Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP025014 Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence 0 crisprs csa3,DEDDh 0 0 0 0
CP025013 Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence 0 crisprs csa3 0 0 0 0
CP025016 Rhizobium leguminosarum strain Norway plasmid pRLN4, complete sequence 0 crisprs NA 0 0 0 0
CP025012 Rhizobium leguminosarum strain Norway chromosome, complete genome 3 crisprs csa3,WYL,cas3,DEDDh 0 2 5 0
CP025017 Rhizobium leguminosarum strain Norway plasmid pRLN5, complete sequence 0 crisprs NA 0 0 0 0
CP025015 Rhizobium leguminosarum strain Norway plasmid pRLN3, complete sequence 0 crisprs RT 0 0 1 0

Results visualization

1. CP025015
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 280292 : 344724 61 Wolbachia_phage(17.65%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP025012
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025012_1 110994-111137 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025012_2 572929-573014 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025012_3 736515-736596 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP025012_3 3.1|736541|30|CP025012|CRISPRCasFinder 736541-736570 30 NZ_CP020399 Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence 45281-45310 7 0.767
CP025012_3 3.1|736541|30|CP025012|CRISPRCasFinder 736541-736570 30 NZ_CP016289 Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence 1361-1390 8 0.733
CP025012_3 3.1|736541|30|CP025012|CRISPRCasFinder 736541-736570 30 NZ_CP050082 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence 508559-508588 8 0.733
CP025012_3 3.1|736541|30|CP025012|CRISPRCasFinder 736541-736570 30 NZ_CP050099 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence 253387-253416 8 0.733
CP025012_3 3.1|736541|30|CP025012|CRISPRCasFinder 736541-736570 30 NZ_CP050105 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence 470243-470272 8 0.733
CP025012_3 3.1|736541|30|CP025012|CRISPRCasFinder 736541-736570 30 NZ_CP025014 Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence 390838-390867 8 0.733
CP025012_3 3.1|736541|30|CP025012|CRISPRCasFinder 736541-736570 30 NZ_CP049732 Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence 442943-442972 8 0.733
CP025012_3 3.1|736541|30|CP025012|CRISPRCasFinder 736541-736570 30 NZ_CP053441 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence 262194-262223 8 0.733
CP025012_3 3.1|736541|30|CP025012|CRISPRCasFinder 736541-736570 30 NZ_CP006989 Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence 297497-297526 8 0.733
CP025012_3 3.1|736541|30|CP025012|CRISPRCasFinder 736541-736570 30 NZ_CP050110 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence 470245-470274 8 0.733
CP025012_3 3.1|736541|30|CP025012|CRISPRCasFinder 736541-736570 30 NZ_CP048282 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence 327070-327099 8 0.733
CP025012_3 3.1|736541|30|CP025012|CRISPRCasFinder 736541-736570 30 NZ_CP030764 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence 306752-306781 8 0.733
CP025012_3 3.1|736541|30|CP025012|CRISPRCasFinder 736541-736570 30 CP007642 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence 282105-282134 8 0.733
CP025012_3 3.1|736541|30|CP025012|CRISPRCasFinder 736541-736570 30 NZ_CP053208 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence 407160-407189 8 0.733
CP025012_1 1.1|111038|56|CP025012|CRISPRCasFinder 111038-111093 56 NC_011366 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence 132194-132249 9 0.839

1. spacer 3.1|736541|30|CP025012|CRISPRCasFinder matches to NZ_CP020399 (Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cagtgggtgagccgcgatggcgcaacgcgc	CRISPR spacer
acgtccttgagccgcgccggcgcaacgcgc	Protospacer
  **   ********* .************

2. spacer 3.1|736541|30|CP025012|CRISPRCasFinder matches to NZ_CP016289 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733

cagtgggtgagccgcgatggcgcaacgcgc	CRISPR spacer
tgatgggtgagccgcaatggcgcatcatga	Protospacer
...************.******** *..* 

3. spacer 3.1|736541|30|CP025012|CRISPRCasFinder matches to NZ_CP050082 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence) position: , mismatch: 8, identity: 0.733

cagtgggtgagccgcgatggcgcaacgcgc	CRISPR spacer
tgatgggtgagccgcaatggcgcatcatga	Protospacer
...************.******** *..* 

4. spacer 3.1|736541|30|CP025012|CRISPRCasFinder matches to NZ_CP050099 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence) position: , mismatch: 8, identity: 0.733

cagtgggtgagccgcgatggcgcaacgcgc	CRISPR spacer
tgatgggtgagccgcaatggcgcatcatga	Protospacer
...************.******** *..* 

5. spacer 3.1|736541|30|CP025012|CRISPRCasFinder matches to NZ_CP050105 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence) position: , mismatch: 8, identity: 0.733

cagtgggtgagccgcgatggcgcaacgcgc	CRISPR spacer
tgatgggtgagccgcaatggcgcatcatga	Protospacer
...************.******** *..* 

6. spacer 3.1|736541|30|CP025012|CRISPRCasFinder matches to NZ_CP025014 (Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence) position: , mismatch: 8, identity: 0.733

cagtgggtgagccgcgatggcgcaacgcgc	CRISPR spacer
tgatgggtgagccgcaatggcgcatcatga	Protospacer
...************.******** *..* 

7. spacer 3.1|736541|30|CP025012|CRISPRCasFinder matches to NZ_CP049732 (Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence) position: , mismatch: 8, identity: 0.733

cagtgggtgagccgcgatggcgcaacgcgc	CRISPR spacer
tgatgggtgagccgcaatggcgcatcatga	Protospacer
...************.******** *..* 

8. spacer 3.1|736541|30|CP025012|CRISPRCasFinder matches to NZ_CP053441 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence) position: , mismatch: 8, identity: 0.733

cagtgggtgagccgcgatggcgcaacgcgc	CRISPR spacer
tgatgggtgagccgcaatggcgcatcatga	Protospacer
...************.******** *..* 

9. spacer 3.1|736541|30|CP025012|CRISPRCasFinder matches to NZ_CP006989 (Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence) position: , mismatch: 8, identity: 0.733

cagtgggtgagccgcgatggcgcaacgcgc	CRISPR spacer
tgatgggtgagccgcaatggcgcatcatga	Protospacer
...************.******** *..* 

10. spacer 3.1|736541|30|CP025012|CRISPRCasFinder matches to NZ_CP050110 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence) position: , mismatch: 8, identity: 0.733

cagtgggtgagccgcgatggcgcaacgcgc	CRISPR spacer
tgatgggtgagccgcaatggcgcatcatga	Protospacer
...************.******** *..* 

11. spacer 3.1|736541|30|CP025012|CRISPRCasFinder matches to NZ_CP048282 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence) position: , mismatch: 8, identity: 0.733

cagtgggtgagccgcgatggcgcaacgcgc	CRISPR spacer
tgatgggtgagccgcaatggcgcatcatga	Protospacer
...************.******** *..* 

12. spacer 3.1|736541|30|CP025012|CRISPRCasFinder matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.733

cagtgggtgagccgcgatggcgcaacgcgc	CRISPR spacer
tgatgggtgagccgcaatggcgcatcatga	Protospacer
...************.******** *..* 

13. spacer 3.1|736541|30|CP025012|CRISPRCasFinder matches to CP007642 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence) position: , mismatch: 8, identity: 0.733

cagtgggtgagccgcgatggcgcaacgcgc	CRISPR spacer
tgatgggtgagccgcaatggcgcatcatga	Protospacer
...************.******** *..* 

14. spacer 3.1|736541|30|CP025012|CRISPRCasFinder matches to NZ_CP053208 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence) position: , mismatch: 8, identity: 0.733

cagtgggtgagccgcgatggcgcaacgcgc	CRISPR spacer
tgatgggtgagccgcaatggcgcatcatga	Protospacer
...************.******** *..* 

15. spacer 1.1|111038|56|CP025012|CRISPRCasFinder matches to NC_011366 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence) position: , mismatch: 9, identity: 0.839

tgcgctaatgcatgacgcccggaagtgtgcggcggttccgggataacgacatgctc	CRISPR spacer
cataccaatgcatgtcgcccggaagtgtgcagcggttccgggataacgacatgcat	Protospacer
....*.******** ***************.*********************** .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1264795 : 1273841 9 Escherichia_phage(28.57%) NA NA
DBSCAN-SWA_2 1592661 : 1606046 13 uncultured_Mediterranean_phage(90.91%) tRNA NA
DBSCAN-SWA_3 1857168 : 1868021 11 uncultured_Mediterranean_phage(83.33%) NA NA
DBSCAN-SWA_4 3028167 : 3042009 12 Vibrio_phage(25.0%) NA NA
DBSCAN-SWA_5 3988371 : 3998352 9 Mycobacterium_phage(25.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage