Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP026724 Escherichia coli strain 266917_2 plasmid p266917_2_01, complete sequence 0 crisprs NA 0 0 0 0
CP026723 Escherichia coli strain 266917_2 chromosome, complete genome 4 crisprs NA 0 23 0 0
CP026727 Escherichia coli strain 266917_2 plasmid p266917_2_04, complete sequence 0 crisprs NA 0 0 0 0
CP026725 Escherichia coli strain 266917_2 plasmid p266917_2_02, complete sequence 0 crisprs NA 0 0 0 0
CP026728 Escherichia coli strain 266917_2 plasmid p266917_2_05, complete sequence 0 crisprs NA 0 0 0 0
CP026726 Escherichia coli strain 266917_2 plasmid p266917_2_03, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. CP026723
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026723_1 1830646-1831284 Orphan I-E
10 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026723_2 1858421-1859425 Orphan I-E
16 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026723_3 4574093-4574234 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026723_4 5030333-5030421 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP026723_1 1.1|1830675|32|CP026723|PILER-CR,CRISPRCasFinder,CRT 1830675-1830706 32 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 246876-246907 0 1.0
CP026723_1 1.2|1830736|32|CP026723|PILER-CR,CRISPRCasFinder,CRT 1830736-1830767 32 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 246815-246846 0 1.0
CP026723_1 1.3|1830797|32|CP026723|PILER-CR,CRISPRCasFinder,CRT 1830797-1830828 32 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 246754-246785 0 1.0
CP026723_1 1.4|1830858|32|CP026723|PILER-CR,CRISPRCasFinder,CRT 1830858-1830889 32 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 246693-246724 0 1.0
CP026723_1 1.5|1830919|32|CP026723|PILER-CR,CRISPRCasFinder,CRT 1830919-1830950 32 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 246632-246663 0 1.0
CP026723_1 1.6|1830980|32|CP026723|PILER-CR,CRISPRCasFinder,CRT 1830980-1831011 32 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 246571-246602 0 1.0
CP026723_1 1.7|1831041|32|CP026723|PILER-CR,CRISPRCasFinder,CRT 1831041-1831072 32 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 246510-246541 0 1.0
CP026723_1 1.8|1831102|32|CP026723|PILER-CR,CRISPRCasFinder,CRT 1831102-1831133 32 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 246449-246480 0 1.0
CP026723_1 1.9|1831163|32|CP026723|PILER-CR,CRISPRCasFinder,CRT 1831163-1831194 32 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 246449-246480 0 1.0
CP026723_1 1.10|1831224|32|CP026723|PILER-CR,CRISPRCasFinder,CRT 1831224-1831255 32 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 246388-246419 0 1.0
CP026723_2 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1859365-1859396 32 NZ_CP048306 Escherichia coli strain 9 plasmid p009_B, complete sequence 85745-85776 0 1.0
CP026723_2 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1859365-1859396 32 NZ_CP025883 Escherichia coli strain 503440 plasmid p503440_100, complete sequence 74209-74240 1 0.969
CP026723_2 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1859365-1859396 32 NZ_CP025894 Escherichia coli strain 503025 plasmid p503025_100, complete sequence 77020-77051 1 0.969
CP026723_2 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1859365-1859396 32 NZ_CP025868 Escherichia coli strain 504211 plasmid p504211_100, complete sequence 18988-19019 1 0.969
CP026723_2 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1859365-1859396 32 CP043018 Escherichia coli strain 388808_gen plasmid unnamed3, complete sequence 7820-7851 1 0.969
CP026723_2 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1859365-1859396 32 NZ_CP023851 Escherichia coli strain 4/0 plasmid p4_0.2, complete sequence 85863-85894 1 0.969
CP026723_2 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1859365-1859396 32 NZ_AP017612 Escherichia coli strain 20Ec-P-124 plasmid pMRY16-002_2, complete sequence 84770-84801 1 0.969
CP026723_2 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1859365-1859396 32 NZ_CP025870 Escherichia coli strain 503829 plasmid p503829_100, complete sequence 91177-91208 1 0.969
CP026723_2 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1859365-1859396 32 NZ_CP028430 Escherichia coli strain RM9131 plasmid pRM9131-1, complete sequence 36203-36234 1 0.969
CP026723_2 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1859365-1859396 32 NZ_CP053233 Escherichia coli strain SCU-306 plasmid pSCU-306-2, complete sequence 88329-88360 1 0.969
CP026723_2 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1859365-1859396 32 NZ_CP019013 Escherichia coli strain Ecol_AZ162 plasmid pECAZ162_2, complete sequence 33813-33844 1 0.969
CP026723_2 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1859365-1859396 32 CP025897 Escherichia coli strain 500465 plasmid p500465_152, complete sequence 147147-147178 1 0.969
CP026723_2 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1859365-1859396 32 NZ_CP019027 Escherichia coli strain Ecol_881 plasmid pEC881_2, complete sequence 57925-57956 1 0.969
CP026723_2 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1859365-1859396 32 NZ_CP019002 Escherichia coli strain Ecol_AZ155 plasmid pECAZ155_2, complete sequence 69838-69869 1 0.969
CP026723_2 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1859365-1859396 32 NZ_CP028433 Escherichia coli strain RM9975 plasmid pRM9975-1, complete sequence 94312-94343 1 0.969
CP026723_2 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1859365-1859396 32 NZ_CP012114 Escherichia coli strain PSUO78 plasmid pPSUO78_2, complete sequence 89288-89319 1 0.969
CP026723_2 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1859365-1859396 32 MK972693 Salmonella phage SI23, complete genome 20077-20108 1 0.969
CP026723_2 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1859365-1859396 32 MK770415 Salmonella phage SF11, complete genome 1521-1552 1 0.969
CP026723_2 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1859365-1859396 32 MK972694 Salmonella phage SE22, complete genome 41165-41196 1 0.969
CP026723_2 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1859365-1859396 32 MK770414 Salmonella phage SE16, complete genome 5417-5448 1 0.969
CP026723_2 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1859365-1859396 32 MK972686 Salmonella phage SF3, complete genome 24871-24902 1 0.969
CP026723_2 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1859365-1859396 32 MK972685 Salmonella phage SE10, complete genome 26090-26121 1 0.969
CP026723_2 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1859365-1859396 32 MK972687 Salmonella phage SE1 (in:P22virus), complete genome 16364-16395 1 0.969
CP026723_2 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1859365-1859396 32 MT740315 Escherichia phage JEP4, complete genome 24063-24094 1 0.969
CP026723_2 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1859365-1859396 32 MK972692 Salmonella phage SE21, complete genome 40301-40332 1 0.969
CP026723_2 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1859365-1859396 32 MF356679 Escherichia phage D6, complete genome 78029-78060 1 0.969
CP026723_4 4.1|5030356|43|CP026723|CRISPRCasFinder 5030356-5030398 43 NC_016160 Escherichia phage HK75, complete genome 28589-28631 1 0.977
CP026723_4 4.1|5030356|43|CP026723|CRISPRCasFinder 5030356-5030398 43 NC_019705 Enterobacteria phage mEpX2, complete genome 29043-29085 1 0.977
CP026723_4 4.1|5030356|43|CP026723|CRISPRCasFinder 5030356-5030398 43 KY979108 Escherichia phage ECP1, complete genome 424-466 1 0.977
CP026723_4 4.1|5030356|43|CP026723|CRISPRCasFinder 5030356-5030398 43 NC_019719 Enterobacteria phage HK633, complete genome 31737-31779 1 0.977
CP026723_4 4.1|5030356|43|CP026723|CRISPRCasFinder 5030356-5030398 43 JF974339 Enterobacteria phage IME10, complete genome 9720-9762 1 0.977
CP026723_2 2.2|1858511|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1858511-1858542 32 KT898133 Aeromonas phage phiARM81ld, complete genome 45655-45686 2 0.938
CP026723_2 2.12|1859121|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1859121-1859152 32 NZ_CP021720 Escherichia coli strain AR_0128 plasmid tig00000793, complete sequence 108177-108208 2 0.938
CP026723_2 2.12|1859121|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1859121-1859152 32 NZ_CP020051 Escherichia coli strain AR_0118 plasmid unitig_3, complete sequence 58915-58946 2 0.938
CP026723_2 2.12|1859121|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1859121-1859152 32 KP869108 Escherichia coli O157 typing phage 10, complete genome 36668-36699 2 0.938
CP026723_2 2.12|1859121|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1859121-1859152 32 KP869107 Escherichia coli O157 typing phage 9, partial genome 36792-36823 2 0.938
CP026723_2 2.12|1859121|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1859121-1859152 32 NC_019711 Enterobacteria phage HK629, complete genome 30059-30090 2 0.938
CP026723_2 2.12|1859121|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1859121-1859152 32 NC_007804 Escherichia phage phiV10, complete genome 36258-36289 2 0.938
CP026723_2 2.12|1859121|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1859121-1859152 32 DQ126339 Enterobacteria phage phiV10, complete genome 36258-36289 2 0.938
CP026723_2 2.12|1859121|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1859121-1859152 32 MT225100 Escherichia phage Lys8385Vzw, complete genome 29553-29584 2 0.938
CP026723_4 4.1|5030356|43|CP026723|CRISPRCasFinder 5030356-5030398 43 NC_005344 Enterobacteria phage Sf6, complete genome 28407-28449 2 0.953
CP026723_4 4.1|5030356|43|CP026723|CRISPRCasFinder 5030356-5030398 43 NC_019715 Enterobacterial phage mEp234, complete genome 30405-30447 2 0.953
CP026723_4 4.1|5030356|43|CP026723|CRISPRCasFinder 5030356-5030398 43 NC_019711 Enterobacteria phage HK629, complete genome 37166-37208 2 0.953
CP026723_4 4.1|5030356|43|CP026723|CRISPRCasFinder 5030356-5030398 43 NC_019769 Enterobacteria phage HK542, complete genome 29172-29214 2 0.953
CP026723_4 4.1|5030356|43|CP026723|CRISPRCasFinder 5030356-5030398 43 NC_019768 Enterobacteria phage HK106, complete genome 32701-32743 2 0.953
CP026723_1 1.6|1830980|32|CP026723|PILER-CR,CRISPRCasFinder,CRT 1830980-1831011 32 MN855767 Bacteriophage sp. isolate 11, complete genome 31880-31911 5 0.844
CP026723_1 1.2|1830736|32|CP026723|PILER-CR,CRISPRCasFinder,CRT 1830736-1830767 32 NZ_CP045381 Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence 394835-394866 6 0.812
CP026723_1 1.2|1830736|32|CP026723|PILER-CR,CRISPRCasFinder,CRT 1830736-1830767 32 NZ_CP019631 Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence 62722-62753 6 0.812
CP026723_1 1.4|1830858|32|CP026723|PILER-CR,CRISPRCasFinder,CRT 1830858-1830889 32 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 100800-100831 6 0.812
CP026723_2 2.11|1859060|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1859060-1859091 32 NZ_CP006570 Sodalis praecaptivus strain HS1 plasmid pHS1, complete sequence 200247-200278 6 0.812
CP026723_2 2.14|1859243|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1859243-1859274 32 NC_016040 Sulfobacillus thermotolerans strain Y0017 plasmid pY0017, complete sequence 37866-37897 6 0.812
CP026723_1 1.2|1830736|32|CP026723|PILER-CR,CRISPRCasFinder,CRT 1830736-1830767 32 NZ_CP050254 Orbus sp. IPMB12 plasmid pIPMB12, complete sequence 17842-17873 7 0.781
CP026723_1 1.6|1830980|32|CP026723|PILER-CR,CRISPRCasFinder,CRT 1830980-1831011 32 NZ_AP017656 Sphingobium cloacae strain JCM 10874 plasmid pSCLO_2, complete sequence 103191-103222 7 0.781
CP026723_1 1.10|1831224|32|CP026723|PILER-CR,CRISPRCasFinder,CRT 1831224-1831255 32 NZ_CP036405 Komagataeibacter saccharivorans strain JH1 plasmid p221732, complete sequence 83754-83785 7 0.781
CP026723_1 1.10|1831224|32|CP026723|PILER-CR,CRISPRCasFinder,CRT 1831224-1831255 32 NZ_CP023037 Komagataeibacter saccharivorans strain CV1 plasmid unnamed1, complete sequence 128632-128663 7 0.781
CP026723_2 2.11|1859060|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1859060-1859091 32 NZ_CP047145 Streptomyces sp. HF10 plasmid plas1, complete sequence 69691-69722 7 0.781
CP026723_3 3.1|4574140|48|CP026723|CRISPRCasFinder 4574140-4574187 48 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 12111-12158 7 0.854
CP026723_1 1.4|1830858|32|CP026723|PILER-CR,CRISPRCasFinder,CRT 1830858-1830889 32 NZ_CP016821 Rhodococcus sp. p52 plasmid pDF01, complete sequence 123752-123783 8 0.75
CP026723_1 1.4|1830858|32|CP026723|PILER-CR,CRISPRCasFinder,CRT 1830858-1830889 32 NZ_CP016821 Rhodococcus sp. p52 plasmid pDF01, complete sequence 136491-136522 8 0.75
CP026723_2 2.2|1858511|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1858511-1858542 32 MN901520 Halorubrum coriense virus Hardycor2, complete genome 16524-16555 8 0.75
CP026723_2 2.4|1858633|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1858633-1858664 32 MN855880 Siphoviridae sp. isolate 369, complete genome 5249-5280 8 0.75
CP026723_2 2.11|1859060|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1859060-1859091 32 NZ_AP017656 Sphingobium cloacae strain JCM 10874 plasmid pSCLO_2, complete sequence 234032-234063 8 0.75
CP026723_2 2.11|1859060|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1859060-1859091 32 NZ_CP011450 Sphingomonas sanxanigenens DSM 19645 = NX02 plasmid pNXO2, complete sequence 59722-59753 8 0.75
CP026723_2 2.13|1859182|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1859182-1859213 32 MN855878 Bacteriophage sp. isolate 336, complete genome 5171-5202 8 0.75
CP026723_2 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1859365-1859396 32 MK820013 Vibrio phage vB_VpaP_MGD2, complete genome 24310-24341 8 0.75
CP026723_1 1.5|1830919|32|CP026723|PILER-CR,CRISPRCasFinder,CRT 1830919-1830950 32 NZ_CP020900 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence 178777-178808 9 0.719
CP026723_1 1.5|1830919|32|CP026723|PILER-CR,CRISPRCasFinder,CRT 1830919-1830950 32 NZ_CP013589 Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence 251306-251337 9 0.719
CP026723_1 1.5|1830919|32|CP026723|PILER-CR,CRISPRCasFinder,CRT 1830919-1830950 32 NZ_CP013562 Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence 256809-256840 9 0.719
CP026723_1 1.5|1830919|32|CP026723|PILER-CR,CRISPRCasFinder,CRT 1830919-1830950 32 NZ_CP013536 Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence 653047-653078 9 0.719
CP026723_1 1.5|1830919|32|CP026723|PILER-CR,CRISPRCasFinder,CRT 1830919-1830950 32 NZ_CP013546 Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence 259879-259910 9 0.719
CP026723_1 1.5|1830919|32|CP026723|PILER-CR,CRISPRCasFinder,CRT 1830919-1830950 32 NC_010997 Rhizobium etli CIAT 652 plasmid pC, complete sequence 248019-248050 9 0.719
CP026723_1 1.10|1831224|32|CP026723|PILER-CR,CRISPRCasFinder,CRT 1831224-1831255 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2552746-2552777 9 0.719
CP026723_2 2.4|1858633|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1858633-1858664 32 NZ_CP016463 Bosea sp. RAC05 plasmid pBSY19_1, complete sequence 542861-542892 9 0.719
CP026723_2 2.11|1859060|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1859060-1859091 32 NZ_CP011515 Mitsuaria sp. 7 plasmid, complete sequence 162356-162387 9 0.719
CP026723_2 2.15|1859304|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1859304-1859335 32 MN340231 Escherichia phage phiv205-1, complete genome 16237-16268 9 0.719
CP026723_2 2.15|1859304|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1859304-1859335 32 CP000711 Enterobacteria phage CUS-3, complete genome 12689-12720 9 0.719
CP026723_2 2.15|1859304|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1859304-1859335 32 MH717096 Escherichia phage N7, complete genome 9978-10009 9 0.719
CP026723_3 3.1|4574140|48|CP026723|CRISPRCasFinder 4574140-4574187 48 NZ_CP044147 Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2 7391-7438 9 0.812
CP026723_3 3.1|4574140|48|CP026723|CRISPRCasFinder 4574140-4574187 48 CP044351 Escherichia coli strain 194195 plasmid p194195_1, complete sequence 84215-84262 9 0.812
CP026723_3 3.1|4574140|48|CP026723|CRISPRCasFinder 4574140-4574187 48 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 87125-87172 9 0.812
CP026723_2 2.4|1858633|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1858633-1858664 32 NC_010625 Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence 1903726-1903757 10 0.688
CP026723_2 2.5|1858694|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1858694-1858725 32 MN657072 Psychrobacter sp. strain ANT_P36 plasmid pA36P2, complete sequence 2874-2905 10 0.688
CP026723_2 2.7|1858816|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1858816-1858847 32 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1222563-1222594 10 0.688
CP026723_2 2.7|1858816|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1858816-1858847 32 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1140926-1140957 10 0.688
CP026723_2 2.7|1858816|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1858816-1858847 32 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1200643-1200674 10 0.688
CP026723_2 2.7|1858816|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1858816-1858847 32 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 1140023-1140054 10 0.688
CP026723_2 2.7|1858816|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1858816-1858847 32 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 1140918-1140949 10 0.688
CP026723_2 2.7|1858816|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1858816-1858847 32 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 1140274-1140305 10 0.688
CP026723_2 2.7|1858816|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1858816-1858847 32 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 1140909-1140940 10 0.688
CP026723_2 2.7|1858816|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1858816-1858847 32 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1222678-1222709 10 0.688
CP026723_2 2.7|1858816|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1858816-1858847 32 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1222662-1222693 10 0.688
CP026723_2 2.7|1858816|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1858816-1858847 32 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1222655-1222686 10 0.688
CP026723_2 2.10|1858999|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1858999-1859030 32 MN693290 Marine virus AFVG_25M557, complete genome 19244-19275 10 0.688
CP026723_2 2.10|1858999|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1858999-1859030 32 MN693243 Marine virus AFVG_25M556, complete genome 14971-15002 10 0.688
CP026723_2 2.11|1859060|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1859060-1859091 32 MN850587 Escherichia phage mistaenkt, complete genome 62540-62571 10 0.688
CP026723_2 2.11|1859060|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1859060-1859091 32 MH791400 UNVERIFIED: Escherichia phage EcSzw-2, complete genome 63164-63195 10 0.688
CP026723_2 2.11|1859060|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1859060-1859091 32 MK562504 Enterobacteria phage CHB7, complete genome 51394-51425 10 0.688
CP026723_2 2.11|1859060|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1859060-1859091 32 NC_028808 Escherichia phage SUSP1, complete genome 60791-60822 10 0.688
CP026723_2 2.11|1859060|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1859060-1859091 32 MH791413 UNVERIFIED: Escherichia phage EcSzw_1, complete genome 62597-62628 10 0.688
CP026723_2 2.11|1859060|32|CP026723|CRISPRCasFinder,CRT,PILER-CR 1859060-1859091 32 NC_028935 Escherichia phage SUSP2, complete genome 58756-58787 10 0.688
CP026723_3 3.1|4574140|48|CP026723|CRISPRCasFinder 4574140-4574187 48 NZ_CP044307 Escherichia coli strain C27A plasmid pC27A-2, complete sequence 15006-15053 10 0.792
CP026723_1 1.2|1830736|32|CP026723|PILER-CR,CRISPRCasFinder,CRT 1830736-1830767 32 NC_013449 Streptomyces sp. W9 plasmid pCQ3, complete sequence 5026-5057 11 0.656
CP026723_1 1.2|1830736|32|CP026723|PILER-CR,CRISPRCasFinder,CRT 1830736-1830767 32 NC_019307 Streptomyces sp. W75 plasmid pCQ4, complete sequence 11401-11432 11 0.656
CP026723_3 3.1|4574140|48|CP026723|CRISPRCasFinder 4574140-4574187 48 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 3371-3418 11 0.771
CP026723_3 3.1|4574140|48|CP026723|CRISPRCasFinder 4574140-4574187 48 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4012-4059 11 0.771
CP026723_3 3.1|4574140|48|CP026723|CRISPRCasFinder 4574140-4574187 48 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4113-4160 11 0.771
CP026723_3 3.1|4574140|48|CP026723|CRISPRCasFinder 4574140-4574187 48 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 3370-3417 11 0.771
CP026723_3 3.1|4574140|48|CP026723|CRISPRCasFinder 4574140-4574187 48 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4011-4058 11 0.771
CP026723_3 3.1|4574140|48|CP026723|CRISPRCasFinder 4574140-4574187 48 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4112-4159 11 0.771
CP026723_3 3.1|4574140|48|CP026723|CRISPRCasFinder 4574140-4574187 48 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 3370-3417 11 0.771
CP026723_3 3.1|4574140|48|CP026723|CRISPRCasFinder 4574140-4574187 48 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4011-4058 11 0.771
CP026723_3 3.1|4574140|48|CP026723|CRISPRCasFinder 4574140-4574187 48 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4112-4159 11 0.771
CP026723_3 3.1|4574140|48|CP026723|CRISPRCasFinder 4574140-4574187 48 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 3370-3417 11 0.771
CP026723_3 3.1|4574140|48|CP026723|CRISPRCasFinder 4574140-4574187 48 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4011-4058 11 0.771
CP026723_3 3.1|4574140|48|CP026723|CRISPRCasFinder 4574140-4574187 48 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4112-4159 11 0.771
CP026723_3 3.1|4574140|48|CP026723|CRISPRCasFinder 4574140-4574187 48 MT230402 Escherichia coli strain DH5alpha plasmid pESBL87, complete sequence 270-317 11 0.771
CP026723_3 3.1|4574140|48|CP026723|CRISPRCasFinder 4574140-4574187 48 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 101195-101242 11 0.771
CP026723_3 3.1|4574140|48|CP026723|CRISPRCasFinder 4574140-4574187 48 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 208980-209027 12 0.75
CP026723_3 3.1|4574140|48|CP026723|CRISPRCasFinder 4574140-4574187 48 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 219474-219521 12 0.75
CP026723_3 3.1|4574140|48|CP026723|CRISPRCasFinder 4574140-4574187 48 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 210308-210355 12 0.75
CP026723_3 3.1|4574140|48|CP026723|CRISPRCasFinder 4574140-4574187 48 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 191263-191310 12 0.75
CP026723_3 3.1|4574140|48|CP026723|CRISPRCasFinder 4574140-4574187 48 NZ_AP023207 Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence 31250-31297 12 0.75
CP026723_3 3.1|4574140|48|CP026723|CRISPRCasFinder 4574140-4574187 48 MT230312 Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence 158-205 12 0.75

1. spacer 1.1|1830675|32|CP026723|PILER-CR,CRISPRCasFinder,CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

ggctttaaccacacgagcaagtccttcgctgg	CRISPR spacer
ggctttaaccacacgagcaagtccttcgctgg	Protospacer
********************************

2. spacer 1.2|1830736|32|CP026723|PILER-CR,CRISPRCasFinder,CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

agttaacaacccgcgccgaacaagcccgacaa	CRISPR spacer
agttaacaacccgcgccgaacaagcccgacaa	Protospacer
********************************

3. spacer 1.3|1830797|32|CP026723|PILER-CR,CRISPRCasFinder,CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

tcgcaccgcgttaatccggcagaaaaacaaca	CRISPR spacer
tcgcaccgcgttaatccggcagaaaaacaaca	Protospacer
********************************

4. spacer 1.4|1830858|32|CP026723|PILER-CR,CRISPRCasFinder,CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

ccgacaatctccgcctccagtcggtcgacctg	CRISPR spacer
ccgacaatctccgcctccagtcggtcgacctg	Protospacer
********************************

5. spacer 1.5|1830919|32|CP026723|PILER-CR,CRISPRCasFinder,CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

tgtgcccgactgcgtgccgcgtcgagcgcctg	CRISPR spacer
tgtgcccgactgcgtgccgcgtcgagcgcctg	Protospacer
********************************

6. spacer 1.6|1830980|32|CP026723|PILER-CR,CRISPRCasFinder,CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

ttcgccgccatcatcctgtggtgccagttgac	CRISPR spacer
ttcgccgccatcatcctgtggtgccagttgac	Protospacer
********************************

7. spacer 1.7|1831041|32|CP026723|PILER-CR,CRISPRCasFinder,CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

gcgcctcggttgtttagccatgctcagcccca	CRISPR spacer
gcgcctcggttgtttagccatgctcagcccca	Protospacer
********************************

8. spacer 1.8|1831102|32|CP026723|PILER-CR,CRISPRCasFinder,CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

ctttccacccaggcactgatactccacataaa	CRISPR spacer
ctttccacccaggcactgatactccacataaa	Protospacer
********************************

9. spacer 1.9|1831163|32|CP026723|PILER-CR,CRISPRCasFinder,CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

ctttccacccaggcactgatactccacataaa	CRISPR spacer
ctttccacccaggcactgatactccacataaa	Protospacer
********************************

10. spacer 1.10|1831224|32|CP026723|PILER-CR,CRISPRCasFinder,CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

gatcgccgggcgcggttacccgctgcgaaaat	CRISPR spacer
gatcgccgggcgcggttacccgctgcgaaaat	Protospacer
********************************

11. spacer 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP048306 (Escherichia coli strain 9 plasmid p009_B, complete sequence) position: , mismatch: 0, identity: 1.0

tgatgttcaagtgtgtatgcacactcagcaaa	CRISPR spacer
tgatgttcaagtgtgtatgcacactcagcaaa	Protospacer
********************************

12. spacer 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025883 (Escherichia coli strain 503440 plasmid p503440_100, complete sequence) position: , mismatch: 1, identity: 0.969

tgatgttcaagtgtgtatgcacactcagcaaa	CRISPR spacer
tgatgttcaagtgtgtatgcacactccgcaaa	Protospacer
************************** *****

13. spacer 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025894 (Escherichia coli strain 503025 plasmid p503025_100, complete sequence) position: , mismatch: 1, identity: 0.969

tgatgttcaagtgtgtatgcacactcagcaaa	CRISPR spacer
tgatgttcaagtgtgtatgcacactccgcaaa	Protospacer
************************** *****

14. spacer 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025868 (Escherichia coli strain 504211 plasmid p504211_100, complete sequence) position: , mismatch: 1, identity: 0.969

tgatgttcaagtgtgtatgcacactcagcaaa	CRISPR spacer
tgatgttcaagtgtgtatgcacactccgcaaa	Protospacer
************************** *****

15. spacer 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to CP043018 (Escherichia coli strain 388808_gen plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.969

tgatgttcaagtgtgtatgcacactcagcaaa	CRISPR spacer
tgatgttcaagtgtgtatgcgcactcagcaaa	Protospacer
********************.***********

16. spacer 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023851 (Escherichia coli strain 4/0 plasmid p4_0.2, complete sequence) position: , mismatch: 1, identity: 0.969

tgatgttcaagtgtgtatgcacactcagcaaa	CRISPR spacer
tgatgttcaagtgtgtatgcacactccgcaaa	Protospacer
************************** *****

17. spacer 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP017612 (Escherichia coli strain 20Ec-P-124 plasmid pMRY16-002_2, complete sequence) position: , mismatch: 1, identity: 0.969

tgatgttcaagtgtgtatgcacactcagcaaa	CRISPR spacer
tgatgttcaagtgtgtatgcgcactcagcaaa	Protospacer
********************.***********

18. spacer 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025870 (Escherichia coli strain 503829 plasmid p503829_100, complete sequence) position: , mismatch: 1, identity: 0.969

tgatgttcaagtgtgtatgcacactcagcaaa	CRISPR spacer
tgatgttcaagtgtgtatgcacactccgcaaa	Protospacer
************************** *****

19. spacer 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028430 (Escherichia coli strain RM9131 plasmid pRM9131-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatgttcaagtgtgtatgcacactcagcaaa	CRISPR spacer
tgatgttcaagtgtgtatgcgcactcagcaaa	Protospacer
********************.***********

20. spacer 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053233 (Escherichia coli strain SCU-306 plasmid pSCU-306-2, complete sequence) position: , mismatch: 1, identity: 0.969

tgatgttcaagtgtgtatgcacactcagcaaa	CRISPR spacer
tgatgttcaagtgtgtatgcgcactcagcaaa	Protospacer
********************.***********

21. spacer 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019013 (Escherichia coli strain Ecol_AZ162 plasmid pECAZ162_2, complete sequence) position: , mismatch: 1, identity: 0.969

tgatgttcaagtgtgtatgcacactcagcaaa	CRISPR spacer
tgatgttcaagtgtgtatgcacactccgcaaa	Protospacer
************************** *****

22. spacer 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to CP025897 (Escherichia coli strain 500465 plasmid p500465_152, complete sequence) position: , mismatch: 1, identity: 0.969

tgatgttcaagtgtgtatgcacactcagcaaa	CRISPR spacer
tgatgttcaagtgtgtatgcacactccgcaaa	Protospacer
************************** *****

23. spacer 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019027 (Escherichia coli strain Ecol_881 plasmid pEC881_2, complete sequence) position: , mismatch: 1, identity: 0.969

tgatgttcaagtgtgtatgcacactcagcaaa	CRISPR spacer
tgatgttcaagtgtgtatgcacactccgcaaa	Protospacer
************************** *****

24. spacer 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019002 (Escherichia coli strain Ecol_AZ155 plasmid pECAZ155_2, complete sequence) position: , mismatch: 1, identity: 0.969

tgatgttcaagtgtgtatgcacactcagcaaa	CRISPR spacer
tgatgttcaagtgtgtatgcgcactcagcaaa	Protospacer
********************.***********

25. spacer 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028433 (Escherichia coli strain RM9975 plasmid pRM9975-1, complete sequence) position: , mismatch: 1, identity: 0.969

tgatgttcaagtgtgtatgcacactcagcaaa	CRISPR spacer
tgatgttcaagtgtgtatgcgcactcagcaaa	Protospacer
********************.***********

26. spacer 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012114 (Escherichia coli strain PSUO78 plasmid pPSUO78_2, complete sequence) position: , mismatch: 1, identity: 0.969

tgatgttcaagtgtgtatgcacactcagcaaa	CRISPR spacer
tgatgttcaagtgtgtatgcacactccgcaaa	Protospacer
************************** *****

27. spacer 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to MK972693 (Salmonella phage SI23, complete genome) position: , mismatch: 1, identity: 0.969

tgatgttcaagtgtgtatgcacactcagcaaa	CRISPR spacer
tgatgttcaagtgtgtatgcacactccgcaaa	Protospacer
************************** *****

28. spacer 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to MK770415 (Salmonella phage SF11, complete genome) position: , mismatch: 1, identity: 0.969

tgatgttcaagtgtgtatgcacactcagcaaa	CRISPR spacer
tgatgttcaagtgtgtatgcacactccgcaaa	Protospacer
************************** *****

29. spacer 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to MK972694 (Salmonella phage SE22, complete genome) position: , mismatch: 1, identity: 0.969

tgatgttcaagtgtgtatgcacactcagcaaa	CRISPR spacer
tgatgttcaagtgtgtatgcacactccgcaaa	Protospacer
************************** *****

30. spacer 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to MK770414 (Salmonella phage SE16, complete genome) position: , mismatch: 1, identity: 0.969

tgatgttcaagtgtgtatgcacactcagcaaa	CRISPR spacer
tgatgttcaagtgtgtatgcacactccgcaaa	Protospacer
************************** *****

31. spacer 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to MK972686 (Salmonella phage SF3, complete genome) position: , mismatch: 1, identity: 0.969

tgatgttcaagtgtgtatgcacactcagcaaa	CRISPR spacer
tgatgttcaagtgtgtatgcacactccgcaaa	Protospacer
************************** *****

32. spacer 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to MK972685 (Salmonella phage SE10, complete genome) position: , mismatch: 1, identity: 0.969

tgatgttcaagtgtgtatgcacactcagcaaa	CRISPR spacer
tgatgttcaagtgtgtatgcacactccgcaaa	Protospacer
************************** *****

33. spacer 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to MK972687 (Salmonella phage SE1 (in:P22virus), complete genome) position: , mismatch: 1, identity: 0.969

tgatgttcaagtgtgtatgcacactcagcaaa	CRISPR spacer
tgatgttcaagtgtgtatgcacactccgcaaa	Protospacer
************************** *****

34. spacer 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to MT740315 (Escherichia phage JEP4, complete genome) position: , mismatch: 1, identity: 0.969

tgatgttcaagtgtgtatgcacactcagcaaa	CRISPR spacer
tgatgttcaagtgtgtatgcacactccgcaaa	Protospacer
************************** *****

35. spacer 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to MK972692 (Salmonella phage SE21, complete genome) position: , mismatch: 1, identity: 0.969

tgatgttcaagtgtgtatgcacactcagcaaa	CRISPR spacer
tgatgttcaagtgtgtatgcacactccgcaaa	Protospacer
************************** *****

36. spacer 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to MF356679 (Escherichia phage D6, complete genome) position: , mismatch: 1, identity: 0.969

tgatgttcaagtgtgtatgcacactcagcaaa	CRISPR spacer
tgatgttcaagtgtgtatgcgcactcagcaaa	Protospacer
********************.***********

37. spacer 4.1|5030356|43|CP026723|CRISPRCasFinder matches to NC_016160 (Escherichia phage HK75, complete genome) position: , mismatch: 1, identity: 0.977

gttgtccaacgcaaacaccagtaacggcgcggctctcagcgga	CRISPR spacer
gttgtccaacgcaaacaccagtaatggcgcggctctcagcgga	Protospacer
************************.******************

38. spacer 4.1|5030356|43|CP026723|CRISPRCasFinder matches to NC_019705 (Enterobacteria phage mEpX2, complete genome) position: , mismatch: 1, identity: 0.977

gttgtccaacgcaaacaccagtaacggcgcggctctcagcgga	CRISPR spacer
gttgtccaacgcaaacaccagtaatggcgcggctctcagcgga	Protospacer
************************.******************

39. spacer 4.1|5030356|43|CP026723|CRISPRCasFinder matches to KY979108 (Escherichia phage ECP1, complete genome) position: , mismatch: 1, identity: 0.977

gttgtccaacgcaaacaccagtaacggcgcggctctcagcgga	CRISPR spacer
gttgtccaacgcaaacaccagtaatggcgcggctctcagcgga	Protospacer
************************.******************

40. spacer 4.1|5030356|43|CP026723|CRISPRCasFinder matches to NC_019719 (Enterobacteria phage HK633, complete genome) position: , mismatch: 1, identity: 0.977

gttgtccaacgcaaacaccagtaacggcgcggctctcagcgga	CRISPR spacer
gttgtccaacgcaaacaccagtaatggcgcggctctcagcgga	Protospacer
************************.******************

41. spacer 4.1|5030356|43|CP026723|CRISPRCasFinder matches to JF974339 (Enterobacteria phage IME10, complete genome) position: , mismatch: 1, identity: 0.977

gttgtccaacgcaaacaccagtaacggcgcggctctcagcgga	CRISPR spacer
gttgtccaacgcaaacaccagtaatggcgcggctctcagcgga	Protospacer
************************.******************

42. spacer 2.2|1858511|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to KT898133 (Aeromonas phage phiARM81ld, complete genome) position: , mismatch: 2, identity: 0.938

acgaacgcggcacaccagggcgtctcatcgtc	CRISPR spacer
acgaacgcggcgcaccagggcgtctcgtcgtc	Protospacer
***********.**************.*****

43. spacer 2.12|1859121|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021720 (Escherichia coli strain AR_0128 plasmid tig00000793, complete sequence) position: , mismatch: 2, identity: 0.938

agcacggcaggccatatgaaatacctgttgct	CRISPR spacer
agcacggcaggccatttgaaatacccgttgct	Protospacer
*************** *********.******

44. spacer 2.12|1859121|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020051 (Escherichia coli strain AR_0118 plasmid unitig_3, complete sequence) position: , mismatch: 2, identity: 0.938

agcacggcaggccatatgaaatacctgttgct	CRISPR spacer
agcacggcaggccatttgaaatacccgttgct	Protospacer
*************** *********.******

45. spacer 2.12|1859121|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to KP869108 (Escherichia coli O157 typing phage 10, complete genome) position: , mismatch: 2, identity: 0.938

agcacggcaggccatatgaaatacctgttgct	CRISPR spacer
agcacggcaggccatttgaaataccagttgct	Protospacer
*************** ********* ******

46. spacer 2.12|1859121|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to KP869107 (Escherichia coli O157 typing phage 9, partial genome) position: , mismatch: 2, identity: 0.938

agcacggcaggccatatgaaatacctgttgct	CRISPR spacer
agcacggcaggccatttgaaataccagttgct	Protospacer
*************** ********* ******

47. spacer 2.12|1859121|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to NC_019711 (Enterobacteria phage HK629, complete genome) position: , mismatch: 2, identity: 0.938

agcacggcaggccatatgaaatacctgttgct	CRISPR spacer
agcacggcaggccatttgaaataccagttgct	Protospacer
*************** ********* ******

48. spacer 2.12|1859121|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to NC_007804 (Escherichia phage phiV10, complete genome) position: , mismatch: 2, identity: 0.938

agcacggcaggccatatgaaatacctgttgct	CRISPR spacer
agcacggcaggccatttgaaataccagttgct	Protospacer
*************** ********* ******

49. spacer 2.12|1859121|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to DQ126339 (Enterobacteria phage phiV10, complete genome) position: , mismatch: 2, identity: 0.938

agcacggcaggccatatgaaatacctgttgct	CRISPR spacer
agcacggcaggccatttgaaataccagttgct	Protospacer
*************** ********* ******

50. spacer 2.12|1859121|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to MT225100 (Escherichia phage Lys8385Vzw, complete genome) position: , mismatch: 2, identity: 0.938

agcacggcaggccatatgaaatacctgttgct	CRISPR spacer
agcacggcaggccatttgaaataccagttgct	Protospacer
*************** ********* ******

51. spacer 4.1|5030356|43|CP026723|CRISPRCasFinder matches to NC_005344 (Enterobacteria phage Sf6, complete genome) position: , mismatch: 2, identity: 0.953

gttgtccaacgcaaacaccagtaacggcgcggctctcagcgga	CRISPR spacer
tttgtccaacgcaaacaccagtaatggcgcggctctcagcgga	Protospacer
 ***********************.******************

52. spacer 4.1|5030356|43|CP026723|CRISPRCasFinder matches to NC_019715 (Enterobacterial phage mEp234, complete genome) position: , mismatch: 2, identity: 0.953

gttgtccaacgcaaacaccagtaacggcgcggctctcagcgga	CRISPR spacer
gttgtccaacgcaaacaccagtaatggcgcggatctcagcgga	Protospacer
************************.******* **********

53. spacer 4.1|5030356|43|CP026723|CRISPRCasFinder matches to NC_019711 (Enterobacteria phage HK629, complete genome) position: , mismatch: 2, identity: 0.953

gttgtccaacgcaaacaccagtaacggcgcggctctcagcgga	CRISPR spacer
gttgtccaacgcaaacaccagtaatggcgcgtctctcagcgga	Protospacer
************************.****** ***********

54. spacer 4.1|5030356|43|CP026723|CRISPRCasFinder matches to NC_019769 (Enterobacteria phage HK542, complete genome) position: , mismatch: 2, identity: 0.953

gttgtccaacgcaaacaccagtaacggcgcggctctcagcgga	CRISPR spacer
gttgtccaacgcaaacaccagtaatggtgcggctctcagcgga	Protospacer
************************.**.***************

55. spacer 4.1|5030356|43|CP026723|CRISPRCasFinder matches to NC_019768 (Enterobacteria phage HK106, complete genome) position: , mismatch: 2, identity: 0.953

gttgtccaacgcaaacaccagtaacggcgcggctctcagcgga	CRISPR spacer
gttgtccaacgcaaacaccagtaatggcgcggatctcagcgga	Protospacer
************************.******* **********

56. spacer 1.6|1830980|32|CP026723|PILER-CR,CRISPRCasFinder,CRT matches to MN855767 (Bacteriophage sp. isolate 11, complete genome) position: , mismatch: 5, identity: 0.844

ttcgccgccatcatcctgtggtgccagttgac	CRISPR spacer
gaagccgccatcatcttgtggtgccagttaac	Protospacer
   ************.*************.**

57. spacer 1.2|1830736|32|CP026723|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045381 (Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence) position: , mismatch: 6, identity: 0.812

-agttaacaacccgcgccgaacaagcccgacaa	CRISPR spacer
tcgttga-agcccgcgccgaacatgaccgacaa	Protospacer
  ***.* *.************* * *******

58. spacer 1.2|1830736|32|CP026723|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019631 (Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

-agttaacaacccgcgccgaacaagcccgacaa	CRISPR spacer
tcgttga-agcccgcgccgaacatgaccgacaa	Protospacer
  ***.* *.************* * *******

59. spacer 1.4|1830858|32|CP026723|PILER-CR,CRISPRCasFinder,CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 6, identity: 0.812

-ccgacaatctccgcctccagtcggtcgacctg	CRISPR spacer
gtctac-atctccgcctccagcgggtcgaccgg	Protospacer
 .* ** **************. ******** *

60. spacer 2.11|1859060|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP006570 (Sodalis praecaptivus strain HS1 plasmid pHS1, complete sequence) position: , mismatch: 6, identity: 0.812

ttaatcaggtcgtcgtactcagcgccgctggc	CRISPR spacer
ataatcaggtcgtcgttctctgcgcctcggtc	Protospacer
 *************** *** ***** * * *

61. spacer 2.14|1859243|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to NC_016040 (Sulfobacillus thermotolerans strain Y0017 plasmid pY0017, complete sequence) position: , mismatch: 6, identity: 0.812

gagagcgaggggagattccggcagggcgtgca	CRISPR spacer
aatcgtgaggggatcttccggcagggcgtgca	Protospacer
.*  *.*******  *****************

62. spacer 1.2|1830736|32|CP026723|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050254 (Orbus sp. IPMB12 plasmid pIPMB12, complete sequence) position: , mismatch: 7, identity: 0.781

agttaacaacccgcgccgaacaagcccgacaa	CRISPR spacer
tgttaaaaacccccgccgaacaagctcactaa	Protospacer
 ***** ***** ************.*. .**

63. spacer 1.6|1830980|32|CP026723|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP017656 (Sphingobium cloacae strain JCM 10874 plasmid pSCLO_2, complete sequence) position: , mismatch: 7, identity: 0.781

ttcgccgccatcatcctgtggtgccagttgac	CRISPR spacer
ttcgccgccatcatcttctggtgcatgtccat	Protospacer
***************.* ******  **. *.

64. spacer 1.10|1831224|32|CP026723|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP036405 (Komagataeibacter saccharivorans strain JH1 plasmid p221732, complete sequence) position: , mismatch: 7, identity: 0.781

gatcgccgggcgcggttacccgctgcgaaaat	CRISPR spacer
tatcgccgggcgcggctgcccgctgcgtcacg	Protospacer
 **************.*.*********  *  

65. spacer 1.10|1831224|32|CP026723|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023037 (Komagataeibacter saccharivorans strain CV1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

gatcgccgggcgcggttacccgctgcgaaaat	CRISPR spacer
tatcgccgggcgcggctgcccgctgcgtcacg	Protospacer
 **************.*.*********  *  

66. spacer 2.11|1859060|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP047145 (Streptomyces sp. HF10 plasmid plas1, complete sequence) position: , mismatch: 7, identity: 0.781

ttaatcag--gtcgtcgtactcagcgccgctggc	CRISPR spacer
--agccggatgtcgtcgtagtccgcgccgctggc	Protospacer
  *..*.*  ********* ** ***********

67. spacer 3.1|4574140|48|CP026723|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 7, identity: 0.854

aaatcgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
gactcgtaggcctgataagacgcgccagcgtcgcatcaggcaccgaac	Protospacer
.* ********************** ****************   *.*

68. spacer 1.4|1830858|32|CP026723|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016821 (Rhodococcus sp. p52 plasmid pDF01, complete sequence) position: , mismatch: 8, identity: 0.75

ccgacaatctccgcctccagtcggtcgacctg	CRISPR spacer
gccgcgttctcggcctccagtcggtcgatctt	Protospacer
 * .*. **** ****************.** 

69. spacer 1.4|1830858|32|CP026723|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016821 (Rhodococcus sp. p52 plasmid pDF01, complete sequence) position: , mismatch: 8, identity: 0.75

ccgacaatctccgcctccagtcggtcgacctg	CRISPR spacer
gccgcgttctcggcctccagtcggtcgatctt	Protospacer
 * .*. **** ****************.** 

70. spacer 2.2|1858511|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to MN901520 (Halorubrum coriense virus Hardycor2, complete genome) position: , mismatch: 8, identity: 0.75

acgaacgcggcacaccagggcgtctcatcgtc--	CRISPR spacer
ccgaacgcggcacacccgagcg--tcggcggcgg	Protospacer
 *************** *.***  **. ** *  

71. spacer 2.4|1858633|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to MN855880 (Siphoviridae sp. isolate 369, complete genome) position: , mismatch: 8, identity: 0.75

tgccactggtttcatgcaggccgcgcaaaaat	CRISPR spacer
cccgcctggtttcatgaaggccccgcaaaaca	Protospacer
. *  *********** ***** *******  

72. spacer 2.11|1859060|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP017656 (Sphingobium cloacae strain JCM 10874 plasmid pSCLO_2, complete sequence) position: , mismatch: 8, identity: 0.75

ttaatcaggtcgtcgtactcagcgccgctggc	CRISPR spacer
agagcatggtcgtcgcactcagcgccgcgggc	Protospacer
  *..  ********.************ ***

73. spacer 2.11|1859060|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011450 (Sphingomonas sanxanigenens DSM 19645 = NX02 plasmid pNXO2, complete sequence) position: , mismatch: 8, identity: 0.75

ttaatcaggtcgtcgtactcagcgccgctggc	CRISPR spacer
agagcatggtcgtcgcactcagcgccgcgggc	Protospacer
  *..  ********.************ ***

74. spacer 2.13|1859182|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to MN855878 (Bacteriophage sp. isolate 336, complete genome) position: , mismatch: 8, identity: 0.75

taatatccc----tggcgataatcaaccggcttact	CRISPR spacer
----acgccatggtggcgataatcatcctgcttact	Protospacer
    *. **    ************ ** *******

75. spacer 2.16|1859365|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to MK820013 (Vibrio phage vB_VpaP_MGD2, complete genome) position: , mismatch: 8, identity: 0.75

tgatgttcaagtgtgtatgcacactcagcaaa	CRISPR spacer
agtacttcaagtgtgtacgcacagtcagctac	Protospacer
 *   ************.***** ***** * 

76. spacer 1.5|1830919|32|CP026723|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020900 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence) position: , mismatch: 9, identity: 0.719

tgtgcccgactgcgtgccgcgtcgagcgcctg	CRISPR spacer
gacgggcgacggcgtgctgcgtcgagcgcata	Protospacer
 ..*  **** ******.*********** *.

77. spacer 1.5|1830919|32|CP026723|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013589 (Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence) position: , mismatch: 9, identity: 0.719

tgtgcccgactgcgtgccgcgtcgagcgcctg	CRISPR spacer
gacgggcgacggcgtgctgcgtcgagcgcata	Protospacer
 ..*  **** ******.*********** *.

78. spacer 1.5|1830919|32|CP026723|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013562 (Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence) position: , mismatch: 9, identity: 0.719

tgtgcccgactgcgtgccgcgtcgagcgcctg	CRISPR spacer
gacgggcgacggcgtgctgcgtcgagcgcata	Protospacer
 ..*  **** ******.*********** *.

79. spacer 1.5|1830919|32|CP026723|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013536 (Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence) position: , mismatch: 9, identity: 0.719

tgtgcccgactgcgtgccgcgtcgagcgcctg	CRISPR spacer
gacgggcgacggcgtgctgcgtcgagcgcata	Protospacer
 ..*  **** ******.*********** *.

80. spacer 1.5|1830919|32|CP026723|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 9, identity: 0.719

tgtgcccgactgcgtgccgcgtcgagcgcctg	CRISPR spacer
gacgggcgacggcgtgctgcgtcgagcgcata	Protospacer
 ..*  **** ******.*********** *.

81. spacer 1.5|1830919|32|CP026723|PILER-CR,CRISPRCasFinder,CRT matches to NC_010997 (Rhizobium etli CIAT 652 plasmid pC, complete sequence) position: , mismatch: 9, identity: 0.719

tgtgcccgactgcgtgccgcgtcgagcgcctg	CRISPR spacer
gacgggcgacggcgtgctgcgtcgagcgcata	Protospacer
 ..*  **** ******.*********** *.

82. spacer 1.10|1831224|32|CP026723|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719

gatcgccgggcgcggttacccgctgcgaaaat	CRISPR spacer
cgccgccgagcgcggtcacccgctgcgcgacc	Protospacer
 ..*****.*******.********** .* .

83. spacer 2.4|1858633|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016463 (Bosea sp. RAC05 plasmid pBSY19_1, complete sequence) position: , mismatch: 9, identity: 0.719

tgccactggtttcatgcaggccgcgcaaaaat	CRISPR spacer
gacgcctggtttcatgcaggcggcggaatgac	Protospacer
 .*  **************** *** ** .*.

84. spacer 2.11|1859060|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011515 (Mitsuaria sp. 7 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719

ttaatcaggtcgtcgtactcagcgccgctggc	CRISPR spacer
cgctgcaggtcgtcgtcctcagcaccgccagc	Protospacer
.    *********** ******.****..**

85. spacer 2.15|1859304|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to MN340231 (Escherichia phage phiv205-1, complete genome) position: , mismatch: 9, identity: 0.719

aaaaccgatatttaccaggttgttactgatag	CRISPR spacer
aagaccgatatttgccaggttgttgtaattgt	Protospacer
**.**********.**********.. . *. 

86. spacer 2.15|1859304|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to CP000711 (Enterobacteria phage CUS-3, complete genome) position: , mismatch: 9, identity: 0.719

aaaaccgatatttaccaggttgttactgatag	CRISPR spacer
aagaccgatatttgccaggttgttgtaattgt	Protospacer
**.**********.**********.. . *. 

87. spacer 2.15|1859304|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to MH717096 (Escherichia phage N7, complete genome) position: , mismatch: 9, identity: 0.719

aaaaccgatatttaccaggttgttactgatag	CRISPR spacer
aagaccgatatttgccaggttgttgtaattgt	Protospacer
**.**********.**********.. . *. 

88. spacer 3.1|4574140|48|CP026723|CRISPRCasFinder matches to NZ_CP044147 (Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2) position: , mismatch: 9, identity: 0.812

aaatcgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
gttttgtaggcatgataagacgcgccagcgtcgcatcaggcatccggc	Protospacer
.  *.****** ************* ****************  *.**

89. spacer 3.1|4574140|48|CP026723|CRISPRCasFinder matches to CP044351 (Escherichia coli strain 194195 plasmid p194195_1, complete sequence) position: , mismatch: 9, identity: 0.812

aaatcgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
gttttgtaggcatgataagacgcgccagcgtcgcatcaggcatccggc	Protospacer
.  *.****** ************* ****************  *.**

90. spacer 3.1|4574140|48|CP026723|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.812

aaatcgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
attttgtaggcctgataagacgcggcagcgtcgcatcaggcatcgtgc	Protospacer
*  *.*******************  ****************    **

91. spacer 2.4|1858633|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 10, identity: 0.688

tgccactggtttcatgcaggccgcgcaaaaat	CRISPR spacer
catcacaggtttcatgcaggctgcgcacctcg	Protospacer
...*** **************.*****     

92. spacer 2.5|1858694|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to MN657072 (Psychrobacter sp. strain ANT_P36 plasmid pA36P2, complete sequence) position: , mismatch: 10, identity: 0.688

caattcatatactgataaatcatcaaaacaaa	CRISPR spacer
ctgaacatcttctgataaatcatcaaaatctt	Protospacer
* .  *** * *****************.   

93. spacer 2.7|1858816|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ggtgctgtctttaccgtacattgcgcgaatct	CRISPR spacer
gcccaaccctttaccggacattgcgcgagtcg	Protospacer
* .    .******** ***********.** 

94. spacer 2.7|1858816|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ggtgctgtctttaccgtacattgcgcgaatct	CRISPR spacer
gcccaaccctttaccggacattgcgcgagtcg	Protospacer
* .    .******** ***********.** 

95. spacer 2.7|1858816|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ggtgctgtctttaccgtacattgcgcgaatct	CRISPR spacer
gcccaaccctttaccggacattgcgcgagtcg	Protospacer
* .    .******** ***********.** 

96. spacer 2.7|1858816|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 10, identity: 0.688

ggtgctgtctttaccgtacattgcgcgaatct	CRISPR spacer
gcccaaccctttaccggacattgcgcgagtcg	Protospacer
* .    .******** ***********.** 

97. spacer 2.7|1858816|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ggtgctgtctttaccgtacattgcgcgaatct	CRISPR spacer
gcccaaccctttaccggacattgcgcgagtcg	Protospacer
* .    .******** ***********.** 

98. spacer 2.7|1858816|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ggtgctgtctttaccgtacattgcgcgaatct	CRISPR spacer
gcccaaccctttaccggacattgcgcgagtcg	Protospacer
* .    .******** ***********.** 

99. spacer 2.7|1858816|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ggtgctgtctttaccgtacattgcgcgaatct	CRISPR spacer
gcccaaccctttaccggacattgcgcgagtcg	Protospacer
* .    .******** ***********.** 

100. spacer 2.7|1858816|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ggtgctgtctttaccgtacattgcgcgaatct	CRISPR spacer
gcccaaccctttaccggacattgcgcgagtcg	Protospacer
* .    .******** ***********.** 

101. spacer 2.7|1858816|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ggtgctgtctttaccgtacattgcgcgaatct	CRISPR spacer
gcccaaccctttaccggacattgcgcgagtcg	Protospacer
* .    .******** ***********.** 

102. spacer 2.7|1858816|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ggtgctgtctttaccgtacattgcgcgaatct	CRISPR spacer
gcccaaccctttaccggacattgcgcgagtcg	Protospacer
* .    .******** ***********.** 

103. spacer 2.10|1858999|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to MN693290 (Marine virus AFVG_25M557, complete genome) position: , mismatch: 10, identity: 0.688

tttttccagctccagcattgctgttgtattga	CRISPR spacer
catttccagctacagcattgatgttacttgag	Protospacer
. ********* ******** ****.. * ..

104. spacer 2.10|1858999|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to MN693243 (Marine virus AFVG_25M556, complete genome) position: , mismatch: 10, identity: 0.688

tttttccagctccagcattgctgttgtattga	CRISPR spacer
catttccagctacagcattgatgttacttgag	Protospacer
. ********* ******** ****.. * ..

105. spacer 2.11|1859060|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to MN850587 (Escherichia phage mistaenkt, complete genome) position: , mismatch: 10, identity: 0.688

ttaatcaggtcgtcgtactcagcgccgctggc	CRISPR spacer
ttaatcaggtcgtcgtagacagcttttagaga	Protospacer
*****************  **** ..   .* 

106. spacer 2.11|1859060|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to MH791400 (UNVERIFIED: Escherichia phage EcSzw-2, complete genome) position: , mismatch: 10, identity: 0.688

ttaatcaggtcgtcgtactcagcgccgctggc	CRISPR spacer
ttaatcaggtcgtcgtagacagcttttagaga	Protospacer
*****************  **** ..   .* 

107. spacer 2.11|1859060|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to MK562504 (Enterobacteria phage CHB7, complete genome) position: , mismatch: 10, identity: 0.688

ttaatcaggtcgtcgtactcagcgccgctggc	CRISPR spacer
ttaatcaggtcgtcgtagacagcttttagaga	Protospacer
*****************  **** ..   .* 

108. spacer 2.11|1859060|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to NC_028808 (Escherichia phage SUSP1, complete genome) position: , mismatch: 10, identity: 0.688

ttaatcaggtcgtcgtactcagcgccgctggc	CRISPR spacer
ttaatcaggtcgtcgtagacagcttttagaga	Protospacer
*****************  **** ..   .* 

109. spacer 2.11|1859060|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to MH791413 (UNVERIFIED: Escherichia phage EcSzw_1, complete genome) position: , mismatch: 10, identity: 0.688

ttaatcaggtcgtcgtactcagcgccgctggc	CRISPR spacer
ttaatcaggtcgtcgtagacagcttttagaga	Protospacer
*****************  **** ..   .* 

110. spacer 2.11|1859060|32|CP026723|CRISPRCasFinder,CRT,PILER-CR matches to NC_028935 (Escherichia phage SUSP2, complete genome) position: , mismatch: 10, identity: 0.688

ttaatcaggtcgtcgtactcagcgccgctggc	CRISPR spacer
ttaatcaggtcgtcgtagacagcttttagaga	Protospacer
*****************  **** ..   .* 

111. spacer 3.1|4574140|48|CP026723|CRISPRCasFinder matches to NZ_CP044307 (Escherichia coli strain C27A plasmid pC27A-2, complete sequence) position: , mismatch: 10, identity: 0.792

aaatcgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
ggctcgtaggcatgataagacgcgccagcgtcgcatcaggcacctggt	Protospacer
.. ******** ************* ****************  ..*.

112. spacer 1.2|1830736|32|CP026723|PILER-CR,CRISPRCasFinder,CRT matches to NC_013449 (Streptomyces sp. W9 plasmid pCQ3, complete sequence) position: , mismatch: 11, identity: 0.656

agttaacaacccgcgccgaacaagcccgacaa	CRISPR spacer
ccgcctggacccccgccgaacaagcccaacac	Protospacer
   .   .**** **************.*** 

113. spacer 1.2|1830736|32|CP026723|PILER-CR,CRISPRCasFinder,CRT matches to NC_019307 (Streptomyces sp. W75 plasmid pCQ4, complete sequence) position: , mismatch: 11, identity: 0.656

agttaacaacccgcgccgaacaagcccgacaa	CRISPR spacer
ccgcctggacccccgccgaacaagcccaacac	Protospacer
   .   .**** **************.*** 

114. spacer 3.1|4574140|48|CP026723|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 11, identity: 0.771

aaatcgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
ggctcgtaggcatgataagacgcgccagcgtcgcatcaggcacctgcg	Protospacer
.. ******** ************* ****************  ..  

115. spacer 3.1|4574140|48|CP026723|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 11, identity: 0.771

aaatcgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
agtttgtaggcatgataagacgcgctagcgtcgcatcaggcatctgcg	Protospacer
*. *.****** ************* ****************  ..  

116. spacer 3.1|4574140|48|CP026723|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 11, identity: 0.771

aaatcgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
agtttgtaggcatgataagacgcgccagcgtcgcatcaggcatctgcg	Protospacer
*. *.****** ************* ****************  ..  

117. spacer 3.1|4574140|48|CP026723|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 11, identity: 0.771

aaatcgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
ggctcgtaggcatgataagacgcgccagcgtcgcatcaggcacctgcg	Protospacer
.. ******** ************* ****************  ..  

118. spacer 3.1|4574140|48|CP026723|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 11, identity: 0.771

aaatcgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
agtttgtaggcatgataagacgcgctagcgtcgcatcaggcatctgcg	Protospacer
*. *.****** ************* ****************  ..  

119. spacer 3.1|4574140|48|CP026723|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 11, identity: 0.771

aaatcgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
agtttgtaggcatgataagacgcgccagcgtcgcatcaggcatctgcg	Protospacer
*. *.****** ************* ****************  ..  

120. spacer 3.1|4574140|48|CP026723|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 11, identity: 0.771

aaatcgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
ggctcgtaggcatgataagacgcgccagcgtcgcatcaggcacctgcg	Protospacer
.. ******** ************* ****************  ..  

121. spacer 3.1|4574140|48|CP026723|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 11, identity: 0.771

aaatcgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
agtttgtaggcatgataagacgcgctagcgtcgcatcaggcatctgcg	Protospacer
*. *.****** ************* ****************  ..  

122. spacer 3.1|4574140|48|CP026723|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 11, identity: 0.771

aaatcgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
agtttgtaggcatgataagacgcgccagcgtcgcatcaggcatctgcg	Protospacer
*. *.****** ************* ****************  ..  

123. spacer 3.1|4574140|48|CP026723|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 11, identity: 0.771

aaatcgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
ggctcgtaggcatgataagacgcgccagcgtcgcatcaggcacctgcg	Protospacer
.. ******** ************* ****************  ..  

124. spacer 3.1|4574140|48|CP026723|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 11, identity: 0.771

aaatcgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
agtttgtaggcatgataagacgcgctagcgtcgcatcaggcatctgcg	Protospacer
*. *.****** ************* ****************  ..  

125. spacer 3.1|4574140|48|CP026723|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 11, identity: 0.771

aaatcgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
agtttgtaggcatgataagacgcgccagcgtcgcatcaggcatctgcg	Protospacer
*. *.****** ************* ****************  ..  

126. spacer 3.1|4574140|48|CP026723|CRISPRCasFinder matches to MT230402 (Escherichia coli strain DH5alpha plasmid pESBL87, complete sequence) position: , mismatch: 11, identity: 0.771

aaatcgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
ggtttgtaggcctgataagacgcgacagcgtcgcatcaggcattgatt	Protospacer
.. *.*******************  ****************   * .

127. spacer 3.1|4574140|48|CP026723|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 11, identity: 0.771

aaatcgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
taatacaaggcctgataagacgcgccagcgtcgcatcaggcgctgaat	Protospacer
 ***   ****************** ***************.   *..

128. spacer 3.1|4574140|48|CP026723|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.75

aaatcgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
agtgggtaggcctgataagacgcgtcagcgtcgcatcaggcatctgag	Protospacer
*.   *******************. ****************  ... 

129. spacer 3.1|4574140|48|CP026723|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.75

aaatcgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
agtgggtaggcctgataagacgcgtcagcgtcgcatcaggcatctgag	Protospacer
*.   *******************. ****************  ... 

130. spacer 3.1|4574140|48|CP026723|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.75

aaatcgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
agtgggtaggcctgataagacgcgtcagcgtcgcatcaggcatctgag	Protospacer
*.   *******************. ****************  ... 

131. spacer 3.1|4574140|48|CP026723|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.75

aaatcgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
agtgggtaggcctgataagacgcgtcagcgtcgcatcaggcatctgag	Protospacer
*.   *******************. ****************  ... 

132. spacer 3.1|4574140|48|CP026723|CRISPRCasFinder matches to NZ_AP023207 (Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence) position: , mismatch: 12, identity: 0.75

aaatcgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
cggctgtaggcctgataagacgcgacagcgtcgcatcaggcattgatt	Protospacer
 ....*******************  ****************   * .

133. spacer 3.1|4574140|48|CP026723|CRISPRCasFinder matches to MT230312 (Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence) position: , mismatch: 12, identity: 0.75

aaatcgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
gtctngtaggcctgataagacgcgtcagcgtcgcatcaggcttcaatt	Protospacer
.  * *******************. ***************    * .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage