Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP020091 Enterobacter cloacae strain PIMB10EC27 plasmid pEC27-2, complete sequence 0 crisprs RT 0 0 1 0
CP020089 Enterobacter cloacae strain PIMB10EC27 chromosome, complete genome 2 crisprs csa3,DEDDh,WYL,DinG,cas1,cas8f,cas5f,cas7f,cas6f,cas3 0 19 8 0
CP020090 Enterobacter cloacae strain PIMB10EC27 plasmid pEC27-1, complete sequence 0 crisprs NA 0 0 1 0

Results visualization

1. CP020091
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3686 : 79295 65 Escherichia_phage(36.0%) transposase,integrase,tRNA attL 41217:41276|attR 75947:76767

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP020089
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP020089_2 1388913-1389029 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP020089_3 1719950-1721839 TypeI-F I-F
31 spacers
cas1,cas8f,cas5f,cas7f,cas6f

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP020089_3 3.6|1720279|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720279-1720310 32 NZ_CP044178 Salmonella enterica subsp. enterica serovar Concord strain AR-0407 plasmid pAR-0407-1 30348-30379 0 1.0
CP020089_3 3.6|1720279|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720279-1720310 32 NZ_LN890526 Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712385 plasmid 3, complete sequence 40713-40744 0 1.0
CP020089_3 3.15|1720820|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720820-1720851 32 MT261384 Salmonella virus PAT1, complete genome 25469-25500 1 0.969
CP020089_3 3.15|1720820|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720820-1720851 32 MT580116 Salmonella phage 65FD, complete genome 17515-17546 1 0.969
CP020089_3 3.15|1720820|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720820-1720851 32 MT580117 Salmonella phage 66FD, complete genome 8353-8384 1 0.969
CP020089_3 3.17|1720940|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720940-1720971 32 NC_004775 Enterobacteria phage epsilon15, complete genome 36161-36192 1 0.969
CP020089_3 3.8|1720399|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720399-1720430 32 BK000583 TPA_inf: Enterobacteria phage P22 wild type, complete genome 5773-5804 2 0.938
CP020089_3 3.8|1720399|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720399-1720430 32 MN161573 UNVERIFIED: Salmonella virus P22 isolate HT105/1 int-201, complete genome 5773-5804 2 0.938
CP020089_3 3.8|1720399|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720399-1720430 32 KU927496 Salmonella phage 101962B_sal5, complete genome 29635-29666 2 0.938
CP020089_3 3.8|1720399|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720399-1720430 32 AB426868 Enterobacteria phage P22 DNA, complete genome, strain: ATCC 19585-B1 5773-5804 2 0.938
CP020089_3 3.8|1720399|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720399-1720430 32 KU927491 Salmonella phage 146851_sal5, complete genome 30402-30433 2 0.938
CP020089_3 3.8|1720399|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720399-1720430 32 KR296686 Salmonella phage 22, complete genome 169-200 2 0.938
CP020089_3 3.8|1720399|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720399-1720430 32 NC_002371 Enterobacteria phage P22 virus, complete genome 5773-5804 2 0.938
CP020089_3 3.8|1720399|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720399-1720430 32 KU927495 Salmonella phage 103203_sal4, complete genome 29898-29929 2 0.938
CP020089_3 3.8|1720399|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720399-1720430 32 KR296688 Salmonella phage 34, complete genome 10349-10380 2 0.938
CP020089_3 3.8|1720399|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720399-1720430 32 M59749 Bacteriophage P22 packaging genes 6060-6091 2 0.938
CP020089_3 3.8|1720399|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720399-1720430 32 KU927498 Salmonella phage 64795_sal4, complete genome 6904-6935 2 0.938
CP020089_3 3.8|1720399|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720399-1720430 32 KU927492 Salmonella phage 146851_sal4, complete genome 6915-6946 2 0.938
CP020089_3 3.8|1720399|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720399-1720430 32 AF217253 Bacteriophage P22 complete genome 29248-29279 2 0.938
CP020089_3 3.8|1720399|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720399-1720430 32 NC_030919 Salmonella phage 118970_sal4, complete genome 29927-29958 2 0.938
CP020089_3 3.8|1720399|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720399-1720430 32 KR296687 Salmonella phage 25, complete genome 10363-10394 2 0.938
CP020089_3 3.8|1720399|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720399-1720430 32 AB362338 Enterobacteria phage P22 DNA, complete sequence, strain: MSU 5773-5804 2 0.938
CP020089_3 3.8|1720399|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720399-1720430 32 GQ422451 Enterobacteria phage Phi75, partial genome 28660-28691 2 0.938
CP020089_3 3.8|1720399|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720399-1720430 32 GQ422450 Enterobacteria phage UAB_Phi20, complete genome 15133-15164 2 0.938
CP020089_3 3.8|1720399|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720399-1720430 32 AF527608 Bacteriophage P22-pbi, complete sequence 5773-5804 2 0.938
CP020089_3 3.8|1720399|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720399-1720430 32 NC_031946 Salmonella Phage 103203_sal5, complete genome 6917-6948 2 0.938
CP020089_3 3.8|1720399|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720399-1720430 32 NC_047875 Salmonella phage UPF_BP1, complete genome 19277-19308 2 0.938
CP020089_3 3.8|1720399|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720399-1720430 32 MT932212 Salmonella phage VSe13, complete genome 6051-6082 2 0.938
CP020089_3 3.15|1720820|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720820-1720851 32 KC911857 Salmonella phage SPC32N, complete genome 1313-1344 2 0.938
CP020089_3 3.15|1720820|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720820-1720851 32 KC911856 Salmonella phage SPC32H, complete genome 1313-1344 2 0.938
CP020089_3 3.15|1720820|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720820-1720851 32 NC_016761 Salmonella phage SPN1S, complete genome 1342-1373 2 0.938
CP020089_3 3.15|1720820|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720820-1720851 32 JQ691610 Salmonella phage SPN9TCW, complete genome 1342-1373 2 0.938
CP020089_3 3.20|1721120|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1721120-1721151 32 HQ201308 Cronobacter phage ENT47670, complete genome 47397-47428 2 0.938
CP020089_3 3.15|1720820|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720820-1720851 32 NZ_CP014649 Klebsiella pneumoniae strain KPNIH36 plasmid pKPN-fff, complete sequence 49276-49307 3 0.906
CP020089_3 3.15|1720820|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720820-1720851 32 NC_021654 Klebsiella pneumoniae plasmid pKN-LS6, complete sequence 192095-192126 3 0.906
CP020089_3 3.15|1720820|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720820-1720851 32 NZ_CP007729 Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKPN-498, complete sequence 156669-156700 3 0.906
CP020089_3 3.15|1720820|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720820-1720851 32 NZ_CP037929 Klebsiella pneumoniae subsp. pneumoniae strain KP-8788 plasmid pKPN-IT-8788, complete sequence 253224-253255 3 0.906
CP020089_3 3.15|1720820|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720820-1720851 32 MN922301 Klebsiella pneumoniae strain KP-14159 plasmid pKPN-IT-14159, complete sequence 253224-253255 3 0.906
CP020089_3 3.15|1720820|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720820-1720851 32 MK416010 Klebsiella phage ST11-OXA245phi3.2, complete genome 28757-28788 3 0.906
CP020089_3 3.15|1720820|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720820-1720851 32 MK422448 Klebsiella phage ST512-KPC3phi13.3, complete genome 32442-32473 3 0.906
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 CP053324 Salmonella enterica subsp. salamae serovar 40:c:e,n,z15 strain 2013K-0524 plasmid unnamed, complete sequence 35882-35913 3 0.906
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 NC_004313 Salmonella phage ST64B, complete genome 24465-24496 3 0.906
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 NC_006949 Enterobacteria phage ES18, complete genome 30384-30415 3 0.906
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 CP051275 Salmonella phage SW-37, complete genome 22867-22898 3 0.906
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 JQ288021 Salmonella phage SPN3UB, complete genome 37694-37725 3 0.906
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 AY736146 Salmonella typhimurium bacteriophage ES18, complete sequence 30384-30415 3 0.906
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 AY055382 Salmonella typhimurium phage ST64B complete sequence 24465-24496 3 0.906
CP020089_4 4.1|1799803|38|CP020089|CRISPRCasFinder 1799803-1799840 38 AJ298298 Bacteriophage P27 complete genome 10703-10740 3 0.921
CP020089_4 4.1|1799803|38|CP020089|CRISPRCasFinder 1799803-1799840 38 NC_003356 Enterobacteria phage phiP27, complete genome 10703-10740 3 0.921
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 NZ_KP763470 Salmonella enterica subsp. enterica serovar Typhimurium strain L946 plasmid pSTM_Phi, complete sequence 45654-45685 4 0.875
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 BK000583 TPA_inf: Enterobacteria phage P22 wild type, complete genome 25469-25500 4 0.875
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 MN161573 UNVERIFIED: Salmonella virus P22 isolate HT105/1 int-201, complete genome 25469-25500 4 0.875
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 AB426868 Enterobacteria phage P22 DNA, complete genome, strain: ATCC 19585-B1 25406-25437 4 0.875
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 JQ182733 Enterobacterial phage mEp213, complete genome 26421-26452 4 0.875
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 KR296686 Salmonella phage 22, complete genome 22180-22211 4 0.875
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 L06296 Bacteriophage P22 eaA - eaI genes, complete cds 4158-4189 4 0.875
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 NC_002371 Enterobacteria phage P22 virus, complete genome 25469-25500 4 0.875
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 KR296688 Salmonella phage 34, complete genome 32369-32400 4 0.875
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 AF217253 Bacteriophage P22 complete genome 7220-7251 4 0.875
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 KR296687 Salmonella phage 25, complete genome 32376-32407 4 0.875
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 AB362338 Enterobacteria phage P22 DNA, complete sequence, strain: MSU 25406-25437 4 0.875
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 MN856003 Bacteriophage sp. isolate 1, complete genome 31820-31851 4 0.875
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 NC_019706 Enterobacteria phage mEp043 c-1, complete genome 26421-26452 4 0.875
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 AF527608 Bacteriophage P22-pbi, complete sequence 25469-25500 4 0.875
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 EU570103 Salmonella phage epsilon34, complete genome 25168-25199 4 0.875
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 NC_047875 Salmonella phage UPF_BP1, complete genome 36129-36160 4 0.875
CP020089_3 3.1|1719978|33|CP020089|PILER-CR,CRISPRCasFinder,CRT 1719978-1720010 33 MG945491 UNVERIFIED: Microviridae sp. isolate 1258-1602, complete genome 2084-2116 5 0.848
CP020089_3 3.1|1719978|33|CP020089|PILER-CR,CRISPRCasFinder,CRT 1719978-1720010 33 MH572345 Microviridae sp. isolate SD_SC_53, complete genome 236-268 5 0.848
CP020089_3 3.18|1721000|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1721000-1721031 32 NZ_CP042999 Aquisphaera giovannonii strain OJF2 plasmid pOJF2_2, complete sequence 17709-17740 5 0.844
CP020089_3 3.24|1721360|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1721360-1721391 32 HQ201308 Cronobacter phage ENT47670, complete genome 46212-46243 5 0.844
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 CP053410 Salmonella enterica strain 2014K-0203 plasmid unnamed, complete sequence 45487-45518 5 0.844
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 NZ_CP054718 Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence 12195-12226 5 0.844
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 NZ_CP054718 Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence 36929-36960 5 0.844
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 NZ_CP054718 Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence 116168-116199 5 0.844
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 NC_031077 Enterobacter phage Tyrion, complete genome 39917-39948 5 0.844
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 NZ_CP039495 Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000669 plasmid pCFSAN000669_2, complete sequence 16647-16678 5 0.844
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 MW013502 Salmonella virus L cI-40 13-am43, complete genome 24969-25000 5 0.844
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 NC_004348 Enterobacteria phage ST64T, complete genome 8156-8187 5 0.844
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 MW013503 Salmonella virus L cII-101, complete genome 24969-25000 5 0.844
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 NC_010393 Phage Gifsy-2, complete genome 10147-10178 5 0.844
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 NC_010392 Phage Gifsy-1, complete genome 38172-38203 5 0.844
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 NC_018275 Salmonella phage vB_SemP_Emek, complete genome 25135-25166 5 0.844
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 AY052766 Salmonella typhimurium bacteriophage ST64T, complete genome 8156-8187 5 0.844
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 MF188997 Salmonella phage vB_SalP_PM43, complete genome 8155-8186 5 0.844
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 NC_004775 Enterobacteria phage epsilon15, complete genome 37198-37229 5 0.844
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 KJ832078 Enterobacteria phage Sf101, complete genome 20979-21010 5 0.844
CP020089_1 1.1|800911|30|CP020089|CRISPRCasFinder 800911-800940 30 NZ_CP017753 Cupriavidus sp. USMAHM13 plasmid unnamed1, complete sequence 49531-49560 6 0.8
CP020089_1 1.1|800911|30|CP020089|CRISPRCasFinder 800911-800940 30 NZ_CP017750 Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence 436076-436105 6 0.8
CP020089_1 1.1|800911|30|CP020089|CRISPRCasFinder 800911-800940 30 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 1386373-1386402 6 0.8
CP020089_3 3.18|1721000|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1721000-1721031 32 NC_041927 Sphingobium phage Lacusarx, complete genome 102311-102342 6 0.812
CP020089_3 3.23|1721300|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1721300-1721331 32 NC_020548 Azoarcus sp. KH32C plasmid pAZKH, complete sequence 511832-511863 6 0.812
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 MT774487 Salmonella phage MG40, complete genome 22947-22978 6 0.812
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 NC_016158 Escherichia phage HK639, complete genome 41038-41069 6 0.812
CP020089_1 1.1|800911|30|CP020089|CRISPRCasFinder 800911-800940 30 NZ_CP013600 Rhizobium sp. N741 plasmid pRspN741e, complete sequence 737346-737375 7 0.767
CP020089_1 1.1|800911|30|CP020089|CRISPRCasFinder 800911-800940 30 NZ_CP013504 Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence 737376-737405 7 0.767
CP020089_1 1.1|800911|30|CP020089|CRISPRCasFinder 800911-800940 30 NZ_CP013510 Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence 735787-735816 7 0.767
CP020089_1 1.1|800911|30|CP020089|CRISPRCasFinder 800911-800940 30 NZ_CP013521 Rhizobium sp. N113 plasmid pRspN113d, complete sequence 740034-740063 7 0.767
CP020089_1 1.1|800911|30|CP020089|CRISPRCasFinder 800911-800940 30 NZ_CP013494 Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence 726935-726964 7 0.767
CP020089_1 1.1|800911|30|CP020089|CRISPRCasFinder 800911-800940 30 NZ_CP013594 Rhizobium sp. N871 plasmid pRspN871d, complete sequence 737376-737405 7 0.767
CP020089_1 1.2|800965|30|CP020089|CRISPRCasFinder 800965-800994 30 CP052797 Salmonella enterica subsp. enterica serovar Infantis strain CVM N18S2039 plasmid pN18S2039, complete sequence 63456-63485 7 0.767
CP020089_1 1.2|800965|30|CP020089|CRISPRCasFinder 800965-800994 30 CP052804 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S973 plasmid pN17S0973, complete sequence 12622-12651 7 0.767
CP020089_1 1.2|800965|30|CP020089|CRISPRCasFinder 800965-800994 30 CP038508 Salmonella enterica subsp. enterica serovar Infantis strain FARPER-219 plasmid p-F219, complete sequence 129996-130025 7 0.767
CP020089_1 1.2|800965|30|CP020089|CRISPRCasFinder 800965-800994 30 CP052788 Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0611 plasmid pN19S0611, complete sequence 221022-221051 7 0.767
CP020089_1 1.2|800965|30|CP020089|CRISPRCasFinder 800965-800994 30 CP052786 Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0641 plasmid pN19S0641, complete sequence 232950-232979 7 0.767
CP020089_1 1.2|800965|30|CP020089|CRISPRCasFinder 800965-800994 30 CP052838 Salmonella enterica subsp. enterica serovar Infantis strain CVM N16S097 plasmid pN16S097, complete sequence 231525-231554 7 0.767
CP020089_1 1.2|800965|30|CP020089|CRISPRCasFinder 800965-800994 30 NZ_CP028316 Salmonella enterica subsp. enterica serovar Typhimurium var. 5- strain CFSAN067217 plasmid pSC-31-2, complete sequence 128630-128659 7 0.767
CP020089_1 1.2|800965|30|CP020089|CRISPRCasFinder 800965-800994 30 CP051676 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1234 plasmid pN16S1234, complete sequence 101317-101346 7 0.767
CP020089_1 1.2|800965|30|CP020089|CRISPRCasFinder 800965-800994 30 NZ_CP022063 Salmonella enterica strain FDAARGOS_312 plasmid unnamed3, complete sequence 84260-84289 7 0.767
CP020089_1 1.2|800965|30|CP020089|CRISPRCasFinder 800965-800994 30 CP052781 Salmonella enterica strain CVM N19S0949 plasmid pN19S0949, complete sequence 187128-187157 7 0.767
CP020089_1 1.2|800965|30|CP020089|CRISPRCasFinder 800965-800994 30 CP052834 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S041 plasmid pN17S0041, complete sequence 24105-24134 7 0.767
CP020089_1 1.2|800965|30|CP020089|CRISPRCasFinder 800965-800994 30 CP052793 Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0388 plasmid pN19S0388, complete sequence 43406-43435 7 0.767
CP020089_1 1.2|800965|30|CP020089|CRISPRCasFinder 800965-800994 30 CP052832 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1040 plasmid pN17S1040, complete sequence 178361-178390 7 0.767
CP020089_1 1.2|800965|30|CP020089|CRISPRCasFinder 800965-800994 30 CP052830 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1105 plasmid pN17S1105, complete sequence 211357-211386 7 0.767
CP020089_1 1.2|800965|30|CP020089|CRISPRCasFinder 800965-800994 30 NZ_CP022662 Salmonella enterica subsp. enterica strain RM11065 plasmid pRM11065-2, complete sequence 73314-73343 7 0.767
CP020089_1 1.2|800965|30|CP020089|CRISPRCasFinder 800965-800994 30 CP052812 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S376 plasmid pN17S0376, complete sequence 19319-19348 7 0.767
CP020089_1 1.2|800965|30|CP020089|CRISPRCasFinder 800965-800994 30 CP052810 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S535 plasmid pN17S0535, complete sequence 230399-230428 7 0.767
CP020089_1 1.2|800965|30|CP020089|CRISPRCasFinder 800965-800994 30 CP052808 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S637 plasmid pN17S0637, complete sequence 11111-11140 7 0.767
CP020089_1 1.2|800965|30|CP020089|CRISPRCasFinder 800965-800994 30 CP052806 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S816 plasmid pN17S0816, complete sequence 182227-182256 7 0.767
CP020089_1 1.2|800965|30|CP020089|CRISPRCasFinder 800965-800994 30 CP052791 Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0552 plasmid pN17S0637, complete sequence 185722-185751 7 0.767
CP020089_1 1.2|800965|30|CP020089|CRISPRCasFinder 800965-800994 30 CP052818 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1509 plasmid pN17S1509, complete sequence 208172-208201 7 0.767
CP020089_1 1.2|800965|30|CP020089|CRISPRCasFinder 800965-800994 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1688442-1688471 7 0.767
CP020089_1 1.2|800965|30|CP020089|CRISPRCasFinder 800965-800994 30 CP052799 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S990 plasmid pN17S0990-1, complete sequence 24105-24134 7 0.767
CP020089_1 1.2|800965|30|CP020089|CRISPRCasFinder 800965-800994 30 CP052795 Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0125 plasmid pN19S0125, complete sequence 264943-264972 7 0.767
CP020089_1 1.2|800965|30|CP020089|CRISPRCasFinder 800965-800994 30 NZ_CP047882 Salmonella enterica subsp. enterica serovar Infantis strain 119944 plasmid pESI, complete sequence 77271-77300 7 0.767
CP020089_1 1.2|800965|30|CP020089|CRISPRCasFinder 800965-800994 30 CP052802 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S976 plasmid pN17S0976, complete sequence 298048-298077 7 0.767
CP020089_1 1.2|800965|30|CP020089|CRISPRCasFinder 800965-800994 30 CP052840 Salmonella enterica subsp. enterica serovar Infantis strain CVM N16S024 plasmid pN16S024, complete sequence 110008-110037 7 0.767
CP020089_1 1.2|800965|30|CP020089|CRISPRCasFinder 800965-800994 30 CP052783 Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0679 plasmid pN19S0679-1, complete sequence 176473-176502 7 0.767
CP020089_1 1.2|800965|30|CP020089|CRISPRCasFinder 800965-800994 30 CP052836 Salmonella enterica subsp. enterica serovar Infantis strain CVM N16S103 plasmid pN16S103, complete sequence 764-793 7 0.767
CP020089_1 1.2|800965|30|CP020089|CRISPRCasFinder 800965-800994 30 CP052779 Salmonella enterica strain 19TN07GT06K-S plasmid pN19S1233, complete sequence 122769-122798 7 0.767
CP020089_1 1.2|800965|30|CP020089|CRISPRCasFinder 800965-800994 30 NZ_CP031362 Salmonella enterica subsp. enterica serovar Heidelberg strain 5 plasmid p3, complete sequence 123173-123202 7 0.767
CP020089_1 1.2|800965|30|CP020089|CRISPRCasFinder 800965-800994 30 CP052828 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1126 plasmid pN17S1126, complete sequence 109328-109357 7 0.767
CP020089_1 1.2|800965|30|CP020089|CRISPRCasFinder 800965-800994 30 CP052826 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1245 plasmid pN17S0637, complete sequence 93338-93367 7 0.767
CP020089_1 1.2|800965|30|CP020089|CRISPRCasFinder 800965-800994 30 NZ_CP016409 Salmonella enterica subsp. enterica serovar Infantis strain FSIS1502916 plasmid pFSIS1502916, complete sequence 77270-77299 7 0.767
CP020089_1 1.2|800965|30|CP020089|CRISPRCasFinder 800965-800994 30 CP052824 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1265 plasmid pN17S1265, complete sequence 73851-73880 7 0.767
CP020089_1 1.2|800965|30|CP020089|CRISPRCasFinder 800965-800994 30 CP052822 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1349 plasmid pN17S1349, complete sequence 93338-93367 7 0.767
CP020089_1 1.2|800965|30|CP020089|CRISPRCasFinder 800965-800994 30 NZ_CP016407 Salmonella enterica subsp. enterica serovar Infantis strain FSIS1502169 plasmid pFSIS1502169, complete sequence 77270-77299 7 0.767
CP020089_1 1.2|800965|30|CP020089|CRISPRCasFinder 800965-800994 30 CP052820 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1442 plasmid pN17S1442, complete sequence 77270-77299 7 0.767
CP020089_1 1.2|800965|30|CP020089|CRISPRCasFinder 800965-800994 30 NZ_CP016413 Salmonella enterica subsp. enterica serovar Infantis strain CVM44454 plasmid pCVM44454, complete sequence 77270-77299 7 0.767
CP020089_1 1.2|800965|30|CP020089|CRISPRCasFinder 800965-800994 30 NZ_CP016411 Salmonella enterica subsp. enterica serovar Infantis strain N55391 plasmid pN55391, complete sequence 77270-77299 7 0.767
CP020089_1 1.2|800965|30|CP020089|CRISPRCasFinder 800965-800994 30 CP052816 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1598 plasmid pN17S1598 147671-147700 7 0.767
CP020089_1 1.2|800965|30|CP020089|CRISPRCasFinder 800965-800994 30 CP052814 Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S349 plasmid pN17S0349, complete sequence 81463-81492 7 0.767
CP020089_3 3.13|1720700|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720700-1720731 32 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 1054486-1054517 7 0.781
CP020089_3 3.15|1720820|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720820-1720851 32 NZ_CP026561 Pseudomonas amygdali pv. morsprunorum strain R15244 plasmid p4_tig6, complete sequence 853-884 7 0.781
CP020089_3 3.15|1720820|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720820-1720851 32 NZ_LT222315 Pseudomonas cerasi isolate Sour cherry (Prunus cerasus) symptomatic leaf plasmid p58T3 5760-5791 7 0.781
CP020089_3 3.15|1720820|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720820-1720851 32 NZ_LT222315 Pseudomonas cerasi isolate Sour cherry (Prunus cerasus) symptomatic leaf plasmid p58T3 71377-71408 7 0.781
CP020089_3 3.15|1720820|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720820-1720851 32 NZ_LT963397 Pseudomonas cerasi isolate PL963 plasmid PP2, complete sequence 119956-119987 7 0.781
CP020089_3 3.18|1721000|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1721000-1721031 32 NZ_CP047896 Sphingomonas sp. C33 plasmid pC33, complete sequence 58639-58670 7 0.781
CP020089_3 3.18|1721000|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1721000-1721031 32 NZ_CP006369 Aureimonas sp. AU20 plasmid pAU20b, complete sequence 203867-203898 7 0.781
CP020089_3 3.18|1721000|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1721000-1721031 32 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 416621-416652 7 0.781
CP020089_3 3.18|1721000|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1721000-1721031 32 NZ_CP022365 Azospirillum sp. TSH58 plasmid TSH58_p06, complete sequence 59038-59069 7 0.781
CP020089_3 3.18|1721000|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1721000-1721031 32 NZ_CP031116 Rubrobacter indicoceani strain SCSIO 08198 plasmid unnamed1, complete sequence 131490-131521 7 0.781
CP020089_3 3.18|1721000|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1721000-1721031 32 NZ_CP011808 Pandoraea faecigallinarum strain DSM 23572 plasmid pPF72-1, complete sequence 51175-51206 7 0.781
CP020089_3 3.18|1721000|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1721000-1721031 32 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 1277910-1277941 7 0.781
CP020089_3 3.18|1721000|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1721000-1721031 32 CP006880 Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence 353684-353715 7 0.781
CP020089_3 3.20|1721120|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1721120-1721151 32 NZ_CP021084 Deinococcus ficus strain CC-FR2-10 plasmid pDFI3, complete sequence 33354-33385 7 0.781
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 NZ_KY515226 Salmonella enterica subsp. enterica serovar Derby strain S701 plasmid AnCo3, complete sequence 62056-62087 7 0.781
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 JQ806764 Salmonella phage vB_SosS_Oslo, complete genome 29928-29959 7 0.781
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 MH370364 Salmonella phage S107, complete genome 31936-31967 7 0.781
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 MH370382 Salmonella phage S135, complete genome 31936-31967 7 0.781
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 MH370383 Salmonella phage S137, complete genome 31936-31967 7 0.781
CP020089_1 1.1|800911|30|CP020089|CRISPRCasFinder 800911-800940 30 NC_022049 Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence 341179-341208 8 0.733
CP020089_1 1.2|800965|30|CP020089|CRISPRCasFinder 800965-800994 30 KP881232 Sinorhizobium phage phiM9, complete genome 86166-86195 8 0.733
CP020089_3 3.3|1720099|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720099-1720130 32 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 637094-637125 8 0.75
CP020089_3 3.3|1720099|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720099-1720130 32 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 495916-495947 8 0.75
CP020089_3 3.6|1720279|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720279-1720310 32 NZ_CP050092 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence 258097-258128 8 0.75
CP020089_3 3.13|1720700|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720700-1720731 32 NZ_CP015231 Epibacterium mobile F1926 plasmid unnamed1, complete sequence 886856-886887 8 0.75
CP020089_3 3.13|1720700|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720700-1720731 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4550221-4550252 8 0.75
CP020089_3 3.13|1720700|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720700-1720731 32 NZ_CP044329 Methylocystis rosea strain BRCS1 plasmid unnamed1, complete sequence 30237-30268 8 0.75
CP020089_3 3.18|1721000|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1721000-1721031 32 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 622934-622965 8 0.75
CP020089_3 3.18|1721000|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1721000-1721031 32 NZ_CP049906 Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence 127992-128023 8 0.75
CP020089_3 3.18|1721000|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1721000-1721031 32 MT723940 Mycobacterium phage Ellie, complete genome 57246-57277 8 0.75
CP020089_3 3.18|1721000|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1721000-1721031 32 NZ_CP018821 Sphingomonas koreensis strain ABOJV plasmid tig00000001, complete sequence 50538-50569 8 0.75
CP020089_3 3.18|1721000|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1721000-1721031 32 NZ_LR594690 Variovorax sp. WDL1 plasmid 2 518667-518698 8 0.75
CP020089_3 3.18|1721000|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1721000-1721031 32 NZ_LR594663 Variovorax sp. RA8 plasmid 2 176859-176890 8 0.75
CP020089_3 3.20|1721120|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1721120-1721151 32 NZ_CP049751 Rhodococcus fascians A21d2 plasmid unnamed2, complete sequence 3977-4008 8 0.75
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 KJ019098 Synechococcus phage ACG-2014f isolate Syn7803US39, complete genome 58224-58255 8 0.75
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 KJ019152 Synechococcus phage ACG-2014f isolate Syn7803C25, complete genome 56396-56427 8 0.75
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 KJ019150 Synechococcus phage ACG-2014f isolate Syn7803C22, complete genome 58346-58377 8 0.75
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 KJ019037 Synechococcus phage ACG-2014f isolate Syn7803C58, complete genome 57668-57699 8 0.75
CP020089_1 1.1|800911|30|CP020089|CRISPRCasFinder 800911-800940 30 MF417874 Uncultured Caudovirales phage clone 3S_14, partial genome 5991-6020 9 0.7
CP020089_1 1.1|800911|30|CP020089|CRISPRCasFinder 800911-800940 30 NZ_CP049244 Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence 707379-707408 9 0.7
CP020089_3 3.3|1720099|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720099-1720130 32 CP000662 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 453528-453559 9 0.719
CP020089_3 3.6|1720279|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720279-1720310 32 NZ_CP018230 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence 335972-336003 9 0.719
CP020089_3 3.9|1720459|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720459-1720490 32 KY962008 Escherichia phage ST31, complete genome 13450-13481 9 0.719
CP020089_3 3.9|1720459|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720459-1720490 32 NC_023576 Citrobacter phage CR44b complete genome 13571-13602 9 0.719
CP020089_3 3.9|1720459|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720459-1720490 32 MT446393 UNVERIFIED: Escherichia virus TH16, complete genome 31963-31994 9 0.719
CP020089_3 3.9|1720459|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720459-1720490 32 MT350292 Enterococcus phage EFA-1, complete genome 15217-15248 9 0.719
CP020089_3 3.9|1720459|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720459-1720490 32 MT862763 Escherichia phage vB_EcoP-U8, complete genome 33483-33514 9 0.719
CP020089_3 3.10|1720519|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720519-1720550 32 NZ_CP019022 Escherichia coli strain Ecol_881 plasmid pEC881_7, complete sequence 1497-1528 9 0.719
CP020089_3 3.13|1720700|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720700-1720731 32 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 409818-409849 9 0.719
CP020089_3 3.18|1721000|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1721000-1721031 32 NZ_CP022999 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence 1200710-1200741 9 0.719
CP020089_3 3.18|1721000|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1721000-1721031 32 NZ_CP013072 Sphingobium indicum B90A plasmid pSRL2, complete sequence 71943-71974 9 0.719
CP020089_3 3.18|1721000|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1721000-1721031 32 NZ_CP013454 Burkholderia vietnamiensis strain MSMB608WGS plasmid pMSMB608, complete sequence 64720-64751 9 0.719
CP020089_3 3.18|1721000|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1721000-1721031 32 NZ_CP016354 Prauserella marina strain DSM 45268 plasmid pPmarDSM45268, complete sequence 92529-92560 9 0.719
CP020089_3 3.18|1721000|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1721000-1721031 32 NZ_CP011665 Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence 349858-349889 9 0.719
CP020089_3 3.18|1721000|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1721000-1721031 32 NZ_CP029359 Azospirillum sp. CFH 70021 plasmid unnamed4 32813-32844 9 0.719
CP020089_3 3.18|1721000|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1721000-1721031 32 NZ_CP029359 Azospirillum sp. CFH 70021 plasmid unnamed4 51966-51997 9 0.719
CP020089_3 3.18|1721000|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1721000-1721031 32 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 2179284-2179315 9 0.719
CP020089_3 3.23|1721300|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1721300-1721331 32 MN586021 Arthrobacter phage Beagle, complete genome 4883-4914 9 0.719
CP020089_3 3.23|1721300|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1721300-1721331 32 MT889394 Arthrobacter phage Odyssey395, complete genome 5081-5112 9 0.719
CP020089_3 3.24|1721360|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1721360-1721391 32 NZ_CP020897 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5a, complete sequence 249596-249627 9 0.719
CP020089_3 3.24|1721360|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1721360-1721391 32 NZ_CP013524 Rhizobium phaseoli strain R744 plasmid pRphaR744b, complete sequence 330834-330865 9 0.719
CP020089_3 3.24|1721360|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1721360-1721391 32 NZ_CP013553 Rhizobium phaseoli strain N931 plasmid pRphaN931a, complete sequence 328065-328096 9 0.719
CP020089_3 3.24|1721360|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1721360-1721391 32 NZ_CP013586 Rhizobium phaseoli strain N161 plasmid pRphaN161a, complete sequence 342123-342154 9 0.719
CP020089_3 3.24|1721360|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1721360-1721391 32 NZ_CP013559 Rhizobium phaseoli strain N841 plasmid pRphaN841b, complete sequence 338786-338817 9 0.719
CP020089_3 3.24|1721360|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1721360-1721391 32 NZ_CP013576 Rhizobium phaseoli strain N671 plasmid pRphaN671b, complete sequence 339567-339598 9 0.719
CP020089_3 3.24|1721360|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1721360-1721391 32 NZ_CP013548 Rhizobium phaseoli strain R611 plasmid pRetR611a, complete sequence 339563-339594 9 0.719
CP020089_3 3.24|1721360|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1721360-1721391 32 NZ_CP013528 Rhizobium phaseoli strain R723 plasmid pRphaR723a, complete sequence 337227-337258 9 0.719
CP020089_3 3.24|1721360|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1721360-1721391 32 NZ_CP013533 Rhizobium phaseoli strain R650 plasmid pRphaR650a, complete sequence 339563-339594 9 0.719
CP020089_3 3.24|1721360|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1721360-1721391 32 NZ_CP013538 Rhizobium phaseoli strain R630 plasmid pRphaR630a, complete sequence 332276-332307 9 0.719
CP020089_3 3.24|1721360|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1721360-1721391 32 NZ_CP013543 Rhizobium phaseoli strain R620 plasmid pRphaR620a, complete sequence 343823-343854 9 0.719
CP020089_3 3.24|1721360|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1721360-1721391 32 NZ_CP013564 Rhizobium phaseoli strain N831 plasmid pRphaN831a, complete sequence 328065-328096 9 0.719
CP020089_3 3.24|1721360|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1721360-1721391 32 NZ_CP013581 Rhizobium phaseoli strain N261 plasmid pRphaN261a, complete sequence 337230-337261 9 0.719
CP020089_3 3.24|1721360|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1721360-1721391 32 NZ_CP013570 Rhizobium phaseoli strain N771 plasmid pRphaN771b, complete sequence 339567-339598 9 0.719
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 231801-231832 9 0.719
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 KJ019095 Synechococcus phage ACG-2014f isolate Syn7803US34, complete genome 57907-57938 9 0.719
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 KJ019107 Synechococcus phage ACG-2014f isolate Syn7803US52, complete genome 53863-53894 9 0.719
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 KJ019142 Synechococcus phage ACG-2014f isolate Syn7803C11, complete genome 53657-53688 9 0.719
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 KJ019111 Synechococcus phage ACG-2014f isolate Syn7803US57, complete genome 53677-53708 9 0.719
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 KJ019155 Synechococcus phage ACG-2014f isolate Syn7803C29, complete genome 53644-53675 9 0.719
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 KJ019085 Synechococcus phage ACG-2014f isolate Syn7803US13, complete genome 53475-53506 9 0.719
CP020089_3 3.6|1720279|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720279-1720310 32 MK448803 Streptococcus phage Javan551, complete genome 4692-4723 10 0.688
CP020089_3 3.6|1720279|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720279-1720310 32 MK448981 Streptococcus phage Javan548, complete genome 4692-4723 10 0.688
CP020089_3 3.6|1720279|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720279-1720310 32 KC348598 Streptococcus phage phi20c, complete genome 28703-28734 10 0.688
CP020089_3 3.13|1720700|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720700-1720731 32 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 376815-376846 10 0.688
CP020089_3 3.18|1721000|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1721000-1721031 32 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1849639-1849670 10 0.688
CP020089_3 3.20|1721120|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1721120-1721151 32 KJ829260 Mycobacterium phage YungJamal, complete genome 2767-2798 10 0.688
CP020089_3 3.31|1721780|32|CP020089|CRISPRCasFinder 1721780-1721811 32 NZ_CP010024 Paraburkholderia fungorum strain ATCC BAA-463 plasmid pBIL, complete sequence 204907-204938 10 0.688
CP020089_3 3.16|1720880|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1720880-1720911 32 MN047793 Xanthomonas phage Xoo-sp13, complete genome 42723-42754 11 0.656
CP020089_3 3.18|1721000|32|CP020089|PILER-CR,CRISPRCasFinder,CRT 1721000-1721031 32 NZ_CP028970 Aminobacter sp. MSH1 plasmid pUSP2, complete sequence 301866-301897 11 0.656
CP020089_3 3.30|1721720|32|CP020089|CRISPRCasFinder,CRT 1721720-1721751 32 NC_010009 Bacillus megaterium QM B1551 plasmid pBM200, complete sequence 3412-3443 11 0.656

1. spacer 3.6|1720279|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044178 (Salmonella enterica subsp. enterica serovar Concord strain AR-0407 plasmid pAR-0407-1) position: , mismatch: 0, identity: 1.0 

atgctggaaaggaaggctggcagaaatgcagt	CRISPR spacer
atgctggaaaggaaggctggcagaaatgcagt	Protospacer
********************************

2. spacer 3.6|1720279|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LN890526 (Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712385 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0 

atgctggaaaggaaggctggcagaaatgcagt	CRISPR spacer
atgctggaaaggaaggctggcagaaatgcagt	Protospacer
********************************

3. spacer 3.15|1720820|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to MT261384 (Salmonella virus PAT1, complete genome) position: , mismatch: 1, identity: 0.969 

gcaaatacaagcaccgctggaagtgtgcgcag	CRISPR spacer
gcaaatacaaacaccgctggaagtgtgcgcag	Protospacer
**********.*********************

4. spacer 3.15|1720820|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to MT580116 (Salmonella phage 65FD, complete genome) position: , mismatch: 1, identity: 0.969 

gcaaatacaagcaccgctggaagtgtgcgcag	CRISPR spacer
gcaaatacaaacaccgctggaagtgtgcgcag	Protospacer
**********.*********************

5. spacer 3.15|1720820|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to MT580117 (Salmonella phage 66FD, complete genome) position: , mismatch: 1, identity: 0.969 

gcaaatacaagcaccgctggaagtgtgcgcag	CRISPR spacer
gcaaatacaaacaccgctggaagtgtgcgcag	Protospacer
**********.*********************

6. spacer 3.17|1720940|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NC_004775 (Enterobacteria phage epsilon15, complete genome) position: , mismatch: 1, identity: 0.969 

ctgccctgacattgcaccgacctgctcaaggt	CRISPR spacer
ctgccctggcattgcaccgacctgctcaaggt	Protospacer
********.***********************

7. spacer 3.8|1720399|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to BK000583 (TPA_inf: Enterobacteria phage P22 wild type, complete genome) position: , mismatch: 2, identity: 0.938 

agcgaggtgttcacgttggcgtatgcacgctg	CRISPR spacer
agcgaggtgttaacgttggcgtaggcacgctg	Protospacer
*********** *********** ********

8. spacer 3.8|1720399|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to MN161573 (UNVERIFIED: Salmonella virus P22 isolate HT105/1 int-201, complete genome) position: , mismatch: 2, identity: 0.938 

agcgaggtgttcacgttggcgtatgcacgctg	CRISPR spacer
agcgaggtgttaacgttggcgtaggcacgctg	Protospacer
*********** *********** ********

9. spacer 3.8|1720399|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to KU927496 (Salmonella phage 101962B_sal5, complete genome) position: , mismatch: 2, identity: 0.938 

agcgaggtgttcacgttggcgtatgcacgctg	CRISPR spacer
agcgaggtgttaacgttggcgtaggcacgctg	Protospacer
*********** *********** ********

10. spacer 3.8|1720399|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to AB426868 (Enterobacteria phage P22 DNA, complete genome, strain: ATCC 19585-B1) position: , mismatch: 2, identity: 0.938 

agcgaggtgttcacgttggcgtatgcacgctg	CRISPR spacer
agcgaggtgttaacgttggcgtaggcacgctg	Protospacer
*********** *********** ********

11. spacer 3.8|1720399|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to KU927491 (Salmonella phage 146851_sal5, complete genome) position: , mismatch: 2, identity: 0.938 

agcgaggtgttcacgttggcgtatgcacgctg	CRISPR spacer
agcgaggtgttaacgttggcgtaggcacgctg	Protospacer
*********** *********** ********

12. spacer 3.8|1720399|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to KR296686 (Salmonella phage 22, complete genome) position: , mismatch: 2, identity: 0.938 

agcgaggtgttcacgttggcgtatgcacgctg	CRISPR spacer
agcgaggtgttaacgttggcgtaggcacgctg	Protospacer
*********** *********** ********

13. spacer 3.8|1720399|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NC_002371 (Enterobacteria phage P22 virus, complete genome) position: , mismatch: 2, identity: 0.938 

agcgaggtgttcacgttggcgtatgcacgctg	CRISPR spacer
agcgaggtgttaacgttggcgtaggcacgctg	Protospacer
*********** *********** ********

14. spacer 3.8|1720399|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to KU927495 (Salmonella phage 103203_sal4, complete genome) position: , mismatch: 2, identity: 0.938 

agcgaggtgttcacgttggcgtatgcacgctg	CRISPR spacer
agcgaggtgttaacgttggcgtaggcacgctg	Protospacer
*********** *********** ********

15. spacer 3.8|1720399|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to KR296688 (Salmonella phage 34, complete genome) position: , mismatch: 2, identity: 0.938 

agcgaggtgttcacgttggcgtatgcacgctg	CRISPR spacer
agcgaggtgttaacgttggcgtaggcacgctg	Protospacer
*********** *********** ********

16. spacer 3.8|1720399|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to M59749 (Bacteriophage P22 packaging genes) position: , mismatch: 2, identity: 0.938 

agcgaggtgttcacgttggcgtatgcacgctg	CRISPR spacer
agcgaggtgttaacgttggcgtaggcacgctg	Protospacer
*********** *********** ********

17. spacer 3.8|1720399|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to KU927498 (Salmonella phage 64795_sal4, complete genome) position: , mismatch: 2, identity: 0.938 

agcgaggtgttcacgttggcgtatgcacgctg	CRISPR spacer
agcgaggtgttaacgttggcgtaggcacgctg	Protospacer
*********** *********** ********

18. spacer 3.8|1720399|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to KU927492 (Salmonella phage 146851_sal4, complete genome) position: , mismatch: 2, identity: 0.938 

agcgaggtgttcacgttggcgtatgcacgctg	CRISPR spacer
agcgaggtgttaacgttggcgtaggcacgctg	Protospacer
*********** *********** ********

19. spacer 3.8|1720399|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to AF217253 (Bacteriophage P22 complete genome) position: , mismatch: 2, identity: 0.938 

agcgaggtgttcacgttggcgtatgcacgctg	CRISPR spacer
agcgaggtgttaacgttggcgtaggcacgctg	Protospacer
*********** *********** ********

20. spacer 3.8|1720399|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NC_030919 (Salmonella phage 118970_sal4, complete genome) position: , mismatch: 2, identity: 0.938 

agcgaggtgttcacgttggcgtatgcacgctg	CRISPR spacer
agcgaggtgttaacgttggcgtaggcacgctg	Protospacer
*********** *********** ********

21. spacer 3.8|1720399|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to KR296687 (Salmonella phage 25, complete genome) position: , mismatch: 2, identity: 0.938 

agcgaggtgttcacgttggcgtatgcacgctg	CRISPR spacer
agcgaggtgttaacgttggcgtaggcacgctg	Protospacer
*********** *********** ********

22. spacer 3.8|1720399|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to AB362338 (Enterobacteria phage P22 DNA, complete sequence, strain: MSU) position: , mismatch: 2, identity: 0.938 

agcgaggtgttcacgttggcgtatgcacgctg	CRISPR spacer
agcgaggtgttaacgttggcgtaggcacgctg	Protospacer
*********** *********** ********

23. spacer 3.8|1720399|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to GQ422451 (Enterobacteria phage Phi75, partial genome) position: , mismatch: 2, identity: 0.938 

agcgaggtgttcacgttggcgtatgcacgctg	CRISPR spacer
agcgaggtgttaacgttggcgtaggcacgctg	Protospacer
*********** *********** ********

24. spacer 3.8|1720399|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to GQ422450 (Enterobacteria phage UAB_Phi20, complete genome) position: , mismatch: 2, identity: 0.938 

agcgaggtgttcacgttggcgtatgcacgctg	CRISPR spacer
agcgaggtgttaacgttggcgtaggcacgctg	Protospacer
*********** *********** ********

25. spacer 3.8|1720399|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to AF527608 (Bacteriophage P22-pbi, complete sequence) position: , mismatch: 2, identity: 0.938 

agcgaggtgttcacgttggcgtatgcacgctg	CRISPR spacer
agcgaggtgttaacgttggcgtaggcacgctg	Protospacer
*********** *********** ********

26. spacer 3.8|1720399|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NC_031946 (Salmonella Phage 103203_sal5, complete genome) position: , mismatch: 2, identity: 0.938 

agcgaggtgttcacgttggcgtatgcacgctg	CRISPR spacer
agcgaggtgttaacgttggcgtaggcacgctg	Protospacer
*********** *********** ********

27. spacer 3.8|1720399|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NC_047875 (Salmonella phage UPF_BP1, complete genome) position: , mismatch: 2, identity: 0.938 

agcgaggtgttcacgttggcgtatgcacgctg	CRISPR spacer
agcgaggtgttaacgttggcgtaggcacgctg	Protospacer
*********** *********** ********

28. spacer 3.8|1720399|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to MT932212 (Salmonella phage VSe13, complete genome) position: , mismatch: 2, identity: 0.938 

agcgaggtgttcacgttggcgtatgcacgctg	CRISPR spacer
agcgaggtgttaacgttggcgtaggcacgctg	Protospacer
*********** *********** ********

29. spacer 3.15|1720820|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to KC911857 (Salmonella phage SPC32N, complete genome) position: , mismatch: 2, identity: 0.938 

gcaaatacaagcaccgctggaagtgtgcgcag	CRISPR spacer
gcaaatacaaacaccgctggaagtgcgcgcag	Protospacer
**********.**************.******

30. spacer 3.15|1720820|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to KC911856 (Salmonella phage SPC32H, complete genome) position: , mismatch: 2, identity: 0.938 

gcaaatacaagcaccgctggaagtgtgcgcag	CRISPR spacer
gcaaatacaaacaccgctggaagtgcgcgcag	Protospacer
**********.**************.******

31. spacer 3.15|1720820|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NC_016761 (Salmonella phage SPN1S, complete genome) position: , mismatch: 2, identity: 0.938 

gcaaatacaagcaccgctggaagtgtgcgcag	CRISPR spacer
gcaaatacaaacaccgctggaagtgcgcgcag	Protospacer
**********.**************.******

32. spacer 3.15|1720820|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to JQ691610 (Salmonella phage SPN9TCW, complete genome) position: , mismatch: 2, identity: 0.938 

gcaaatacaagcaccgctggaagtgtgcgcag	CRISPR spacer
gcaaatacaaacaccgctggaagtgcgcgcag	Protospacer
**********.**************.******

33. spacer 3.20|1721120|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to HQ201308 (Cronobacter phage ENT47670, complete genome) position: , mismatch: 2, identity: 0.938 

acatgcgccggttgcgcgccgcggtacccgac	CRISPR spacer
acatgcgccggttgtgcgccgcggtaccccac	Protospacer
**************.************** **

34. spacer 3.15|1720820|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014649 (Klebsiella pneumoniae strain KPNIH36 plasmid pKPN-fff, complete sequence) position: , mismatch: 3, identity: 0.906 

gcaaatacaagcaccgctggaagtgtgcgcag	CRISPR spacer
gcaaatacaagcaccgctggaaatgcgcgcaa	Protospacer
**********************.**.*****.

35. spacer 3.15|1720820|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NC_021654 (Klebsiella pneumoniae plasmid pKN-LS6, complete sequence) position: , mismatch: 3, identity: 0.906 

gcaaatacaagcaccgctggaagtgtgcgcag	CRISPR spacer
gcaaatacaagcaccgctggaaatgcgcgcaa	Protospacer
**********************.**.*****.

36. spacer 3.15|1720820|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007729 (Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKPN-498, complete sequence) position: , mismatch: 3, identity: 0.906 

gcaaatacaagcaccgctggaagtgtgcgcag	CRISPR spacer
gcaaatacaagcaccgctggaaatgcgcgcaa	Protospacer
**********************.**.*****.

37. spacer 3.15|1720820|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP037929 (Klebsiella pneumoniae subsp. pneumoniae strain KP-8788 plasmid pKPN-IT-8788, complete sequence) position: , mismatch: 3, identity: 0.906 

gcaaatacaagcaccgctggaagtgtgcgcag	CRISPR spacer
gcaaatacaagcaccgctggaaatgcgcgcaa	Protospacer
**********************.**.*****.

38. spacer 3.15|1720820|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to MN922301 (Klebsiella pneumoniae strain KP-14159 plasmid pKPN-IT-14159, complete sequence) position: , mismatch: 3, identity: 0.906 

gcaaatacaagcaccgctggaagtgtgcgcag	CRISPR spacer
gcaaatacaagcaccgctggaaatgcgcgcaa	Protospacer
**********************.**.*****.

39. spacer 3.15|1720820|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to MK416010 (Klebsiella phage ST11-OXA245phi3.2, complete genome) position: , mismatch: 3, identity: 0.906 

gcaaatacaagcaccgctggaagtgtgcgcag	CRISPR spacer
gcaaatacaagcatcgctggaagtgcgcgcaa	Protospacer
*************.***********.*****.

40. spacer 3.15|1720820|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to MK422448 (Klebsiella phage ST512-KPC3phi13.3, complete genome) position: , mismatch: 3, identity: 0.906 

gcaaatacaagcaccgctggaagtgtgcgcag	CRISPR spacer
gcaaatacaagcaccgctggaaatgcgcgcaa	Protospacer
**********************.**.*****.

41. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to CP053324 (Salmonella enterica subsp. salamae serovar 40:c:e,n,z15 strain 2013K-0524 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.906 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
aatgagcaacatcgacaaacaggcgctacgtg	Protospacer
*****.***********************..*

42. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to NC_004313 (Salmonella phage ST64B, complete genome) position: , mismatch: 3, identity: 0.906 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
aatgagcaacatcgacaaacaggcgctacgag	Protospacer
*****.***********************. *

43. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to NC_006949 (Enterobacteria phage ES18, complete genome) position: , mismatch: 3, identity: 0.906 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
aatgagcaacatcgacaaacaggcgctacgtg	Protospacer
*****.***********************..*

44. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to CP051275 (Salmonella phage SW-37, complete genome) position: , mismatch: 3, identity: 0.906 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
aatgagcaacatcgacaaacaggcgctacgtg	Protospacer
*****.***********************..*

45. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to JQ288021 (Salmonella phage SPN3UB, complete genome) position: , mismatch: 3, identity: 0.906 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
aatgagcaacatcgacaaacaggcgctactgg	Protospacer
*****.***********************  *

46. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to AY736146 (Salmonella typhimurium bacteriophage ES18, complete sequence) position: , mismatch: 3, identity: 0.906 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
aatgagcaacatcgacaaacaggcgctacgtg	Protospacer
*****.***********************..*

47. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to AY055382 (Salmonella typhimurium phage ST64B complete sequence) position: , mismatch: 3, identity: 0.906 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
aatgagcaacatcgacaaacaggcgctacgag	Protospacer
*****.***********************. *

48. spacer 4.1|1799803|38|CP020089|CRISPRCasFinder matches to AJ298298 (Bacteriophage P27 complete genome) position: , mismatch: 3, identity: 0.921 

ccttcaaaatctgaaccgtcagattctggatgttcaag	CRISPR spacer
ccttcaaaatctgaaccgtcagaatctgaatgttcagg	Protospacer
*********************** ****.*******.*

49. spacer 4.1|1799803|38|CP020089|CRISPRCasFinder matches to NC_003356 (Enterobacteria phage phiP27, complete genome) position: , mismatch: 3, identity: 0.921 

ccttcaaaatctgaaccgtcagattctggatgttcaag	CRISPR spacer
ccttcaaaatctgaaccgtcagaatctgaatgttcagg	Protospacer
*********************** ****.*******.*

50. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to NZ_KP763470 (Salmonella enterica subsp. enterica serovar Typhimurium strain L946 plasmid pSTM_Phi, complete sequence) position: , mismatch: 4, identity: 0.875 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
aatgagcaacatcgacaaacaggcgcttcgtg	Protospacer
*****.********************* *..*

51. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to BK000583 (TPA_inf: Enterobacteria phage P22 wild type, complete genome) position: , mismatch: 4, identity: 0.875 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
aatgagcaacatcgacaaacaggcgctgcgtg	Protospacer
*****.*********************.*..*

52. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to MN161573 (UNVERIFIED: Salmonella virus P22 isolate HT105/1 int-201, complete genome) position: , mismatch: 4, identity: 0.875 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
aatgagcaacatcgacaaacaggcgctgcgtg	Protospacer
*****.*********************.*..*

53. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to AB426868 (Enterobacteria phage P22 DNA, complete genome, strain: ATCC 19585-B1) position: , mismatch: 4, identity: 0.875 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
aatgagcaacatcgacaaacaggcgctgcgtg	Protospacer
*****.*********************.*..*

54. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to JQ182733 (Enterobacterial phage mEp213, complete genome) position: , mismatch: 4, identity: 0.875 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
aatgagcaacatcgacaaacaggcgctgcgtg	Protospacer
*****.*********************.*..*

55. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to KR296686 (Salmonella phage 22, complete genome) position: , mismatch: 4, identity: 0.875 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
aatgagcaacatcgacaaacaggcgctgcgtg	Protospacer
*****.*********************.*..*

56. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to L06296 (Bacteriophage P22 eaA - eaI genes, complete cds) position: , mismatch: 4, identity: 0.875 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
aatgagcaacatcgacaaacaggcgctgcgtg	Protospacer
*****.*********************.*..*

57. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to NC_002371 (Enterobacteria phage P22 virus, complete genome) position: , mismatch: 4, identity: 0.875 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
aatgagcaacatcgacaaacaggcgctgcgtg	Protospacer
*****.*********************.*..*

58. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to KR296688 (Salmonella phage 34, complete genome) position: , mismatch: 4, identity: 0.875 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
aatgagcaacatcgacaaacaggcgctgcgtg	Protospacer
*****.*********************.*..*

59. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to AF217253 (Bacteriophage P22 complete genome) position: , mismatch: 4, identity: 0.875 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
aatgagcaacatcgacaaacaggcgctgcgtg	Protospacer
*****.*********************.*..*

60. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to KR296687 (Salmonella phage 25, complete genome) position: , mismatch: 4, identity: 0.875 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
aatgagcaacatcgacaaacaggcgctgcgtg	Protospacer
*****.*********************.*..*

61. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to AB362338 (Enterobacteria phage P22 DNA, complete sequence, strain: MSU) position: , mismatch: 4, identity: 0.875 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
aatgagcaacatcgacaaacaggcgctgcgtg	Protospacer
*****.*********************.*..*

62. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to MN856003 (Bacteriophage sp. isolate 1, complete genome) position: , mismatch: 4, identity: 0.875 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
aatgagcaacatcgacaaacaggcgctgcgtg	Protospacer
*****.*********************.*..*

63. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to NC_019706 (Enterobacteria phage mEp043 c-1, complete genome) position: , mismatch: 4, identity: 0.875 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
aatgagcaacatcgacaaacaggcgctgcgtg	Protospacer
*****.*********************.*..*

64. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to AF527608 (Bacteriophage P22-pbi, complete sequence) position: , mismatch: 4, identity: 0.875 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
aatgagcaacatcgacaaacaggcgctgcgtg	Protospacer
*****.*********************.*..*

65. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to EU570103 (Salmonella phage epsilon34, complete genome) position: , mismatch: 4, identity: 0.875 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
aatgagcaacatcgacaaacaggcgctgcgtg	Protospacer
*****.*********************.*..*

66. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to NC_047875 (Salmonella phage UPF_BP1, complete genome) position: , mismatch: 4, identity: 0.875 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
aatgagcaacatcgacaaacaggcgctgcgtg	Protospacer
*****.*********************.*..*

67. spacer 3.1|1719978|33|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to MG945491 (UNVERIFIED: Microviridae sp. isolate 1258-1602, complete genome) position: , mismatch: 5, identity: 0.848 

agttatcccaaacaaggcgatttggcaccgaga	CRISPR spacer
aattatcccaaacaaggcgatttggaacaaaaa	Protospacer
*.*********************** ** .*.*

68. spacer 3.1|1719978|33|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to MH572345 (Microviridae sp. isolate SD_SC_53, complete genome) position: , mismatch: 5, identity: 0.848 

agttatcccaaacaaggcgatttggcaccgaga	CRISPR spacer
agttatcccagacaaggcgatttggtactgcaa	Protospacer
**********.**************.**.* .*

69. spacer 3.18|1721000|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042999 (Aquisphaera giovannonii strain OJF2 plasmid pOJF2_2, complete sequence) position: , mismatch: 5, identity: 0.844 

atcgcc-gccgcttcgagccgctgcgcgacgag	CRISPR spacer
-ccgccggccgattcgagccgccgcgcgacgcg	Protospacer
 .**** **** **********.******** *

70. spacer 3.24|1721360|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to HQ201308 (Cronobacter phage ENT47670, complete genome) position: , mismatch: 5, identity: 0.844 

agcggaagccagtcgggatagtcgataattgg	CRISPR spacer
aacggcagccattcgggatagtcgataatagc	Protospacer
*.*** ***** ***************** *

71. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to CP053410 (Salmonella enterica strain 2014K-0203 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
aatgagcaacatcgacaaacaggcgctaaggt	Protospacer
*****.********************** .

72. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.844 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
aatgagcaacatcgacaaacaggcgctgcgtc	Protospacer
*****.*********************.*..

73. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.844 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
aatgagcaacatcgacaaacaggcgctgcgtc	Protospacer
*****.*********************.*..

74. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.844 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
aatgagcaacatcgacaaacaggcgctgcgtc	Protospacer
*****.*********************.*..

75. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to NC_031077 (Enterobacter phage Tyrion, complete genome) position: , mismatch: 5, identity: 0.844 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
aatgagcaacatcgacaaacaggcgctgcgaa	Protospacer
*****.*********************.*. .

76. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to NZ_CP039495 (Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000669 plasmid pCFSAN000669_2, complete sequence) position: , mismatch: 5, identity: 0.844 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
tatgagcaacatcgacaaacaggcgctgcggg	Protospacer
 ****.*********************.*. *

77. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to MW013502 (Salmonella virus L cI-40 13-am43, complete genome) position: , mismatch: 5, identity: 0.844 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
aatgagcaacatcgacaaacgggcgcttcgtg	Protospacer
*****.**************.****** *..*

78. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to NC_004348 (Enterobacteria phage ST64T, complete genome) position: , mismatch: 5, identity: 0.844 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
aatgagcaacatcgacaaacgggcgcttcgtg	Protospacer
*****.**************.****** *..*

79. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to MW013503 (Salmonella virus L cII-101, complete genome) position: , mismatch: 5, identity: 0.844 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
aatgagcaacatcgacaaacgggcgcttcgtg	Protospacer
*****.**************.****** *..*

80. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to NC_010393 (Phage Gifsy-2, complete genome) position: , mismatch: 5, identity: 0.844 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
aatgagcaacatcgacaaacgggcgcttcgtg	Protospacer
*****.**************.****** *..*

81. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to NC_010392 (Phage Gifsy-1, complete genome) position: , mismatch: 5, identity: 0.844 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
aatgagcaacatcgacaaacgggcgcttcgtg	Protospacer
*****.**************.****** *..*

82. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to NC_018275 (Salmonella phage vB_SemP_Emek, complete genome) position: , mismatch: 5, identity: 0.844 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
aatgagcaacatcgacaaacgggcgcttcgtg	Protospacer
*****.**************.****** *..*

83. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to AY052766 (Salmonella typhimurium bacteriophage ST64T, complete genome) position: , mismatch: 5, identity: 0.844 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
aatgagcaacatcgacaaacgggcgcttcgtg	Protospacer
*****.**************.****** *..*

84. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to MF188997 (Salmonella phage vB_SalP_PM43, complete genome) position: , mismatch: 5, identity: 0.844 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
aatgagcaacatcgacaaacgggcgcttcgtg	Protospacer
*****.**************.****** *..*

85. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to NC_004775 (Enterobacteria phage epsilon15, complete genome) position: , mismatch: 5, identity: 0.844 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
aatgagcaacatcgacaaacaggtgctgcgtg	Protospacer
*****.*****************.***.*..*

86. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to KJ832078 (Enterobacteria phage Sf101, complete genome) position: , mismatch: 5, identity: 0.844 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
aatgagcaacatcaacaaacaggcgctgcgtg	Protospacer
*****.*******.*************.*..*

87. spacer 1.1|800911|30|CP020089|CRISPRCasFinder matches to NZ_CP017753 (Cupriavidus sp. USMAHM13 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8 

taccaccgtcgccgttatcattgccgccgc	CRISPR spacer
cagcgccgtcgccgtcatcatggccgccga	Protospacer
.* *.**********.***** *******

88. spacer 1.1|800911|30|CP020089|CRISPRCasFinder matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8 

taccaccgtcgccgttatcattgccgccgc	CRISPR spacer
cagcgccgtcgccgtcatcatggccgccga	Protospacer
.* *.**********.***** *******

89. spacer 1.1|800911|30|CP020089|CRISPRCasFinder matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 6, identity: 0.8 

taccaccgtcgccgttatcattgccgccgc	CRISPR spacer
tattgccaccgccgttaccattgccgccgc	Protospacer
**...**..********.************

90. spacer 3.18|1721000|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NC_041927 (Sphingobium phage Lacusarx, complete genome) position: , mismatch: 6, identity: 0.812 

atcgccg-ccgcttcgagccgctgcgcgacgag	CRISPR spacer
-tcgtggaaggcttcgaggcgctgcgcgacgag	Protospacer
 ***. *   ******** **************

91. spacer 3.23|1721300|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NC_020548 (Azoarcus sp. KH32C plasmid pAZKH, complete sequence) position: , mismatch: 6, identity: 0.812 

gttctcgccgcgcgagtgcagcgcctgacggt--	CRISPR spacer
cttcttgacgcgcgagtgcagcgc--gaaggtcg	Protospacer
 ****.* ****************  ** ***

92. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to MT774487 (Salmonella phage MG40, complete genome) position: , mismatch: 6, identity: 0.812 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
aatgagcaacatcgacaaacaggcagtaacag	Protospacer
*****.******************. **   *

93. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to NC_016158 (Escherichia phage HK639, complete genome) position: , mismatch: 6, identity: 0.812 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
aatgagcaacatcgacaaacatgccgtccaag	Protospacer
*****.*************** **  * ** *

94. spacer 1.1|800911|30|CP020089|CRISPRCasFinder matches to NZ_CP013600 (Rhizobium sp. N741 plasmid pRspN741e, complete sequence) position: , mismatch: 7, identity: 0.767 

taccaccgtcgccgttatcattgccgccgc	CRISPR spacer
cgtctccgtcgccgtcatcatcgccgccgg	Protospacer
...* **********.*****.*******

95. spacer 1.1|800911|30|CP020089|CRISPRCasFinder matches to NZ_CP013504 (Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence) position: , mismatch: 7, identity: 0.767 

taccaccgtcgccgttatcattgccgccgc	CRISPR spacer
cgtctccgtcgccgtcatcatcgccgccgg	Protospacer
...* **********.*****.*******

96. spacer 1.1|800911|30|CP020089|CRISPRCasFinder matches to NZ_CP013510 (Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence) position: , mismatch: 7, identity: 0.767 

taccaccgtcgccgttatcattgccgccgc	CRISPR spacer
cgtctccgtcgccgtcatcatcgccgccgg	Protospacer
...* **********.*****.*******

97. spacer 1.1|800911|30|CP020089|CRISPRCasFinder matches to NZ_CP013521 (Rhizobium sp. N113 plasmid pRspN113d, complete sequence) position: , mismatch: 7, identity: 0.767 

taccaccgtcgccgttatcattgccgccgc	CRISPR spacer
cgtctccgtcgccgtcatcatcgccgccgg	Protospacer
...* **********.*****.*******

98. spacer 1.1|800911|30|CP020089|CRISPRCasFinder matches to NZ_CP013494 (Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence) position: , mismatch: 7, identity: 0.767 

taccaccgtcgccgttatcattgccgccgc	CRISPR spacer
cgtctccgtcgccgtcatcatcgccgccgg	Protospacer
...* **********.*****.*******

99. spacer 1.1|800911|30|CP020089|CRISPRCasFinder matches to NZ_CP013594 (Rhizobium sp. N871 plasmid pRspN871d, complete sequence) position: , mismatch: 7, identity: 0.767 

taccaccgtcgccgttatcattgccgccgc	CRISPR spacer
cgtctccgtcgccgtcatcatcgccgccgg	Protospacer
...* **********.*****.*******

100. spacer 1.2|800965|30|CP020089|CRISPRCasFinder matches to CP052797 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N18S2039 plasmid pN18S2039, complete sequence) position: , mismatch: 7, identity: 0.767 

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*

101. spacer 1.2|800965|30|CP020089|CRISPRCasFinder matches to CP052804 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S973 plasmid pN17S0973, complete sequence) position: , mismatch: 7, identity: 0.767 

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*

102. spacer 1.2|800965|30|CP020089|CRISPRCasFinder matches to CP038508 (Salmonella enterica subsp. enterica serovar Infantis strain FARPER-219 plasmid p-F219, complete sequence) position: , mismatch: 7, identity: 0.767 

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*

103. spacer 1.2|800965|30|CP020089|CRISPRCasFinder matches to CP052788 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0611 plasmid pN19S0611, complete sequence) position: , mismatch: 7, identity: 0.767 

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*

104. spacer 1.2|800965|30|CP020089|CRISPRCasFinder matches to CP052786 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0641 plasmid pN19S0641, complete sequence) position: , mismatch: 7, identity: 0.767 

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*

105. spacer 1.2|800965|30|CP020089|CRISPRCasFinder matches to CP052838 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N16S097 plasmid pN16S097, complete sequence) position: , mismatch: 7, identity: 0.767 

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*

106. spacer 1.2|800965|30|CP020089|CRISPRCasFinder matches to NZ_CP028316 (Salmonella enterica subsp. enterica serovar Typhimurium var. 5- strain CFSAN067217 plasmid pSC-31-2, complete sequence) position: , mismatch: 7, identity: 0.767 

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*

107. spacer 1.2|800965|30|CP020089|CRISPRCasFinder matches to CP051676 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1234 plasmid pN16S1234, complete sequence) position: , mismatch: 7, identity: 0.767 

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*

108. spacer 1.2|800965|30|CP020089|CRISPRCasFinder matches to NZ_CP022063 (Salmonella enterica strain FDAARGOS_312 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767 

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*

109. spacer 1.2|800965|30|CP020089|CRISPRCasFinder matches to CP052781 (Salmonella enterica strain CVM N19S0949 plasmid pN19S0949, complete sequence) position: , mismatch: 7, identity: 0.767 

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*

110. spacer 1.2|800965|30|CP020089|CRISPRCasFinder matches to CP052834 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S041 plasmid pN17S0041, complete sequence) position: , mismatch: 7, identity: 0.767 

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*

111. spacer 1.2|800965|30|CP020089|CRISPRCasFinder matches to CP052793 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0388 plasmid pN19S0388, complete sequence) position: , mismatch: 7, identity: 0.767 

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*

112. spacer 1.2|800965|30|CP020089|CRISPRCasFinder matches to CP052832 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1040 plasmid pN17S1040, complete sequence) position: , mismatch: 7, identity: 0.767 

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*

113. spacer 1.2|800965|30|CP020089|CRISPRCasFinder matches to CP052830 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1105 plasmid pN17S1105, complete sequence) position: , mismatch: 7, identity: 0.767 

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*

114. spacer 1.2|800965|30|CP020089|CRISPRCasFinder matches to NZ_CP022662 (Salmonella enterica subsp. enterica strain RM11065 plasmid pRM11065-2, complete sequence) position: , mismatch: 7, identity: 0.767 

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattccccc	Protospacer
.*******.***.************ .*

115. spacer 1.2|800965|30|CP020089|CRISPRCasFinder matches to CP052812 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S376 plasmid pN17S0376, complete sequence) position: , mismatch: 7, identity: 0.767 

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*

116. spacer 1.2|800965|30|CP020089|CRISPRCasFinder matches to CP052810 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S535 plasmid pN17S0535, complete sequence) position: , mismatch: 7, identity: 0.767 

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*

117. spacer 1.2|800965|30|CP020089|CRISPRCasFinder matches to CP052808 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S637 plasmid pN17S0637, complete sequence) position: , mismatch: 7, identity: 0.767 

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*

118. spacer 1.2|800965|30|CP020089|CRISPRCasFinder matches to CP052806 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S816 plasmid pN17S0816, complete sequence) position: , mismatch: 7, identity: 0.767 

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*

119. spacer 1.2|800965|30|CP020089|CRISPRCasFinder matches to CP052791 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0552 plasmid pN17S0637, complete sequence) position: , mismatch: 7, identity: 0.767 

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*

120. spacer 1.2|800965|30|CP020089|CRISPRCasFinder matches to CP052818 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1509 plasmid pN17S1509, complete sequence) position: , mismatch: 7, identity: 0.767 

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*

121. spacer 1.2|800965|30|CP020089|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767 

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccactggtaccgccattcgacg	Protospacer
.*******.***** **********    *

122. spacer 1.2|800965|30|CP020089|CRISPRCasFinder matches to CP052799 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S990 plasmid pN17S0990-1, complete sequence) position: , mismatch: 7, identity: 0.767 

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*

123. spacer 1.2|800965|30|CP020089|CRISPRCasFinder matches to CP052795 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0125 plasmid pN19S0125, complete sequence) position: , mismatch: 7, identity: 0.767 

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*

124. spacer 1.2|800965|30|CP020089|CRISPRCasFinder matches to NZ_CP047882 (Salmonella enterica subsp. enterica serovar Infantis strain 119944 plasmid pESI, complete sequence) position: , mismatch: 7, identity: 0.767 

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*

125. spacer 1.2|800965|30|CP020089|CRISPRCasFinder matches to CP052802 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S976 plasmid pN17S0976, complete sequence) position: , mismatch: 7, identity: 0.767 

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*

126. spacer 1.2|800965|30|CP020089|CRISPRCasFinder matches to CP052840 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N16S024 plasmid pN16S024, complete sequence) position: , mismatch: 7, identity: 0.767 

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*

127. spacer 1.2|800965|30|CP020089|CRISPRCasFinder matches to CP052783 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N19S0679 plasmid pN19S0679-1, complete sequence) position: , mismatch: 7, identity: 0.767 

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*

128. spacer 1.2|800965|30|CP020089|CRISPRCasFinder matches to CP052836 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N16S103 plasmid pN16S103, complete sequence) position: , mismatch: 7, identity: 0.767 

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*

129. spacer 1.2|800965|30|CP020089|CRISPRCasFinder matches to CP052779 (Salmonella enterica strain 19TN07GT06K-S plasmid pN19S1233, complete sequence) position: , mismatch: 7, identity: 0.767 

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*

130. spacer 1.2|800965|30|CP020089|CRISPRCasFinder matches to NZ_CP031362 (Salmonella enterica subsp. enterica serovar Heidelberg strain 5 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.767 

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*

131. spacer 1.2|800965|30|CP020089|CRISPRCasFinder matches to CP052828 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1126 plasmid pN17S1126, complete sequence) position: , mismatch: 7, identity: 0.767 

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*

132. spacer 1.2|800965|30|CP020089|CRISPRCasFinder matches to CP052826 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1245 plasmid pN17S0637, complete sequence) position: , mismatch: 7, identity: 0.767 

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*

133. spacer 1.2|800965|30|CP020089|CRISPRCasFinder matches to NZ_CP016409 (Salmonella enterica subsp. enterica serovar Infantis strain FSIS1502916 plasmid pFSIS1502916, complete sequence) position: , mismatch: 7, identity: 0.767 

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*

134. spacer 1.2|800965|30|CP020089|CRISPRCasFinder matches to CP052824 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1265 plasmid pN17S1265, complete sequence) position: , mismatch: 7, identity: 0.767 

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*

135. spacer 1.2|800965|30|CP020089|CRISPRCasFinder matches to CP052822 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1349 plasmid pN17S1349, complete sequence) position: , mismatch: 7, identity: 0.767 

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*

136. spacer 1.2|800965|30|CP020089|CRISPRCasFinder matches to NZ_CP016407 (Salmonella enterica subsp. enterica serovar Infantis strain FSIS1502169 plasmid pFSIS1502169, complete sequence) position: , mismatch: 7, identity: 0.767 

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*

137. spacer 1.2|800965|30|CP020089|CRISPRCasFinder matches to CP052820 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1442 plasmid pN17S1442, complete sequence) position: , mismatch: 7, identity: 0.767 

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*

138. spacer 1.2|800965|30|CP020089|CRISPRCasFinder matches to NZ_CP016413 (Salmonella enterica subsp. enterica serovar Infantis strain CVM44454 plasmid pCVM44454, complete sequence) position: , mismatch: 7, identity: 0.767 

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*

139. spacer 1.2|800965|30|CP020089|CRISPRCasFinder matches to NZ_CP016411 (Salmonella enterica subsp. enterica serovar Infantis strain N55391 plasmid pN55391, complete sequence) position: , mismatch: 7, identity: 0.767 

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*

140. spacer 1.2|800965|30|CP020089|CRISPRCasFinder matches to CP052816 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S1598 plasmid pN17S1598) position: , mismatch: 7, identity: 0.767 

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*

141. spacer 1.2|800965|30|CP020089|CRISPRCasFinder matches to CP052814 (Salmonella enterica subsp. enterica serovar Infantis strain CVM N17S349 plasmid pN17S0349, complete sequence) position: , mismatch: 7, identity: 0.767 

tgccattgtcactgttaccgccattatcag	CRISPR spacer
cgccattgccaccgttaccgccattgcccc	Protospacer
.*******.***.************..*

142. spacer 3.13|1720700|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781 

gcgcagctccggcaaccgggcgccgcgccatc	CRISPR spacer
gcgcagctccgccaaccgggcgcaggcctcgc	Protospacer
*********** *********** *  *.  *

143. spacer 3.15|1720820|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026561 (Pseudomonas amygdali pv. morsprunorum strain R15244 plasmid p4_tig6, complete sequence) position: , mismatch: 7, identity: 0.781 

gcaaatacaagcaccgctggaagtgtgcgcag----	CRISPR spacer
gcaaatacaggcatcgctggaagt----tcagaatc	Protospacer
*********.***.**********     ***

144. spacer 3.15|1720820|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT222315 (Pseudomonas cerasi isolate Sour cherry (Prunus cerasus) symptomatic leaf plasmid p58T3) position: , mismatch: 7, identity: 0.781 

gcaaatacaagcaccgctggaagtgtgcgcag----	CRISPR spacer
gcaaatacaggcatcgctggaagt----tcagaatc	Protospacer
*********.***.**********     ***

145. spacer 3.15|1720820|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT222315 (Pseudomonas cerasi isolate Sour cherry (Prunus cerasus) symptomatic leaf plasmid p58T3) position: , mismatch: 7, identity: 0.781 

gcaaatacaagcaccgctggaagtgtgcgcag----	CRISPR spacer
gcaaatacaggcatcgctggaagt----tcagaatc	Protospacer
*********.***.**********     ***

146. spacer 3.15|1720820|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT963397 (Pseudomonas cerasi isolate PL963 plasmid PP2, complete sequence) position: , mismatch: 7, identity: 0.781 

gcaaatacaagcaccgctggaagtgtgcgcag----	CRISPR spacer
gcaaatacaggcatcgctggaagt----tcagaatc	Protospacer
*********.***.**********     ***

147. spacer 3.18|1721000|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047896 (Sphingomonas sp. C33 plasmid pC33, complete sequence) position: , mismatch: 7, identity: 0.781 

atcgccgccgcttcgagccgctgcgcgacgag	CRISPR spacer
ggccgctcggcttcgagccgctgcccgacgag	Protospacer
. *  * * *************** *******

148. spacer 3.18|1721000|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP006369 (Aureimonas sp. AU20 plasmid pAU20b, complete sequence) position: , mismatch: 7, identity: 0.781 

atcgccgccgcttcgagccgctgcgcgacgag	CRISPR spacer
tgcggacccgcttcgaggagctgcgcgacgag	Protospacer
  **   **********  *************

149. spacer 3.18|1721000|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781 

atcgccgccgcttcgagccgctgcgcgacgag	CRISPR spacer
atgtccgccgcttcgggccgctgggcgatggc	Protospacer
**  ***********.******* ****.*.

150. spacer 3.18|1721000|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022365 (Azospirillum sp. TSH58 plasmid TSH58_p06, complete sequence) position: , mismatch: 7, identity: 0.781 

atcgccgccgcttcgagccgctgcgcgacgag	CRISPR spacer
agcgcctccgcttcgagccgctccgcctggac	Protospacer
* **** *************** ***   **

151. spacer 3.18|1721000|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031116 (Rubrobacter indicoceani strain SCSIO 08198 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781 

atcgccgc-cgcttcgagccgctgcgcgacgag	CRISPR spacer
-ttacggcgggcttcgacccgttgcgcgacgag	Protospacer
 *..* **  ******* ***.***********

152. spacer 3.18|1721000|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011808 (Pandoraea faecigallinarum strain DSM 23572 plasmid pPF72-1, complete sequence) position: , mismatch: 7, identity: 0.781 

atcgccgccgcttcgagccgctgcgcgacgag	CRISPR spacer
atcgccgcggcttccagccgctggccgttgat	Protospacer
******** ***** ********  ** .**

153. spacer 3.18|1721000|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 7, identity: 0.781 

atcgccgccgcttcgagccgctgcgcgacgag	CRISPR spacer
accgagcccgcttcgagcgcctgcgcgacgcg	Protospacer
*.**   ***********  ********** *

154. spacer 3.18|1721000|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 7, identity: 0.781 

atcgccgccgcttcgagccgctgcgcgacgag	CRISPR spacer
accgagcccgcttcgagcgcctgcgcgacgcg	Protospacer
*.**   ***********  ********** *

155. spacer 3.20|1721120|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021084 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI3, complete sequence) position: , mismatch: 7, identity: 0.781 

acatgcgccggttgcgcgccgcggtacccgac	CRISPR spacer
tcgcccgacggttgcgggccgcggtacccggc	Protospacer
 *.. ** ******** *************.*

156. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to NZ_KY515226 (Salmonella enterica subsp. enterica serovar Derby strain S701 plasmid AnCo3, complete sequence) position: , mismatch: 7, identity: 0.781 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
aatgagcaacatcgataaacaggcagtaacag	Protospacer
*****.*********.********. **   *

157. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to JQ806764 (Salmonella phage vB_SosS_Oslo, complete genome) position: , mismatch: 7, identity: 0.781 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
aatgagcaacatcgataaacaggcagtaacag	Protospacer
*****.*********.********. **   *

158. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to MH370364 (Salmonella phage S107, complete genome) position: , mismatch: 7, identity: 0.781 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
aatgagcaacatcgataaacaggcagtaacag	Protospacer
*****.*********.********. **   *

159. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to MH370382 (Salmonella phage S135, complete genome) position: , mismatch: 7, identity: 0.781 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
aatgagcaacatcgataaacaggcagtaacag	Protospacer
*****.*********.********. **   *

160. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to MH370383 (Salmonella phage S137, complete genome) position: , mismatch: 7, identity: 0.781 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
aatgagcaacatcgataaacaggcagtaacag	Protospacer
*****.*********.********. **   *

161. spacer 1.1|800911|30|CP020089|CRISPRCasFinder matches to NC_022049 (Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence) position: , mismatch: 8, identity: 0.733 

taccaccgtcgccgttatcattgccgccgc	CRISPR spacer
ggtttcggtcgccgatatcatggccgccgc	Protospacer
 ... * ******* ****** ********

162. spacer 1.2|800965|30|CP020089|CRISPRCasFinder matches to KP881232 (Sinorhizobium phage phiM9, complete genome) position: , mismatch: 8, identity: 0.733 

tgccattgtcactgttaccgccattatcag	CRISPR spacer
tgccattgccaccgttaccgccagctccgc	Protospacer
********.***.********** . .*.

163. spacer 3.3|1720099|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75 

accccgcacgctgcgccgctccttgaccctcc	CRISPR spacer
ggcccgcgcgctgcgccgctccgtgccgcgcg	Protospacer
. *****.************** ** * * *

164. spacer 3.3|1720099|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 8, identity: 0.75 

accccgcacgctgcgccgctccttgaccctcc	CRISPR spacer
ggcccgcgcgctgcgccgctccgtgccgcgcg	Protospacer
. *****.************** ** * * *

165. spacer 3.6|1720279|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 8, identity: 0.75 

atgctggaaaggaaggctggcagaaatgcagt	CRISPR spacer
atcctcgaaaggaaggctggcagattgctggt	Protospacer
** ** ******************    ..**

166. spacer 3.13|1720700|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015231 (Epibacterium mobile F1926 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

gcgcagctccggcaaccgggcgccgcgccatc	CRISPR spacer
ctccaactccggcaaccaggcgccgcgcgcgc	Protospacer
 . **.***********.**********   *

167. spacer 3.13|1720700|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75 

gcgcagctccggcaaccgggcgccgcgccatc--	CRISPR spacer
aggcagctccggcagcccggcgc--cgtcgtcga	Protospacer
. ************.** *****  **.*.**

168. spacer 3.13|1720700|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044329 (Methylocystis rosea strain BRCS1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

gcgcagctccggcaaccgggcgccgcgccatc-	CRISPR spacer
cagcagctccgtcaaccaggcgccg-atcaccg	Protospacer
  ********* *****.******* ..**.*

169. spacer 3.18|1721000|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.75 

atcgccgccgcttcgagccgctgcgcgacgag	CRISPR spacer
acgcctaacgattcgagccgccgcgcgacgag	Protospacer
*.  *.. ** **********.**********

170. spacer 3.18|1721000|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049906 (Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

atcgccgccgcttcgagccgctgcgcgacgag	CRISPR spacer
tccgctgccgcttccagccgctgcgctttgcg	Protospacer
 .***.******** ***********  .* *

171. spacer 3.18|1721000|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to MT723940 (Mycobacterium phage Ellie, complete genome) position: , mismatch: 8, identity: 0.75 

atcgccgccgcttcgagccgctgcgcgacgag	CRISPR spacer
gccctcgcggtttcgagccgctgcgcgacaac	Protospacer
..* .*** *.******************.*

172. spacer 3.18|1721000|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018821 (Sphingomonas koreensis strain ABOJV plasmid tig00000001, complete sequence) position: , mismatch: 8, identity: 0.75 

atcgccgccgcttcgagccgctgcgcgacgag	CRISPR spacer
ttctcgaccgcatcgagctgctgcgcgacgtc	Protospacer
 ** * .**** ******.***********

173. spacer 3.18|1721000|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR594690 (Variovorax sp. WDL1 plasmid 2) position: , mismatch: 8, identity: 0.75 

atcgccgccgcttcgagccgctgcgcgacgag	CRISPR spacer
aagccggctgcttcgagacgctgcgcgaccac	Protospacer
*   * **.******** *********** *

174. spacer 3.18|1721000|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR594663 (Variovorax sp. RA8 plasmid 2) position: , mismatch: 8, identity: 0.75 

atcgccgccgcttcgagccgctgcgcgacgag	CRISPR spacer
aagccggctgcttcgagacgctgcgcgaccac	Protospacer
*   * **.******** *********** *

175. spacer 3.20|1721120|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049751 (Rhodococcus fascians A21d2 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75 

acatgcgccggttgcgcgccgcggtacccgac	CRISPR spacer
gctcgcgccggttgcgtgcggcggtacgccag	Protospacer
.* .************.** ******* * *

176. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to KJ019098 (Synechococcus phage ACG-2014f isolate Syn7803US39, complete genome) position: , mismatch: 8, identity: 0.75 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
tatgaacaacatcgacaacctggcaatggacc	Protospacer
 ***************** * ***. *. **

177. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to KJ019152 (Synechococcus phage ACG-2014f isolate Syn7803C25, complete genome) position: , mismatch: 8, identity: 0.75 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
tatgaacaacatcgacaacctggcaatggacc	Protospacer
 ***************** * ***. *. **

178. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to KJ019150 (Synechococcus phage ACG-2014f isolate Syn7803C22, complete genome) position: , mismatch: 8, identity: 0.75 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
catgaacaacatcgacaacctggcaatggacc	Protospacer
 ***************** * ***. *. **

179. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to KJ019037 (Synechococcus phage ACG-2014f isolate Syn7803C58, complete genome) position: , mismatch: 8, identity: 0.75 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
tatgaacaacatcgacaacctggcaatggacc	Protospacer
 ***************** * ***. *. **

180. spacer 1.1|800911|30|CP020089|CRISPRCasFinder matches to MF417874 (Uncultured Caudovirales phage clone 3S_14, partial genome) position: , mismatch: 9, identity: 0.7 

taccaccgtcgccgttatcattgccgccgc	CRISPR spacer
gcccagcgtagccgttatcattgccaaacg	Protospacer
  *** *** ***************.

181. spacer 1.1|800911|30|CP020089|CRISPRCasFinder matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.7 

taccaccgtcgccgttatcattgccgccgc	CRISPR spacer
aaagcccgtcgccgttatcatcgccgaaat	Protospacer
 *   ****************.****  ..

182. spacer 3.3|1720099|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 9, identity: 0.719 

accccgcacgctgcgccgctccttgaccctcc	CRISPR spacer
ccttccggcgctgcgccgcttcgtgaccctct	Protospacer
 *..*  .************.* ********.

183. spacer 3.6|1720279|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018230 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719 

atgctggaaaggaaggctggcagaaatgcagt	CRISPR spacer
atgctgaaaaggaaggccggcaggcctatatc	Protospacer
******.**********.*****.  *..* .

184. spacer 3.9|1720459|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to KY962008 (Escherichia phage ST31, complete genome) position: , mismatch: 9, identity: 0.719 

gataaacagatggagcaccggtagccgggtga	CRISPR spacer
tctcaccatatggagcaccgttagccgggacc	Protospacer
  * * ** *********** ********

185. spacer 3.9|1720459|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NC_023576 (Citrobacter phage CR44b complete genome) position: , mismatch: 9, identity: 0.719 

gataaacagatggagcaccggtagccgggtga	CRISPR spacer
tctcaccatatggagcaccgttagccgggact	Protospacer
  * * ** *********** ********

186. spacer 3.9|1720459|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to MT446393 (UNVERIFIED: Escherichia virus TH16, complete genome) position: , mismatch: 9, identity: 0.719 

gataaacagatggagcaccggtagccgggtga	CRISPR spacer
tctcaccatatggagcaccgttagccgggact	Protospacer
  * * ** *********** ********

187. spacer 3.9|1720459|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to MT350292 (Enterococcus phage EFA-1, complete genome) position: , mismatch: 9, identity: 0.719 

gataaacagatggagcaccggtagccgggtga	CRISPR spacer
tctcaccatatggagcaccgttagccgggact	Protospacer
  * * ** *********** ********

188. spacer 3.9|1720459|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to MT862763 (Escherichia phage vB_EcoP-U8, complete genome) position: , mismatch: 9, identity: 0.719 

gataaacagatggagcaccggtagccgggtga	CRISPR spacer
tctcaccatatggagcaccgttagccgggacc	Protospacer
  * * ** *********** ********

189. spacer 3.10|1720519|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019022 (Escherichia coli strain Ecol_881 plasmid pEC881_7, complete sequence) position: , mismatch: 9, identity: 0.719 

aacaatgccggagagcttgcttatgaggctac	CRISPR spacer
gacaatgccggagagtttgattatcgtacttt	Protospacer
.**************.*** **** . .** .

190. spacer 3.13|1720700|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 9, identity: 0.719 

gcgcagctccggcaaccgggcgccgcgccatc	CRISPR spacer
catcagcgccggcagccgggcgccgcgggtgc	Protospacer
   **** ******.************    *

191. spacer 3.18|1721000|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 9, identity: 0.719 

atcgccgccgcttcgagccgctgcgcgacgag	CRISPR spacer
tcggccaccgcttccagccgctgcgcgaactc	Protospacer
 . ***.******* *************

192. spacer 3.18|1721000|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013072 (Sphingobium indicum B90A plasmid pSRL2, complete sequence) position: , mismatch: 9, identity: 0.719 

atcgccgccgcttcgagccgctgcgcgacgag	CRISPR spacer
gcctgttccgcatcgagcggctgcgcgacgac	Protospacer
..*  . **** ****** ************

193. spacer 3.18|1721000|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013454 (Burkholderia vietnamiensis strain MSMB608WGS plasmid pMSMB608, complete sequence) position: , mismatch: 9, identity: 0.719 

atcgccgccgcttcgagccgctgcgcgacgag	CRISPR spacer
aagaaacccgcttcgagccgctggtcgacgaa	Protospacer
*  .   ****************  ******.

194. spacer 3.18|1721000|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016354 (Prauserella marina strain DSM 45268 plasmid pPmarDSM45268, complete sequence) position: , mismatch: 9, identity: 0.719 

atcgccgccgcttcgagccgctgcgcgacgag	CRISPR spacer
ccggccgccgcttcgagcggctgcacggctgc	Protospacer
 . *************** *****.**.* .

195. spacer 3.18|1721000|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011665 (Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence) position: , mismatch: 9, identity: 0.719 

atcgccgccgcttcgagccgctgcgcgacgag	CRISPR spacer
ccgcccgccgcgtcgagcagctgcgcgccccg	Protospacer
 .  ******* ****** ******** *  *

196. spacer 3.18|1721000|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029359 (Azospirillum sp. CFH 70021 plasmid unnamed4) position: , mismatch: 9, identity: 0.719 

atcgccgccgcttcgagccgctgcgcgacgag	CRISPR spacer
tccagcagcgcatcgagcggctgcgcgacgac	Protospacer
 .*. *. *** ****** ************

197. spacer 3.18|1721000|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029359 (Azospirillum sp. CFH 70021 plasmid unnamed4) position: , mismatch: 9, identity: 0.719 

atcgccgccgcttcgagccgctgcgcgacgag	CRISPR spacer
tccagcagcgcatcgagcggctgcgcgacgac	Protospacer
 .*. *. *** ****** ************

198. spacer 3.18|1721000|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 9, identity: 0.719 

atcgccgccgcttcgagccgctgcgcgacgag	CRISPR spacer
atcgccgccgcttcgaggcactggggcttcac	Protospacer
***************** *.*** *   . *

199. spacer 3.23|1721300|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to MN586021 (Arthrobacter phage Beagle, complete genome) position: , mismatch: 9, identity: 0.719 

gttctcgccgcgcgagtgcagcgcctgacggt	CRISPR spacer
ggtggcgccgagcgcgtgcagcgcctgatatc	Protospacer
* *  ***** *** *************.. .

200. spacer 3.23|1721300|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to MT889394 (Arthrobacter phage Odyssey395, complete genome) position: , mismatch: 9, identity: 0.719 

gttctcgccgcgcgagtgcagcgcctgacggt	CRISPR spacer
ggtggcgccgagcgcgtgcagcgcctgatacc	Protospacer
* *  ***** *** *************.. .

201. spacer 3.24|1721360|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020897 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5a, complete sequence) position: , mismatch: 9, identity: 0.719 

agcggaagccagtcgggatagtcgataattgg	CRISPR spacer
atcggaaaccagtcgggattgtcgatgccgcc	Protospacer
* *****.*********** ******. .

202. spacer 3.24|1721360|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013524 (Rhizobium phaseoli strain R744 plasmid pRphaR744b, complete sequence) position: , mismatch: 9, identity: 0.719 

agcggaagccagtcgggatagtcgataattgg	CRISPR spacer
atcggaaaccagtcgggattgtcgatgccgcc	Protospacer
* *****.*********** ******. .

203. spacer 3.24|1721360|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013553 (Rhizobium phaseoli strain N931 plasmid pRphaN931a, complete sequence) position: , mismatch: 9, identity: 0.719 

agcggaagccagtcgggatagtcgataattgg	CRISPR spacer
atcggaaaccagtcgggattgtcgatgccgcc	Protospacer
* *****.*********** ******. .

204. spacer 3.24|1721360|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013586 (Rhizobium phaseoli strain N161 plasmid pRphaN161a, complete sequence) position: , mismatch: 9, identity: 0.719 

agcggaagccagtcgggatagtcgataattgg	CRISPR spacer
atcggaaaccagtcgggattgtcgatgccgcc	Protospacer
* *****.*********** ******. .

205. spacer 3.24|1721360|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013559 (Rhizobium phaseoli strain N841 plasmid pRphaN841b, complete sequence) position: , mismatch: 9, identity: 0.719 

agcggaagccagtcgggatagtcgataattgg	CRISPR spacer
atcggaaaccagtcgggattgtcgatgccgcc	Protospacer
* *****.*********** ******. .

206. spacer 3.24|1721360|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013576 (Rhizobium phaseoli strain N671 plasmid pRphaN671b, complete sequence) position: , mismatch: 9, identity: 0.719 

agcggaagccagtcgggatagtcgataattgg	CRISPR spacer
atcggaaaccagtcgggattgtcgatgccgcc	Protospacer
* *****.*********** ******. .

207. spacer 3.24|1721360|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013548 (Rhizobium phaseoli strain R611 plasmid pRetR611a, complete sequence) position: , mismatch: 9, identity: 0.719 

agcggaagccagtcgggatagtcgataattgg	CRISPR spacer
atcggaaaccagtcgggattgtcgatgccgcc	Protospacer
* *****.*********** ******. .

208. spacer 3.24|1721360|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013528 (Rhizobium phaseoli strain R723 plasmid pRphaR723a, complete sequence) position: , mismatch: 9, identity: 0.719 

agcggaagccagtcgggatagtcgataattgg	CRISPR spacer
atcggaaaccagtcgggattgtcgatgccgcc	Protospacer
* *****.*********** ******. .

209. spacer 3.24|1721360|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013533 (Rhizobium phaseoli strain R650 plasmid pRphaR650a, complete sequence) position: , mismatch: 9, identity: 0.719 

agcggaagccagtcgggatagtcgataattgg	CRISPR spacer
atcggaaaccagtcgggattgtcgatgccgcc	Protospacer
* *****.*********** ******. .

210. spacer 3.24|1721360|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013538 (Rhizobium phaseoli strain R630 plasmid pRphaR630a, complete sequence) position: , mismatch: 9, identity: 0.719 

agcggaagccagtcgggatagtcgataattgg	CRISPR spacer
atcggaaaccagtcgggattgtcgatgccgcc	Protospacer
* *****.*********** ******. .

211. spacer 3.24|1721360|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013543 (Rhizobium phaseoli strain R620 plasmid pRphaR620a, complete sequence) position: , mismatch: 9, identity: 0.719 

agcggaagccagtcgggatagtcgataattgg	CRISPR spacer
atcggaaaccagtcgggattgtcgatgccgcc	Protospacer
* *****.*********** ******. .

212. spacer 3.24|1721360|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013564 (Rhizobium phaseoli strain N831 plasmid pRphaN831a, complete sequence) position: , mismatch: 9, identity: 0.719 

agcggaagccagtcgggatagtcgataattgg	CRISPR spacer
atcggaaaccagtcgggattgtcgatgccgcc	Protospacer
* *****.*********** ******. .

213. spacer 3.24|1721360|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013581 (Rhizobium phaseoli strain N261 plasmid pRphaN261a, complete sequence) position: , mismatch: 9, identity: 0.719 

agcggaagccagtcgggatagtcgataattgg	CRISPR spacer
atcggaaaccagtcgggattgtcgatgccgcc	Protospacer
* *****.*********** ******. .

214. spacer 3.24|1721360|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013570 (Rhizobium phaseoli strain N771 plasmid pRphaN771b, complete sequence) position: , mismatch: 9, identity: 0.719 

agcggaagccagtcgggatagtcgataattgg	CRISPR spacer
atcggaaaccagtcgggattgtcgatgccgcc	Protospacer
* *****.*********** ******. .

215. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 9, identity: 0.719 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
gaaaaacatcatcgccaaacaggcgctcggca	Protospacer
.* .**** ***** ************  .*.

216. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to KJ019095 (Synechococcus phage ACG-2014f isolate Syn7803US34, complete genome) position: , mismatch: 9, identity: 0.719 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
tatgaacaacatcgacaacctggcaatggatc	Protospacer
 ***************** * ***. *. *.

217. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to KJ019107 (Synechococcus phage ACG-2014f isolate Syn7803US52, complete genome) position: , mismatch: 9, identity: 0.719 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
tatgaacaacatcgacaacctggcaatggatc	Protospacer
 ***************** * ***. *. *.

218. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to KJ019142 (Synechococcus phage ACG-2014f isolate Syn7803C11, complete genome) position: , mismatch: 9, identity: 0.719 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
tatgaacaacatcgacaacctggcaatggatc	Protospacer
 ***************** * ***. *. *.

219. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to KJ019111 (Synechococcus phage ACG-2014f isolate Syn7803US57, complete genome) position: , mismatch: 9, identity: 0.719 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
tatgaacaacatcgacaacctggcaatggatc	Protospacer
 ***************** * ***. *. *.

220. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to KJ019155 (Synechococcus phage ACG-2014f isolate Syn7803C29, complete genome) position: , mismatch: 9, identity: 0.719 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
tatgaacaacatcgacaacctggcaatggatc	Protospacer
 ***************** * ***. *. *.

221. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to KJ019085 (Synechococcus phage ACG-2014f isolate Syn7803US13, complete genome) position: , mismatch: 9, identity: 0.719 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
tatgaacaacatcgacaacctggcaatggatc	Protospacer
 ***************** * ***. *. *.

222. spacer 3.6|1720279|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to MK448803 (Streptococcus phage Javan551, complete genome) position: , mismatch: 10, identity: 0.688 

atgctggaaaggaaggctggcagaaatgcagt	CRISPR spacer
accaaagaaagaaacgctggcagaaatgcttg	Protospacer
*.   .*****.** **************

223. spacer 3.6|1720279|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to MK448981 (Streptococcus phage Javan548, complete genome) position: , mismatch: 10, identity: 0.688 

atgctggaaaggaaggctggcagaaatgcagt	CRISPR spacer
accaaagaaagaaacgctggcagaaatgcttg	Protospacer
*.   .*****.** **************

224. spacer 3.6|1720279|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to KC348598 (Streptococcus phage phi20c, complete genome) position: , mismatch: 10, identity: 0.688 

atgctggaaaggaaggctggcagaaatgcagt	CRISPR spacer
accaaagaaagaaacgctggcagaaatgcttg	Protospacer
*.   .*****.** **************

225. spacer 3.13|1720700|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 10, identity: 0.688 

gcgcagctccggcaaccgggcgccgcgccatc	CRISPR spacer
cgggccctccgccaaccgggagccgcgccgga	Protospacer
  *   ***** ******** ********.

226. spacer 3.18|1721000|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.688 

atcgccgccgcttcgagccgctgcgcgacgag	CRISPR spacer
tggagggccgcgccgagccgctgcgcgaccat	Protospacer
   .  ***** .**************** *

227. spacer 3.20|1721120|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to KJ829260 (Mycobacterium phage YungJamal, complete genome) position: , mismatch: 10, identity: 0.688 

acatgcgccggttgcgcgccgcggtacccgac	CRISPR spacer
caccccgcccgtcgcgcgccgcggtaccgtgc	Protospacer
   . **** **.***************  .*

228. spacer 3.31|1721780|32|CP020089|CRISPRCasFinder matches to NZ_CP010024 (Paraburkholderia fungorum strain ATCC BAA-463 plasmid pBIL, complete sequence) position: , mismatch: 10, identity: 0.688 

aatgaacaacatcgacaaacaggcgctacacg	CRISPR spacer
tgggctcagcatcgacaaagaggcgctactga	Protospacer
 . *  **.********** *********  .

229. spacer 3.16|1720880|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to MN047793 (Xanthomonas phage Xoo-sp13, complete genome) position: , mismatch: 11, identity: 0.656 

tgacaatatccagatgcttgccagcacctacg	CRISPR spacer
acacaatatccagttgcttgacagcgttgtaa	Protospacer
  *********** ****** ****...   .

230. spacer 3.18|1721000|32|CP020089|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028970 (Aminobacter sp. MSH1 plasmid pUSP2, complete sequence) position: , mismatch: 11, identity: 0.656 

atcgccgccgcttcgagccgctgcgcgacgag	CRISPR spacer
ccaagtgccgcttcgagcagccgcgcgacttc	Protospacer
 . . .************ **.*******

231. spacer 3.30|1721720|32|CP020089|CRISPRCasFinder,CRT matches to NC_010009 (Bacillus megaterium QM B1551 plasmid pBM200, complete sequence) position: , mismatch: 11, identity: 0.656 

gggcaaagacagctgcgctagctctgtgcgga	CRISPR spacer
ccataaagacagctgcgccagctccgtatttc	Protospacer
  ..**************.*****.**..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 613679 : 641674 35 Escherichia_phage(88.89%) capsid,tRNA,integrase,transposase attL 615340:615376|attR 629022:629058
DBSCAN-SWA_2 1196582 : 1302320 108 Enterobacteria_phage(40.48%) capsid,integrase,tail,terminase,tRNA,transposase,portal,plate attL 1231092:1231114|attR 1305807:1305829
DBSCAN-SWA_3 1774433 : 1853238 80 Enterobacteria_phage(31.37%) capsid,head,integrase,tail,terminase,protease,tRNA,portal attL 1768426:1768441|attR 1827296:1827311
DBSCAN-SWA_4 3245365 : 3296530 71 Salmonella_phage(42.86%) head,holin,integrase,tail,lysis,terminase,transposase attL 3288050:3288064|attR 3305139:3305153
DBSCAN-SWA_5 3320663 : 3328626 8 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_6 3535608 : 3544691 7 Pseudomonas_phage(33.33%) holin NA
DBSCAN-SWA_7 4176926 : 4232966 52 Bacillus_phage(16.67%) protease,tRNA,integrase,transposase attL 4176805:4176832|attR 4192411:4192438
DBSCAN-SWA_8 4336223 : 4355727 16 Stx2-converting_phage(42.86%) transposase NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. CP020090
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 17353 : 47021 31 Escherichia_phage(38.46%) transposase NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage