Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP026777 Shigella dysenteriae strain 69-3818 chromosome, complete genome 2 crisprs NA 0 2 0 0
CP026778 Shigella dysenteriae strain 69-3818 plasmid unnamed1 0 crisprs NA 0 0 0 0
CP026779 Shigella dysenteriae strain 69-3818 plasmid unnamed2, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. CP026777
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026777_1 1834752-1834891 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026777_2 3117836-3117927 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP026777_2 2.1|3117862|40|CP026777|CRISPRCasFinder 3117862-3117901 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 2 0.95
CP026777_1 1.1|1834796|52|CP026777|CRISPRCasFinder 1834796-1834847 52 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 12113-12164 10 0.808
CP026777_1 1.1|1834796|52|CP026777|CRISPRCasFinder 1834796-1834847 52 MT230402 Escherichia coli strain DH5alpha plasmid pESBL87, complete sequence 272-323 10 0.808
CP026777_1 1.1|1834796|52|CP026777|CRISPRCasFinder 1834796-1834847 52 NZ_AP023207 Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence 31252-31303 10 0.808
CP026777_1 1.1|1834796|52|CP026777|CRISPRCasFinder 1834796-1834847 52 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4115-4166 11 0.788
CP026777_1 1.1|1834796|52|CP026777|CRISPRCasFinder 1834796-1834847 52 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4114-4165 11 0.788
CP026777_1 1.1|1834796|52|CP026777|CRISPRCasFinder 1834796-1834847 52 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4114-4165 11 0.788
CP026777_1 1.1|1834796|52|CP026777|CRISPRCasFinder 1834796-1834847 52 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4114-4165 11 0.788
CP026777_1 1.1|1834796|52|CP026777|CRISPRCasFinder 1834796-1834847 52 MT230312 Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence 152-203 11 0.788
CP026777_1 1.1|1834796|52|CP026777|CRISPRCasFinder 1834796-1834847 52 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 208982-209033 12 0.769
CP026777_1 1.1|1834796|52|CP026777|CRISPRCasFinder 1834796-1834847 52 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 44-95 12 0.769
CP026777_1 1.1|1834796|52|CP026777|CRISPRCasFinder 1834796-1834847 52 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 219476-219527 12 0.769
CP026777_1 1.1|1834796|52|CP026777|CRISPRCasFinder 1834796-1834847 52 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 43-94 12 0.769
CP026777_1 1.1|1834796|52|CP026777|CRISPRCasFinder 1834796-1834847 52 NZ_CP044307 Escherichia coli strain C27A plasmid pC27A-2, complete sequence 18332-18383 12 0.769
CP026777_1 1.1|1834796|52|CP026777|CRISPRCasFinder 1834796-1834847 52 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 210310-210361 12 0.769
CP026777_1 1.1|1834796|52|CP026777|CRISPRCasFinder 1834796-1834847 52 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 43-94 12 0.769
CP026777_1 1.1|1834796|52|CP026777|CRISPRCasFinder 1834796-1834847 52 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 191265-191316 12 0.769
CP026777_1 1.1|1834796|52|CP026777|CRISPRCasFinder 1834796-1834847 52 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 43-94 12 0.769
CP026777_1 1.1|1834796|52|CP026777|CRISPRCasFinder 1834796-1834847 52 NZ_CP044147 Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2 7393-7444 12 0.769
CP026777_1 1.1|1834796|52|CP026777|CRISPRCasFinder 1834796-1834847 52 CP044351 Escherichia coli strain 194195 plasmid p194195_1, complete sequence 84217-84268 12 0.769
CP026777_1 1.1|1834796|52|CP026777|CRISPRCasFinder 1834796-1834847 52 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 3373-3424 13 0.75
CP026777_1 1.1|1834796|52|CP026777|CRISPRCasFinder 1834796-1834847 52 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 3372-3423 13 0.75
CP026777_1 1.1|1834796|52|CP026777|CRISPRCasFinder 1834796-1834847 52 NZ_CP044307 Escherichia coli strain C27A plasmid pC27A-2, complete sequence 15000-15051 13 0.75
CP026777_1 1.1|1834796|52|CP026777|CRISPRCasFinder 1834796-1834847 52 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 3372-3423 13 0.75
CP026777_1 1.1|1834796|52|CP026777|CRISPRCasFinder 1834796-1834847 52 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 3372-3423 13 0.75
CP026777_1 1.1|1834796|52|CP026777|CRISPRCasFinder 1834796-1834847 52 NZ_AP023209 Escherichia coli strain TUM18781 plasmid pMTY18781-4, complete sequence 70-121 14 0.731
CP026777_1 1.1|1834796|52|CP026777|CRISPRCasFinder 1834796-1834847 52 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 30159-30210 14 0.731

1. spacer 2.1|3117862|40|CP026777|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 2, identity: 0.95

acagcacagcggggggaatttcaagaatgatccgcagcgc	CRISPR spacer
acagcacagcgggggtaatttcaagaatgacccgcagcgc	Protospacer
*************** **************.*********

2. spacer 1.1|1834796|52|CP026777|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 10, identity: 0.808

gccttgcctgatgcgacgctgtcgcgtcttatcaggcctacgagttcagtgc	CRISPR spacer
tcggtgcctgatgcgacgctggcgcgtcttatcaggcctacgagtcgcccgt	Protospacer
 *  ***************** ***********************.   .*.

3. spacer 1.1|1834796|52|CP026777|CRISPRCasFinder matches to MT230402 (Escherichia coli strain DH5alpha plasmid pESBL87, complete sequence) position: , mismatch: 10, identity: 0.808

gccttgcctgatgcgacgctgtcgcgtcttatcaggcctacgagttcagtgc-	CRISPR spacer
tcaatgcctgatgcgacgctgtcgcgtcttatcaggcctacaaa-ccgttacc	Protospacer
 *  *************************************.*. .*. *.* 

4. spacer 1.1|1834796|52|CP026777|CRISPRCasFinder matches to NZ_AP023207 (Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence) position: , mismatch: 10, identity: 0.808

gccttgcctgatgcgacgctgtcgcgtcttatcaggcctacgagttcagtgc--	CRISPR spacer
tcaatgcctgatgcgacgctgtcgcgtcttatcaggcctacag--ccgttgcca	Protospacer
 *  *************************************..  .*. ***  

5. spacer 1.1|1834796|52|CP026777|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 11, identity: 0.788

gccttgcctgatgcgacgctgtcgcgtcttatcaggcctacgagttcagtgc-	CRISPR spacer
cagatgcctgatgcgacgctggcgcgtcttatcatgcctacaaactt-gtgcc	Protospacer
    ***************** ************ ******.*..*. **** 

6. spacer 1.1|1834796|52|CP026777|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 11, identity: 0.788

gccttgcctgatgcgacgctgtcgcgtcttatcaggcctacgagttcagtgc-	CRISPR spacer
cagatgcctgatgcgacgctggcgcgtcttatcatgcctacaaactt-gtgcc	Protospacer
    ***************** ************ ******.*..*. **** 

7. spacer 1.1|1834796|52|CP026777|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 11, identity: 0.788

gccttgcctgatgcgacgctgtcgcgtcttatcaggcctacgagttcagtgc-	CRISPR spacer
cagatgcctgatgcgacgctggcgcgtcttatcatgcctacaaactt-gtgcc	Protospacer
    ***************** ************ ******.*..*. **** 

8. spacer 1.1|1834796|52|CP026777|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 11, identity: 0.788

gccttgcctgatgcgacgctgtcgcgtcttatcaggcctacgagttcagtgc-	CRISPR spacer
cagatgcctgatgcgacgctggcgcgtcttatcatgcctacaaactt-gtgcc	Protospacer
    ***************** ************ ******.*..*. **** 

9. spacer 1.1|1834796|52|CP026777|CRISPRCasFinder matches to MT230312 (Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence) position: , mismatch: 11, identity: 0.788

gccttgcctgatgcgacgctgtcgcgtcttatcaggcctacgagttcagtgc	CRISPR spacer
ttgaagcctgatgcgacgctgacgcgtcttatcaggcctacnagacccgagc	Protospacer
 .   **************** ******************* ** .* * **

10. spacer 1.1|1834796|52|CP026777|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.769

gccttgcctgatgcgacgctgtcgcgtcttatcaggcctacgagttcagtgc----	CRISPR spacer
cagatgcctgatgcgacgctgacgcgtcttatcaggcctac----ccactgttttt	Protospacer
    ***************** *******************    .** **.    

11. spacer 1.1|1834796|52|CP026777|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.769

gccttgcctgatgcgacgctgtcgcgtcttatcaggcctacgagttcagtgc-	CRISPR spacer
ctgatgcctgatgcgacgctgacgcgtcttatcatgcctacaaatct-gtacg	Protospacer
 .  ***************** ************ ******.*.*.. **.* 

12. spacer 1.1|1834796|52|CP026777|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.769

gccttgcctgatgcgacgctgtcgcgtcttatcaggcctacgagttcagtgc----	CRISPR spacer
cagatgcctgatgcgacgctgacgcgtcttatcaggcctac----ccactgttttt	Protospacer
    ***************** *******************    .** **.    

13. spacer 1.1|1834796|52|CP026777|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.769

gccttgcctgatgcgacgctgtcgcgtcttatcaggcctacgagttcagtgc-	CRISPR spacer
ctgatgcctgatgcgacgctgacgcgtcttatcatgcctacaaatct-gtacg	Protospacer
 .  ***************** ************ ******.*.*.. **.* 

14. spacer 1.1|1834796|52|CP026777|CRISPRCasFinder matches to NZ_CP044307 (Escherichia coli strain C27A plasmid pC27A-2, complete sequence) position: , mismatch: 12, identity: 0.769

gccttgcctgatgcgacgctgtcgcgtcttatcaggcctacgagttcagtgc-	CRISPR spacer
ctgatgcctgatgcgacgctgacgcgtcttatcatgcctacaaatct-gtacg	Protospacer
 .  ***************** ************ ******.*.*.. **.* 

15. spacer 1.1|1834796|52|CP026777|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.769

gccttgcctgatgcgacgctgtcgcgtcttatcaggcctacgagttcagtgc----	CRISPR spacer
cagatgcctgatgcgacgctgacgcgtcttatcaggcctac----ccactgttttt	Protospacer
    ***************** *******************    .** **.    

16. spacer 1.1|1834796|52|CP026777|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.769

gccttgcctgatgcgacgctgtcgcgtcttatcaggcctacgagttcagtgc-	CRISPR spacer
ctgatgcctgatgcgacgctgacgcgtcttatcatgcctacaaatct-gtacg	Protospacer
 .  ***************** ************ ******.*.*.. **.* 

17. spacer 1.1|1834796|52|CP026777|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.769

gccttgcctgatgcgacgctgtcgcgtcttatcaggcctacgagttcagtgc----	CRISPR spacer
cagatgcctgatgcgacgctgacgcgtcttatcaggcctac----ccactgttttt	Protospacer
    ***************** *******************    .** **.    

18. spacer 1.1|1834796|52|CP026777|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.769

gccttgcctgatgcgacgctgtcgcgtcttatcaggcctacgagttcagtgc-	CRISPR spacer
ctgatgcctgatgcgacgctgacgcgtcttatcatgcctacaaatct-gtacg	Protospacer
 .  ***************** ************ ******.*.*.. **.* 

19. spacer 1.1|1834796|52|CP026777|CRISPRCasFinder matches to NZ_CP044147 (Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2) position: , mismatch: 12, identity: 0.769

gccttgcctgatgcgacgctgtcgcgtcttatcaggcctacgagttcagtgc---	CRISPR spacer
cggatgcctgatgcgacgctggcgcgtcttatcatgcctacaaa---actgcact	Protospacer
    ***************** ************ ******.*.   * ***   

20. spacer 1.1|1834796|52|CP026777|CRISPRCasFinder matches to CP044351 (Escherichia coli strain 194195 plasmid p194195_1, complete sequence) position: , mismatch: 12, identity: 0.769

gccttgcctgatgcgacgctgtcgcgtcttatcaggcctacgagttcagtgc---	CRISPR spacer
cggatgcctgatgcgacgctggcgcgtcttatcatgcctacaaa---actgcact	Protospacer
    ***************** ************ ******.*.   * ***   

21. spacer 1.1|1834796|52|CP026777|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 13, identity: 0.75

gccttgcctgatgcgacgctgtcgcgtcttatcaggcctacgagttcagtgc	CRISPR spacer
caggtgcctgatgcgacgctggcgcgtcttatcatgcctacgagcccgcgaa	Protospacer
    ***************** ************ *********..*.  . 

22. spacer 1.1|1834796|52|CP026777|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 13, identity: 0.75

gccttgcctgatgcgacgctgtcgcgtcttatcaggcctacgagttcagtgc	CRISPR spacer
caggtgcctgatgcgacgctggcgcgtcttatcatgcctacgagcccgcgaa	Protospacer
    ***************** ************ *********..*.  . 

23. spacer 1.1|1834796|52|CP026777|CRISPRCasFinder matches to NZ_CP044307 (Escherichia coli strain C27A plasmid pC27A-2, complete sequence) position: , mismatch: 13, identity: 0.75

gccttgcctgatgcgacgctgtcgcgtcttatcaggcctacgagttcagtgc	CRISPR spacer
caggtgcctgatgcgacgctggcgcgtcttatcatgcctacgagcccgcgaa	Protospacer
    ***************** ************ *********..*.  . 

24. spacer 1.1|1834796|52|CP026777|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 13, identity: 0.75

gccttgcctgatgcgacgctgtcgcgtcttatcaggcctacgagttcagtgc	CRISPR spacer
caggtgcctgatgcgacgctggcgcgtcttatcatgcctacgagcccgcgaa	Protospacer
    ***************** ************ *********..*.  . 

25. spacer 1.1|1834796|52|CP026777|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 13, identity: 0.75

gccttgcctgatgcgacgctgtcgcgtcttatcaggcctacgagttcagtgc	CRISPR spacer
caggtgcctgatgcgacgctggcgcgtcttatcatgcctacgagcccgcgaa	Protospacer
    ***************** ************ *********..*.  . 

26. spacer 1.1|1834796|52|CP026777|CRISPRCasFinder matches to NZ_AP023209 (Escherichia coli strain TUM18781 plasmid pMTY18781-4, complete sequence) position: , mismatch: 14, identity: 0.731

gccttgcctgatgcgacgctgtcgcgtcttatcaggcctacgagttcagtgc	CRISPR spacer
ccgatgcctgatgcgacgctgacgcgtcttatcatgcctacggacctgaacc	Protospacer
 *  ***************** ************ *******.......  *

27. spacer 1.1|1834796|52|CP026777|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 14, identity: 0.731

gccttgcctgatgcgacgctgtcgcgtcttatcaggcctacgagttcagtgc	CRISPR spacer
ctgatgcctgatgcgacgctgacgcgtcttatcatgcctacaatctgcaccc	Protospacer
 .  ***************** ************ ******.* .*  .. *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage