Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP026836 Shigella boydii strain ATCC 49812 chromosome, complete genome 5 crisprs NA 0 5 0 0
CP026837 Shigella boydii strain ATCC 49812 plasmid unnamed, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. CP026836
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026836_1 56597-56714 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026836_2 1082618-1082741 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026836_3 2677468-2677583 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026836_4 2701059-2701191 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026836_5 4632220-4632553 Orphan I-E
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP026836_3 3.1|2677499|54|CP026836|CRISPRCasFinder 2677499-2677552 54 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 165411-165464 1 0.981
CP026836_4 4.1|2701076|42|CP026836|PILER-CR 2701076-2701117 42 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141085-141126 1 0.976
CP026836_2 2.1|1082661|38|CP026836|CRISPRCasFinder 1082661-1082698 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
CP026836_4 4.2|2701135|40|CP026836|PILER-CR 2701135-2701174 40 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141028-141067 2 0.95
CP026836_5 5.1|4632249|32|CP026836|PILER-CR,CRISPRCasFinder 4632249-4632280 32 NZ_CP045959 Salmonella enterica subsp. enterica serovar Birkenhead strain AUSMDU00010532 plasmid pAUSMDU00010532_01, complete sequence 26456-26487 9 0.719
CP026836_3 3.1|2677499|54|CP026836|CRISPRCasFinder 2677499-2677552 54 NZ_CP048385 Citrobacter freundii strain 62 plasmid p6_C, complete sequence 72431-72484 12 0.778

1. spacer 3.1|2677499|54|CP026836|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 1, identity: 0.981

tggcctacacgctgcgattttgtaggccggataagcaaagcgcatccggcattc	CRISPR spacer
tggcctacacgctgcgattttgtaggccggataagcaaagcgcatccggcattg	Protospacer
***************************************************** 

2. spacer 4.1|2701076|42|CP026836|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 1, identity: 0.976

tgtcacacgcagataaatccaactttcaatattgttaagtcc	CRISPR spacer
tgtcacacgcagataaatccaactttcaatattgttaagttc	Protospacer
****************************************.*

3. spacer 2.1|1082661|38|CP026836|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

ttggttcgagtccaattgaacgcaccatcctgcgtccg	CRISPR spacer
ttggttcgagtccaattgaacgcaccattctgcgtctg	Protospacer
****************************.*******.*

4. spacer 4.2|2701135|40|CP026836|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 2, identity: 0.95

catggcgtagcaaaaagaaattttcaatattgttttatgg	CRISPR spacer
catggcgtagaaaaaagaaattttcaatattgctttatgg	Protospacer
********** *********************.*******

5. spacer 5.1|4632249|32|CP026836|PILER-CR,CRISPRCasFinder matches to NZ_CP045959 (Salmonella enterica subsp. enterica serovar Birkenhead strain AUSMDU00010532 plasmid pAUSMDU00010532_01, complete sequence) position: , mismatch: 9, identity: 0.719

ttgccggtacagctccagcattaatccccacc	CRISPR spacer
ctgccggtacagctccggcagtaaaattgtcc	Protospacer
.***************.*** ***  ..  **

6. spacer 3.1|2677499|54|CP026836|CRISPRCasFinder matches to NZ_CP048385 (Citrobacter freundii strain 62 plasmid p6_C, complete sequence) position: , mismatch: 12, identity: 0.778

tggcctacacgct-----gcgattttgtaggccggataagcaaagcgcatccggcattc	CRISPR spacer
-----tacaaattaattcgcggtattgtaggccggataagcaaagcgcatccggcagta	Protospacer
     **** ..*     ***.* ******************************** * 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage