675, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaattc	CRISPR spacer
cctgtagaatttcttttcgaaattc	Protospacer
*************************

10. spacer 5.1|784252|25|CP027486|CRISPRCasFinder matches to position: 1629182-1629206, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaattc	CRISPR spacer
cctgtagaatttcttttcgaaattc	Protospacer
*************************

11. spacer 5.1|784252|25|CP027486|CRISPRCasFinder matches to position: 1931112-1931136, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaattc	CRISPR spacer
cctgtagaatttcttttcgaaattc	Protospacer
*************************

12. spacer 9.1|2033657|34|CP027486|CRISPRCasFinder matches to position: 778760-778793, mismatch: 0, identity: 1.0

ttgtagaatttcttttcgaaattctctgtgttgg	CRISPR spacer
ttgtagaatttcttttcgaaattctctgtgttgg	Protospacer
**********************************

13. spacer 9.1|2033657|34|CP027486|CRISPRCasFinder matches to position: 1133723-1133756, mismatch: 0, identity: 1.0

ttgtagaatttcttttcgaaattctctgtgttgg	CRISPR spacer
ttgtagaatttcttttcgaaattctctgtgttgg	Protospacer
**********************************

14. spacer 1.1|162569|33|CP027486|CRISPRCasFinder matches to position: 827349-827381, mismatch: 1, identity: 0.97

tgggccccaacaaagagaaattggattcccaat	CRISPR spacer
tgggccccaacaaagagaaattggattctcaat	Protospacer
****************************.****

15. spacer 4.1|778785|31|CP027486|CRISPRCasFinder matches to position: 285327-285357, mismatch: 1, identity: 0.968

ctgtgttggggccccgccaacttgcattgcc	CRISPR spacer
ctgtgttggggccccgccaacttgcattacc	Protospacer
****************************.**

16. spacer 5.1|784252|25|CP027486|CRISPRCasFinder matches to position: 285359-285383, mismatch: 1, identity: 0.96

cctgtagaatttcttttcgaaattc	CRISPR spacer
cctgtagaatttcttttcgaatttc	Protospacer
********************* ***

17. spacer 5.1|784252|25|CP027486|CRISPRCasFinder matches to position: 827398-827422, mismatch: 1, identity: 0.96

cctgtagaatttcttttcgaaattc	CRISPR spacer
cctgcagaatttcttttcgaaattc	Protospacer
****.********************

18. spacer 5.1|784252|25|CP027486|CRISPRCasFinder matches to position: 896394-896418, mismatch: 1, identity: 0.96

cctgtagaatttcttttcgaaattc	CRISPR spacer
cctgtagaatttcttttagaaattc	Protospacer
***************** *******

19. spacer 5.1|784252|25|CP027486|CRISPRCasFinder matches to position: 1649212-1649236, mismatch: 1, identity: 0.96

cctgtagaatttcttttcgaaattc	CRISPR spacer
cctgtagaatttctttacgaaattc	Protospacer
**************** ********

20. spacer 7.1|1614601|33|CP027486|CRISPRCasFinder matches to position: 1344508-1344540, mismatch: 1, identity: 0.97

attgggaatccaatttctctgtgttggggccca	CRISPR spacer
attgggaatccaatttctctttgttggggccca	Protospacer
******************** ************

21. spacer 1.1|162569|33|CP027486|CRISPRCasFinder matches to position: 1433108-1433140, mismatch: 2, identity: 0.939

tgggccccaacaaagagaaattggattcccaat	CRISPR spacer
tggaccccaacaaagagaaattgtattcccaat	Protospacer
***.******************* *********

22. spacer 7.1|1614601|33|CP027486|CRISPRCasFinder matches to position: 827349-827381, mismatch: 2, identity: 0.939

attgggaatccaatttctctgtgttggggccca	CRISPR spacer
attgagaatccaatttctctttgttggggccca	Protospacer
****.*************** ************

23. spacer 8.1|1649253|43|CP027486|PILER-CR matches to position: 361848-361890, mismatch: 2, identity: 0.953

atccccaacttgcacattattgaaagctgacttttggtcagct	CRISPR spacer
atccccaacttgcacattattgtaagctgacttttcgtcagct	Protospacer
********************** ************ *******

24. spacer 8.1|1649253|43|CP027486|PILER-CR matches to position: 1036720-1036762, mismatch: 2, identity: 0.953

atccccaacttgcacattattgaaagctgacttttggtcagct	CRISPR spacer
atccccaacttgcacattattgtaagctgacttttcgtcagct	Protospacer
********************** ************ *******

25. spacer 8.1|1649253|43|CP027486|PILER-CR matches to position: 1138098-1138140, mismatch: 2, identity: 0.953

atccccaacttgcacattattgaaagctgacttttggtcagct	CRISPR spacer
atccccaacttgcacattattgtaagctgacttttcgtcagct	Protospacer
********************** ************ *******

26. spacer 8.1|1649253|43|CP027486|PILER-CR matches to position: 1344466-1344508, mismatch: 2, identity: 0.953

atccccaacttgcacattattgaaagctgacttttggtcagct	CRISPR spacer
atccccaacttgcacattattgtaagctgacttttcgtcagct	Protospacer
********************** ************ *******

27. spacer 8.1|1649253|43|CP027486|PILER-CR matches to position: 1433140-1433182, mismatch: 2, identity: 0.953

atccccaacttgcacattattgaaagctgacttttggtcagct	CRISPR spacer
atccccaacttgcacattattgtaagctgacttttcgtcagct	Protospacer
********************** ************ *******

28. spacer 9.1|2033657|34|CP027486|CRISPRCasFinder matches to position: 1734857-1734890, mismatch: 2, identity: 0.941

ttgtagaatttcttttcgaaattctctgtgttgg	CRISPR spacer
ttgtagaatttcttttcgaaattctttgkgttgg	Protospacer
*************************.** *****

29. spacer 9.1|2033657|34|CP027486|CRISPRCasFinder matches to position: 1348881-1348914, mismatch: 2, identity: 0.941

ttgtagaatttcttttcgaaattctctgtgttgg	CRISPR spacer
ttgtggaatttcttatcgaaattctctgtgttgg	Protospacer
****.********* *******************

30. spacer 9.1|2033657|34|CP027486|CRISPRCasFinder matches to position: 2710026-2710059, mismatch: 2, identity: 0.941

ttgtagaatttcttttcgaaattctctgtgttgg	CRISPR spacer
ttgtagaatttcttttcgaaattctttttgttgg	Protospacer
*************************.* ******

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP027486_11 11.1|2168787|34|CP027486|CRISPRCasFinder 2168787-2168820 34 JN882286 Cronobacter phage vB_CsaP_GAP52, complete genome 23034-23067 8 0.765
CP027486_11 11.1|2168787|34|CP027486|CRISPRCasFinder 2168787-2168820 34 CP030544 Staphylococcus aureus strain ER04166.3 plasmid unnamed2, complete sequence 7567-7600 8 0.765

1. spacer 11.1|2168787|34|CP027486|CRISPRCasFinder matches to JN882286 (Cronobacter phage vB_CsaP_GAP52, complete genome) position: , mismatch: 8, identity: 0.765

ttgcatatctttagctttattgtttgcaactggg	CRISPR spacer
ttgcatatctttagctttatagcttttatatgct	Protospacer
******************** *.** .*  **  

2. spacer 11.1|2168787|34|CP027486|CRISPRCasFinder matches to CP030544 (Staphylococcus aureus strain ER04166.3 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.765

ttgcatatctttagctttattgtttgcaactggg	CRISPR spacer
ttgaataactttagctttattgttataaacagta	Protospacer
*** *** ****************   *** * .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 715989 : 723810 10 Hokovirus(16.67%) NA NA
DBSCAN-SWA_2 735781 : 750366 18 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_3 946380 : 1019315 93 Staphylococcus_phage(77.61%) bacteriocin,capsid,protease,integrase,portal,tail,head,holin,terminase attL 949226:949252|attR 993701:993727
DBSCAN-SWA_4 1038242 : 1046715 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_5 1664485 : 1673528 7 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_6 1787574 : 1859085 66 Staphylococcus_phage(95.65%) protease,tRNA NA
DBSCAN-SWA_7 1865286 : 1869533 6 Staphylococcus_phage(66.67%) NA NA
DBSCAN-SWA_8 1955144 : 2038597 106 Staphylococcus_phage(90.54%) capsid,protease,integrase,portal,tail,head,holin,terminase attL 2004919:2004936|attR 2029737:2029754
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage