Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP026829 Shigella dysenteriae strain ATCC 12037 plasmid unnamed, complete sequence 0 crisprs NA 0 0 0 0
CP026828 Shigella dysenteriae strain ATCC 12037 chromosome, complete genome 2 crisprs NA 0 2 0 0

Results visualization

1. CP026828
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026828_1 1635424-1635539 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026828_2 3178175-3178298 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP026828_1 1.1|1635455|54|CP026828|CRISPRCasFinder 1635455-1635508 54 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 165411-165464 1 0.981
CP026828_2 2.1|3178218|38|CP026828|CRISPRCasFinder 3178218-3178255 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
CP026828_1 1.1|1635455|54|CP026828|CRISPRCasFinder 1635455-1635508 54 NZ_CP048385 Citrobacter freundii strain 62 plasmid p6_C, complete sequence 72431-72484 12 0.778

1. spacer 1.1|1635455|54|CP026828|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 1, identity: 0.981

gaatgccggatgcgctttgcttatccggcctacaaaatcgcagcgtgtaggcca	CRISPR spacer
caatgccggatgcgctttgcttatccggcctacaaaatcgcagcgtgtaggcca	Protospacer
 *****************************************************

2. spacer 2.1|3178218|38|CP026828|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

3. spacer 1.1|1635455|54|CP026828|CRISPRCasFinder matches to NZ_CP048385 (Citrobacter freundii strain 62 plasmid p6_C, complete sequence) position: , mismatch: 12, identity: 0.778

gaatgccggatgcgctttgcttatccggcctacaaaatcgc-----agcgtgtaggcca	CRISPR spacer
tactgccggatgcgctttgcttatccggcctacaataccgcgaattaatttgta-----	Protospacer
 * ******************************** *.***     *.. ****     

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage