Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP021278 Legionella pneumophila subsp. fraseri strain D-4058 plasmid unnamed, complete sequence 0 crisprs NA 0 0 0 0
CP021277 Legionella pneumophila subsp. fraseri strain D-4058 chromosome, complete genome 2 crisprs NA 0 2 0 0

Results visualization

1. CP021277
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP021277_1 200541-201302 Orphan NA
10 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP021277_2 2727444-2727616 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP021277_2 2.2|2727546|40|CP021277|CRISPRCasFinder 2727546-2727585 40 NZ_LR134418 Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 9 257659-257698 1 0.975
CP021277_1 1.9|201159|34|CP021277|CRISPRCasFinder,CRT,PILER-CR 201159-201192 34 NZ_CP016745 Lactococcus lactis subsp. cremoris strain JM2 plasmid pMPJM2, complete sequence 102474-102507 10 0.706
CP021277_1 1.9|201159|34|CP021277|CRISPRCasFinder,CRT,PILER-CR 201159-201192 34 NZ_CP016746 Lactococcus lactis subsp. cremoris strain JM1 plasmid pMPJM1, complete sequence 172093-172126 10 0.706

1. spacer 2.2|2727546|40|CP021277|CRISPRCasFinder matches to NZ_LR134418 (Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 9) position: , mismatch: 1, identity: 0.975

atggtgaattaatgcaaaaaaatgcaataataaatttatt	CRISPR spacer
atggtgaattaatgcaaataaatgcaataataaatttatt	Protospacer
****************** *********************

2. spacer 1.9|201159|34|CP021277|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016745 (Lactococcus lactis subsp. cremoris strain JM2 plasmid pMPJM2, complete sequence) position: , mismatch: 10, identity: 0.706

cggctggtattacaaggatgcaagacacatggat	CRISPR spacer
caaaaataattacaaggaggcaagagacatggct	Protospacer
*..  .  ********** ****** ****** *

3. spacer 1.9|201159|34|CP021277|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016746 (Lactococcus lactis subsp. cremoris strain JM1 plasmid pMPJM1, complete sequence) position: , mismatch: 10, identity: 0.706

cggctggtattacaaggatgcaagacacatggat	CRISPR spacer
caaaaataattacaaggaggcaagagacatggct	Protospacer
*..  .  ********** ****** ****** *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage