Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP014041 Vibrio alginolyticus strain J207 chromosome 2, complete sequence 0 crisprs csa3,RT,cas3,WYL,DEDDh 0 0 0 0
CP014040 Vibrio alginolyticus strain J207 chromosome 1, complete sequence 1 crisprs DinG,csa3,cas3,csx1,DEDDh,PrimPol,WYL,RT 2 1 2 0

Results visualization

1. CP014040
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP014040_1 2658481-2658727 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP014040_1 1.1|2658527|37|CP014040|PILER-CR 2658527-2658563 37 CP014040.1 2658173-2658209 0 1.0
CP014040_1 1.1|2658527|37|CP014040|PILER-CR 2658527-2658563 37 CP014040.1 3011492-3011528 0 1.0
CP014040_1 1.2|2658610|75|CP014040|PILER-CR 2658610-2658684 75 CP014040.1 2658256-2658330 17 0.773

1. spacer 1.1|2658527|37|CP014040|PILER-CR matches to position: 2658173-2658209, mismatch: 0, identity: 1.0

taggtcaccagttcgattccggtagtcggcaccattc	CRISPR spacer
taggtcaccagttcgattccggtagtcggcaccattc	Protospacer
*************************************

2. spacer 1.1|2658527|37|CP014040|PILER-CR matches to position: 3011492-3011528, mismatch: 0, identity: 1.0

taggtcaccagttcgattccggtagtcggcaccattc	CRISPR spacer
taggtcaccagttcgattccggtagtcggcaccattc	Protospacer
*************************************

3. spacer 1.2|2658610|75|CP014040|PILER-CR matches to position: 2658256-2658330, mismatch: 17, identity: 0.773

cgtgtcggtggttcgattccgcctcgaggcaccatatctggtgcacttgcttcataagca	CRISPR spacer
cgtgtcggtggttcgattccgcctcgaggcaccatatttggtgaacttgcttcataagca	Protospacer
*************************************.***** ****************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP014040_1 1.1|2658527|37|CP014040|PILER-CR 2658527-2658563 37 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 296499-296535 2 0.946
CP014040_1 1.1|2658527|37|CP014040|PILER-CR 2658527-2658563 37 NZ_LN868946 Salmonella enterica subsp. enterica serovar Senftenberg strain NCTC10384 plasmid 4, complete sequence 103821-103857 2 0.946
CP014040_1 1.1|2658527|37|CP014040|PILER-CR 2658527-2658563 37 KU052038 Escherichia phage SerU-LTIIb, partial genome 1164-1200 2 0.946
CP014040_1 1.1|2658527|37|CP014040|PILER-CR 2658527-2658563 37 KU052038 Escherichia phage SerU-LTIIb, partial genome 3070-3106 2 0.946
CP014040_1 1.1|2658527|37|CP014040|PILER-CR 2658527-2658563 37 LN997803 Escherichia coli phage phi467 15126-15162 2 0.946
CP014040_1 1.1|2658527|37|CP014040|PILER-CR 2658527-2658563 37 NZ_CP022660 Salmonella enterica subsp. enterica strain RM11060 plasmid pRM11060-2, complete sequence 52078-52114 2 0.946
CP014040_1 1.1|2658527|37|CP014040|PILER-CR 2658527-2658563 37 NZ_CP045061 Salmonella enterica subsp. enterica serovar Muenchen strain LG26 plasmid pLG26p2, complete sequence 52084-52120 2 0.946
CP014040_1 1.1|2658527|37|CP014040|PILER-CR 2658527-2658563 37 NZ_CP045054 Salmonella enterica subsp. enterica serovar Muenchen strain LG24 plasmid pLG24p2, complete sequence 52089-52125 2 0.946
CP014040_1 1.1|2658527|37|CP014040|PILER-CR 2658527-2658563 37 NZ_CP045058 Salmonella enterica subsp. enterica serovar Muenchen strain LG25 plasmid pLG25p2, complete sequence 52088-52124 2 0.946
CP014040_1 1.1|2658527|37|CP014040|PILER-CR 2658527-2658563 37 NC_021742 Serratia liquefaciens ATCC 27592 plasmid unnamed, complete sequence 35428-35464 2 0.946
CP014040_1 1.1|2658527|37|CP014040|PILER-CR 2658527-2658563 37 MH791411 UNVERIFIED: Escherichia phage Ecwhy_1, complete genome 13645-13681 2 0.946
CP014040_1 1.1|2658527|37|CP014040|PILER-CR 2658527-2658563 37 MH494197 Escherichia phage CMSTMSU, complete genome 196772-196808 2 0.946
CP014040_1 1.1|2658527|37|CP014040|PILER-CR 2658527-2658563 37 NZ_CP023526 Cedecea neteri strain FDAARGOS_392 plasmid unnamed, complete sequence 1927-1963 3 0.919
CP014040_1 1.1|2658527|37|CP014040|PILER-CR 2658527-2658563 37 NZ_CP054057 Scandinavium goeteborgense strain CCUG 66741 plasmid pSg66741_1, complete sequence 85817-85853 3 0.919
CP014040_1 1.1|2658527|37|CP014040|PILER-CR 2658527-2658563 37 KY653118 Morganella phage IME1369_01, complete genome 698-734 4 0.892
CP014040_1 1.1|2658527|37|CP014040|PILER-CR 2658527-2658563 37 LC494302 Escherichia phage SP27 DNA, complete genome 76611-76647 5 0.865
CP014040_1 1.1|2658527|37|CP014040|PILER-CR 2658527-2658563 37 LT603033 Escherichia phage vB_Eco_slurp01 genome assembly, chromosome: I 17117-17153 5 0.865
CP014040_1 1.1|2658527|37|CP014040|PILER-CR 2658527-2658563 37 NC_027364 Escherichia phage PBECO 4, complete genome 207832-207868 5 0.865
CP014040_1 1.1|2658527|37|CP014040|PILER-CR 2658527-2658563 37 NC_049942 Escherichia phage JLK-2012, complete sequence 23524-23560 5 0.865
CP014040_1 1.1|2658527|37|CP014040|PILER-CR 2658527-2658563 37 MK817115 Escherichia phage vB_EcoM_phAPEC6, complete genome 52945-52981 6 0.838
CP014040_1 1.1|2658527|37|CP014040|PILER-CR 2658527-2658563 37 MH383160 Escherichia phage UB, complete genome 272124-272160 6 0.838
CP014040_1 1.1|2658527|37|CP014040|PILER-CR 2658527-2658563 37 MK327931 Escherichia phage vB_EcoM_G17, complete genome 77929-77965 6 0.838
CP014040_1 1.1|2658527|37|CP014040|PILER-CR 2658527-2658563 37 KM507819 Escherichia phage 121Q, complete genome 77938-77974 7 0.811

1. spacer 1.1|2658527|37|CP014040|PILER-CR matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 2, identity: 0.946

taggtcaccagttcgattccggtagtcggcaccattc	CRISPR spacer
taggtcaccagttcgattccggtagtcggcaccatat	Protospacer
*********************************** .

2. spacer 1.1|2658527|37|CP014040|PILER-CR matches to NZ_LN868946 (Salmonella enterica subsp. enterica serovar Senftenberg strain NCTC10384 plasmid 4, complete sequence) position: , mismatch: 2, identity: 0.946

taggtcaccagttcgattccggtagtcggcaccattc	CRISPR spacer
taggtcaccagttcgattccggtagtcggcaccatca	Protospacer
***********************************. 

3. spacer 1.1|2658527|37|CP014040|PILER-CR matches to KU052038 (Escherichia phage SerU-LTIIb, partial genome) position: , mismatch: 2, identity: 0.946

taggtcaccagttcgattccggtagtcggcaccattc	CRISPR spacer
taggtcaccagttcgattccggtagtcggcaccatat	Protospacer
*********************************** .

4. spacer 1.1|2658527|37|CP014040|PILER-CR matches to KU052038 (Escherichia phage SerU-LTIIb, partial genome) position: , mismatch: 2, identity: 0.946

taggtcaccagttcgattccggtagtcggcaccattc	CRISPR spacer
taggtcaccagttcgattccggtagtcggcaccatat	Protospacer
*********************************** .

5. spacer 1.1|2658527|37|CP014040|PILER-CR matches to LN997803 (Escherichia coli phage phi467) position: , mismatch: 2, identity: 0.946

taggtcaccagttcgattccggtagtcggcaccattc	CRISPR spacer
taggtcaccagttcgattccggtagtcggcaccatat	Protospacer
*********************************** .

6. spacer 1.1|2658527|37|CP014040|PILER-CR matches to NZ_CP022660 (Salmonella enterica subsp. enterica strain RM11060 plasmid pRM11060-2, complete sequence) position: , mismatch: 2, identity: 0.946

taggtcaccagttcgattccggtagtcggcaccattc	CRISPR spacer
taggtcaccagttcgattccggtagtcggcaccactt	Protospacer
**********************************.*.

7. spacer 1.1|2658527|37|CP014040|PILER-CR matches to NZ_CP045061 (Salmonella enterica subsp. enterica serovar Muenchen strain LG26 plasmid pLG26p2, complete sequence) position: , mismatch: 2, identity: 0.946

taggtcaccagttcgattccggtagtcggcaccattc	CRISPR spacer
taggtcaccagttcgattccggtagtcggcaccactt	Protospacer
**********************************.*.

8. spacer 1.1|2658527|37|CP014040|PILER-CR matches to NZ_CP045054 (Salmonella enterica subsp. enterica serovar Muenchen strain LG24 plasmid pLG24p2, complete sequence) position: , mismatch: 2, identity: 0.946

taggtcaccagttcgattccggtagtcggcaccattc	CRISPR spacer
taggtcaccagttcgattccggtagtcggcaccactt	Protospacer
**********************************.*.

9. spacer 1.1|2658527|37|CP014040|PILER-CR matches to NZ_CP045058 (Salmonella enterica subsp. enterica serovar Muenchen strain LG25 plasmid pLG25p2, complete sequence) position: , mismatch: 2, identity: 0.946

taggtcaccagttcgattccggtagtcggcaccattc	CRISPR spacer
taggtcaccagttcgattccggtagtcggcaccactt	Protospacer
**********************************.*.

10. spacer 1.1|2658527|37|CP014040|PILER-CR matches to NC_021742 (Serratia liquefaciens ATCC 27592 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.946

taggtcaccagttcgattccggtagtcggcaccattc	CRISPR spacer
taggtcaccagttcgattccggtagccggcaccaatc	Protospacer
*************************.******** **

11. spacer 1.1|2658527|37|CP014040|PILER-CR matches to MH791411 (UNVERIFIED: Escherichia phage Ecwhy_1, complete genome) position: , mismatch: 2, identity: 0.946

taggtcaccagttcgattccggtagtcggcaccattc	CRISPR spacer
taggtcaccagttcgattccggtagtcggcacaaatc	Protospacer
******************************** * **

12. spacer 1.1|2658527|37|CP014040|PILER-CR matches to MH494197 (Escherichia phage CMSTMSU, complete genome) position: , mismatch: 2, identity: 0.946

taggtcaccagttcgattccggtagtcggcaccattc	CRISPR spacer
taggtcaccagttcgattccggtagtcggcacaaatc	Protospacer
******************************** * **

13. spacer 1.1|2658527|37|CP014040|PILER-CR matches to NZ_CP023526 (Cedecea neteri strain FDAARGOS_392 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.919

taggtcaccagttcgattccggtagtcggcaccattc	CRISPR spacer
taggtcaccagttcgattccggtagtcggcaccagaa	Protospacer
**********************************   

14. spacer 1.1|2658527|37|CP014040|PILER-CR matches to NZ_CP054057 (Scandinavium goeteborgense strain CCUG 66741 plasmid pSg66741_1, complete sequence) position: , mismatch: 3, identity: 0.919

taggtcaccagttcgattccggtagtcggcaccattc	CRISPR spacer
taggtcaccagttcgattccggtagtcggcaccaaat	Protospacer
**********************************  .

15. spacer 1.1|2658527|37|CP014040|PILER-CR matches to KY653118 (Morganella phage IME1369_01, complete genome) position: , mismatch: 4, identity: 0.892

taggtcaccagttcgattccggtagtcggcaccattc	CRISPR spacer
taggtcaccagttcgactccggtagccggcaccatat	Protospacer
****************.********.********* .

16. spacer 1.1|2658527|37|CP014040|PILER-CR matches to LC494302 (Escherichia phage SP27 DNA, complete genome) position: , mismatch: 5, identity: 0.865

taggtcaccagttcgattccggtagtcggcaccattc	CRISPR spacer
aaggtcaccagttcgattccggtagtcggcacaaaat	Protospacer
 ******************************* *  .

17. spacer 1.1|2658527|37|CP014040|PILER-CR matches to LT603033 (Escherichia phage vB_Eco_slurp01 genome assembly, chromosome: I) position: , mismatch: 5, identity: 0.865

taggtcaccagttcgattccggtagtcggcaccattc	CRISPR spacer
aaggtcaccagttcgattccggtagtcggcacaaaat	Protospacer
 ******************************* *  .

18. spacer 1.1|2658527|37|CP014040|PILER-CR matches to NC_027364 (Escherichia phage PBECO 4, complete genome) position: , mismatch: 5, identity: 0.865

taggtcaccagttcgattccggtagtcggcaccattc	CRISPR spacer
aaggtcaccagttcgattccggtagtcggcacaaaat	Protospacer
 ******************************* *  .

19. spacer 1.1|2658527|37|CP014040|PILER-CR matches to NC_049942 (Escherichia phage JLK-2012, complete sequence) position: , mismatch: 5, identity: 0.865

taggtcaccagttcgattccggtagtcggcaccattc	CRISPR spacer
caggtcgccagttcgattccggtagccggcaccatat	Protospacer
.*****.******************.********* .

20. spacer 1.1|2658527|37|CP014040|PILER-CR matches to MK817115 (Escherichia phage vB_EcoM_phAPEC6, complete genome) position: , mismatch: 6, identity: 0.838

taggtcaccagttcgattccggtagtcggcaccattc	CRISPR spacer
aatgtcaccagttcgattccggtagtcggcacaaaat	Protospacer
 * ***************************** *  .

21. spacer 1.1|2658527|37|CP014040|PILER-CR matches to MH383160 (Escherichia phage UB, complete genome) position: , mismatch: 6, identity: 0.838

taggtcaccagttcgattccggtagtcggcaccattc	CRISPR spacer
aatgtcaccagttcgattccggtagtcggcacaaaat	Protospacer
 * ***************************** *  .

22. spacer 1.1|2658527|37|CP014040|PILER-CR matches to MK327931 (Escherichia phage vB_EcoM_G17, complete genome) position: , mismatch: 6, identity: 0.838

taggtcaccagttcgattccggtagtcggcaccattc	CRISPR spacer
aatgtcaccagttcgattccggtagtcggcacaaaat	Protospacer
 * ***************************** *  .

23. spacer 1.1|2658527|37|CP014040|PILER-CR matches to KM507819 (Escherichia phage 121Q, complete genome) position: , mismatch: 7, identity: 0.811

taggtcaccagttcgattccggtagtcggcaccattc	CRISPR spacer
aatgtcaccagttcaattccggtagtcggcacaaaat	Protospacer
 * ***********.***************** *  .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 447800 : 454584 7 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_2 2578064 : 2595238 15 uncultured_Mediterranean_phage(18.18%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage