Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP027026 Streptomyces sp. WAC00288 plasmid p4, complete sequence 0 crisprs NA 0 0 0 0
CP027024 Streptomyces sp. WAC00288 plasmid p2, complete sequence 0 crisprs DEDDh 1 10 0 0
CP027022 Streptomyces sp. WAC00288 chromosome, complete genome 10 crisprs WYL,csa3,DEDDh,DinG,cas3,cas4 1 16 1 0
CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 8 crisprs cas3,cas8e,cse2gr11,cas7,cas5,cas6e 2 82 0 0
CP027023 Streptomyces sp. WAC00288 plasmid p1, complete sequence 2 crisprs cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e 0 18 0 0

Results visualization

1. CP027024
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP027024_2 2.1|99774|71|CP027024|CRT 99774-99844 71 CP027022.1 83357-83427 11 0.845

1. spacer 2.1|99774|71|CP027024|CRT matches to position: 83357-83427, mismatch: 11, identity: 0.845

aaccgactcctcaccgactgcacctccaccacccaggccaccacctgccccagcaccgaa	CRISPR spacer
aaccgactcctcaccgactgcacctccaccacccaggccaccacctgccccagcaccgaa	Protospacer
************************************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP027024_1 1.1|99489|37|CP027024|CRISPRCasFinder 99489-99525 37 NZ_CP027024 Streptomyces sp. WAC00288 plasmid p2, complete sequence 99489-99525 0 1.0
CP027024_2 2.2|99864|41|CP027024|CRT 99864-99904 41 NZ_CP027024 Streptomyces sp. WAC00288 plasmid p2, complete sequence 99864-99904 0 1.0
CP027024_2 2.3|99924|41|CP027024|CRT 99924-99964 41 NZ_CP027024 Streptomyces sp. WAC00288 plasmid p2, complete sequence 99924-99964 0 1.0
CP027024_2 2.4|99984|29|CP027024|CRT 99984-100012 29 NZ_CP027024 Streptomyces sp. WAC00288 plasmid p2, complete sequence 99984-100012 0 1.0
CP027024_2 2.5|100032|41|CP027024|CRT 100032-100072 41 NZ_CP027024 Streptomyces sp. WAC00288 plasmid p2, complete sequence 100032-100072 0 1.0
CP027024_2 2.6|99858|37|CP027024|CRISPRCasFinder 99858-99894 37 NZ_CP027024 Streptomyces sp. WAC00288 plasmid p2, complete sequence 99858-99894 0 1.0
CP027024_2 2.7|99918|37|CP027024|CRISPRCasFinder 99918-99954 37 NZ_CP027024 Streptomyces sp. WAC00288 plasmid p2, complete sequence 99918-99954 0 1.0
CP027024_2 2.8|99978|25|CP027024|CRISPRCasFinder 99978-100002 25 NZ_CP027024 Streptomyces sp. WAC00288 plasmid p2, complete sequence 99978-100002 0 1.0
CP027024_2 2.9|100026|37|CP027024|CRISPRCasFinder 100026-100062 37 NZ_CP027024 Streptomyces sp. WAC00288 plasmid p2, complete sequence 100026-100062 0 1.0
CP027024_2 2.1|99774|71|CP027024|CRT 99774-99844 71 NZ_CP027024 Streptomyces sp. WAC00288 plasmid p2, complete sequence 99774-99844 11 0.845

1. spacer 1.1|99489|37|CP027024|CRISPRCasFinder matches to NZ_CP027024 (Streptomyces sp. WAC00288 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

gccgacggccgccgcaccagccagaccggaacagccg	CRISPR spacer
gccgacggccgccgcaccagccagaccggaacagccg	Protospacer
*************************************

2. spacer 2.2|99864|41|CP027024|CRT matches to NZ_CP027024 (Streptomyces sp. WAC00288 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

ggcaaccgcaccacccagaccaaagctggcacagccaccac	CRISPR spacer
ggcaaccgcaccacccagaccaaagctggcacagccaccac	Protospacer
*****************************************

3. spacer 2.3|99924|41|CP027024|CRT matches to NZ_CP027024 (Streptomyces sp. WAC00288 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

gaccagctcaccagcgaaaccacaggtggctccaaccgcgc	CRISPR spacer
gaccagctcaccagcgaaaccacaggtggctccaaccgcgc	Protospacer
*****************************************

4. spacer 2.4|99984|29|CP027024|CRT matches to NZ_CP027024 (Streptomyces sp. WAC00288 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

ggcaaccagacatcgaatggcgccaccac	CRISPR spacer
ggcaaccagacatcgaatggcgccaccac	Protospacer
*****************************

5. spacer 2.5|100032|41|CP027024|CRT matches to NZ_CP027024 (Streptomyces sp. WAC00288 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

aaccagctcgcctcggtaagcgttggcgcagacacctaccg	CRISPR spacer
aaccagctcgcctcggtaagcgttggcgcagacacctaccg	Protospacer
*****************************************

6. spacer 2.6|99858|37|CP027024|CRISPRCasFinder matches to NZ_CP027024 (Streptomyces sp. WAC00288 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

caggtcggcaaccgcaccacccagaccaaagctggca	CRISPR spacer
caggtcggcaaccgcaccacccagaccaaagctggca	Protospacer
*************************************

7. spacer 2.7|99918|37|CP027024|CRISPRCasFinder matches to NZ_CP027024 (Streptomyces sp. WAC00288 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

gacgccgaccagctcaccagcgaaaccacaggtggct	CRISPR spacer
gacgccgaccagctcaccagcgaaaccacaggtggct	Protospacer
*************************************

8. spacer 2.8|99978|25|CP027024|CRISPRCasFinder matches to NZ_CP027024 (Streptomyces sp. WAC00288 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

gccgacggcaaccagacatcgaatg	CRISPR spacer
gccgacggcaaccagacatcgaatg	Protospacer
*************************

9. spacer 2.9|100026|37|CP027024|CRISPRCasFinder matches to NZ_CP027024 (Streptomyces sp. WAC00288 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

gcgaaaaaccagctcgcctcggtaagcgttggcgcag	CRISPR spacer
gcgaaaaaccagctcgcctcggtaagcgttggcgcag	Protospacer
*************************************

10. spacer 2.1|99774|71|CP027024|CRT matches to NZ_CP027024 (Streptomyces sp. WAC00288 plasmid p2, complete sequence) position: , mismatch: 11, identity: 0.845

aaccgactcctcaccgactgcacctccaccacccaggccaccacctgccccagcaccgaa	CRISPR spacer
aaccgactcctcaccgactgcacctccaccacccaggccaccacctgccccagcaccgaa	Protospacer
************************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP027022
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027022_6 1889955-1890127 Orphan NA
2 spacers
DinG

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027022_8 2555149-2555249 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027022_9 2972452-2972586 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027022_13 4137455-4137538 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027022_15 5127251-5127355 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027022_16 5578094-5578181 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027022_17 5653646-5653742 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027022_18 5678392-5678516 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027022_19 6027978-6028073 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027022_23 7089486-7089635 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP027022_7 7.2|2013261|15|CP027022|CRISPRCasFinder 2013261-2013275 15 CP027024.1 57251-57265 2 0.867
CP027022_7 7.2|2013261|15|CP027022|CRISPRCasFinder 2013261-2013275 15 CP027024.1 106480-106494 2 0.867

1. spacer 7.2|2013261|15|CP027022|CRISPRCasFinder matches to position: 57251-57265, mismatch: 2, identity: 0.867

cgaccgccgaagccg	CRISPR spacer
cgaccgccgacggcg	Protospacer
********** * **

2. spacer 7.2|2013261|15|CP027022|CRISPRCasFinder matches to position: 106480-106494, mismatch: 2, identity: 0.867

cgaccgccgaagccg	CRISPR spacer
cgaccgcggaggccg	Protospacer
******* **.****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP027022_2 2.1|83137|37|CP027022|CRISPRCasFinder 83137-83173 37 NZ_CP027024 Streptomyces sp. WAC00288 plasmid p2, complete sequence 100028-100064 0 1.0
CP027022_2 2.2|83197|19|CP027022|CRISPRCasFinder 83197-83215 19 NZ_CP027024 Streptomyces sp. WAC00288 plasmid p2, complete sequence 99986-100004 0 1.0
CP027022_2 2.3|83239|37|CP027022|CRISPRCasFinder 83239-83275 37 NZ_CP027024 Streptomyces sp. WAC00288 plasmid p2, complete sequence 99926-99962 0 1.0
CP027022_2 2.4|83299|43|CP027022|CRISPRCasFinder 83299-83341 43 NZ_CP027024 Streptomyces sp. WAC00288 plasmid p2, complete sequence 99860-99902 0 1.0
CP027022_3 3.1|83674|37|CP027022|CRISPRCasFinder 83674-83710 37 NZ_CP027024 Streptomyces sp. WAC00288 plasmid p2, complete sequence 99491-99527 0 1.0
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 1219087-1219113 2 0.926
CP027022_20 20.1|6093348|23|CP027022|CRISPRCasFinder 6093348-6093370 23 NC_020489 Rhodobacter phage RcapNL, complete genome 34032-34054 2 0.913
CP027022_20 20.1|6093348|23|CP027022|CRISPRCasFinder 6093348-6093370 23 JF974309 Rhodobacter phage RcNL1, *** SEQUENCING IN PROGRESS ***, 5 unordered pieces 44183-44205 2 0.913
CP027022_7 7.3|2013300|24|CP027022|CRISPRCasFinder 2013300-2013323 24 NZ_CP025436 Gordonia sp. YC-JH1 plasmid pGOR1, complete sequence 66023-66046 3 0.875
CP027022_7 7.3|2013300|24|CP027022|CRISPRCasFinder 2013300-2013323 24 NZ_CP045303 Azotobacter salinestris strain KACC 13899 plasmid unnamed1, complete sequence 264364-264387 3 0.875
CP027022_7 7.3|2013300|24|CP027022|CRISPRCasFinder 2013300-2013323 24 NZ_CP010421 Azotobacter chroococcum NCIMB 8003 plasmid pAcX50f, complete sequence 93813-93836 3 0.875
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 1512930-1512956 3 0.889
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP011053 Halomonas sp. KO116 plasmid unnamed1, complete sequence 22709-22735 3 0.889
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 622239-622265 3 0.889
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 392440-392466 3 0.889
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 234542-234568 3 0.889
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 1376285-1376308 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 199621-199644 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 1338530-1338553 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NZ_CP040720 Rhodococcus pyridinivorans strain YF3 plasmid unnamed1, complete sequence 179831-179854 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 513155-513178 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 524886-524909 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 527971-527994 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 628546-628569 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 183485-183508 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 532999-533022 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1530240-1530263 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 529234-529257 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 540705-540728 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 526359-526382 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 427006-427029 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 525453-525476 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 545376-545399 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 529251-529274 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 545376-545399 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 545374-545397 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 628572-628595 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 523399-523422 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 545376-545399 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 523403-523426 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 545376-545399 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 545376-545399 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 523403-523426 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 540688-540711 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 540641-540664 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 575071-575094 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 532465-532488 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 545376-545399 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 523403-523426 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 622849-622872 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 545373-545396 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 523403-523426 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 523403-523426 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 545376-545399 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 545376-545399 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 545376-545399 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 KM597530 Mycobacterium phage Bipolar, complete genome 33711-33734 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 KM101122 Mycobacterium phage Hades, complete genome 34315-34338 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 MH669014 Mycobacterium phage Spikelee, complete genome 35483-35506 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 MG770213 Mycobacterium phage OldBen, complete genome 34130-34153 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 FJ174693 Mycobacterium phage Ramsey, complete genome 34926-34949 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 MN062708 Mycobacteriumphage NothingSpecial, complete genome 20209-20232 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NC_023728 Mycobacterium virus DeadP, complete genome 34915-34938 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 MT114167 Mycobacterium phage Phanphagia, complete genome 33370-33393 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 97037-97060 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 1392065-1392088 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 1650074-1650097 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 542148-542171 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1463081-1463104 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 1568652-1568675 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 MK937603 Gordonia phage Bakery, complete genome 31922-31945 3 0.875
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 KC736071 Mycobacterium phage WIVsmall, complete genome 20264-20287 3 0.875
CP027022_20 20.1|6093348|23|CP027022|CRISPRCasFinder 6093348-6093370 23 NC_024970 Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence 130287-130309 3 0.87
CP027022_20 20.1|6093348|23|CP027022|CRISPRCasFinder 6093348-6093370 23 NZ_KJ396772 Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence 130287-130309 3 0.87
CP027022_20 20.1|6093348|23|CP027022|CRISPRCasFinder 6093348-6093370 23 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4810671-4810693 3 0.87
CP027022_20 20.1|6093348|23|CP027022|CRISPRCasFinder 6093348-6093370 23 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 476613-476635 3 0.87
CP027022_20 20.1|6093348|23|CP027022|CRISPRCasFinder 6093348-6093370 23 NZ_CP024986 Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence 110768-110790 3 0.87
CP027022_7 7.3|2013300|24|CP027022|CRISPRCasFinder 2013300-2013323 24 AP018486 Mycobacterium phage PP DNA, complete genome 8225-8248 4 0.833
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NC_001396 Xanthomonas phage Cf1c, complete genome 432-458 4 0.852
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 AB910602 Xanthomonas phage XacF1 DNA, complete genome 1730-1756 4 0.852
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 U41819 Xanthomonas virus Cf1c B coat protein and A coat protein genes, complete cds 432-458 4 0.852
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 M57538 Xanthomonas phage Cf1c unknown gene 432-458 4 0.852
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP045381 Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence 70737-70763 4 0.852
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP022419 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-4, complete sequence 43443-43469 4 0.852
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP019631 Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence 153422-153448 4 0.852
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP032676 Rhodococcus rhodochrous strain ATCC BAA870 plasmid pNit, complete sequence 297801-297827 4 0.852
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 673371-673397 4 0.852
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 CP042595 Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence 155615-155641 4 0.852
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 MN908691 Gordonia phage DatBoi, complete genome 56300-56326 4 0.852
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_AP014812 Methylorubrum populi strain P-1M plasmid pMPPM03, complete sequence 28358-28384 4 0.852
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 443300-443326 4 0.852
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 443309-443335 4 0.852
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP029831 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence 549167-549193 4 0.852
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 235345-235371 4 0.852
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 235343-235369 4 0.852
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 444052-444078 4 0.852
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 421116-421142 4 0.852
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1766974-1767000 4 0.852
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1783664-1783690 4 0.852
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NC_023284 Streptomyces sp. F2 plasmid pFRL4, complete sequence 25336-25362 4 0.852
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NC_016624 Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence 60016-60042 4 0.852
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 482539-482565 4 0.852
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1746897-1746923 4 0.852
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NC_014819 Asticcacaulis excentricus CB 48 plasmid pASTEX02, complete sequence 89453-89479 4 0.852
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 785683-785709 4 0.852
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1027392-1027418 4 0.852
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 426007-426033 4 0.852
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 708790-708816 4 0.852
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 371277-371303 4 0.852
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 306982-307008 4 0.852
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 715959-715985 4 0.852
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 CP054934 Nocardiopsis flavescens strain NA01583 plasmid unnamed1, complete sequence 46383-46409 4 0.852
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP023064 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence 105135-105161 4 0.852
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 CP003951 Rhodococcus opacus PD630 plasmid 2, complete sequence 88576-88602 4 0.852
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 CP003951 Rhodococcus opacus PD630 plasmid 2, complete sequence 88867-88893 4 0.852
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 CP003951 Rhodococcus opacus PD630 plasmid 2, complete sequence 89219-89245 4 0.852
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 MF377441 Arthrobacter phage Timinator, complete genome 31283-31309 4 0.852
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 MT310895 Arthrobacter phage StevieBAY, complete genome 31278-31304 4 0.852
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 KU647629 Arthrobacter phage BarretLemon, complete genome 31281-31307 4 0.852
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NC_025133 Sphingobium wenxiniae strain JZ-1 plasmid pPBA, complete sequence 29354-29380 4 0.852
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP005192 Sphingobium sp. MI1205 plasmid pMI3, complete sequence 82869-82895 4 0.852
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 AB244976 Uncultured bacterium plasmid pLB1 DNA, complete sequence 60493-60519 4 0.852
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP005089 Sphingobium sp. TKS plasmid pTK5, complete sequence 38167-38193 4 0.852
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 421219-421245 4 0.852
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 MH001451 Mycobacterium phage Nairb, complete genome 26679-26705 4 0.852
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 MF155936 Mycobacterium phage ZenTime222, complete genome 26679-26705 4 0.852
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 MK494089 Mycobacterium phage Ibrahim, complete genome 26679-26705 4 0.852
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NC_024135 Mycobacterium phage Bernal13, complete genome 26679-26705 4 0.852
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 KM591905 Mycobacterium phage RonRayGun, complete genome 26679-26705 4 0.852
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 MN735432 Mycobacteriophage Whitty, complete genome 26679-26705 4 0.852
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 1376153-1376176 4 0.833
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 629607-629630 4 0.833
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1606122-1606145 4 0.833
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 824787-824810 4 0.833
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NZ_CP035710 Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence 12908-12931 4 0.833
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 489909-489932 4 0.833
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 29366-29389 4 0.833
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 207147-207170 4 0.833
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 1307593-1307616 4 0.833
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NC_004808 Streptomyces rochei plasmid pSLA2-L DNA, complete sequence 86875-86898 4 0.833
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 436532-436555 4 0.833
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 NC_048860 Microbacterium phage Arete, complete genome 29960-29983 4 0.833
CP027022_7 7.5|2013399|24|CP027022|CRISPRCasFinder 2013399-2013422 24 KC252997 Halovirus PH1, complete genome 1757-1780 4 0.833
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 652346-652372 5 0.815
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 680213-680239 5 0.815
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 MT361768 Ralstonia phage RPZH6, complete genome 31411-31437 5 0.815
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 MT361768 Ralstonia phage RPZH6, complete genome 31882-31908 5 0.815
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2210895-2210921 5 0.815
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP020740 [Pseudomonas] mesoacidophila strain ATCC 31433 plasmid pATCC31433, complete sequence 67855-67881 5 0.815
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 CP000618 Burkholderia vietnamiensis G4 plasmid pBVIE02, complete sequence 42670-42696 5 0.815
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 MK305888 Streptomyces phage Austintatious, complete genome 34188-34214 5 0.815
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NC_014718 Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence 554023-554049 5 0.815
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NC_014718 Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence 20484-20510 5 0.815
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_LR134460 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence 331035-331061 5 0.815
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 339601-339627 5 0.815
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_HG938354 Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence 1306046-1306072 5 0.815
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP018918 Serratia marcescens strain UMH5 plasmid unnamed2, complete sequence 19146-19172 5 0.815
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NC_013859 Azospirillum sp. B510 plasmid pAB510e, complete sequence 403263-403289 5 0.815
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 439920-439946 5 0.815
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP029358 Azospirillum sp. CFH 70021 plasmid unnamed3 323224-323250 5 0.815
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP054025 Rhizobium sp. JKLM12A2 plasmid pPR12A204, complete sequence 197388-197414 5 0.815
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 324784-324810 5 0.815
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP047145 Streptomyces sp. HF10 plasmid plas1, complete sequence 35613-35639 5 0.815
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP033582 Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence 507155-507181 5 0.815
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP020333 Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM170, complete sequence 130218-130244 5 0.815
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP054034 Rhizobium sp. JKLM13E plasmid pPR13E03, complete sequence 160828-160854 5 0.815
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NC_021278 Mycobacteroides abscessus subsp. bolletii 50594 plasmid 1, complete sequence 18467-18493 5 0.815
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP010894 Pseudomonas sp. MRSN12121 plasmid, complete sequence 5455-5481 5 0.815
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 KY555147 Caulobacter phage Ccr34, complete genome 41971-41997 5 0.815
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 MF668280 Mycobacterium phage Phabba, complete genome 108689-108715 5 0.815
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 MF377442 Arthrobacter phage Franzy, complete genome 30935-30961 5 0.815
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NC_041930 Arthrobacter phage Brent, complete genome 30936-30962 5 0.815
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 KY555146 Caulobacter phage Ccr32, complete genome 42005-42031 5 0.815
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NC_048047 Caulobacter phage CcrBL9, complete genome 70050-70076 5 0.815
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP053379 Serratia marcescens strain FY plasmid p1, complete sequence 5494-5520 5 0.815
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP033895 Serratia liquefaciens strain FG3 plasmid p2-125, complete sequence 25821-25847 5 0.815
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 1389280-1389306 5 0.815
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NC_010183 Bacillus mycoides KBAB4 plasmid pBWB404, complete sequence 51711-51737 5 0.815
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP018916 Serratia marcescens strain UMH1 plasmid unnamed1, complete sequence 50377-50403 5 0.815
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP041653 Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence 86402-86428 5 0.815
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP011665 Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence 182028-182054 5 0.815
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 104212-104238 5 0.815
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 1367246-1367272 5 0.815
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP054616 Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence 517561-517587 5 0.815
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP041045 Paracoccus sp. AK26 plasmid pAK1, complete sequence 244042-244068 5 0.815
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 KM083128 Mycobacterium phage Sparky, complete genome 56688-56714 5 0.815
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 JX163858 Caulobacter phage phiCbK, complete genome 165826-165852 5 0.815
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 1070677-1070703 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 520649-520675 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NC_023285 Streptomyces sp. F8 plasmid pFRL5, complete sequence 224837-224863 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 KY249644 Synechococcus virus S-ESS1, complete genome 59383-59409 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 KY249644 Synechococcus virus S-ESS1, complete genome 59410-59436 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 87722-87748 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP020897 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5a, complete sequence 47515-47541 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP013538 Rhizobium phaseoli strain R630 plasmid pRphaR630a, complete sequence 74930-74956 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 KY092483 Streptomyces phage Bioscum, complete genome 35824-35850 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NC_047792 Streptomyces phage Ididsumtinwong, complete genome 35811-35837 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 174565-174591 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_LR134460 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence 89941-89967 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 996901-996927 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 109976-110002 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 167349-167375 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 493458-493484 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP046101 Rhodococcus sp. AQ5-07 plasmid unnamed2, complete sequence 3924-3950 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP015006 Aminobacter aminovorans strain KCTC 2477 plasmid pAA01, complete sequence 383174-383200 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP024609 Massilia violaceinigra strain B2 plasmid unnamed, complete sequence 19062-19088 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP040246 Mycobacterium avium subsp. hominissuis strain 101034 plasmid pFLAC0181_CHOP1, complete sequence 20479-20505 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP029833 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence 173296-173322 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NC_013859 Azospirillum sp. B510 plasmid pAB510e, complete sequence 291160-291186 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 499883-499909 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 649878-649904 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 863893-863919 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP013052 Sinorhizobium americanum CCGM7 plasmid A, complete sequence 39611-39637 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 764440-764466 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP054620 Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence 166666-166692 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP020385 Rhodovulum sp. MB263 plasmid pRSMBA, complete sequence 131515-131541 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 1743140-1743166 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 MT740738 Ralstonia phage Gamede, complete genome 50142-50168 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 MT740736 Ralstonia phage Eline, complete genome 52623-52649 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 KU160664 Arthrobacter phage Salgado, complete genome 10008-10034 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 MH727549 Mycobacterium phage Gancho, complete genome 21803-21829 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 MF140418 Arthrobacter phage LiSara, complete genome 10034-10060 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 KU160654 Arthrobacter phage Laroye, complete genome 10000-10026 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 885604-885630 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP051473 Rhodobacter sphaeroides strain CH10 plasmid pRspCH10DE, complete sequence 85063-85089 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP023150 Mycobacterium intracellulare strain FLAC0181 plasmid pFLAC0181, complete sequence 7577-7603 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP030276 Rhodobacter sphaeroides 2.4.1 plasmid pDE, complete sequence 85071-85097 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP040254 Mycobacterium avium subsp. hominissuis strain 101115 plasmid pFLAC0181_CHOP101, complete sequence 19943-19969 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP015289 Rhodobacter sphaeroides strain MBTLJ-20 plasmid a, complete sequence 19237-19263 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1701800-1701826 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NC_019730 Oscillatoria nigro-viridis PCC 7112 plasmid pOSC7112.02, complete sequence 149245-149271 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP013744 Streptomyces sp. CdTB01 plasmid unnamed, complete sequence 249716-249742 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP040248 Mycobacterium avium subsp. hominissuis strain 101174 plasmid pFLAC0181_CHOP101, complete sequence 22194-22220 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP033037 Agrobacterium fabrum strain 12D13 plasmid pAt12D13b, complete sequence 54647-54673 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP021356 Rhodococcus sp. S2-17 plasmid pRB29, complete sequence 76527-76553 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP029357 Azospirillum sp. CFH 70021 plasmid unnamed2 577799-577825 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP053709 Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed1, complete sequence 336197-336223 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP031358 Erythrobacter aureus strain YH-07 plasmid unnamed, complete sequence 188896-188922 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP046575 Rhodococcus sp. WAY2 plasmid pRWAY03, complete sequence 124863-124889 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP015212 Rhodobacter sphaeroides strain MBTLJ-13 plasmid a, complete sequence 84374-84400 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 1268491-1268517 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP024940 Paraburkholderia hospita strain mHSR1 plasmid pmHSR1_P, complete sequence 634658-634684 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 196068-196094 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 MN813684 Microbacterium phage Terij, complete genome 20880-20906 6 0.778
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 MK977705 Gordonia Phage Mollymur, complete genome 57278-57304 6 0.778
CP027022_8 8.1|2555184|31|CP027022|CRISPRCasFinder 2555184-2555214 31 MT310862 Streptomyces phage Itza, complete genome 27654-27684 6 0.806
CP027022_8 8.1|2555184|31|CP027022|CRISPRCasFinder 2555184-2555214 31 MN062705 Streptomyces phage Celia, complete genome 27740-27770 6 0.806
CP027022_8 8.1|2555184|31|CP027022|CRISPRCasFinder 2555184-2555214 31 MN234189 Streptomyces phage Urza, complete genome 27675-27705 6 0.806
CP027022_12 12.2|3302283|32|CP027022|CRISPRCasFinder 3302283-3302314 32 NZ_CP021372 Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence 237694-237725 6 0.812
CP027022_12 12.2|3302283|32|CP027022|CRISPRCasFinder 3302283-3302314 32 NZ_CP017077 Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence 669917-669948 6 0.812
CP027022_12 12.2|3302283|32|CP027022|CRISPRCasFinder 3302283-3302314 32 NZ_AF331043 Arthrobacter keyseri strain 12B plasmid pRE1, complete sequence 7888-7919 6 0.812
CP027022_12 12.2|3302283|32|CP027022|CRISPRCasFinder 3302283-3302314 32 NC_015147 Pseudarthrobacter phenanthrenivorans Sphe3 plasmid pASPHE302, complete sequence 48282-48313 6 0.812
CP027022_12 12.2|3302283|32|CP027022|CRISPRCasFinder 3302283-3302314 32 NC_008538 Arthrobacter sp. FB24 plasmid 2, complete sequence 112984-113015 6 0.812
CP027022_23 23.1|7089514|33|CP027022|CRISPRCasFinder 7089514-7089546 33 NC_016435 Gordonia phage GRU1, complete genome 42392-42424 6 0.818
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP040937 Hymenobacter sp. DG01 plasmid unnamed, complete sequence 102434-102460 7 0.741
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_AP022622 Mycobacteroides abscessus strain JCM 30620 plasmid pJCM30620_1 92664-92690 7 0.741
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP006588 Hymenobacter sp. APR13 plasmid pHA, complete sequence 88944-88970 7 0.741
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2293842-2293868 7 0.741
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NC_021279 Mycobacteroides abscessus subsp. bolletii 50594 plasmid 2, complete sequence 42520-42546 7 0.741
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 MH834619 Arthrobacter phage Maureen, complete genome 35922-35948 7 0.741
CP027022_7 7.4|2013348|27|CP027022|CRISPRCasFinder 2013348-2013374 27 NC_048115 Arthrobacter phage Liebe, complete genome 35922-35948 7 0.741
CP027022_8 8.1|2555184|31|CP027022|CRISPRCasFinder 2555184-2555214 31 MN585980 Microbacterium phage Gina, complete genome 24782-24812 7 0.774
CP027022_8 8.1|2555184|31|CP027022|CRISPRCasFinder 2555184-2555214 31 MN586059 Microbacterium phage Teamocil, complete genome 24881-24911 7 0.774
CP027022_11 11.2|3257475|31|CP027022|CRISPRCasFinder 3257475-3257505 31 NZ_CP025432 Paracoccus zhejiangensis strain J6 plasmid pPZ02, complete sequence 127072-127102 7 0.774
CP027022_11 11.2|3257475|31|CP027022|CRISPRCasFinder 3257475-3257505 31 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 776239-776269 7 0.774
CP027022_11 11.2|3257475|31|CP027022|CRISPRCasFinder 3257475-3257505 31 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 392200-392230 7 0.774
CP027022_11 11.2|3257475|31|CP027022|CRISPRCasFinder 3257475-3257505 31 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 1057615-1057645 7 0.774
CP027022_11 11.2|3257475|31|CP027022|CRISPRCasFinder 3257475-3257505 31 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 659345-659375 7 0.774
CP027022_11 11.2|3257475|31|CP027022|CRISPRCasFinder 3257475-3257505 31 NZ_CP016560 Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence 316601-316631 7 0.774
CP027022_11 11.2|3257475|31|CP027022|CRISPRCasFinder 3257475-3257505 31 NZ_CP031166 Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence 234062-234092 7 0.774
CP027022_12 12.2|3302283|32|CP027022|CRISPRCasFinder 3302283-3302314 32 NC_014811 Mycolicibacterium gilvum Spyr1 plasmid pMSPYR101, complete sequence 186419-186450 7 0.781
CP027022_12 12.2|3302283|32|CP027022|CRISPRCasFinder 3302283-3302314 32 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 741625-741656 7 0.781
CP027022_12 12.2|3302283|32|CP027022|CRISPRCasFinder 3302283-3302314 32 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 700675-700706 7 0.781
CP027022_12 12.2|3302283|32|CP027022|CRISPRCasFinder 3302283-3302314 32 NZ_CP035092 Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence 236836-236867 7 0.781
CP027022_12 12.2|3302283|32|CP027022|CRISPRCasFinder 3302283-3302314 32 NC_008688 Paracoccus denitrificans PD1222 plasmid 1, complete sequence 484184-484215 7 0.781
CP027022_12 12.2|3302283|32|CP027022|CRISPRCasFinder 3302283-3302314 32 NZ_CP030763 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence 356668-356699 7 0.781
CP027022_11 11.2|3257475|31|CP027022|CRISPRCasFinder 3257475-3257505 31 NZ_CP013855 Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence 160005-160035 8 0.742
CP027022_11 11.2|3257475|31|CP027022|CRISPRCasFinder 3257475-3257505 31 NZ_HG938356 Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence 474119-474149 8 0.742
CP027022_11 11.2|3257475|31|CP027022|CRISPRCasFinder 3257475-3257505 31 NZ_CP011667 Streptomyces sp. Mg1 plasmid pSMg1-3, complete sequence 28141-28171 8 0.742
CP027022_11 11.2|3257475|31|CP027022|CRISPRCasFinder 3257475-3257505 31 NC_042350 Salinibacter virus M8CR30-2, complete genome 12933-12963 8 0.742
CP027022_11 11.2|3257475|31|CP027022|CRISPRCasFinder 3257475-3257505 31 MF580958 Salinibacter virus M8CR30-4, partial genome 13097-13127 8 0.742
CP027022_11 11.2|3257475|31|CP027022|CRISPRCasFinder 3257475-3257505 31 NC_042348 Salinibacter virus M1EM-1, partial genome 12535-12565 8 0.742
CP027022_11 11.2|3257475|31|CP027022|CRISPRCasFinder 3257475-3257505 31 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 448270-448300 8 0.742
CP027022_11 11.2|3257475|31|CP027022|CRISPRCasFinder 3257475-3257505 31 NZ_CP033583 Streptomyces sp. ADI95-16 plasmid pADI95-16b, complete sequence 212930-212960 8 0.742
CP027022_11 11.2|3257475|31|CP027022|CRISPRCasFinder 3257475-3257505 31 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 436625-436655 8 0.742
CP027022_11 11.2|3257475|31|CP027022|CRISPRCasFinder 3257475-3257505 31 MK814757 Gordonia phage Fairfaxidum, complete genome 42113-42143 8 0.742
CP027022_12 12.2|3302283|32|CP027022|CRISPRCasFinder 3302283-3302314 32 NZ_CP019603 Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence 410558-410589 8 0.75
CP027022_12 12.2|3302283|32|CP027022|CRISPRCasFinder 3302283-3302314 32 NZ_CP039697 Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence 672280-672311 8 0.75
CP027022_12 12.2|3302283|32|CP027022|CRISPRCasFinder 3302283-3302314 32 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 1371572-1371603 8 0.75
CP027022_23 23.1|7089514|33|CP027022|CRISPRCasFinder 7089514-7089546 33 NZ_CP050081 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b5, complete sequence 336376-336408 8 0.758
CP027022_23 23.1|7089514|33|CP027022|CRISPRCasFinder 7089514-7089546 33 NZ_CP049249 Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence 1065851-1065883 8 0.758
CP027022_11 11.2|3257475|31|CP027022|CRISPRCasFinder 3257475-3257505 31 NZ_CP023455 Rhodobacteraceae bacterium QY30 plasmid unnamed, complete sequence 14939-14969 9 0.71
CP027022_11 11.2|3257475|31|CP027022|CRISPRCasFinder 3257475-3257505 31 MF324912 Mycobacterium phage Phrank, complete genome 32123-32153 9 0.71
CP027022_11 11.2|3257475|31|CP027022|CRISPRCasFinder 3257475-3257505 31 MF324908 Mycobacterium phage Unicorn, complete genome 32163-32193 9 0.71
CP027022_11 11.2|3257475|31|CP027022|CRISPRCasFinder 3257475-3257505 31 MN369762 Mycobacterium phage Bryler, complete genome 32146-32176 9 0.71
CP027022_11 11.2|3257475|31|CP027022|CRISPRCasFinder 3257475-3257505 31 MF324909 Mycobacterium phage PhelpsODU, complete genome 32163-32193 9 0.71
CP027022_11 11.2|3257475|31|CP027022|CRISPRCasFinder 3257475-3257505 31 MF324913 Mycobacterium phage Cain, complete genome 32134-32164 9 0.71
CP027022_11 11.2|3257475|31|CP027022|CRISPRCasFinder 3257475-3257505 31 MN234176 Mycobacterium phage Yuna, complete genome 34036-34066 9 0.71
CP027022_12 12.2|3302283|32|CP027022|CRISPRCasFinder 3302283-3302314 32 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 558460-558491 9 0.719
CP027022_12 12.2|3302283|32|CP027022|CRISPRCasFinder 3302283-3302314 32 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 261648-261679 9 0.719
CP027022_12 12.2|3302283|32|CP027022|CRISPRCasFinder 3302283-3302314 32 NZ_CP050100 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b3, complete sequence 148077-148108 9 0.719
CP027022_12 12.2|3302283|32|CP027022|CRISPRCasFinder 3302283-3302314 32 NZ_CP025017 Rhizobium leguminosarum strain Norway plasmid pRLN5, complete sequence 128780-128811 9 0.719
CP027022_12 12.2|3302283|32|CP027022|CRISPRCasFinder 3302283-3302314 32 NZ_LR134452 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence 222019-222050 9 0.719
CP027022_12 12.2|3302283|32|CP027022|CRISPRCasFinder 3302283-3302314 32 NC_012854 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132505, complete sequence 181282-181313 9 0.719
CP027022_12 12.2|3302283|32|CP027022|CRISPRCasFinder 3302283-3302314 32 NZ_CP013631 Rhizobium sp. N324 plasmid pRspN324a, complete sequence 167215-167246 9 0.719
CP027022_12 12.2|3302283|32|CP027022|CRISPRCasFinder 3302283-3302314 32 NZ_CP018232 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed4, complete sequence 162086-162117 9 0.719
CP027022_12 12.2|3302283|32|CP027022|CRISPRCasFinder 3302283-3302314 32 NZ_CP016291 Rhizobium leguminosarum strain Vaf10 plasmid unnamed6, complete sequence 255625-255656 9 0.719
CP027022_12 12.2|3302283|32|CP027022|CRISPRCasFinder 3302283-3302314 32 NC_011368 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence 101334-101365 9 0.719
CP027022_12 12.2|3302283|32|CP027022|CRISPRCasFinder 3302283-3302314 32 NZ_CP048284 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248b, complete sequence 149421-149452 9 0.719
CP027022_12 12.2|3302283|32|CP027022|CRISPRCasFinder 3302283-3302314 32 NZ_CP032053 Streptomyces clavuligerus strain F1D-5 plasmid pSCL2, complete sequence 10100-10131 9 0.719
CP027022_12 12.2|3302283|32|CP027022|CRISPRCasFinder 3302283-3302314 32 NZ_CP054036 Rhizobium sp. JKLM13E plasmid pPR13E05, complete sequence 11611-11642 9 0.719
CP027022_12 12.2|3302283|32|CP027022|CRISPRCasFinder 3302283-3302314 32 NZ_CP022568 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK04, complete sequence 195258-195289 9 0.719
CP027022_12 12.2|3302283|32|CP027022|CRISPRCasFinder 3302283-3302314 32 MK977708 Mycobacterium phage Fulbright, complete genome 9706-9737 9 0.719
CP027022_12 12.2|3302283|32|CP027022|CRISPRCasFinder 3302283-3302314 32 MG099948 Mycobacterium phage Philonius, complete genome 9706-9737 9 0.719
CP027022_12 12.2|3302283|32|CP027022|CRISPRCasFinder 3302283-3302314 32 MH926055 Mycobacterium phage Chewbacca, complete genome 9706-9737 9 0.719
CP027022_12 12.2|3302283|32|CP027022|CRISPRCasFinder 3302283-3302314 32 KF986246 Mycobacterium phage MichelleMyBell, complete genome 9745-9776 9 0.719
CP027022_12 12.2|3302283|32|CP027022|CRISPRCasFinder 3302283-3302314 32 MT723932 Mycobacterium phage Schnauzer, complete genome 9706-9737 9 0.719
CP027022_12 12.2|3302283|32|CP027022|CRISPRCasFinder 3302283-3302314 32 KU935726 Mycobacterium phage Xerxes, complete genome 9706-9737 9 0.719
CP027022_12 12.2|3302283|32|CP027022|CRISPRCasFinder 3302283-3302314 32 KU935730 Mycobacterium phage Pipsqueaks, complete genome 9706-9737 9 0.719
CP027022_12 12.2|3302283|32|CP027022|CRISPRCasFinder 3302283-3302314 32 MH316570 Mycobacterium phage Silvafighter, complete genome 9706-9737 9 0.719
CP027022_12 12.2|3302283|32|CP027022|CRISPRCasFinder 3302283-3302314 32 MK524518 Mycobacterium phage Smurph, complete genome 9706-9737 9 0.719
CP027022_12 12.2|3302283|32|CP027022|CRISPRCasFinder 3302283-3302314 32 MK524515 Mycobacterium phage Parmesanjohn, complete genome 9706-9737 9 0.719
CP027022_12 12.2|3302283|32|CP027022|CRISPRCasFinder 3302283-3302314 32 MH697585 Mycobacterium phage Gex, complete genome 9705-9736 9 0.719
CP027022_12 12.2|3302283|32|CP027022|CRISPRCasFinder 3302283-3302314 32 MH399787 Mycobacterium phage Rubeelu, complete genome 9726-9757 9 0.719
CP027022_12 12.2|3302283|32|CP027022|CRISPRCasFinder 3302283-3302314 32 KM588359 Mycobacterium phage Carcharodon, complete genome 9706-9737 9 0.719
CP027022_12 12.2|3302283|32|CP027022|CRISPRCasFinder 3302283-3302314 32 MH697576 Mycobacterium phage Aggie, complete genome 9707-9738 9 0.719
CP027022_12 12.2|3302283|32|CP027022|CRISPRCasFinder 3302283-3302314 32 NC_021061 Mycobacterium phage Butters, complete genome 9726-9757 9 0.719
CP027022_12 12.2|3302283|32|CP027022|CRISPRCasFinder 3302283-3302314 32 MH697593 Mycobacterium phage Tapioca, complete genome 9706-9737 9 0.719
CP027022_12 12.2|3302283|32|CP027022|CRISPRCasFinder 3302283-3302314 32 MK524500 Mycobacterium phage Kevin1, complete genome 9726-9757 9 0.719
CP027022_12 12.2|3302283|32|CP027022|CRISPRCasFinder 3302283-3302314 32 MG099936 Mycobacterium phage Andies, complete genome 9706-9737 9 0.719
CP027022_12 12.2|3302283|32|CP027022|CRISPRCasFinder 3302283-3302314 32 NC_031243 Mycobacterium phage Xeno, complete genome 9706-9737 9 0.719
CP027022_12 12.2|3302283|32|CP027022|CRISPRCasFinder 3302283-3302314 32 JN256079 Mycobacterium phage Charlie, complete genome 9706-9737 9 0.719
CP027022_16 16.1|5578121|34|CP027022|CRISPRCasFinder 5578121-5578154 34 MT498048 Mycobacterium phage Raymond7, complete genome 40949-40982 9 0.735
CP027022_16 16.1|5578121|34|CP027022|CRISPRCasFinder 5578121-5578154 34 MK524522 Mycobacterium phage Purgamenstris, complete genome 41161-41194 9 0.735
CP027022_16 16.1|5578121|34|CP027022|CRISPRCasFinder 5578121-5578154 34 MT498042 Mycobacterium phage Rebel, complete genome 39145-39178 9 0.735
CP027022_16 16.1|5578121|34|CP027022|CRISPRCasFinder 5578121-5578154 34 MK392367 Mycobacterium phage BabeRuth, complete genome 41161-41194 9 0.735
CP027022_16 16.1|5578121|34|CP027022|CRISPRCasFinder 5578121-5578154 34 MK524520 Mycobacterium phage Nenae, complete genome 41163-41196 9 0.735
CP027022_16 16.1|5578121|34|CP027022|CRISPRCasFinder 5578121-5578154 34 JN624851 Mycobacterium phage Redi, complete genome 41160-41193 9 0.735
CP027022_16 16.1|5578121|34|CP027022|CRISPRCasFinder 5578121-5578154 34 MK524528 Mycobacterium phage ShrimpFriedEgg, complete genome 41160-41193 9 0.735
CP027022_9 9.2|2972525|37|CP027022|PILER-CR 2972525-2972561 37 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1791923-1791959 10 0.73
CP027022_11 11.1|3257421|31|CP027022|CRISPRCasFinder 3257421-3257451 31 NZ_CP015882 Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence 885171-885201 10 0.677
CP027022_11 11.1|3257421|31|CP027022|CRISPRCasFinder 3257421-3257451 31 NZ_CP030264 Ensifer adhaerens strain Corn53 plasmid AB, complete sequence 45787-45817 10 0.677
CP027022_12 12.2|3302283|32|CP027022|CRISPRCasFinder 3302283-3302314 32 NZ_CP021082 Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence 368067-368098 10 0.688
CP027022_23 23.1|7089514|33|CP027022|CRISPRCasFinder 7089514-7089546 33 NZ_CP029209 Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence 827010-827042 10 0.697

1. spacer 2.1|83137|37|CP027022|CRISPRCasFinder matches to NZ_CP027024 (Streptomyces sp. WAC00288 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

gtctgcgccaacgcttaccgaggcgagctggtttttc	CRISPR spacer
gtctgcgccaacgcttaccgaggcgagctggtttttc	Protospacer
*************************************

2. spacer 2.2|83197|19|CP027022|CRISPRCasFinder matches to NZ_CP027024 (Streptomyces sp. WAC00288 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

gccattcgatgtctggttg	CRISPR spacer
gccattcgatgtctggttg	Protospacer
*******************

3. spacer 2.3|83239|37|CP027022|CRISPRCasFinder matches to NZ_CP027024 (Streptomyces sp. WAC00288 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

gcggttggagccacctgtggtttcgctggtgagctgg	CRISPR spacer
gcggttggagccacctgtggtttcgctggtgagctgg	Protospacer
*************************************

4. spacer 2.4|83299|43|CP027022|CRISPRCasFinder matches to NZ_CP027024 (Streptomyces sp. WAC00288 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

ggtggctgtgccagctttggtctgggtggtgcggttgccgacc	CRISPR spacer
ggtggctgtgccagctttggtctgggtggtgcggttgccgacc	Protospacer
*******************************************

5. spacer 3.1|83674|37|CP027022|CRISPRCasFinder matches to NZ_CP027024 (Streptomyces sp. WAC00288 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

gccggctgttccggtctggctggtgcggcggccgtcg	CRISPR spacer
gccggctgttccggtctggctggtgcggcggccgtcg	Protospacer
*************************************

6. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 2, identity: 0.926

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cggccggcgcagccgccgccgccgccg	Protospacer
********* *************.***

7. spacer 20.1|6093348|23|CP027022|CRISPRCasFinder matches to NC_020489 (Rhodobacter phage RcapNL, complete genome) position: , mismatch: 2, identity: 0.913

tgtggcggggccggaggcgggct	CRISPR spacer
tgcggcgggcccggaggcgggct	Protospacer
**.****** *************

8. spacer 20.1|6093348|23|CP027022|CRISPRCasFinder matches to JF974309 (Rhodobacter phage RcNL1, *** SEQUENCING IN PROGRESS ***, 5 unordered pieces) position: , mismatch: 2, identity: 0.913

tgtggcggggccggaggcgggct	CRISPR spacer
tgcggcgggcccggaggcgggct	Protospacer
**.****** *************

9. spacer 7.3|2013300|24|CP027022|CRISPRCasFinder matches to NZ_CP025436 (Gordonia sp. YC-JH1 plasmid pGOR1, complete sequence) position: , mismatch: 3, identity: 0.875

ccaccgccgggaccacccggacga	CRISPR spacer
gcaccgccgagaccgcccggacga	Protospacer
 ********.****.*********

10. spacer 7.3|2013300|24|CP027022|CRISPRCasFinder matches to NZ_CP045303 (Azotobacter salinestris strain KACC 13899 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ccaccgccgggaccacccggacga	CRISPR spacer
ccagcgccgggaacacccggacgt	Protospacer
*** ******** ********** 

11. spacer 7.3|2013300|24|CP027022|CRISPRCasFinder matches to NZ_CP010421 (Azotobacter chroococcum NCIMB 8003 plasmid pAcX50f, complete sequence) position: , mismatch: 3, identity: 0.875

ccaccgccgggaccacccggacga	CRISPR spacer
ccagcgccgggaacacccggacgt	Protospacer
*** ******** ********** 

12. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 3, identity: 0.889

cggccggcgaagccgccgccgccaccg	CRISPR spacer
tcgccggcgaagccgccgccgccgccg	Protospacer
. *********************.***

13. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP011053 (Halomonas sp. KO116 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.889

cggccggcgaagccgccgccgccaccg	CRISPR spacer
ccgccaccgaagccgccgccgccaccg	Protospacer
* ***. ********************

14. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.889

cggccggcgaagccgccgccgccaccg	CRISPR spacer
ctgccggcgaagccctcgccgccaccg	Protospacer
* ************ .***********

15. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.889

cggccggcgaagccgccgccgccaccg	CRISPR spacer
ccgccggcgaatccgccgccgcgaccg	Protospacer
* ********* ********** ****

16. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 3, identity: 0.889

cggccggcgaagccgccgccgccaccg	CRISPR spacer
ccgccggcgaatccgccgccgcgaccg	Protospacer
* ********* ********** ****

17. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
ccaccgggacgaccgccgccgcca	Protospacer
  .*********************

18. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
cagccaggacgaccgccgccgcct	Protospacer
 ****.***************** 

19. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
ccgccgggacgatcgccgccgcca	Protospacer
  **********.***********

20. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NZ_CP040720 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
aagccgggacgaccgccgacgctg	Protospacer
****************** ***..

21. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
aagccgggccggccgccgccgccc	Protospacer
******** **.*********** 

22. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
aagccgggccggccgccgccgccc	Protospacer
******** **.*********** 

23. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
aagccgggccggccgccgccgccc	Protospacer
******** **.*********** 

24. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
aagccgggccggccgccgccgccc	Protospacer
******** **.*********** 

25. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
aagccgggccggccgccgccgccc	Protospacer
******** **.*********** 

26. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
aagccgggccggccgccgccgccc	Protospacer
******** **.*********** 

27. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
aagccgggccggccgccgccgccc	Protospacer
******** **.*********** 

28. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
aagccgggccggccgccgccgccc	Protospacer
******** **.*********** 

29. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
aagccgggccggccgccgccgccc	Protospacer
******** **.*********** 

30. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
aagccgggccggccgccgccgccc	Protospacer
******** **.*********** 

31. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
aagccgggccggccgccgccgccc	Protospacer
******** **.*********** 

32. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
aagccgggccggccgccgccgccc	Protospacer
******** **.*********** 

33. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
aagccgggccggccgccgccgccc	Protospacer
******** **.*********** 

34. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
aagccgggccggccgccgccgccc	Protospacer
******** **.*********** 

35. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
aagccgggccggccgccgccgccc	Protospacer
******** **.*********** 

36. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
aagccgggccggccgccgccgccc	Protospacer
******** **.*********** 

37. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
aagccgggccggccgccgccgccc	Protospacer
******** **.*********** 

38. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
aagccgggccggccgccgccgccc	Protospacer
******** **.*********** 

39. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
aagccgggccggccgccgccgccc	Protospacer
******** **.*********** 

40. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
aagccgggccggccgccgccgccc	Protospacer
******** **.*********** 

41. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
aagccgggccggccgccgccgccc	Protospacer
******** **.*********** 

42. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
aagccgggccggccgccgccgccc	Protospacer
******** **.*********** 

43. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
aagccgggccggccgccgccgccc	Protospacer
******** **.*********** 

44. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
aagccgggccggccgccgccgccc	Protospacer
******** **.*********** 

45. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
aagccgggccggccgccgccgccc	Protospacer
******** **.*********** 

46. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
aagccgggccggccgccgccgccc	Protospacer
******** **.*********** 

47. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
aagccgggccggccgccgccgccc	Protospacer
******** **.*********** 

48. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
aagccgggccggccgccgccgccc	Protospacer
******** **.*********** 

49. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
aagccgggccggccgccgccgccc	Protospacer
******** **.*********** 

50. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
aagccgggccggccgccgccgccc	Protospacer
******** **.*********** 

51. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
aagccgggccggccgccgccgccc	Protospacer
******** **.*********** 

52. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
aagccgggccggccgccgccgccc	Protospacer
******** **.*********** 

53. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
aagccgggccggccgccgccgccc	Protospacer
******** **.*********** 

54. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
aagccgggccggccgccgccgccc	Protospacer
******** **.*********** 

55. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
aagccgggccggccgccgccgccc	Protospacer
******** **.*********** 

56. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
aagccgggccggccgccgccgccc	Protospacer
******** **.*********** 

57. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to KM597530 (Mycobacterium phage Bipolar, complete genome) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
aagccgagacgaccgcagccgccg	Protospacer
******.********* ******.

58. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to KM101122 (Mycobacterium phage Hades, complete genome) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
aagccgagacgaccgcagccgccg	Protospacer
******.********* ******.

59. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to MH669014 (Mycobacterium phage Spikelee, complete genome) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
aagccgagacgaccgcagccgccg	Protospacer
******.********* ******.

60. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to MG770213 (Mycobacterium phage OldBen, complete genome) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
aagccgagacgaccgcagccgccg	Protospacer
******.********* ******.

61. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to FJ174693 (Mycobacterium phage Ramsey, complete genome) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
aagccgagacgaccgcagccgccg	Protospacer
******.********* ******.

62. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to MN062708 (Mycobacteriumphage NothingSpecial, complete genome) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
cagcctggacgaccgccgcagcca	Protospacer
 **** ************* ****

63. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NC_023728 (Mycobacterium virus DeadP, complete genome) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
aagccgagacgaccgcagccgccg	Protospacer
******.********* ******.

64. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
aagccgagacgaccgcagccgccg	Protospacer
******.********* ******.

65. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
aagccgggccggccgccgccgccc	Protospacer
******** **.*********** 

66. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
aagccgggccggccgccgccgccc	Protospacer
******** **.*********** 

67. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
aagccgggccggccgccgccgccc	Protospacer
******** **.*********** 

68. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
aagccgggccggccgccgccgccc	Protospacer
******** **.*********** 

69. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
aagccgggccggccgccgccgccc	Protospacer
******** **.*********** 

70. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
aagccgggccggccgccgccgccc	Protospacer
******** **.*********** 

71. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to MK937603 (Gordonia phage Bakery, complete genome) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
aagccgtgacgaccgctgccgccg	Protospacer
****** *********.******.

72. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to KC736071 (Mycobacterium phage WIVsmall, complete genome) position: , mismatch: 3, identity: 0.875

aagccgggacgaccgccgccgcca	CRISPR spacer
aagccgagacgaccgcagccgccg	Protospacer
******.********* ******.

73. spacer 20.1|6093348|23|CP027022|CRISPRCasFinder matches to NC_024970 (Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 3, identity: 0.87

tgtggcggggccggaggcgggct	CRISPR spacer
cgtggcggggccggtggcgggca	Protospacer
.************* ******* 

74. spacer 20.1|6093348|23|CP027022|CRISPRCasFinder matches to NZ_KJ396772 (Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 3, identity: 0.87

tgtggcggggccggaggcgggct	CRISPR spacer
cgtggcggggccggtggcgggca	Protospacer
.************* ******* 

75. spacer 20.1|6093348|23|CP027022|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.87

tgtggcggggccggaggcgggct	CRISPR spacer
cgtggcggggctggaggcgggcg	Protospacer
.**********.********** 

76. spacer 20.1|6093348|23|CP027022|CRISPRCasFinder matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 3, identity: 0.87

tgtggcggggccggaggcgggct	CRISPR spacer
ggtggcggagccggaggcgggcg	Protospacer
 *******.************* 

77. spacer 20.1|6093348|23|CP027022|CRISPRCasFinder matches to NZ_CP024986 (Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence) position: , mismatch: 3, identity: 0.87

tgtggcggggccggaggcgggct	CRISPR spacer
cgtggcggggccggtggcgggca	Protospacer
.************* ******* 

78. spacer 7.3|2013300|24|CP027022|CRISPRCasFinder matches to AP018486 (Mycobacterium phage PP DNA, complete genome) position: , mismatch: 4, identity: 0.833

ccaccgccgggaccacccggacga	CRISPR spacer
gcaccgccgggaccacccgcacag	Protospacer
 ****************** **..

79. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NC_001396 (Xanthomonas phage Cf1c, complete genome) position: , mismatch: 4, identity: 0.852

cggccggcgaagccgccgccgccaccg	CRISPR spacer
gtgccgtcgaagtcgccgccgccaccg	Protospacer
  **** *****.**************

80. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to AB910602 (Xanthomonas phage XacF1 DNA, complete genome) position: , mismatch: 4, identity: 0.852

cggccggcgaagccgccgccgccaccg	CRISPR spacer
gtgccgtcgaagtcgccgccgccaccg	Protospacer
  **** *****.**************

81. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to U41819 (Xanthomonas virus Cf1c B coat protein and A coat protein genes, complete cds) position: , mismatch: 4, identity: 0.852

cggccggcgaagccgccgccgccaccg	CRISPR spacer
gtgccgtcgaagtcgccgccgccaccg	Protospacer
  **** *****.**************

82. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to M57538 (Xanthomonas phage Cf1c unknown gene) position: , mismatch: 4, identity: 0.852

cggccggcgaagccgccgccgccaccg	CRISPR spacer
gtgccgtcgaagtcgccgccgccaccg	Protospacer
  **** *****.**************

83. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP045381 (Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence) position: , mismatch: 4, identity: 0.852

cggccggcgaagccgccgccgccaccg	CRISPR spacer
tcgccgccgaaaccgccgccgccaccg	Protospacer
. **** ****.***************

84. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP022419 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-4, complete sequence) position: , mismatch: 4, identity: 0.852

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cggcgtgcgaagccgccgccgccacac	Protospacer
****  *******************  

85. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP019631 (Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852

cggccggcgaagccgccgccgccaccg	CRISPR spacer
tcgccgccgaaaccgccgccgccaccg	Protospacer
. **** ****.***************

86. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP032676 (Rhodococcus rhodochrous strain ATCC BAA870 plasmid pNit, complete sequence) position: , mismatch: 4, identity: 0.852

cggccggcgaagccgccgccgccaccg	CRISPR spacer
acgccggcgaagctgccggcgccaccg	Protospacer
  ***********.**** ********

87. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 4, identity: 0.852

--cggccggcgaagccgccgccgccaccg	CRISPR spacer
atcga--ggcgaagccgccgccgccaccc	Protospacer
  **.  ********************* 

88. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 4, identity: 0.852

cggccggcgaagccgccgccgccaccg	CRISPR spacer
gcgccgccgaggccgccgccgccaccg	Protospacer
  **** ***.****************

89. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to MN908691 (Gordonia phage DatBoi, complete genome) position: , mismatch: 4, identity: 0.852

cggccggcgaagccgccgccgccaccg	CRISPR spacer
ttgccgccgaagccgccgccgccgccg	Protospacer
. **** ****************.***

90. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_AP014812 (Methylorubrum populi strain P-1M plasmid pMPPM03, complete sequence) position: , mismatch: 4, identity: 0.852

cggccggcgaagccgccgccgccaccg	CRISPR spacer
tggccggccaagccgcagccgccactg	Protospacer
.******* ******* ********.*

91. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852

cggccggcgaagccgccgccgccaccg	CRISPR spacer
ccgccggcgaagccgccgccgcgcgcg	Protospacer
* ********************   **

92. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852

cggccggcgaagccgccgccgccaccg	CRISPR spacer
ccgccggcgaagccgccgccgcgcgcg	Protospacer
* ********************   **

93. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 4, identity: 0.852

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cggccggcgacgccgccgtcgccaggg	Protospacer
********** *******.*****  *

94. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 4, identity: 0.852

cggccggcgaagccgccgccgccaccg	CRISPR spacer
ccgccggcgaagccgccgccgcgcgcg	Protospacer
* ********************   **

95. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852

cggccggcgaagccgccgccgccaccg	CRISPR spacer
ccgccggcgaagccgccgccgcgcgcg	Protospacer
* ********************   **

96. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852

cggccggcgaagccgccgccgccaccg	CRISPR spacer
ccgccggcgaagccgccgccgcgcgcg	Protospacer
* ********************   **

97. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852

cggccggcgaagccgccgccgccaccg	CRISPR spacer
ccgccggcgaagccgccgccgcgcgcg	Protospacer
* ********************   **

98. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852

cggccggcgaagccgccgccgccaccg	CRISPR spacer
ccgccggcgaagccgccgccgcgcgcg	Protospacer
* ********************   **

99. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852

cggccggcgaagccgccgccgccaccg	CRISPR spacer
ccgccggcgaagccgccgccgcgcgcg	Protospacer
* ********************   **

100. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NC_023284 (Streptomyces sp. F2 plasmid pFRL4, complete sequence) position: , mismatch: 4, identity: 0.852

cggccggcgaagccgccgccgccaccg	CRISPR spacer
ccaccggcaaagcggccgccgccaccg	Protospacer
* .*****.**** *************

101. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 4, identity: 0.852

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cggccggcgcagccgccgccgcgccag	Protospacer
********* ************  * *

102. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 4, identity: 0.852

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cggccggcgaagccgcagccgcagcag	Protospacer
**************** ***** .* *

103. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 4, identity: 0.852

cggccggcgaagccgccgccgccaccg	CRISPR spacer
ccgccggcgaagccgccgccgcgcgcg	Protospacer
* ********************   **

104. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NC_014819 (Asticcacaulis excentricus CB 48 plasmid pASTEX02, complete sequence) position: , mismatch: 4, identity: 0.852

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cggccggcgatgccgtcgccgcccctg	Protospacer
********** ****.******* *.*

105. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 4, identity: 0.852

cggccggcgaagccgccgccg-ccaccg	CRISPR spacer
cggccggcgaggccgccgccgatcagc-	Protospacer
**********.********** .** * 

106. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 4, identity: 0.852

cggccggcgaagccgccgccg-ccaccg	CRISPR spacer
cggccggcgaggccgccgccgatcagc-	Protospacer
**********.********** .** * 

107. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 4, identity: 0.852

cggccggcgaagccgccgccgccaccg	CRISPR spacer
ctgccggcgaaggcgccgccggcacgg	Protospacer
* ********** ******** *** *

108. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 4, identity: 0.852

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cggccggcgtagccgccaccgccggcg	Protospacer
********* *******.*****. **

109. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 4, identity: 0.852

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cggcgggcgatgccgccgccgccttcg	Protospacer
**** ***** ************ .**

110. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 4, identity: 0.852

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cggccgacgaagccgccgccgtcgctg	Protospacer
******.**************.*.*.*

111. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.852

cggccggcgaagccgccgccgccaccg	CRISPR spacer
ctgccggcccagccgccgccgccactg	Protospacer
* ******  ***************.*

112. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to CP054934 (Nocardiopsis flavescens strain NA01583 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cggccgccgaagccgcagccgccgacg	Protospacer
****** ********* ******. **

113. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 4, identity: 0.852

cggccggcgaagccgccgccgccaccg	CRISPR spacer
ctgccggcccagccgccgccgccactg	Protospacer
* ******  ***************.*

114. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to CP003951 (Rhodococcus opacus PD630 plasmid 2, complete sequence) position: , mismatch: 4, identity: 0.852

cggcc--ggcgaagccgccgccgccaccg	CRISPR spacer
--gccatggctaagccgccgccgccacca	Protospacer
  ***  *** *****************.

115. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to CP003951 (Rhodococcus opacus PD630 plasmid 2, complete sequence) position: , mismatch: 4, identity: 0.852

cggcc--ggcgaagccgccgccgccaccg	CRISPR spacer
--gccatggctaagccgccgccgccacca	Protospacer
  ***  *** *****************.

116. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to CP003951 (Rhodococcus opacus PD630 plasmid 2, complete sequence) position: , mismatch: 4, identity: 0.852

cggcc--ggcgaagccgccgccgccaccg	CRISPR spacer
--gccatggctaagccgccgccgccacca	Protospacer
  ***  *** *****************.

117. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to MF377441 (Arthrobacter phage Timinator, complete genome) position: , mismatch: 4, identity: 0.852

cggccggcgaagccgccgccgccaccg	CRISPR spacer
ccgccgccgaagccgccgcccccacgg	Protospacer
* **** ************* **** *

118. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to MT310895 (Arthrobacter phage StevieBAY, complete genome) position: , mismatch: 4, identity: 0.852

cggccggcgaagccgccgccgccaccg	CRISPR spacer
ccgccgccgaagccgccgcccccactg	Protospacer
* **** ************* ****.*

119. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to KU647629 (Arthrobacter phage BarretLemon, complete genome) position: , mismatch: 4, identity: 0.852

cggccggcgaagccgccgccgccaccg	CRISPR spacer
ccgccgccgaagccgccgcccccacgg	Protospacer
* **** ************* **** *

120. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NC_025133 (Sphingobium wenxiniae strain JZ-1 plasmid pPBA, complete sequence) position: , mismatch: 4, identity: 0.852

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cggccgccgtagccgccgccgccgctg	Protospacer
****** ** *************.*.*

121. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP005192 (Sphingobium sp. MI1205 plasmid pMI3, complete sequence) position: , mismatch: 4, identity: 0.852

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cggccgccgtagccgccgccgccgctg	Protospacer
****** ** *************.*.*

122. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to AB244976 (Uncultured bacterium plasmid pLB1 DNA, complete sequence) position: , mismatch: 4, identity: 0.852

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cggccgccgtagccgccgccgccgctg	Protospacer
****** ** *************.*.*

123. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP005089 (Sphingobium sp. TKS plasmid pTK5, complete sequence) position: , mismatch: 4, identity: 0.852

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cggccgccgtagccgccgccgccgctg	Protospacer
****** ** *************.*.*

124. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 4, identity: 0.852

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cggccgacgaagccgccgccgtcgctg	Protospacer
******.**************.*.*.*

125. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to MH001451 (Mycobacterium phage Nairb, complete genome) position: , mismatch: 4, identity: 0.852

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cggccggcgttgccgccgccgccggcg	Protospacer
*********  ************. **

126. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to MF155936 (Mycobacterium phage ZenTime222, complete genome) position: , mismatch: 4, identity: 0.852

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cggccggcgttgccgccgccgccggcg	Protospacer
*********  ************. **

127. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to MK494089 (Mycobacterium phage Ibrahim, complete genome) position: , mismatch: 4, identity: 0.852

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cggccggcgttgccgccgccgccggcg	Protospacer
*********  ************. **

128. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NC_024135 (Mycobacterium phage Bernal13, complete genome) position: , mismatch: 4, identity: 0.852

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cggccggcgttgccgccgccgccggcg	Protospacer
*********  ************. **

129. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to KM591905 (Mycobacterium phage RonRayGun, complete genome) position: , mismatch: 4, identity: 0.852

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cggccggcgttgccgccgccgccggcg	Protospacer
*********  ************. **

130. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to MN735432 (Mycobacteriophage Whitty, complete genome) position: , mismatch: 4, identity: 0.852

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cggccggcgttgccgccgccgccggcg	Protospacer
*********  ************. **

131. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.833

aagccgggacgaccgccgccgcca	CRISPR spacer
tgaccgggacgaccaccgccgcca	Protospacer
 ..***********.*********

132. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 4, identity: 0.833

aagccgggacgaccgccgccgcca	CRISPR spacer
gcgccgggacgaccgccgcggccc	Protospacer
. ***************** *** 

133. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 4, identity: 0.833

aagccgggacgaccgccgccgcca	CRISPR spacer
tcgccgcgacgaccgccgccgccg	Protospacer
  **** ****************.

134. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 4, identity: 0.833

aagccgggacgaccgccgccgcca	CRISPR spacer
gcgccgggacgaccgccgcagccc	Protospacer
. ***************** *** 

135. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NZ_CP035710 (Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence) position: , mismatch: 4, identity: 0.833

aagccgggacgaccgccgccgcca	CRISPR spacer
tggccgagacgaccgccgccgccg	Protospacer
 .****.****************.

136. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.833

aagccgggacgaccgccgccgcca	CRISPR spacer
gcgccgggacgaccgccgcggccc	Protospacer
. ***************** *** 

137. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.833

aagccgggacgaccgccgccgcca	CRISPR spacer
gcgccgggacgaccgccgcggccc	Protospacer
. ***************** *** 

138. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 4, identity: 0.833

aagccgggacgaccgccgccgcca	CRISPR spacer
tcgccgcgacgaccgccgccgccg	Protospacer
  **** ****************.

139. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.833

aagccgggacgaccgccgccgcca	CRISPR spacer
gcgccgggacgaccgccgcagccc	Protospacer
. ***************** *** 

140. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NC_004808 (Streptomyces rochei plasmid pSLA2-L DNA, complete sequence) position: , mismatch: 4, identity: 0.833

aagccgggacgaccgccgccgcca	CRISPR spacer
cggccgggacgacggccgccgccc	Protospacer
 .*********** ********* 

141. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.833

aagccgggacgaccgccgccgcca	CRISPR spacer
gcgccgggacgaccgccgcggccc	Protospacer
. ***************** *** 

142. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to NC_048860 (Microbacterium phage Arete, complete genome) position: , mismatch: 4, identity: 0.833

aagccgggacgaccgccgccgcca	CRISPR spacer
cagccgggacgacctccgccgcgc	Protospacer
 ************* *******  

143. spacer 7.5|2013399|24|CP027022|CRISPRCasFinder matches to KC252997 (Halovirus PH1, complete genome) position: , mismatch: 4, identity: 0.833

aagccgggacgaccgccgccgcca	CRISPR spacer
gcgccgggccgaccgccgccgccg	Protospacer
. ****** **************.

144. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 5, identity: 0.815

cggccggcgaagccgccgccgccaccg	CRISPR spacer
agatcgacgaggccgccgccgccaccg	Protospacer
 *..**.***.****************

145. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 5, identity: 0.815

cggccggcgaagccgccgccgccaccg	CRISPR spacer
ctggtcgcgatgccgccgccgccaccg	Protospacer
* * . **** ****************

146. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to MT361768 (Ralstonia phage RPZH6, complete genome) position: , mismatch: 5, identity: 0.815

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cggccggcgaagacgccgccgcctgac	Protospacer
************ **********    

147. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to MT361768 (Ralstonia phage RPZH6, complete genome) position: , mismatch: 5, identity: 0.815

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cggccggcgaagacgccgccgcctgac	Protospacer
************ **********    

148. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.815

cggccggcgaagccgccgccgccaccg	CRISPR spacer
tagtcgccgaagccgccgccgccgccg	Protospacer
..*.** ****************.***

149. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP020740 ([Pseudomonas] mesoacidophila strain ATCC 31433 plasmid pATCC31433, complete sequence) position: , mismatch: 5, identity: 0.815

cggccggcgaagccgccgccgccaccg	CRISPR spacer
atgtcgtcgaagccgccgccgccacca	Protospacer
  *.** *******************.

150. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to CP000618 (Burkholderia vietnamiensis G4 plasmid pBVIE02, complete sequence) position: , mismatch: 5, identity: 0.815

cggccggcgaagccgccgccgccaccg	CRISPR spacer
gaaccggcgtcgccgccgccgccaccg	Protospacer
 ..******  ****************

151. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to MK305888 (Streptomyces phage Austintatious, complete genome) position: , mismatch: 5, identity: 0.815

cggccggcgaagccgccgccgccaccg	CRISPR spacer
aggccggcgaggccgccgccgccgtca	Protospacer
 *********.************..*.

152. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NC_014718 (Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence) position: , mismatch: 5, identity: 0.815

cggccggcgaagccgccgccgccaccg	CRISPR spacer
tcgtcgccgaagccgccgctgccaccg	Protospacer
. *.** ************.*******

153. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NC_014718 (Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence) position: , mismatch: 5, identity: 0.815

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cggccggcgcagcggccgccgccgcat	Protospacer
********* *** *********.*  

154. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_LR134460 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence) position: , mismatch: 5, identity: 0.815

cggccggcgaagccgccgccgccaccg	CRISPR spacer
taggcggcgatgccgccgccgacaccg	Protospacer
..* ****** ********** *****

155. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.815

cggccggcgaagccgccgccgccaccg	CRISPR spacer
ccgccgccgaagccgccgccgccgaag	Protospacer
* **** ****************.  *

156. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 5, identity: 0.815

cggccggcgaagccgccgccgccaccg	CRISPR spacer
aggccggcaaagccgccgccgacaatg	Protospacer
 *******.************ ** .*

157. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP018918 (Serratia marcescens strain UMH5 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815

cggccggcgaagccgccgccgccaccg	CRISPR spacer
ttgccggcgaagccggcgccgcaacgg	Protospacer
. ************* ****** ** *

158. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 5, identity: 0.815

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cggccggcgcagccgccgccgggccag	Protospacer
********* ***********   * *

159. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 5, identity: 0.815

cggccggcgaagccgccgccgccaccg-	CRISPR spacer
tgggcggcgaagccgccgccg-cgctgc	Protospacer
.** ***************** *.*.* 

160. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP029358 (Azospirillum sp. CFH 70021 plasmid unnamed3) position: , mismatch: 5, identity: 0.815

cggccggcgaagccgccgccgccaccg	CRISPR spacer
agatcgacgaggccgccgccgccaccg	Protospacer
 *..**.***.****************

161. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP054025 (Rhizobium sp. JKLM12A2 plasmid pPR12A204, complete sequence) position: , mismatch: 5, identity: 0.815

cggccggcgaagccgccgccgccaccg	CRISPR spacer
tgatcgacgaagccgccgccgccgccg	Protospacer
.*..**.****************.***

162. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 5, identity: 0.815

cggccggcgaagccgccgccgccaccg	CRISPR spacer
tcggcggcgtagccgccaccgccaccg	Protospacer
. * ***** *******.*********

163. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP047145 (Streptomyces sp. HF10 plasmid plas1, complete sequence) position: , mismatch: 5, identity: 0.815

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cggccggcggagacgccgccgccgagg	Protospacer
*********.** **********.  *

164. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 5, identity: 0.815

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cggtcggcgaagccgccgctgccgttg	Protospacer
***.***************.***...*

165. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP020333 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM170, complete sequence) position: , mismatch: 5, identity: 0.815

cggccggcgaagccgccgccgccaccg	CRISPR spacer
tgcgcggcgatgacgccgccgccaccg	Protospacer
.*  ****** * **************

166. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP054034 (Rhizobium sp. JKLM13E plasmid pPR13E03, complete sequence) position: , mismatch: 5, identity: 0.815

cggccggcgaagccgccgccgccaccg	CRISPR spacer
tgatcgacgaagccgccgccgccgccg	Protospacer
.*..**.****************.***

167. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NC_021278 (Mycobacteroides abscessus subsp. bolletii 50594 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.815

cggccggcgaagccgccgccgccaccg	CRISPR spacer
tcggcggcgacgccgccgccgtcaccg	Protospacer
. * ****** **********.*****

168. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP010894 (Pseudomonas sp. MRSN12121 plasmid, complete sequence) position: , mismatch: 5, identity: 0.815

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cggccggcgatgccgccgccgtggcgg	Protospacer
********** **********. .* *

169. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to KY555147 (Caulobacter phage Ccr34, complete genome) position: , mismatch: 5, identity: 0.815

cggccggcgaagccgccgccgccaccg	CRISPR spacer
atgacggtgtagccgccgccgccaccg	Protospacer
  * ***.* *****************

170. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to MF668280 (Mycobacterium phage Phabba, complete genome) position: , mismatch: 5, identity: 0.815

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cgcccggagaagccgccgccgcccttg	Protospacer
** **** *************** ..*

171. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to MF377442 (Arthrobacter phage Franzy, complete genome) position: , mismatch: 5, identity: 0.815

cggccggcgaagccgccgccgccaccg	CRISPR spacer
ccgccgccgaagccgccgccgccgttg	Protospacer
* **** ****************...*

172. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NC_041930 (Arthrobacter phage Brent, complete genome) position: , mismatch: 5, identity: 0.815

cggccggcgaagccgccgccgccaccg	CRISPR spacer
ccgccgccgaagccgccgccgccgttg	Protospacer
* **** ****************...*

173. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to KY555146 (Caulobacter phage Ccr32, complete genome) position: , mismatch: 5, identity: 0.815

cggccggcgaagccgccgccgccaccg	CRISPR spacer
atgacggtgtagccgccgccgccaccg	Protospacer
  * ***.* *****************

174. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NC_048047 (Caulobacter phage CcrBL9, complete genome) position: , mismatch: 5, identity: 0.815

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cctgcggcgtagccgccgccgccgccg	Protospacer
*   ***** *************.***

175. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP053379 (Serratia marcescens strain FY plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.815

cggccggcgaagccgccgccgccaccg	CRISPR spacer
ttgccggcgaagccggcgccgcaacgg	Protospacer
. ************* ****** ** *

176. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP033895 (Serratia liquefaciens strain FG3 plasmid p2-125, complete sequence) position: , mismatch: 5, identity: 0.815

cggccggcgaagccgccgccgccaccg	CRISPR spacer
ttgccggcgaagccggcgccgcaacgg	Protospacer
. ************* ****** ** *

177. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 5, identity: 0.815

cggccggcgaagccgccgccgccaccg	CRISPR spacer
aggccgacgaagccgccgccgacaatg	Protospacer
 *****.************** ** .*

178. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NC_010183 (Bacillus mycoides KBAB4 plasmid pBWB404, complete sequence) position: , mismatch: 5, identity: 0.815

cggccggcgaagccgccgccgccaccg	CRISPR spacer
ccgccagcgaaaccgccgccgccacaa	Protospacer
* ***.*****.************* .

179. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP018916 (Serratia marcescens strain UMH1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

cggccggcgaagccgccgccgccaccg	CRISPR spacer
ttgccggcgaagccggcgccgcaacgg	Protospacer
. ************* ****** ** *

180. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP041653 (Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence) position: , mismatch: 5, identity: 0.815

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cccccggcgaagccgtcgccgccgccc	Protospacer
*  ************.*******.** 

181. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP011665 (Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence) position: , mismatch: 5, identity: 0.815

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cggtcggcgaagccgccgctgccgttg	Protospacer
***.***************.***...*

182. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 5, identity: 0.815

cggccggcgaagccgccgccgccaccg	CRISPR spacer
tcggcggcgtagccgccaccgccaccg	Protospacer
. * ***** *******.*********

183. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 5, identity: 0.815

cggccggcgaagccgccgccgccaccg	CRISPR spacer
aggccgacgaagccgccgccgacaatg	Protospacer
 *****.************** ** .*

184. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cggccggcgaagccgctgtcgccggtg	Protospacer
****************.*.****. .*

185. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 5, identity: 0.815

cggccggcgaagccgccgccgccaccg	CRISPR spacer
tgatcgacgaagccgccgccgccgccg	Protospacer
.*..**.****************.***

186. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to KM083128 (Mycobacterium phage Sparky, complete genome) position: , mismatch: 5, identity: 0.815

cggccggcgaagccgccgccgccaccg	CRISPR spacer
aggcccgcgaagccgccgccgcgtacg	Protospacer
 **** ****************   **

187. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to JX163858 (Caulobacter phage phiCbK, complete genome) position: , mismatch: 5, identity: 0.815

cggccggcgaagccgccgccgccaccg	CRISPR spacer
atgacggtgtagccgccgccgccaccg	Protospacer
  * ***.* *****************

188. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cggacggcgatgccgccgccgccctgc	Protospacer
*** ****** ************ .  

189. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
gtgccgtcgaagccgccgccgcccgcc	Protospacer
  **** ****************  * 

190. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NC_023285 (Streptomyces sp. F8 plasmid pFRL5, complete sequence) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cggccggcgaagacgccgcggccggga	Protospacer
************ ****** ***.  .

191. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to KY249644 (Synechococcus virus S-ESS1, complete genome) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
tggccgccgaagccgccgccgccgaac	Protospacer
.***** ****************.   

192. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to KY249644 (Synechococcus virus S-ESS1, complete genome) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
tggccgccgaagccgccgccgccgaac	Protospacer
.***** ****************.   

193. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
acctcggcgaagccgccgtcgccaccc	Protospacer
   .**************.******* 

194. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP020897 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5a, complete sequence) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cggacggcgaagccgccgccgcgcgtt	Protospacer
*** ******************   . 

195. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP013538 (Rhizobium phaseoli strain R630 plasmid pRphaR630a, complete sequence) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cggacggcgaagccgccgccgcgcgtt	Protospacer
*** ******************   . 

196. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to KY092483 (Streptomyces phage Bioscum, complete genome) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
aggccggcgaggccgccgccgccgtta	Protospacer
 *********.************....

197. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NC_047792 (Streptomyces phage Ididsumtinwong, complete genome) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
aggccggcgaggccgccgccgccgtta	Protospacer
 *********.************....

198. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
tcgcgggcgaagccgccgacgccacac	Protospacer
. ** ************* ******  

199. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_LR134460 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
ccgccgccgaagccgccgccgcccggc	Protospacer
* **** ****************    

200. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
ctgccggcgaagccgccgccgatgatg	Protospacer
* ******************* .. .*

201. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
acgccgtcgaagccgccgccgcgacga	Protospacer
  **** *************** ** .

202. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
ttcccggcgaggccgccgccgccgccc	Protospacer
.  *******.************.** 

203. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
ttgcgggcgaagccgccgacgccacac	Protospacer
. ** ************* ******  

204. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP046101 (Rhodococcus sp. AQ5-07 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
tggcccgcgaagccgccgccgacagtc	Protospacer
.**** *************** ** . 

205. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP015006 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA01, complete sequence) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
ggaccggcgaagccgccgccggcatgc	Protospacer
 *.****************** **.  

206. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP024609 (Massilia violaceinigra strain B2 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
gaaacggcgaagccgcctgcgccaccg	Protospacer
 .. *************  ********

207. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP040246 (Mycobacterium avium subsp. hominissuis strain 101034 plasmid pFLAC0181_CHOP1, complete sequence) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cggccggccaagccgccgccgtcgggc	Protospacer
******** ************.*.   

208. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP029833 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cgggcggcgaagccgccgccgggcttg	Protospacer
*** *****************   ..*

209. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
gcgccggcgaagaagccgccgccacgc	Protospacer
  **********  ***********  

210. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
gcaccggcgatgccgccgccgtcacca	Protospacer
  .******* **********.****.

211. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cggacggcgatgccgccgccgccctgc	Protospacer
*** ****** ************ .  

212. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cgggcggcgaagctgccgccgccggat	Protospacer
*** *********.*********.   

213. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP013052 (Sinorhizobium americanum CCGM7 plasmid A, complete sequence) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
ttcccggcgaggccgccgccgccgccc	Protospacer
.  *******.************.** 

214. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
aggccggggaacccgccgccgccattc	Protospacer
 ****** *** ************.. 

215. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cggccggcgcagccgccgccgggcgag	Protospacer
********* ***********     *

216. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP020385 (Rhodovulum sp. MB263 plasmid pRSMBA, complete sequence) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
tcttcgacgatgccgccgccgccaccg	Protospacer
.  .**.*** ****************

217. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cgggcggcgaagctgccgccgccggat	Protospacer
*** *********.*********.   

218. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to MT740738 (Ralstonia phage Gamede, complete genome) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cagccggcgaagacgccgccgcctgac	Protospacer
*.********** **********    

219. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to MT740736 (Ralstonia phage Eline, complete genome) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cagccggcgaagacgccgccgcctgac	Protospacer
*.********** **********    

220. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to KU160664 (Arthrobacter phage Salgado, complete genome) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
ccgccgccgaagccgccgccgccctgc	Protospacer
* **** **************** .  

221. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to MH727549 (Mycobacterium phage Gancho, complete genome) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
atcgcggccaacccgccgccgccaccg	Protospacer
    **** ** ***************

222. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to MF140418 (Arthrobacter phage LiSara, complete genome) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
ccgccgccgaagccgccgccgccctgc	Protospacer
* **** **************** .  

223. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to KU160654 (Arthrobacter phage Laroye, complete genome) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
ccgccgccgaagccgccgccgccctgc	Protospacer
* **** **************** .  

224. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cgggcggcgaagctgccgccgccggat	Protospacer
*** *********.*********.   

225. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP051473 (Rhodobacter sphaeroides strain CH10 plasmid pRspCH10DE, complete sequence) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cggccggcgacgcggccgccgcccata	Protospacer
********** ** *********  ..

226. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP023150 (Mycobacterium intracellulare strain FLAC0181 plasmid pFLAC0181, complete sequence) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cggccggccaagccgccgccgtcgggc	Protospacer
******** ************.*.   

227. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP030276 (Rhodobacter sphaeroides 2.4.1 plasmid pDE, complete sequence) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cggccggcgacgcggccgccgcccata	Protospacer
********** ** *********  ..

228. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP040254 (Mycobacterium avium subsp. hominissuis strain 101115 plasmid pFLAC0181_CHOP101, complete sequence) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cggccggccaagccgccgccgtcgggc	Protospacer
******** ************.*.   

229. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP015289 (Rhodobacter sphaeroides strain MBTLJ-20 plasmid a, complete sequence) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cggccggcgacgcggccgccgcccata	Protospacer
********** ** *********  ..

230. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cgggcggcgaagctgccgccgccggat	Protospacer
*** *********.*********.   

231. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NC_019730 (Oscillatoria nigro-viridis PCC 7112 plasmid pOSC7112.02, complete sequence) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
aagccgccgaagccgccgccgcccaag	Protospacer
 .**** ****************   *

232. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP013744 (Streptomyces sp. CdTB01 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
acccgggcgaggccgccgccgccaccc	Protospacer
   * *****.*************** 

233. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP040248 (Mycobacterium avium subsp. hominissuis strain 101174 plasmid pFLAC0181_CHOP101, complete sequence) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cggccggccaagccgccgccgtcgggc	Protospacer
******** ************.*.   

234. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP033037 (Agrobacterium fabrum strain 12D13 plasmid pAt12D13b, complete sequence) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
gagccgacgaagccgccgccgcctgca	Protospacer
 .****.****************  *.

235. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP021356 (Rhodococcus sp. S2-17 plasmid pRB29, complete sequence) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
tcgccggcgcagccgcggccgccactc	Protospacer
. ******* ****** ********. 

236. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cggccggcggagccggcgccgcccggc	Protospacer
*********.***** *******    

237. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP053709 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cggccggcgaagccgccgcgtcggcga	Protospacer
*******************  * .* .

238. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP031358 (Erythrobacter aureus strain YH-07 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
aggccggcgaaggcgccgccgcagatg	Protospacer
 *********** ********* . .*

239. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP046575 (Rhodococcus sp. WAY2 plasmid pRWAY03, complete sequence) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
tcgccggcgcagccgcggccgccactc	Protospacer
. ******* ****** ********. 

240. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP015212 (Rhodobacter sphaeroides strain MBTLJ-13 plasmid a, complete sequence) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cggccggcgacgcggccgccgcccata	Protospacer
********** ** *********  ..

241. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cgggcggcgaagctgccgccgccggat	Protospacer
*** *********.*********.   

242. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP024940 (Paraburkholderia hospita strain mHSR1 plasmid pmHSR1_P, complete sequence) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cggacggcgaagccgccgctgccgaat	Protospacer
*** ***************.***.   

243. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
aaatcgacgaggccgccgccgccaccg	Protospacer
 ...**.***.****************

244. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to MN813684 (Microbacterium phage Terij, complete genome) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
gcctcggcgacgccgccgccgccgccg	Protospacer
   .****** ************.***

245. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to MK977705 (Gordonia Phage Mollymur, complete genome) position: , mismatch: 6, identity: 0.778

cggccggcgaagccgccgccgccaccg	CRISPR spacer
tcgccgccgaagccgccgccgccgaag	Protospacer
. **** ****************.  *

246. spacer 8.1|2555184|31|CP027022|CRISPRCasFinder matches to MT310862 (Streptomyces phage Itza, complete genome) position: , mismatch: 6, identity: 0.806

cgggcttcacggccggagcctccagcctgtg	CRISPR spacer
cgggcttcatcgccggagcctccagcttcga	Protospacer
*********. ***************.*  .

247. spacer 8.1|2555184|31|CP027022|CRISPRCasFinder matches to MN062705 (Streptomyces phage Celia, complete genome) position: , mismatch: 6, identity: 0.806

cgggcttcacggccggagcctccagcctgtg	CRISPR spacer
cgggcttcatcgccggagcctccagcttcga	Protospacer
*********. ***************.*  .

248. spacer 8.1|2555184|31|CP027022|CRISPRCasFinder matches to MN234189 (Streptomyces phage Urza, complete genome) position: , mismatch: 6, identity: 0.806

cgggcttcacggccggagcctccagcctgtg	CRISPR spacer
cgggcttcatcgccggagcctccagcttcga	Protospacer
*********. ***************.*  .

249. spacer 12.2|3302283|32|CP027022|CRISPRCasFinder matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 6, identity: 0.812

accaccgaggcccccgcgccgccgaaggcgaa	CRISPR spacer
gcgagcatggcgcccgcgccgccgaaggcgaa	Protospacer
.* * *. *** ********************

250. spacer 12.2|3302283|32|CP027022|CRISPRCasFinder matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 6, identity: 0.812

--accaccgaggcccccgcgccgccgaaggcgaa	CRISPR spacer
cggccatc--ggcccccgagccgccgcaggcgaa	Protospacer
  .***.*  ******** ******* *******

251. spacer 12.2|3302283|32|CP027022|CRISPRCasFinder matches to NZ_AF331043 (Arthrobacter keyseri strain 12B plasmid pRE1, complete sequence) position: , mismatch: 6, identity: 0.812

--accaccgaggcccccgcgccgccgaaggcgaa	CRISPR spacer
ccgtcacc--ggcccccgcgccctcgaaggcgaa	Protospacer
  ..****  ************ .**********

252. spacer 12.2|3302283|32|CP027022|CRISPRCasFinder matches to NC_015147 (Pseudarthrobacter phenanthrenivorans Sphe3 plasmid pASPHE302, complete sequence) position: , mismatch: 6, identity: 0.812

--accaccgaggcccccgcgccgccgaaggcgaa	CRISPR spacer
ccgtcacc--ggcccccgcgccctcgaaggcgaa	Protospacer
  ..****  ************ .**********

253. spacer 12.2|3302283|32|CP027022|CRISPRCasFinder matches to NC_008538 (Arthrobacter sp. FB24 plasmid 2, complete sequence) position: , mismatch: 6, identity: 0.812

--accaccgaggcccccgcgccgccgaaggcgaa	CRISPR spacer
ccgtcacc--ggcccccgcgccctcgaaggcgaa	Protospacer
  ..****  ************ .**********

254. spacer 23.1|7089514|33|CP027022|CRISPRCasFinder matches to NC_016435 (Gordonia phage GRU1, complete genome) position: , mismatch: 6, identity: 0.818

tcgtccggttcgtccttgggctcgtcgtccggc	CRISPR spacer
ggctccggatcgtcctcgggctcgtcgtccggg	Protospacer
   ***** *******.*************** 

255. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP040937 (Hymenobacter sp. DG01 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.741

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cgggcggcgaagccgccgccgaagaaa	Protospacer
*** *****************  .  .

256. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_AP022622 (Mycobacteroides abscessus strain JCM 30620 plasmid pJCM30620_1) position: , mismatch: 7, identity: 0.741

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cacgcggcgaagccgccgccgccctac	Protospacer
*.  ******************* .  

257. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP006588 (Hymenobacter sp. APR13 plasmid pHA, complete sequence) position: , mismatch: 7, identity: 0.741

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cgggcggcgaagccgccgccgaagaaa	Protospacer
*** *****************  .  .

258. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.741

cggccggcgaagccgccgccgccaccg	CRISPR spacer
gtgccgtcgaagccgccgccgccgaac	Protospacer
  **** ****************.   

259. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NC_021279 (Mycobacteroides abscessus subsp. bolletii 50594 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.741

cggccggcgaagccgccgccgccaccg	CRISPR spacer
cacgcggcgaagccgccgccgccctac	Protospacer
*.  ******************* .  

260. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to MH834619 (Arthrobacter phage Maureen, complete genome) position: , mismatch: 7, identity: 0.741

cggccggcgaagccgccgccgccaccg	CRISPR spacer
aggcccgcgaagccgccgccgctgaga	Protospacer
 **** ****************..  .

261. spacer 7.4|2013348|27|CP027022|CRISPRCasFinder matches to NC_048115 (Arthrobacter phage Liebe, complete genome) position: , mismatch: 7, identity: 0.741

cggccggcgaagccgccgccgccaccg	CRISPR spacer
aggcccgcgaagccgccgccgctgaga	Protospacer
 **** ****************..  .

262. spacer 8.1|2555184|31|CP027022|CRISPRCasFinder matches to MN585980 (Microbacterium phage Gina, complete genome) position: , mismatch: 7, identity: 0.774

cgggcttcacggccggagcctccagcctgtg-	CRISPR spacer
cgggcatcaccgccggagcctcca-ccgacat	Protospacer
***** **** ************* ** ... 

263. spacer 8.1|2555184|31|CP027022|CRISPRCasFinder matches to MN586059 (Microbacterium phage Teamocil, complete genome) position: , mismatch: 7, identity: 0.774

cgggcttcacggccggagcctccagcctgtg-	CRISPR spacer
cgggcatcaccgccggagcctcca-ccgacat	Protospacer
***** **** ************* ** ... 

264. spacer 11.2|3257475|31|CP027022|CRISPRCasFinder matches to NZ_CP025432 (Paracoccus zhejiangensis strain J6 plasmid pPZ02, complete sequence) position: , mismatch: 7, identity: 0.774

actcgttcgcctcgatcggctcctgggcgag	CRISPR spacer
cctgcagcgcctcgatcgggtcctgggcgat	Protospacer
 **    ************ ********** 

265. spacer 11.2|3257475|31|CP027022|CRISPRCasFinder matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 7, identity: 0.774

actcgttcgcctcgatcggctcctgggcgag	CRISPR spacer
gcccgaccgcctcgatcgcctccggggcgac	Protospacer
.*.** .*********** **** ****** 

266. spacer 11.2|3257475|31|CP027022|CRISPRCasFinder matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 7, identity: 0.774

actcgttcgcctcgatcggctcctgggcgag	CRISPR spacer
tcaccgtcgcctcgatcagcccctgggcgac	Protospacer
 * *  ***********.**.********* 

267. spacer 11.2|3257475|31|CP027022|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 7, identity: 0.774

actcgttcgcctcgatcggctcctgggcgag	CRISPR spacer
gcaggcccgcctcgatcagcacctgggcgag	Protospacer
.*  *..**********.** **********

268. spacer 11.2|3257475|31|CP027022|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 7, identity: 0.774

actcgttcgcctcgatcggctcctgggcgag	CRISPR spacer
gcaggcccgcctcgatcagcacctgggcgag	Protospacer
.*  *..**********.** **********

269. spacer 11.2|3257475|31|CP027022|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 7, identity: 0.774

actcgttcgcctcgatcggctcctgggcgag	CRISPR spacer
gcaggcccgcctcgatcagcacctgggcgag	Protospacer
.*  *..**********.** **********

270. spacer 11.2|3257475|31|CP027022|CRISPRCasFinder matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 7, identity: 0.774

actcgttcgcctcgatcggctcctgggcgag	CRISPR spacer
actgcgtcgcctcggtcggcacctgggcgga	Protospacer
***   ********.***** ********..

271. spacer 12.2|3302283|32|CP027022|CRISPRCasFinder matches to NC_014811 (Mycolicibacterium gilvum Spyr1 plasmid pMSPYR101, complete sequence) position: , mismatch: 7, identity: 0.781

accaccgaggcccccgcgccgccgaaggcgaa	CRISPR spacer
gggaccgaggcccccgcgccgccggtggcaga	Protospacer
.  *********************. ***..*

272. spacer 12.2|3302283|32|CP027022|CRISPRCasFinder matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 7, identity: 0.781

accaccgaggcccccgcgccgccgaaggcgaa	CRISPR spacer
gcaagcattgcacccgcgccgccgaaggcgaa	Protospacer
.* * *.  ** ********************

273. spacer 12.2|3302283|32|CP027022|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 7, identity: 0.781

accaccgaggcccccgcgccgccgaaggcgaa	CRISPR spacer
gcgagcattgcacccgcgccgccgaaggcgaa	Protospacer
.* * *.  ** ********************

274. spacer 12.2|3302283|32|CP027022|CRISPRCasFinder matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

accaccgaggcccccgcgccgccgaaggcgaa	CRISPR spacer
gccagcatcgcgcccgcgccgccgaatgcgaa	Protospacer
.*** *.  ** ************** *****

275. spacer 12.2|3302283|32|CP027022|CRISPRCasFinder matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.781

accaccgaggcccccgcgccgccgaaggcgaa	CRISPR spacer
gccagcatcgcgcccgcgccgccgaatgcgaa	Protospacer
.*** *.  ** ************** *****

276. spacer 12.2|3302283|32|CP027022|CRISPRCasFinder matches to NZ_CP030763 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781

--accaccgaggcccccgcgccgccgaaggcgaa	CRISPR spacer
cagacacc--cgcccccgcgacgcccaaggcgaa	Protospacer
  . ****   ********* **** ********

277. spacer 11.2|3257475|31|CP027022|CRISPRCasFinder matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 8, identity: 0.742

actcgttcgcctcgatcggctcctgggcgag	CRISPR spacer
cctcgtgcgcctcgaacggctcctcgacctc	Protospacer
 ***** ******** ******** *.*   

278. spacer 11.2|3257475|31|CP027022|CRISPRCasFinder matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 8, identity: 0.742

actcgttcgcctcgatcggctcctgggcgag	CRISPR spacer
accgcaccgcctcgatcggctcgcgggcgaa	Protospacer
**.   .*************** .******.

279. spacer 11.2|3257475|31|CP027022|CRISPRCasFinder matches to NZ_CP011667 (Streptomyces sp. Mg1 plasmid pSMg1-3, complete sequence) position: , mismatch: 8, identity: 0.742

actcgttcgcctcgatcggctcctgggcgag	CRISPR spacer
agaccctcgccaccatcggctcctgggcgcc	Protospacer
*  * .***** * ***************  

280. spacer 11.2|3257475|31|CP027022|CRISPRCasFinder matches to NC_042350 (Salinibacter virus M8CR30-2, complete genome) position: , mismatch: 8, identity: 0.742

actcgttcgcctcgatcggctcctgggcgag	CRISPR spacer
gcctgttcgcctcgatctcctcctggggaat	Protospacer
.*..*************  ******** .* 

281. spacer 11.2|3257475|31|CP027022|CRISPRCasFinder matches to MF580958 (Salinibacter virus M8CR30-4, partial genome) position: , mismatch: 8, identity: 0.742

actcgttcgcctcgatcggctcctgggcgag	CRISPR spacer
gcctgttcgcctcgatctcctcctggggaat	Protospacer
.*..*************  ******** .* 

282. spacer 11.2|3257475|31|CP027022|CRISPRCasFinder matches to NC_042348 (Salinibacter virus M1EM-1, partial genome) position: , mismatch: 8, identity: 0.742

actcgttcgcctcgatcggctcctgggcgag	CRISPR spacer
gtttgttcgcctcgatctcctcctggggaac	Protospacer
..*.*************  ******** .* 

283. spacer 11.2|3257475|31|CP027022|CRISPRCasFinder matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 8, identity: 0.742

actcgttcgcctcgatcggctcctgggcgag	CRISPR spacer
ggcaggtcgcctcggtcggcgcctgggcgcg	Protospacer
. . * ********.***** ******** *

284. spacer 11.2|3257475|31|CP027022|CRISPRCasFinder matches to NZ_CP033583 (Streptomyces sp. ADI95-16 plasmid pADI95-16b, complete sequence) position: , mismatch: 8, identity: 0.742

actcgttcgcctcgatcggctcctgggcgag	CRISPR spacer
agaccctcgccaccatcggctcctgggcgcc	Protospacer
*  * .***** * ***************  

285. spacer 11.2|3257475|31|CP027022|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.742

actcgttcgcctcgatcggctcctgggcgag	CRISPR spacer
gtctggtcgcctcggtcggcgcctgggcgcg	Protospacer
....* ********.***** ******** *

286. spacer 11.2|3257475|31|CP027022|CRISPRCasFinder matches to MK814757 (Gordonia phage Fairfaxidum, complete genome) position: , mismatch: 8, identity: 0.742

actcgttcgcctcgatcggctcctgggcgag	CRISPR spacer
gcttcctcacctcgatcggctcctcggcggt	Protospacer
.**. .**.*************** ****. 

287. spacer 12.2|3302283|32|CP027022|CRISPRCasFinder matches to NZ_CP019603 (Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence) position: , mismatch: 8, identity: 0.75

accaccgaggcccccgcgccgccgaaggcgaa	CRISPR spacer
agaactttggcgcccgcgccggcgaaggcgag	Protospacer
*  **.  *** ********* *********.

288. spacer 12.2|3302283|32|CP027022|CRISPRCasFinder matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 8, identity: 0.75

accaccgaggcccccgcgccgccgaaggcgaa	CRISPR spacer
accgccgaggcacccgcgccgcccaggctggt	Protospacer
***.******* *********** *.* .*. 

289. spacer 12.2|3302283|32|CP027022|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 8, identity: 0.75

accaccgaggcccccgcgccgccgaaggcgaa	CRISPR spacer
gcgagcatcgcgccggcgccgccgaaggcgaa	Protospacer
.* * *.  ** ** *****************

290. spacer 23.1|7089514|33|CP027022|CRISPRCasFinder matches to NZ_CP050081 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b5, complete sequence) position: , mismatch: 8, identity: 0.758

tcgtccggttcgtccttgggctcgtcgtccggc	CRISPR spacer
actgatggttcgtccttgcgctcgtcggccgtc	Protospacer
 *   .************ ******** *** *

291. spacer 23.1|7089514|33|CP027022|CRISPRCasFinder matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.758

tcgtccggttcgtccttgggctcgtcgtccggc	CRISPR spacer
atatgcagttcgtccatgggctcgtcatccggt	Protospacer
 ..* *.******** **********.*****.

292. spacer 11.2|3257475|31|CP027022|CRISPRCasFinder matches to NZ_CP023455 (Rhodobacteraceae bacterium QY30 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

actcgttcgcctcgatcggctcctgggcgag	CRISPR spacer
cggccttcgcctcgatcggcttctgcgccga	Protospacer
   * ****************.*** ** ..

293. spacer 11.2|3257475|31|CP027022|CRISPRCasFinder matches to MF324912 (Mycobacterium phage Phrank, complete genome) position: , mismatch: 9, identity: 0.71

actcgttcgcctcgatcggctcctgggcgag	CRISPR spacer
ccataagcgcctcgatcggctcacgggcgac	Protospacer
 * ..  *************** .****** 

294. spacer 11.2|3257475|31|CP027022|CRISPRCasFinder matches to MF324908 (Mycobacterium phage Unicorn, complete genome) position: , mismatch: 9, identity: 0.71

actcgttcgcctcgatcggctcctgggcgag	CRISPR spacer
gcataagcgcctcgatcggctcacgggcgac	Protospacer
.* ..  *************** .****** 

295. spacer 11.2|3257475|31|CP027022|CRISPRCasFinder matches to MN369762 (Mycobacterium phage Bryler, complete genome) position: , mismatch: 9, identity: 0.71

actcgttcgcctcgatcggctcctgggcgag	CRISPR spacer
ccataagcgcctcgatcggctcacgggcgac	Protospacer
 * ..  *************** .****** 

296. spacer 11.2|3257475|31|CP027022|CRISPRCasFinder matches to MF324909 (Mycobacterium phage PhelpsODU, complete genome) position: , mismatch: 9, identity: 0.71

actcgttcgcctcgatcggctcctgggcgag	CRISPR spacer
gcataagcgcctcgatcggctcacgggcgac	Protospacer
.* ..  *************** .****** 

297. spacer 11.2|3257475|31|CP027022|CRISPRCasFinder matches to MF324913 (Mycobacterium phage Cain, complete genome) position: , mismatch: 9, identity: 0.71

actcgttcgcctcgatcggctcctgggcgag	CRISPR spacer
ccataagcgcctcgatcggctcacgggcgac	Protospacer
 * ..  *************** .****** 

298. spacer 11.2|3257475|31|CP027022|CRISPRCasFinder matches to MN234176 (Mycobacterium phage Yuna, complete genome) position: , mismatch: 9, identity: 0.71

actcgttcgcctcgatcggctcctgggcgag	CRISPR spacer
gcataagcgcctcgatcggctcacgggcgac	Protospacer
.* ..  *************** .****** 

299. spacer 12.2|3302283|32|CP027022|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 9, identity: 0.719

accaccgaggcccccgcgccgccgaaggcgaa	CRISPR spacer
tggaccgacgcccccgcgccgacgaagacctc	Protospacer
   ***** ************ *****.*   

300. spacer 12.2|3302283|32|CP027022|CRISPRCasFinder matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 9, identity: 0.719

accaccgaggcccccgcgccgccgaaggcgaa	CRISPR spacer
gcgataccggccatcgcgccgccgaaggcgat	Protospacer
.* *.   **** .***************** 

301. spacer 12.2|3302283|32|CP027022|CRISPRCasFinder matches to NZ_CP050100 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b3, complete sequence) position: , mismatch: 9, identity: 0.719

accaccgaggcccccgcgccgccgaaggcgaa	CRISPR spacer
gcgaaaccggccatcgcgccgccgaaggcgat	Protospacer
.* *    **** .***************** 

302. spacer 12.2|3302283|32|CP027022|CRISPRCasFinder matches to NZ_CP025017 (Rhizobium leguminosarum strain Norway plasmid pRLN5, complete sequence) position: , mismatch: 9, identity: 0.719

accaccgaggcccccgcgccgccgaaggcgaa	CRISPR spacer
gcgaaaccggccatcgcgccgccgaaggcgat	Protospacer
.* *    **** .***************** 

303. spacer 12.2|3302283|32|CP027022|CRISPRCasFinder matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 9, identity: 0.719

accaccgaggcccccgcgccgccgaaggcgaa	CRISPR spacer
gcttccgaggccaccgcgtcgccgaagtacag	Protospacer
.*. ******** *****.********   *.

304. spacer 12.2|3302283|32|CP027022|CRISPRCasFinder matches to NC_012854 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132505, complete sequence) position: , mismatch: 9, identity: 0.719

accaccgaggcccccgcgccgccgaaggcgaa	CRISPR spacer
gcgaagccggccatcgcgccgccgaaggcgat	Protospacer
.* *    **** .***************** 

305. spacer 12.2|3302283|32|CP027022|CRISPRCasFinder matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 9, identity: 0.719

accaccgaggcccccgcgccgccgaaggcgaa	CRISPR spacer
gcgaagccggccatcgcgccgccgaaggcgat	Protospacer
.* *    **** .***************** 

306. spacer 12.2|3302283|32|CP027022|CRISPRCasFinder matches to NZ_CP018232 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719

accaccgaggcccccgcgccgccgaaggcgaa	CRISPR spacer
gcgaagccggccatcgcgccgccgaaggcgat	Protospacer
.* *    **** .***************** 

307. spacer 12.2|3302283|32|CP027022|CRISPRCasFinder matches to NZ_CP016291 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed6, complete sequence) position: , mismatch: 9, identity: 0.719

accaccgaggcccccgcgccgccgaaggcgaa	CRISPR spacer
gcgaagccggccatcgcgccgccgaaggcgat	Protospacer
.* *    **** .***************** 

308. spacer 12.2|3302283|32|CP027022|CRISPRCasFinder matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 9, identity: 0.719

accaccgaggcccccgcgccgccgaaggcgaa	CRISPR spacer
gcgaagccggccatcgcgccgccgaaggcgat	Protospacer
.* *    **** .***************** 

309. spacer 12.2|3302283|32|CP027022|CRISPRCasFinder matches to NZ_CP048284 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248b, complete sequence) position: , mismatch: 9, identity: 0.719

accaccgaggcccccgcgccgccgaaggcgaa	CRISPR spacer
gcgaagccggccatcgcgccgccgaaggcgat	Protospacer
.* *    **** .***************** 

310. spacer 12.2|3302283|32|CP027022|CRISPRCasFinder matches to NZ_CP032053 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL2, complete sequence) position: , mismatch: 9, identity: 0.719

accaccgaggcccccgcgccgccgaaggcgaa	CRISPR spacer
cgcctgcaggccgccgcgccgccgcaggcgga	Protospacer
  * .  ***** *********** *****.*

311. spacer 12.2|3302283|32|CP027022|CRISPRCasFinder matches to NZ_CP054036 (Rhizobium sp. JKLM13E plasmid pPR13E05, complete sequence) position: , mismatch: 9, identity: 0.719

accaccgaggcccccgcgccgccgaaggcgaa	CRISPR spacer
gcgaagccggccatcgcgccgccgaaggcgat	Protospacer
.* *    **** .***************** 

312. spacer 12.2|3302283|32|CP027022|CRISPRCasFinder matches to NZ_CP022568 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK04, complete sequence) position: , mismatch: 9, identity: 0.719

accaccgaggcccccgcgccgccgaaggcgaa	CRISPR spacer
gcgaagccggccatcgcgccgccgaaggcgat	Protospacer
.* *    **** .***************** 

313. spacer 12.2|3302283|32|CP027022|CRISPRCasFinder matches to MK977708 (Mycobacterium phage Fulbright, complete genome) position: , mismatch: 9, identity: 0.719

accaccgaggcccccgcgccgccgaaggcgaa	CRISPR spacer
accaccgcggccaccgcgccgccctcgggcgg	Protospacer
******* **** **********   **  ..

314. spacer 12.2|3302283|32|CP027022|CRISPRCasFinder matches to MG099948 (Mycobacterium phage Philonius, complete genome) position: , mismatch: 9, identity: 0.719

accaccgaggcccccgcgccgccgaaggcgaa	CRISPR spacer
accaccgcggccaccgcgccgccctcgggcgg	Protospacer
******* **** **********   **  ..

315. spacer 12.2|3302283|32|CP027022|CRISPRCasFinder matches to MH926055 (Mycobacterium phage Chewbacca, complete genome) position: , mismatch: 9, identity: 0.719

accaccgaggcccccgcgccgccgaaggcgaa	CRISPR spacer
accaccgcggccaccgcgccgccctcgggcgg	Protospacer
******* **** **********   **  ..

316. spacer 12.2|3302283|32|CP027022|CRISPRCasFinder matches to KF986246 (Mycobacterium phage MichelleMyBell, complete genome) position: , mismatch: 9, identity: 0.719

accaccgaggcccccgcgccgccgaaggcgaa	CRISPR spacer
accaccgcggccaccgcgccgccctcgggcgg	Protospacer
******* **** **********   **  ..

317. spacer 12.2|3302283|32|CP027022|CRISPRCasFinder matches to MT723932 (Mycobacterium phage Schnauzer, complete genome) position: , mismatch: 9, identity: 0.719

accaccgaggcccccgcgccgccgaaggcgaa	CRISPR spacer
accaccgcggccaccgcgccgccctcgggcgg	Protospacer
******* **** **********   **  ..

318. spacer 12.2|3302283|32|CP027022|CRISPRCasFinder matches to KU935726 (Mycobacterium phage Xerxes, complete genome) position: , mismatch: 9, identity: 0.719

accaccgaggcccccgcgccgccgaaggcgaa	CRISPR spacer
accaccgcggccaccgcgccgccctcgggcgg	Protospacer
******* **** **********   **  ..

319. spacer 12.2|3302283|32|CP027022|CRISPRCasFinder matches to KU935730 (Mycobacterium phage Pipsqueaks, complete genome) position: , mismatch: 9, identity: 0.719

accaccgaggcccccgcgccgccgaaggcgaa	CRISPR spacer
accaccgcggccaccgcgccgccctcgggcgg	Protospacer
******* **** **********   **  ..

320. spacer 12.2|3302283|32|CP027022|CRISPRCasFinder matches to MH316570 (Mycobacterium phage Silvafighter, complete genome) position: , mismatch: 9, identity: 0.719

accaccgaggcccccgcgccgccgaaggcgaa	CRISPR spacer
accaccgcggccaccgcgccgccctcgggcgg	Protospacer
******* **** **********   **  ..

321. spacer 12.2|3302283|32|CP027022|CRISPRCasFinder matches to MK524518 (Mycobacterium phage Smurph, complete genome) position: , mismatch: 9, identity: 0.719

accaccgaggcccccgcgccgccgaaggcgaa	CRISPR spacer
accaccgcggccaccgcgccgccctcgggcgg	Protospacer
******* **** **********   **  ..

322. spacer 12.2|3302283|32|CP027022|CRISPRCasFinder matches to MK524515 (Mycobacterium phage Parmesanjohn, complete genome) position: , mismatch: 9, identity: 0.719

accaccgaggcccccgcgccgccgaaggcgaa	CRISPR spacer
accaccgcggccaccgcgccgccctcgggcgg	Protospacer
******* **** **********   **  ..

323. spacer 12.2|3302283|32|CP027022|CRISPRCasFinder matches to MH697585 (Mycobacterium phage Gex, complete genome) position: , mismatch: 9, identity: 0.719

accaccgaggcccccgcgccgccgaaggcgaa	CRISPR spacer
accaccgcggccaccgcgccgccctcgggcgg	Protospacer
******* **** **********   **  ..

324. spacer 12.2|3302283|32|CP027022|CRISPRCasFinder matches to MH399787 (Mycobacterium phage Rubeelu, complete genome) position: , mismatch: 9, identity: 0.719

accaccgaggcccccgcgccgccgaaggcgaa	CRISPR spacer
accaccgcggccaccgcgccgccctcgggcgg	Protospacer
******* **** **********   **  ..

325. spacer 12.2|3302283|32|CP027022|CRISPRCasFinder matches to KM588359 (Mycobacterium phage Carcharodon, complete genome) position: , mismatch: 9, identity: 0.719

accaccgaggcccccgcgccgccgaaggcgaa	CRISPR spacer
accaccgcggccaccgcgccgccctcgggcgg	Protospacer
******* **** **********   **  ..

326. spacer 12.2|3302283|32|CP027022|CRISPRCasFinder matches to MH697576 (Mycobacterium phage Aggie, complete genome) position: , mismatch: 9, identity: 0.719

accaccgaggcccccgcgccgccgaaggcgaa	CRISPR spacer
accaccgcggccaccgcgccgccctcgggcgg	Protospacer
******* **** **********   **  ..

327. spacer 12.2|3302283|32|CP027022|CRISPRCasFinder matches to NC_021061 (Mycobacterium phage Butters, complete genome) position: , mismatch: 9, identity: 0.719

accaccgaggcccccgcgccgccgaaggcgaa	CRISPR spacer
accaccgcggccaccgcgccgccctcgggcgg	Protospacer
******* **** **********   **  ..

328. spacer 12.2|3302283|32|CP027022|CRISPRCasFinder matches to MH697593 (Mycobacterium phage Tapioca, complete genome) position: , mismatch: 9, identity: 0.719

accaccgaggcccccgcgccgccgaaggcgaa	CRISPR spacer
accaccgcggccaccgcgccgccctcgggcgg	Protospacer
******* **** **********   **  ..

329. spacer 12.2|3302283|32|CP027022|CRISPRCasFinder matches to MK524500 (Mycobacterium phage Kevin1, complete genome) position: , mismatch: 9, identity: 0.719

accaccgaggcccccgcgccgccgaaggcgaa	CRISPR spacer
accaccgcggccaccgcgccgccctcgggcgg	Protospacer
******* **** **********   **  ..

330. spacer 12.2|3302283|32|CP027022|CRISPRCasFinder matches to MG099936 (Mycobacterium phage Andies, complete genome) position: , mismatch: 9, identity: 0.719

accaccgaggcccccgcgccgccgaaggcgaa	CRISPR spacer
accaccgcggccaccgcgccgccctcgggcgg	Protospacer
******* **** **********   **  ..

331. spacer 12.2|3302283|32|CP027022|CRISPRCasFinder matches to NC_031243 (Mycobacterium phage Xeno, complete genome) position: , mismatch: 9, identity: 0.719

accaccgaggcccccgcgccgccgaaggcgaa	CRISPR spacer
accaccgcggccaccgcgccgccctcgggcgg	Protospacer
******* **** **********   **  ..

332. spacer 12.2|3302283|32|CP027022|CRISPRCasFinder matches to JN256079 (Mycobacterium phage Charlie, complete genome) position: , mismatch: 9, identity: 0.719

accaccgaggcccccgcgccgccgaaggcgaa	CRISPR spacer
accaccgcggccaccgcgccgccctcgggcgg	Protospacer
******* **** **********   **  ..

333. spacer 16.1|5578121|34|CP027022|CRISPRCasFinder matches to MT498048 (Mycobacterium phage Raymond7, complete genome) position: , mismatch: 9, identity: 0.735

gacccatgaggcgggccacttcgacggcgaacga	CRISPR spacer
tccacgtgcggcgggcctcttcgacggcgatctg	Protospacer
  * *.** ******** ************ * .

334. spacer 16.1|5578121|34|CP027022|CRISPRCasFinder matches to MK524522 (Mycobacterium phage Purgamenstris, complete genome) position: , mismatch: 9, identity: 0.735

gacccatgaggcgggccacttcgacggcgaacga	CRISPR spacer
tccacgtgcggcgggcctcttcgacggcgatctg	Protospacer
  * *.** ******** ************ * .

335. spacer 16.1|5578121|34|CP027022|CRISPRCasFinder matches to MT498042 (Mycobacterium phage Rebel, complete genome) position: , mismatch: 9, identity: 0.735

gacccatgaggcgggccacttcgacggcgaacga	CRISPR spacer
tccacgtgcggcgggcctcttcgacggcgatctg	Protospacer
  * *.** ******** ************ * .

336. spacer 16.1|5578121|34|CP027022|CRISPRCasFinder matches to MK392367 (Mycobacterium phage BabeRuth, complete genome) position: , mismatch: 9, identity: 0.735

gacccatgaggcgggccacttcgacggcgaacga	CRISPR spacer
tccacgtgcggcgggcctcttcgacggcgatctg	Protospacer
  * *.** ******** ************ * .

337. spacer 16.1|5578121|34|CP027022|CRISPRCasFinder matches to MK524520 (Mycobacterium phage Nenae, complete genome) position: , mismatch: 9, identity: 0.735

gacccatgaggcgggccacttcgacggcgaacga	CRISPR spacer
tccacgtgcggcgggcctcttcgacggcgatctg	Protospacer
  * *.** ******** ************ * .

338. spacer 16.1|5578121|34|CP027022|CRISPRCasFinder matches to JN624851 (Mycobacterium phage Redi, complete genome) position: , mismatch: 9, identity: 0.735

gacccatgaggcgggccacttcgacggcgaacga	CRISPR spacer
tccacgtgcggcgggcctcttcgacggcgatctg	Protospacer
  * *.** ******** ************ * .

339. spacer 16.1|5578121|34|CP027022|CRISPRCasFinder matches to MK524528 (Mycobacterium phage ShrimpFriedEgg, complete genome) position: , mismatch: 9, identity: 0.735

gacccatgaggcgggccacttcgacggcgaacga	CRISPR spacer
tccacgtgcggcgggcctcttcgacggcgatctg	Protospacer
  * *.** ******** ************ * .

340. spacer 9.2|2972525|37|CP027022|PILER-CR matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.73

acctgtccggccgcctgcgccgacgc----ctgcgatccgt	CRISPR spacer
acctgtgcggctgcctgcgccgacgcgatattgcacg----	Protospacer
****** ****.**************    .***.      

341. spacer 11.1|3257421|31|CP027022|CRISPRCasFinder matches to NZ_CP015882 (Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence) position: , mismatch: 10, identity: 0.677

tctccatcggctcggtgggctccttcctctc	CRISPR spacer
gtcgcatcggcgcggtgggcaccttccaggt	Protospacer
 .. ******* ******** ******   .

342. spacer 11.1|3257421|31|CP027022|CRISPRCasFinder matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 10, identity: 0.677

tctccatcggctcggtgggctccttcctctc	CRISPR spacer
gtcgcatcggcgcggtgggcaccttccaggt	Protospacer
 .. ******* ******** ******   .

343. spacer 12.2|3302283|32|CP027022|CRISPRCasFinder matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 10, identity: 0.688

accaccgaggcccccgcgccgccgaaggcgaa	CRISPR spacer
accaccccggcccccgcgccgcccgccacccc	Protospacer
******  *************** .  .*   

344. spacer 23.1|7089514|33|CP027022|CRISPRCasFinder matches to NZ_CP029209 (Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence) position: , mismatch: 10, identity: 0.697

tcgtccggttcgtccttgggctcgtcgtccggc	CRISPR spacer
cgctccgtttcgtccttgggctcgccgcgcacg	Protospacer
.  **** ****************.**. *.  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1515038 : 1526956 11 Bacillus_phage(50.0%) plate,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. CP027025
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027025_1 8857-9496 TypeI-E NA:I-C,I-E,II-B
10 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027025_2 18015-18410 TypeI-E I-C,I-E,II-B:I-E
6 spacers
cas3,cas8e,cse2gr11,cas7,cas5,cas6e

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027025_3 18563-19890 TypeI-E I-E
21 spacers
cas3,cas8e,cse2gr11,cas7,cas5,cas6e

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027025_4 28301-28509 TypeI-E I-E
3 spacers
cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027025_5 28605-29579 TypeI-E I-C,I-E,II-B
15 spacers
cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027025_6 30543-30755 TypeI-E I-C,I-E,II-B
3 spacers
cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027025_7 30850-31367 TypeI-E I-C,I-E,II-B:I-E
8 spacers
cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027025_8 31692-31842 TypeI-E I-C,I-E,II-B
2 spacers
cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP027025_3 3.9|19109|20|CP027025|CRISPRCasFinder,CRT 19109-19128 20 CP027022.1 1438151-1438170 2 0.9
CP027025_7 7.1|30879|32|CP027025|CRISPRCasFinder,CRT 30879-30910 32 CP027025.1 18531-18562 2 0.938

1. spacer 3.9|19109|20|CP027025|CRISPRCasFinder,CRT matches to position: 1438151-1438170, mismatch: 2, identity: 0.9

gcgacgagggcggccgcgct	CRISPR spacer
gcgacgagcgcgcccgcgct	Protospacer
******** *** *******

2. spacer 7.1|30879|32|CP027025|CRISPRCasFinder,CRT matches to position: 18531-18562, mismatch: 2, identity: 0.938

ccacgccgccgcctggtcgccagggaagtcgc	CRISPR spacer
ccacaccgccgcctggtcgccggggaagtcgc	Protospacer
****.****************.**********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP027025_1 1.1|8886|32|CP027025|CRT 8886-8917 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 8886-8917 0 1.0
CP027025_1 1.2|8947|32|CP027025|CRT 8947-8978 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 8947-8978 0 1.0
CP027025_1 1.3|9008|32|CP027025|CRT 9008-9039 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 9008-9039 0 1.0
CP027025_1 1.4|9069|32|CP027025|CRT 9069-9100 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 9069-9100 0 1.0
CP027025_1 1.5|9130|32|CP027025|CRT 9130-9161 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 9130-9161 0 1.0
CP027025_1 1.6|9191|33|CP027025|CRT 9191-9223 33 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 9191-9223 0 1.0
CP027025_1 1.7|9253|32|CP027025|CRT 9253-9284 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 9253-9284 0 1.0
CP027025_1 1.8|9314|32|CP027025|CRT 9314-9345 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 9314-9345 0 1.0
CP027025_1 1.9|9375|32|CP027025|CRT 9375-9406 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 9375-9406 0 1.0
CP027025_1 1.10|9436|32|CP027025|CRT 9436-9467 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 9436-9467 0 1.0
CP027025_1 1.11|8947|31|CP027025|CRISPRCasFinder 8947-8977 31 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 8947-8977 0 1.0
CP027025_1 1.12|9008|31|CP027025|CRISPRCasFinder 9008-9038 31 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 9008-9038 0 1.0
CP027025_1 1.13|9069|31|CP027025|CRISPRCasFinder 9069-9099 31 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 9069-9099 0 1.0
CP027025_1 1.14|9130|31|CP027025|CRISPRCasFinder 9130-9160 31 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 9130-9160 0 1.0
CP027025_1 1.15|9191|32|CP027025|CRISPRCasFinder 9191-9222 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 9191-9222 0 1.0
CP027025_1 1.16|9253|31|CP027025|CRISPRCasFinder 9253-9283 31 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 9253-9283 0 1.0
CP027025_1 1.17|9314|31|CP027025|CRISPRCasFinder 9314-9344 31 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 9314-9344 0 1.0
CP027025_1 1.18|9375|31|CP027025|CRISPRCasFinder 9375-9405 31 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 9375-9405 0 1.0
CP027025_1 1.19|9436|31|CP027025|CRISPRCasFinder 9436-9466 31 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 9436-9466 0 1.0
CP027025_1 1.20|9377|28|CP027025|PILER-CR 9377-9404 28 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 9375-9402 0 1.0
CP027025_1 1.21|9438|28|CP027025|PILER-CR 9438-9465 28 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 9436-9463 0 1.0
CP027025_2 2.1|18044|32|CP027025|CRISPRCasFinder,CRT 18044-18075 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 18044-18075 0 1.0
CP027025_2 2.2|18105|32|CP027025|CRISPRCasFinder,CRT 18105-18136 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 18105-18136 0 1.0
CP027025_2 2.3|18166|32|CP027025|CRISPRCasFinder,CRT 18166-18197 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 18166-18197 0 1.0
CP027025_2 2.4|18227|32|CP027025|CRISPRCasFinder,CRT 18227-18258 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 18227-18258 0 1.0
CP027025_2 2.5|18288|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 18288-18319 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 18288-18319 0 1.0
CP027025_2 2.6|18349|32|CP027025|CRISPRCasFinder,CRT 18349-18380 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 18349-18380 0 1.0
CP027025_2 2.7|18353|28|CP027025|PILER-CR 18353-18380 28 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 18349-18376 0 1.0
CP027025_3 3.1|18592|32|CP027025|CRISPRCasFinder,CRT 18592-18623 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 18592-18623 0 1.0
CP027025_3 3.3|18743|32|CP027025|CRISPRCasFinder,CRT 18743-18774 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 18743-18774 0 1.0
CP027025_3 3.4|18804|32|CP027025|CRISPRCasFinder,CRT 18804-18835 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 18804-18835 0 1.0
CP027025_3 3.5|18865|32|CP027025|CRISPRCasFinder,CRT 18865-18896 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 18865-18896 0 1.0
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 18926-18957 0 1.0
CP027025_3 3.7|18987|32|CP027025|CRISPRCasFinder,CRT 18987-19018 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 18987-19018 0 1.0
CP027025_3 3.8|19048|32|CP027025|CRISPRCasFinder,CRT 19048-19079 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 19048-19079 0 1.0
CP027025_3 3.9|19109|20|CP027025|CRISPRCasFinder,CRT 19109-19128 20 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 19109-19128 0 1.0
CP027025_3 3.10|19158|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19158-19189 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 19158-19189 0 1.0
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 19219-19250 0 1.0
CP027025_3 3.12|19280|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19280-19311 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 19280-19311 0 1.0
CP027025_3 3.13|19341|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19341-19372 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 19341-19372 0 1.0
CP027025_3 3.14|19402|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19402-19433 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 19402-19433 0 1.0
CP027025_3 3.15|19463|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19463-19494 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 19463-19494 0 1.0
CP027025_3 3.16|19524|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19524-19555 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 19524-19555 0 1.0
CP027025_3 3.17|19585|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19585-19616 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 19585-19616 0 1.0
CP027025_3 3.18|19646|33|CP027025|CRISPRCasFinder,CRT,PILER-CR 19646-19678 33 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 19646-19678 0 1.0
CP027025_3 3.19|19708|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19708-19739 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 19708-19739 0 1.0
CP027025_3 3.20|19769|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19769-19800 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 19769-19800 0 1.0
CP027025_3 3.21|19830|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19830-19861 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 19830-19861 0 1.0
CP027025_4 4.1|28330|30|CP027025|CRT 28330-28359 30 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 28330-28359 0 1.0
CP027025_4 4.2|28389|31|CP027025|CRT 28389-28419 31 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 28389-28419 0 1.0
CP027025_4 4.3|28449|32|CP027025|CRT 28449-28480 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 28449-28480 0 1.0
CP027025_5 5.1|28634|32|CP027025|CRISPRCasFinder 28634-28665 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 28634-28665 0 1.0
CP027025_5 5.2|28695|32|CP027025|CRISPRCasFinder 28695-28726 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 28695-28726 0 1.0
CP027025_5 5.3|28756|32|CP027025|CRISPRCasFinder 28756-28787 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 28756-28787 0 1.0
CP027025_5 5.4|28817|32|CP027025|CRISPRCasFinder 28817-28848 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 28817-28848 0 1.0
CP027025_5 5.5|28878|32|CP027025|CRISPRCasFinder 28878-28909 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 28878-28909 0 1.0
CP027025_5 5.6|28939|32|CP027025|CRISPRCasFinder 28939-28970 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 28939-28970 0 1.0
CP027025_5 5.7|29000|32|CP027025|CRISPRCasFinder 29000-29031 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 29000-29031 0 1.0
CP027025_5 5.8|29061|32|CP027025|CRISPRCasFinder 29061-29092 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 29061-29092 0 1.0
CP027025_5 5.9|29122|32|CP027025|CRISPRCasFinder 29122-29153 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 29122-29153 0 1.0
CP027025_5 5.11|29273|32|CP027025|CRISPRCasFinder 29273-29304 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 29273-29304 0 1.0
CP027025_5 5.12|29334|32|CP027025|CRISPRCasFinder 29334-29365 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 29334-29365 0 1.0
CP027025_5 5.13|29395|32|CP027025|CRISPRCasFinder 29395-29426 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 29395-29426 0 1.0
CP027025_5 5.14|29456|32|CP027025|CRISPRCasFinder 29456-29487 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 29456-29487 0 1.0
CP027025_5 5.15|29517|33|CP027025|CRISPRCasFinder 29517-29549 33 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 29517-29549 0 1.0
CP027025_6 6.1|30573|31|CP027025|PILER-CR 30573-30603 31 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 30573-30603 0 1.0
CP027025_6 6.2|30634|31|CP027025|PILER-CR 30634-30664 31 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 30634-30664 0 1.0
CP027025_6 6.3|30572|32|CP027025|CRISPRCasFinder,CRT 30572-30603 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 30572-30603 0 1.0
CP027025_6 6.4|30633|32|CP027025|CRISPRCasFinder,CRT 30633-30664 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 30633-30664 0 1.0
CP027025_6 6.5|30694|32|CP027025|CRISPRCasFinder,CRT 30694-30725 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 30694-30725 0 1.0
CP027025_7 7.1|30879|32|CP027025|CRISPRCasFinder,CRT 30879-30910 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 30879-30910 0 1.0
CP027025_7 7.2|30940|32|CP027025|CRISPRCasFinder,CRT 30940-30971 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 30940-30971 0 1.0
CP027025_7 7.3|31001|32|CP027025|CRISPRCasFinder,CRT 31001-31032 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 31001-31032 0 1.0
CP027025_7 7.4|31062|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 31062-31093 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 31062-31093 0 1.0
CP027025_7 7.5|31123|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 31123-31154 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 31123-31154 0 1.0
CP027025_7 7.6|31184|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 31184-31215 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 31184-31215 0 1.0
CP027025_7 7.7|31245|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 31245-31276 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 31245-31276 0 1.0
CP027025_7 7.8|31306|32|CP027025|CRISPRCasFinder,CRT 31306-31337 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 31306-31337 0 1.0
CP027025_8 8.1|31721|32|CP027025|CRISPRCasFinder 31721-31752 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 31721-31752 0 1.0
CP027025_8 8.2|31782|32|CP027025|CRISPRCasFinder 31782-31813 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 31782-31813 0 1.0
CP027025_1 1.5|9130|32|CP027025|CRT 9130-9161 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 29273-29304 1 0.969
CP027025_1 1.14|9130|31|CP027025|CRISPRCasFinder 9130-9160 31 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 29273-29303 1 0.968
CP027025_3 3.2|18653|61|CP027025|CRISPRCasFinder,CRT 18653-18713 61 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 18653-18713 1 0.984
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 29395-29426 1 0.969
CP027025_3 3.9|19109|20|CP027025|CRISPRCasFinder,CRT 19109-19128 20 NC_012807 Methylorubrum extorquens AM1 plasmid p1META1, complete sequence 1816-1835 1 0.95
CP027025_3 3.12|19280|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19280-19311 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 12636-12667 1 0.969
CP027025_5 5.10|29183|61|CP027025|CRISPRCasFinder 29183-29243 61 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 29183-29243 1 0.984
CP027025_5 5.11|29273|32|CP027025|CRISPRCasFinder 29273-29304 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 9130-9161 1 0.969
CP027025_5 5.13|29395|32|CP027025|CRISPRCasFinder 29395-29426 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 18926-18957 1 0.969
CP027025_1 1.5|9130|32|CP027025|CRT 9130-9161 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 18804-18835 2 0.938
CP027025_1 1.14|9130|31|CP027025|CRISPRCasFinder 9130-9160 31 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 18804-18834 2 0.935
CP027025_2 2.1|18044|32|CP027025|CRISPRCasFinder,CRT 18044-18075 32 MT711975 Streptomyces phage Alderaan, complete genome 29255-29286 2 0.938
CP027025_2 2.1|18044|32|CP027025|CRISPRCasFinder,CRT 18044-18075 32 KY092481 Streptomyces phage PapayaSalad, complete genome 25648-25679 2 0.938
CP027025_3 3.4|18804|32|CP027025|CRISPRCasFinder,CRT 18804-18835 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 9130-9161 2 0.938
CP027025_5 5.3|28756|32|CP027025|CRISPRCasFinder 28756-28787 32 NC_023316 Streptomyces sp. 14R-10 plasmid pZL1, complete sequence 79082-79113 2 0.938
CP027025_5 5.12|29334|32|CP027025|CRISPRCasFinder 29334-29365 32 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 57198-57229 2 0.938
CP027025_5 5.12|29334|32|CP027025|CRISPRCasFinder 29334-29365 32 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 57199-57230 2 0.938
CP027025_7 7.1|30879|32|CP027025|CRISPRCasFinder,CRT 30879-30910 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 18531-18562 2 0.938
CP027025_1 1.20|9377|28|CP027025|PILER-CR 9377-9404 28 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 706336-706363 3 0.893
CP027025_3 3.4|18804|32|CP027025|CRISPRCasFinder,CRT 18804-18835 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 29273-29304 3 0.906
CP027025_5 5.11|29273|32|CP027025|CRISPRCasFinder 29273-29304 32 NZ_CP027025 Streptomyces sp. WAC00288 plasmid p3, complete sequence 18804-18835 3 0.906
CP027025_1 1.3|9008|32|CP027025|CRT 9008-9039 32 NZ_CP006990 Rhizobium sp. IE4771 plasmid pRetIE4771d, complete sequence 66816-66847 4 0.875
CP027025_1 1.3|9008|32|CP027025|CRT 9008-9039 32 NZ_CP020911 Rhizobium etli strain NXC12 plasmid pRetNXC12e, complete sequence 78156-78187 4 0.875
CP027025_1 1.3|9008|32|CP027025|CRT 9008-9039 32 NZ_CP021127 Rhizobium sp. Kim5 plasmid pRetKim5c, complete sequence 65421-65452 4 0.875
CP027025_1 1.3|9008|32|CP027025|CRT 9008-9039 32 CP007644 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence 67006-67037 4 0.875
CP027025_1 1.12|9008|31|CP027025|CRISPRCasFinder 9008-9038 31 NZ_CP006990 Rhizobium sp. IE4771 plasmid pRetIE4771d, complete sequence 66816-66846 4 0.871
CP027025_1 1.12|9008|31|CP027025|CRISPRCasFinder 9008-9038 31 NZ_CP020911 Rhizobium etli strain NXC12 plasmid pRetNXC12e, complete sequence 78156-78186 4 0.871
CP027025_1 1.12|9008|31|CP027025|CRISPRCasFinder 9008-9038 31 NZ_CP021127 Rhizobium sp. Kim5 plasmid pRetKim5c, complete sequence 65421-65451 4 0.871
CP027025_1 1.12|9008|31|CP027025|CRISPRCasFinder 9008-9038 31 CP007644 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence 67006-67036 4 0.871
CP027025_1 1.18|9375|31|CP027025|CRISPRCasFinder 9375-9405 31 NC_014159 Tsukamurella paurometabola DSM 20162 plasmid pTpau01, complete sequence 92890-92920 4 0.871
CP027025_1 1.20|9377|28|CP027025|PILER-CR 9377-9404 28 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3223442-3223469 4 0.857
CP027025_1 1.20|9377|28|CP027025|PILER-CR 9377-9404 28 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 29891-29918 4 0.857
CP027025_1 1.20|9377|28|CP027025|PILER-CR 9377-9404 28 NC_014159 Tsukamurella paurometabola DSM 20162 plasmid pTpau01, complete sequence 92893-92920 4 0.857
CP027025_1 1.20|9377|28|CP027025|PILER-CR 9377-9404 28 NZ_CP023064 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence 298818-298845 4 0.857
CP027025_1 1.20|9377|28|CP027025|PILER-CR 9377-9404 28 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 2186263-2186290 4 0.857
CP027025_1 1.20|9377|28|CP027025|PILER-CR 9377-9404 28 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 2252567-2252594 4 0.857
CP027025_1 1.21|9438|28|CP027025|PILER-CR 9438-9465 28 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 1646470-1646497 4 0.857
CP027025_1 1.21|9438|28|CP027025|PILER-CR 9438-9465 28 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 1646468-1646495 4 0.857
CP027025_1 1.21|9438|28|CP027025|PILER-CR 9438-9465 28 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 1552047-1552074 4 0.857
CP027025_1 1.21|9438|28|CP027025|PILER-CR 9438-9465 28 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 1495244-1495271 4 0.857
CP027025_1 1.21|9438|28|CP027025|PILER-CR 9438-9465 28 KP966108 Burkholderia phage vB_BceM_AP3, complete genome 9762-9789 4 0.857
CP027025_2 2.7|18353|28|CP027025|PILER-CR 18353-18380 28 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 655322-655349 4 0.857
CP027025_2 2.7|18353|28|CP027025|PILER-CR 18353-18380 28 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 655331-655358 4 0.857
CP027025_2 2.7|18353|28|CP027025|PILER-CR 18353-18380 28 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 674910-674937 4 0.857
CP027025_2 2.7|18353|28|CP027025|PILER-CR 18353-18380 28 NZ_CP016453 Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence 285040-285067 4 0.857
CP027025_1 1.3|9008|32|CP027025|CRT 9008-9039 32 NZ_CP030354 Novosphingobium sp. P6W plasmid pP6W1, complete sequence 105122-105153 5 0.844
CP027025_1 1.9|9375|32|CP027025|CRT 9375-9406 32 NZ_AP014659 Bradyrhizobium diazoefficiens strain NK6 plasmid pNK6a, complete sequence 26089-26120 5 0.844
CP027025_1 1.9|9375|32|CP027025|CRT 9375-9406 32 NZ_CP049701 Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence 396402-396433 5 0.844
CP027025_1 1.12|9008|31|CP027025|CRISPRCasFinder 9008-9038 31 NZ_CP030354 Novosphingobium sp. P6W plasmid pP6W1, complete sequence 105123-105153 5 0.839
CP027025_1 1.18|9375|31|CP027025|CRISPRCasFinder 9375-9405 31 NZ_AP014659 Bradyrhizobium diazoefficiens strain NK6 plasmid pNK6a, complete sequence 26089-26119 5 0.839
CP027025_1 1.18|9375|31|CP027025|CRISPRCasFinder 9375-9405 31 NZ_CP049701 Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence 396402-396432 5 0.839
CP027025_1 1.20|9377|28|CP027025|PILER-CR 9377-9404 28 NZ_CP006991 Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence 655364-655391 5 0.821
CP027025_1 1.20|9377|28|CP027025|PILER-CR 9377-9404 28 NC_007764 Rhizobium etli CFN 42 plasmid p42c, complete sequence 174261-174288 5 0.821
CP027025_1 1.20|9377|28|CP027025|PILER-CR 9377-9404 28 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 203372-203399 5 0.821
CP027025_1 1.20|9377|28|CP027025|PILER-CR 9377-9404 28 NZ_CP013524 Rhizobium phaseoli strain R744 plasmid pRphaR744b, complete sequence 262638-262665 5 0.821
CP027025_1 1.20|9377|28|CP027025|PILER-CR 9377-9404 28 NZ_CP020908 Rhizobium etli strain NXC12 plasmid pRetNXC12b, complete sequence 187144-187171 5 0.821
CP027025_1 1.20|9377|28|CP027025|PILER-CR 9377-9404 28 NC_021907 Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1b, complete sequence 189669-189696 5 0.821
CP027025_1 1.20|9377|28|CP027025|PILER-CR 9377-9404 28 NZ_CP021128 Rhizobium sp. Kim5 plasmid pRetKim5d, complete sequence 605390-605417 5 0.821
CP027025_1 1.20|9377|28|CP027025|PILER-CR 9377-9404 28 CP007645 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803d, complete sequence 663806-663833 5 0.821
CP027025_1 1.20|9377|28|CP027025|PILER-CR 9377-9404 28 NZ_LR134465 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence 401817-401844 5 0.821
CP027025_1 1.20|9377|28|CP027025|PILER-CR 9377-9404 28 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 930437-930464 5 0.821
CP027025_1 1.20|9377|28|CP027025|PILER-CR 9377-9404 28 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 2113006-2113033 5 0.821
CP027025_1 1.20|9377|28|CP027025|PILER-CR 9377-9404 28 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 1610780-1610807 5 0.821
CP027025_1 1.20|9377|28|CP027025|PILER-CR 9377-9404 28 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 1587242-1587269 5 0.821
CP027025_1 1.20|9377|28|CP027025|PILER-CR 9377-9404 28 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 1935478-1935505 5 0.821
CP027025_1 1.20|9377|28|CP027025|PILER-CR 9377-9404 28 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 458279-458306 5 0.821
CP027025_1 1.20|9377|28|CP027025|PILER-CR 9377-9404 28 NZ_CP032325 Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence 259835-259862 5 0.821
CP027025_1 1.20|9377|28|CP027025|PILER-CR 9377-9404 28 NZ_AP019802 Thermus thermophilus strain HC11 plasmid pHC11, complete sequence 146791-146818 5 0.821
CP027025_1 1.20|9377|28|CP027025|PILER-CR 9377-9404 28 NZ_CP024310 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence 478114-478141 5 0.821
CP027025_1 1.20|9377|28|CP027025|PILER-CR 9377-9404 28 NZ_CP034185 Deinococcus sp. S14-83 strain S14-83T plasmid unnamed1, complete sequence 276016-276043 5 0.821
CP027025_1 1.20|9377|28|CP027025|PILER-CR 9377-9404 28 NZ_CP050991 Chromobacterium violaceum strain FDAARGOS_635 plasmid unnamed, complete sequence 36410-36437 5 0.821
CP027025_1 1.20|9377|28|CP027025|PILER-CR 9377-9404 28 NZ_MG651603 Chromobacterium violaceum strain ATCC 12472 plasmid pChV1, complete sequence 23434-23461 5 0.821
CP027025_1 1.20|9377|28|CP027025|PILER-CR 9377-9404 28 MT657335 Gordonia phage Mariokart, complete genome 46421-46448 5 0.821
CP027025_1 1.21|9438|28|CP027025|PILER-CR 9438-9465 28 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 592230-592257 5 0.821
CP027025_2 2.7|18353|28|CP027025|PILER-CR 18353-18380 28 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 639630-639657 5 0.821
CP027025_2 2.7|18353|28|CP027025|PILER-CR 18353-18380 28 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 655341-655368 5 0.821
CP027025_2 2.7|18353|28|CP027025|PILER-CR 18353-18380 28 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 525691-525718 5 0.821
CP027025_2 2.7|18353|28|CP027025|PILER-CR 18353-18380 28 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 297572-297599 5 0.821
CP027025_2 2.7|18353|28|CP027025|PILER-CR 18353-18380 28 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 639480-639507 5 0.821
CP027025_2 2.7|18353|28|CP027025|PILER-CR 18353-18380 28 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 639458-639485 5 0.821
CP027025_2 2.7|18353|28|CP027025|PILER-CR 18353-18380 28 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 519595-519622 5 0.821
CP027025_2 2.7|18353|28|CP027025|PILER-CR 18353-18380 28 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 1877301-1877328 5 0.821
CP027025_2 2.7|18353|28|CP027025|PILER-CR 18353-18380 28 NZ_CP054606 Sulfitobacter pseudonitzschiae strain H46 plasmid unnamed7, complete sequence 91264-91291 5 0.821
CP027025_5 5.12|29334|32|CP027025|CRISPRCasFinder 29334-29365 32 NZ_CP026654 Streptomyces dengpaensis strain XZHG99 plasmid unnamed2, complete sequence 57111-57142 5 0.844
CP027025_1 1.3|9008|32|CP027025|CRT 9008-9039 32 NZ_CP029234 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436d, complete sequence 123747-123778 6 0.812
CP027025_1 1.3|9008|32|CP027025|CRT 9008-9039 32 NZ_CP013600 Rhizobium sp. N741 plasmid pRspN741e, complete sequence 179512-179543 6 0.812
CP027025_1 1.3|9008|32|CP027025|CRT 9008-9039 32 NC_011368 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence 869174-869205 6 0.812
CP027025_1 1.3|9008|32|CP027025|CRT 9008-9039 32 NZ_CP013504 Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence 179512-179543 6 0.812
CP027025_1 1.3|9008|32|CP027025|CRT 9008-9039 32 NZ_CP013510 Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence 177953-177984 6 0.812
CP027025_1 1.3|9008|32|CP027025|CRT 9008-9039 32 NZ_CP013521 Rhizobium sp. N113 plasmid pRspN113d, complete sequence 182200-182231 6 0.812
CP027025_1 1.3|9008|32|CP027025|CRT 9008-9039 32 NZ_CP013494 Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence 176318-176349 6 0.812
CP027025_1 1.3|9008|32|CP027025|CRT 9008-9039 32 NZ_CP013594 Rhizobium sp. N871 plasmid pRspN871d, complete sequence 179512-179543 6 0.812
CP027025_1 1.4|9069|32|CP027025|CRT 9069-9100 32 NZ_CP034811 Paracoccus sp. Arc7-R13 plasmid unnamed1, complete sequence 154817-154848 6 0.812
CP027025_1 1.9|9375|32|CP027025|CRT 9375-9406 32 NZ_LR134465 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence 401817-401848 6 0.812
CP027025_1 1.9|9375|32|CP027025|CRT 9375-9406 32 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 1587238-1587269 6 0.812
CP027025_1 1.9|9375|32|CP027025|CRT 9375-9406 32 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 1610776-1610807 6 0.812
CP027025_1 1.9|9375|32|CP027025|CRT 9375-9406 32 NZ_CP023064 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence 298814-298845 6 0.812
CP027025_1 1.9|9375|32|CP027025|CRT 9375-9406 32 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 458279-458310 6 0.812
CP027025_1 1.12|9008|31|CP027025|CRISPRCasFinder 9008-9038 31 NZ_CP029234 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436d, complete sequence 123748-123778 6 0.806
CP027025_1 1.12|9008|31|CP027025|CRISPRCasFinder 9008-9038 31 NZ_CP013600 Rhizobium sp. N741 plasmid pRspN741e, complete sequence 179512-179542 6 0.806
CP027025_1 1.12|9008|31|CP027025|CRISPRCasFinder 9008-9038 31 NC_011368 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence 869174-869204 6 0.806
CP027025_1 1.12|9008|31|CP027025|CRISPRCasFinder 9008-9038 31 NZ_CP013504 Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence 179512-179542 6 0.806
CP027025_1 1.12|9008|31|CP027025|CRISPRCasFinder 9008-9038 31 NZ_CP013510 Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence 177953-177983 6 0.806
CP027025_1 1.12|9008|31|CP027025|CRISPRCasFinder 9008-9038 31 NZ_CP013521 Rhizobium sp. N113 plasmid pRspN113d, complete sequence 182200-182230 6 0.806
CP027025_1 1.12|9008|31|CP027025|CRISPRCasFinder 9008-9038 31 NZ_CP013494 Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence 176318-176348 6 0.806
CP027025_1 1.12|9008|31|CP027025|CRISPRCasFinder 9008-9038 31 NZ_CP013594 Rhizobium sp. N871 plasmid pRspN871d, complete sequence 179512-179542 6 0.806
CP027025_1 1.13|9069|31|CP027025|CRISPRCasFinder 9069-9099 31 NZ_CP034811 Paracoccus sp. Arc7-R13 plasmid unnamed1, complete sequence 154818-154848 6 0.806
CP027025_1 1.17|9314|31|CP027025|CRISPRCasFinder 9314-9344 31 NZ_CP021083 Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence 244366-244396 6 0.806
CP027025_1 1.18|9375|31|CP027025|CRISPRCasFinder 9375-9405 31 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 1610777-1610807 6 0.806
CP027025_1 1.18|9375|31|CP027025|CRISPRCasFinder 9375-9405 31 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 1587239-1587269 6 0.806
CP027025_1 1.18|9375|31|CP027025|CRISPRCasFinder 9375-9405 31 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 458279-458309 6 0.806
CP027025_1 1.19|9436|31|CP027025|CRISPRCasFinder 9436-9466 31 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 1646470-1646500 6 0.806
CP027025_1 1.19|9436|31|CP027025|CRISPRCasFinder 9436-9466 31 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 1646468-1646498 6 0.806
CP027025_1 1.19|9436|31|CP027025|CRISPRCasFinder 9436-9466 31 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 1552047-1552077 6 0.806
CP027025_1 1.19|9436|31|CP027025|CRISPRCasFinder 9436-9466 31 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 1495244-1495274 6 0.806
CP027025_1 1.19|9436|31|CP027025|CRISPRCasFinder 9436-9466 31 KP966108 Burkholderia phage vB_BceM_AP3, complete genome 9759-9789 6 0.806
CP027025_1 1.20|9377|28|CP027025|PILER-CR 9377-9404 28 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4432147-4432174 6 0.786
CP027025_1 1.20|9377|28|CP027025|PILER-CR 9377-9404 28 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 1471277-1471304 6 0.786
CP027025_1 1.20|9377|28|CP027025|PILER-CR 9377-9404 28 NC_011368 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence 174400-174427 6 0.786
CP027025_1 1.20|9377|28|CP027025|PILER-CR 9377-9404 28 MN813693 Mycobacterium phage Imvubu, complete genome 22705-22732 6 0.786
CP027025_1 1.20|9377|28|CP027025|PILER-CR 9377-9404 28 NZ_LR134454 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 12, complete sequence 132000-132027 6 0.786
CP027025_1 1.20|9377|28|CP027025|PILER-CR 9377-9404 28 NC_008537 Arthrobacter sp. FB24 plasmid 1, complete sequence 109301-109328 6 0.786
CP027025_1 1.20|9377|28|CP027025|PILER-CR 9377-9404 28 NZ_CP021082 Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence 520476-520503 6 0.786
CP027025_1 1.20|9377|28|CP027025|PILER-CR 9377-9404 28 MT446395 UNVERIFIED: Escherichia virus TH21, complete genome 15182-15209 6 0.786
CP027025_1 1.20|9377|28|CP027025|PILER-CR 9377-9404 28 NZ_CP017077 Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence 750324-750351 6 0.786
CP027025_1 1.20|9377|28|CP027025|PILER-CR 9377-9404 28 NZ_CP011515 Mitsuaria sp. 7 plasmid, complete sequence 72970-72997 6 0.786
CP027025_1 1.20|9377|28|CP027025|PILER-CR 9377-9404 28 NZ_LR134461 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 19, complete sequence 79852-79879 6 0.786
CP027025_1 1.20|9377|28|CP027025|PILER-CR 9377-9404 28 NZ_CP027299 Streptomyces sp. SGAir0924 plasmid unnamed_5 120954-120981 6 0.786
CP027025_1 1.20|9377|28|CP027025|PILER-CR 9377-9404 28 MK376956 Gordonia phage WilliamBoone, complete genome 14295-14322 6 0.786
CP027025_1 1.21|9438|28|CP027025|PILER-CR 9438-9465 28 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 1265819-1265846 6 0.786
CP027025_1 1.21|9438|28|CP027025|PILER-CR 9438-9465 28 NZ_CP023068 Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence 601643-601670 6 0.786
CP027025_1 1.21|9438|28|CP027025|PILER-CR 9438-9465 28 NZ_CP021028 Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence 16798-16825 6 0.786
CP027025_2 2.7|18353|28|CP027025|PILER-CR 18353-18380 28 NZ_CP017759 Cupriavidus necator strain NH9 plasmid pENH92, complete sequence 209283-209310 6 0.786
CP027025_2 2.7|18353|28|CP027025|PILER-CR 18353-18380 28 NZ_CP007144 Hymenobacter swuensis DY53 plasmid pHsw1, complete sequence 295434-295461 6 0.786
CP027025_2 2.7|18353|28|CP027025|PILER-CR 18353-18380 28 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 721820-721847 6 0.786
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NZ_CP044333 Methylocystis parvus strain BRCS2 plasmid unnamed2, complete sequence 39097-39128 6 0.812
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NZ_CP034813 Paracoccus sp. Arc7-R13 plasmid unnamed2, complete sequence 185973-186004 6 0.812
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 151251-151282 6 0.812
CP027025_3 3.16|19524|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19524-19555 32 NZ_CP020900 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence 75283-75314 6 0.812
CP027025_3 3.16|19524|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19524-19555 32 NZ_CP013526 Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence 332591-332622 6 0.812
CP027025_3 3.16|19524|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19524-19555 32 NZ_CP013589 Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence 335349-335380 6 0.812
CP027025_3 3.16|19524|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19524-19555 32 NZ_CP013579 Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence 332531-332562 6 0.812
CP027025_3 3.16|19524|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19524-19555 32 NZ_CP013531 Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence 351987-352018 6 0.812
CP027025_3 3.16|19524|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19524-19555 32 NZ_CP013536 Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence 568995-569026 6 0.812
CP027025_3 3.16|19524|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19524-19555 32 NZ_CP013541 Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence 338777-338808 6 0.812
CP027025_3 3.16|19524|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19524-19555 32 NZ_CP013546 Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence 346952-346983 6 0.812
CP027025_3 3.16|19524|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19524-19555 32 NZ_CP013584 Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence 351987-352018 6 0.812
CP027025_3 3.16|19524|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19524-19555 32 NZ_CP013573 Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence 332531-332562 6 0.812
CP027025_3 3.16|19524|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19524-19555 32 NC_010997 Rhizobium etli CIAT 652 plasmid pC, complete sequence 332097-332128 6 0.812
CP027025_7 7.3|31001|32|CP027025|CRISPRCasFinder,CRT 31001-31032 32 NZ_CP026529 Sinorhizobium meliloti strain AK21 plasmid pSmeAK21b, complete sequence 47880-47911 6 0.812
CP027025_7 7.5|31123|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 31123-31154 32 NZ_CP045549 Streptomyces sp. SYP-A7193 plasmid unnamed2, complete sequence 119347-119378 6 0.812
CP027025_7 7.6|31184|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 31184-31215 32 NZ_CP014599 Yangia sp. CCB-MM3 plasmid unnamed3, complete sequence 261955-261986 6 0.812
CP027025_1 1.1|8886|32|CP027025|CRT 8886-8917 32 NZ_CP021082 Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence 635496-635527 7 0.781
CP027025_1 1.8|9314|32|CP027025|CRT 9314-9345 32 NZ_CP021083 Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence 244366-244397 7 0.781
CP027025_1 1.8|9314|32|CP027025|CRT 9314-9345 32 NZ_CP010990 Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence 253993-254024 7 0.781
CP027025_1 1.9|9375|32|CP027025|CRT 9375-9406 32 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 2113002-2113033 7 0.781
CP027025_1 1.9|9375|32|CP027025|CRT 9375-9406 32 NZ_CP024310 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence 478110-478141 7 0.781
CP027025_1 1.10|9436|32|CP027025|CRT 9436-9467 32 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 1646470-1646501 7 0.781
CP027025_1 1.10|9436|32|CP027025|CRT 9436-9467 32 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 1646468-1646499 7 0.781
CP027025_1 1.10|9436|32|CP027025|CRT 9436-9467 32 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 1552047-1552078 7 0.781
CP027025_1 1.10|9436|32|CP027025|CRT 9436-9467 32 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 1495244-1495275 7 0.781
CP027025_1 1.10|9436|32|CP027025|CRT 9436-9467 32 KP966108 Burkholderia phage vB_BceM_AP3, complete genome 9758-9789 7 0.781
CP027025_1 1.12|9008|31|CP027025|CRISPRCasFinder 9008-9038 31 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 461070-461100 7 0.774
CP027025_1 1.14|9130|31|CP027025|CRISPRCasFinder 9130-9160 31 NZ_CP045377 Sulfitobacter sp. THAF37 plasmid pTHAF37_e, complete sequence 18026-18056 7 0.774
CP027025_1 1.15|9191|32|CP027025|CRISPRCasFinder 9191-9222 32 KY006853 Erythrobacter phage vB_EliS_R6L, complete genome 651-682 7 0.781
CP027025_1 1.17|9314|31|CP027025|CRISPRCasFinder 9314-9344 31 NC_023284 Streptomyces sp. F2 plasmid pFRL4, complete sequence 57794-57824 7 0.774
CP027025_1 1.17|9314|31|CP027025|CRISPRCasFinder 9314-9344 31 KC292024 Halovirus HHTV-2, complete genome 17967-17997 7 0.774
CP027025_1 1.17|9314|31|CP027025|CRISPRCasFinder 9314-9344 31 NZ_CP010990 Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence 253993-254023 7 0.774
CP027025_1 1.18|9375|31|CP027025|CRISPRCasFinder 9375-9405 31 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3223442-3223472 7 0.774
CP027025_1 1.18|9375|31|CP027025|CRISPRCasFinder 9375-9405 31 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 914529-914559 7 0.774
CP027025_1 1.18|9375|31|CP027025|CRISPRCasFinder 9375-9405 31 NZ_CP006991 Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence 655361-655391 7 0.774
CP027025_1 1.18|9375|31|CP027025|CRISPRCasFinder 9375-9405 31 NC_007764 Rhizobium etli CFN 42 plasmid p42c, complete sequence 174258-174288 7 0.774
CP027025_1 1.18|9375|31|CP027025|CRISPRCasFinder 9375-9405 31 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 203369-203399 7 0.774
CP027025_1 1.18|9375|31|CP027025|CRISPRCasFinder 9375-9405 31 NZ_CP013524 Rhizobium phaseoli strain R744 plasmid pRphaR744b, complete sequence 262635-262665 7 0.774
CP027025_1 1.18|9375|31|CP027025|CRISPRCasFinder 9375-9405 31 NZ_CP020908 Rhizobium etli strain NXC12 plasmid pRetNXC12b, complete sequence 187141-187171 7 0.774
CP027025_1 1.18|9375|31|CP027025|CRISPRCasFinder 9375-9405 31 NC_021907 Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1b, complete sequence 189666-189696 7 0.774
CP027025_1 1.18|9375|31|CP027025|CRISPRCasFinder 9375-9405 31 NZ_CP021128 Rhizobium sp. Kim5 plasmid pRetKim5d, complete sequence 605387-605417 7 0.774
CP027025_1 1.18|9375|31|CP027025|CRISPRCasFinder 9375-9405 31 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 516289-516319 7 0.774
CP027025_1 1.18|9375|31|CP027025|CRISPRCasFinder 9375-9405 31 CP007645 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803d, complete sequence 663803-663833 7 0.774
CP027025_1 1.18|9375|31|CP027025|CRISPRCasFinder 9375-9405 31 NZ_CP016560 Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence 173545-173575 7 0.774
CP027025_1 1.18|9375|31|CP027025|CRISPRCasFinder 9375-9405 31 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 2186263-2186293 7 0.774
CP027025_1 1.18|9375|31|CP027025|CRISPRCasFinder 9375-9405 31 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 2252567-2252597 7 0.774
CP027025_1 1.18|9375|31|CP027025|CRISPRCasFinder 9375-9405 31 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 29888-29918 7 0.774
CP027025_1 1.18|9375|31|CP027025|CRISPRCasFinder 9375-9405 31 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 2113003-2113033 7 0.774
CP027025_1 1.18|9375|31|CP027025|CRISPRCasFinder 9375-9405 31 NZ_CP023064 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence 298815-298845 7 0.774
CP027025_1 1.18|9375|31|CP027025|CRISPRCasFinder 9375-9405 31 NZ_LR134461 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 19, complete sequence 79852-79882 7 0.774
CP027025_1 1.19|9436|31|CP027025|CRISPRCasFinder 9436-9466 31 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 592227-592257 7 0.774
CP027025_1 1.20|9377|28|CP027025|PILER-CR 9377-9404 28 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 795901-795928 7 0.75
CP027025_1 1.20|9377|28|CP027025|PILER-CR 9377-9404 28 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4812318-4812345 7 0.75
CP027025_1 1.20|9377|28|CP027025|PILER-CR 9377-9404 28 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 1315500-1315527 7 0.75
CP027025_1 1.20|9377|28|CP027025|PILER-CR 9377-9404 28 NZ_CP003988 Streptomyces sp. 769 plasmid pSGZL, complete sequence 79271-79298 7 0.75
CP027025_1 1.20|9377|28|CP027025|PILER-CR 9377-9404 28 NZ_CP015882 Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence 780418-780445 7 0.75
CP027025_1 1.20|9377|28|CP027025|PILER-CR 9377-9404 28 NZ_CP030264 Ensifer adhaerens strain Corn53 plasmid AB, complete sequence 128216-128243 7 0.75
CP027025_1 1.21|9438|28|CP027025|PILER-CR 9438-9465 28 NZ_CP050093 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence 19711-19738 7 0.75
CP027025_1 1.21|9438|28|CP027025|PILER-CR 9438-9465 28 NZ_CP050082 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence 20704-20731 7 0.75
CP027025_1 1.21|9438|28|CP027025|PILER-CR 9438-9465 28 NC_008384 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence 19717-19744 7 0.75
CP027025_1 1.21|9438|28|CP027025|PILER-CR 9438-9465 28 NZ_CP025014 Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence 19730-19757 7 0.75
CP027025_1 1.21|9438|28|CP027025|PILER-CR 9438-9465 28 NZ_CP049732 Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence 19658-19685 7 0.75
CP027025_1 1.21|9438|28|CP027025|PILER-CR 9438-9465 28 NZ_CP053441 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence 19555-19582 7 0.75
CP027025_1 1.21|9438|28|CP027025|PILER-CR 9438-9465 28 NZ_CP013503 Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence 16776-16803 7 0.75
CP027025_1 1.21|9438|28|CP027025|PILER-CR 9438-9465 28 NZ_CP048282 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence 19635-19662 7 0.75
CP027025_1 1.21|9438|28|CP027025|PILER-CR 9438-9465 28 NC_016624 Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence 146999-147026 7 0.75
CP027025_1 1.21|9438|28|CP027025|PILER-CR 9438-9465 28 NZ_CP013509 Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence 16776-16803 7 0.75
CP027025_1 1.21|9438|28|CP027025|PILER-CR 9438-9465 28 NZ_CP013520 Rhizobium sp. N113 plasmid pRspN113c, complete sequence 16776-16803 7 0.75
CP027025_1 1.21|9438|28|CP027025|PILER-CR 9438-9465 28 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 584733-584760 7 0.75
CP027025_1 1.21|9438|28|CP027025|PILER-CR 9438-9465 28 NZ_CP013493 Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence 16776-16803 7 0.75
CP027025_1 1.21|9438|28|CP027025|PILER-CR 9438-9465 28 NZ_CP013516 Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence 16776-16803 7 0.75
CP027025_1 1.21|9438|28|CP027025|PILER-CR 9438-9465 28 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 1632364-1632391 7 0.75
CP027025_1 1.21|9438|28|CP027025|PILER-CR 9438-9465 28 NZ_CP021082 Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence 502545-502572 7 0.75
CP027025_1 1.21|9438|28|CP027025|PILER-CR 9438-9465 28 NZ_CP053208 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence 19656-19683 7 0.75
CP027025_2 2.1|18044|32|CP027025|CRISPRCasFinder,CRT 18044-18075 32 NZ_CP031166 Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence 154986-155017 7 0.781
CP027025_2 2.1|18044|32|CP027025|CRISPRCasFinder,CRT 18044-18075 32 NZ_CP030772 Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence 181748-181779 7 0.781
CP027025_2 2.5|18288|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 18288-18319 32 NZ_LR134469 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 27, complete sequence 11903-11934 7 0.781
CP027025_2 2.6|18349|32|CP027025|CRISPRCasFinder,CRT 18349-18380 32 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 655322-655353 7 0.781
CP027025_2 2.6|18349|32|CP027025|CRISPRCasFinder,CRT 18349-18380 32 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 655331-655362 7 0.781
CP027025_2 2.6|18349|32|CP027025|CRISPRCasFinder,CRT 18349-18380 32 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 674910-674941 7 0.781
CP027025_2 2.6|18349|32|CP027025|CRISPRCasFinder,CRT 18349-18380 32 NZ_CP016453 Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence 285036-285067 7 0.781
CP027025_2 2.6|18349|32|CP027025|CRISPRCasFinder,CRT 18349-18380 32 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 721820-721851 7 0.781
CP027025_2 2.7|18353|28|CP027025|PILER-CR 18353-18380 28 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1077920-1077947 7 0.75
CP027025_2 2.7|18353|28|CP027025|PILER-CR 18353-18380 28 NZ_CP032313 Pannonibacter phragmitetus BB plasmid p.BB_1, complete sequence 297024-297051 7 0.75
CP027025_2 2.7|18353|28|CP027025|PILER-CR 18353-18380 28 NZ_CP006369 Aureimonas sp. AU20 plasmid pAU20b, complete sequence 338031-338058 7 0.75
CP027025_2 2.7|18353|28|CP027025|PILER-CR 18353-18380 28 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 572041-572068 7 0.75
CP027025_2 2.7|18353|28|CP027025|PILER-CR 18353-18380 28 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 1390900-1390927 7 0.75
CP027025_2 2.7|18353|28|CP027025|PILER-CR 18353-18380 28 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 1560349-1560376 7 0.75
CP027025_2 2.7|18353|28|CP027025|PILER-CR 18353-18380 28 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 1313799-1313826 7 0.75
CP027025_2 2.7|18353|28|CP027025|PILER-CR 18353-18380 28 NZ_CP033321 Azospirillum brasilense strain Cd plasmid p3, complete sequence 277825-277852 7 0.75
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 LT599585 Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid 177911-177942 7 0.781
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP023549 Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence 662834-662865 7 0.781
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 CP000622 Burkholderia phage phiE255, complete genome 30378-30409 7 0.781
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NC_009237 Burkholderia phage phiE255 chromosome, complete genome 30378-30409 7 0.781
CP027025_3 3.10|19158|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19158-19189 32 NZ_CP054615 Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence 130702-130733 7 0.781
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NC_018452 Burkholderia phage DC1, complete genome 44469-44500 7 0.781
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 AB981169 Ralstonia phage RSY1 DNA, complete genome 21981-22012 7 0.781
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NZ_CP020909 Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence 384206-384237 7 0.781
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NC_021908 Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence 390212-390243 7 0.781
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NZ_CP029830 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence 48223-48254 7 0.781
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 165822-165853 7 0.781
CP027025_3 3.12|19280|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19280-19311 32 NZ_LR134465 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence 17838-17869 7 0.781
CP027025_3 3.13|19341|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19341-19372 32 MK059749 Mycobacterium phage CRB2, complete genome 20613-20644 7 0.781
CP027025_3 3.16|19524|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19524-19555 32 NZ_CP035512 Haematobacter massiliensis strain OT1 plasmid pOT1-2, complete sequence 32201-32232 7 0.781
CP027025_3 3.17|19585|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19585-19616 32 NC_029046 Sinorhizobium phage phiLM21, complete genome 23137-23168 7 0.781
CP027025_3 3.18|19646|33|CP027025|CRISPRCasFinder,CRT,PILER-CR 19646-19678 33 NZ_CP013256 Kocuria flava strain HO-9041 plasmid 2, complete sequence 7939-7971 7 0.788
CP027025_3 3.18|19646|33|CP027025|CRISPRCasFinder,CRT,PILER-CR 19646-19678 33 NZ_CP024583 Roseomonas sp. FDAARGOS_362 plasmid unnamed2, complete sequence 129593-129625 7 0.788
CP027025_3 3.20|19769|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19769-19800 32 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 195999-196030 7 0.781
CP027025_3 3.20|19769|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19769-19800 32 NZ_CP015216 Rhodobacter sphaeroides strain MBTLJ-13 plasmid e, complete sequence 1212-1243 7 0.781
CP027025_3 3.20|19769|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19769-19800 32 NZ_CP034650 Xanthomonas vasicola strain NCPPB 1060 plasmid pXVH29, complete sequence 9719-9750 7 0.781
CP027025_3 3.20|19769|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19769-19800 32 NZ_CP034652 Xanthomonas vasicola strain NCPPB 1060 plasmid pXVH14, complete sequence 13865-13896 7 0.781
CP027025_4 4.2|28389|31|CP027025|CRT 28389-28419 31 NZ_CP020540 Sphingobium herbicidovorans strain MH plasmid pSHV1, complete sequence 217096-217126 7 0.774
CP027025_4 4.2|28389|31|CP027025|CRT 28389-28419 31 NC_008741 Desulfovibrio vulgaris DP4 plasmid pDVUL01, complete sequence 104045-104075 7 0.774
CP027025_4 4.3|28449|32|CP027025|CRT 28449-28480 32 NZ_CP032697 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525a, complete sequence 269348-269379 7 0.781
CP027025_5 5.2|28695|32|CP027025|CRISPRCasFinder 28695-28726 32 NZ_CP018231 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed3 321383-321414 7 0.781
CP027025_5 5.2|28695|32|CP027025|CRISPRCasFinder 28695-28726 32 NZ_HG938354 Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence 1578743-1578774 7 0.781
CP027025_5 5.2|28695|32|CP027025|CRISPRCasFinder 28695-28726 32 NZ_CP016292 Rhizobium leguminosarum strain Vaf10 plasmid unnamed4, complete sequence 58815-58846 7 0.781
CP027025_5 5.2|28695|32|CP027025|CRISPRCasFinder 28695-28726 32 NZ_CP014598 Yangia sp. CCB-MM3 plasmid unnamed2, complete sequence 86046-86077 7 0.781
CP027025_5 5.2|28695|32|CP027025|CRISPRCasFinder 28695-28726 32 NZ_CP032676 Rhodococcus rhodochrous strain ATCC BAA870 plasmid pNit, complete sequence 141775-141806 7 0.781
CP027025_5 5.4|28817|32|CP027025|CRISPRCasFinder 28817-28848 32 MK112543 Mycobacterium Phage Kalb97, complete genome 23711-23742 7 0.781
CP027025_5 5.4|28817|32|CP027025|CRISPRCasFinder 28817-28848 32 MK967399 Mycobacterium phage Groupthink, complete genome 23712-23743 7 0.781
CP027025_5 5.4|28817|32|CP027025|CRISPRCasFinder 28817-28848 32 MK310140 Mycobacterium phage Gemma, complete genome 23708-23739 7 0.781
CP027025_5 5.4|28817|32|CP027025|CRISPRCasFinder 28817-28848 32 KY965063 Mycobacterium phage PurpleHaze, complete genome 23711-23742 7 0.781
CP027025_5 5.4|28817|32|CP027025|CRISPRCasFinder 28817-28848 32 MT657331 Mycobacterium phage Manu, complete genome 23712-23743 7 0.781
CP027025_5 5.4|28817|32|CP027025|CRISPRCasFinder 28817-28848 32 MK494128 Mycobacterium phage Heliosoles, complete genome 23712-23743 7 0.781
CP027025_5 5.4|28817|32|CP027025|CRISPRCasFinder 28817-28848 32 MH450124 Mycobacterium phage Marius, complete genome 23712-23743 7 0.781
CP027025_5 5.4|28817|32|CP027025|CRISPRCasFinder 28817-28848 32 MH450126 Mycobacterium phage PhishRPhriends, complete genome 22896-22927 7 0.781
CP027025_5 5.6|28939|32|CP027025|CRISPRCasFinder 28939-28970 32 NZ_CP049837 Gordonia terrae strain RL-JC02 plasmid pPAE01, complete sequence 2658-2689 7 0.781
CP027025_5 5.6|28939|32|CP027025|CRISPRCasFinder 28939-28970 32 NZ_CP043961 Streptomyces tendae strain 139 plasmid unnamed2, complete sequence 18741-18772 7 0.781
CP027025_5 5.9|29122|32|CP027025|CRISPRCasFinder 29122-29153 32 NC_019957 Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence 301137-301168 7 0.781
CP027025_5 5.13|29395|32|CP027025|CRISPRCasFinder 29395-29426 32 LT599585 Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid 177911-177942 7 0.781
CP027025_6 6.5|30694|32|CP027025|CRISPRCasFinder,CRT 30694-30725 32 NZ_CP018096 Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence 451821-451852 7 0.781
CP027025_7 7.1|30879|32|CP027025|CRISPRCasFinder,CRT 30879-30910 32 NZ_HG938356 Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence 1161532-1161563 7 0.781
CP027025_7 7.2|30940|32|CP027025|CRISPRCasFinder,CRT 30940-30971 32 NZ_LR134450 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence 86491-86522 7 0.781
CP027025_7 7.2|30940|32|CP027025|CRISPRCasFinder,CRT 30940-30971 32 NZ_CP022420 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-5, complete sequence 33517-33548 7 0.781
CP027025_7 7.2|30940|32|CP027025|CRISPRCasFinder,CRT 30940-30971 32 NZ_CP031599 Roseovarius indicus strain DSM 26383 plasmid pRIdsm_01, complete sequence 441451-441482 7 0.781
CP027025_7 7.2|30940|32|CP027025|CRISPRCasFinder,CRT 30940-30971 32 NZ_CP031600 Roseovarius indicus strain DSM 26383 plasmid pRIdsm_02, complete sequence 116443-116474 7 0.781
CP027025_7 7.2|30940|32|CP027025|CRISPRCasFinder,CRT 30940-30971 32 NZ_CP031601 Roseovarius indicus strain DSM 26383 plasmid pRIdsm_03, complete sequence 136424-136455 7 0.781
CP027025_7 7.3|31001|32|CP027025|CRISPRCasFinder,CRT 31001-31032 32 NZ_CP023712 Rhodococcus ruber strain YC-YT1 plasmid unnamed1, complete sequence 31790-31821 7 0.781
CP027025_7 7.6|31184|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 31184-31215 32 NZ_CP006993 Methylobacterium sp. AMS5 plasmid pAMS5a, complete sequence 108546-108577 7 0.781
CP027025_1 1.1|8886|32|CP027025|CRT 8886-8917 32 NZ_CP013744 Streptomyces sp. CdTB01 plasmid unnamed, complete sequence 245177-245208 8 0.75
CP027025_1 1.1|8886|32|CP027025|CRT 8886-8917 32 MT723933 Streptomyces phage Keanu, complete genome 42252-42283 8 0.75
CP027025_1 1.1|8886|32|CP027025|CRT 8886-8917 32 MK411746 Arthrobacter phage Sonali, complete genome 45307-45338 8 0.75
CP027025_1 1.3|9008|32|CP027025|CRT 9008-9039 32 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 461070-461101 8 0.75
CP027025_1 1.5|9130|32|CP027025|CRT 9130-9161 32 NZ_CP045377 Sulfitobacter sp. THAF37 plasmid pTHAF37_e, complete sequence 18025-18056 8 0.75
CP027025_1 1.8|9314|32|CP027025|CRT 9314-9345 32 MN871455 UNVERIFIED: Pseudomonas phage Pa-B, complete genome 4170-4201 8 0.75
CP027025_1 1.9|9375|32|CP027025|CRT 9375-9406 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3223442-3223473 8 0.75
CP027025_1 1.9|9375|32|CP027025|CRT 9375-9406 32 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 914529-914560 8 0.75
CP027025_1 1.9|9375|32|CP027025|CRT 9375-9406 32 NZ_CP006991 Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence 655360-655391 8 0.75
CP027025_1 1.9|9375|32|CP027025|CRT 9375-9406 32 NC_007764 Rhizobium etli CFN 42 plasmid p42c, complete sequence 174257-174288 8 0.75
CP027025_1 1.9|9375|32|CP027025|CRT 9375-9406 32 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 203368-203399 8 0.75
CP027025_1 1.9|9375|32|CP027025|CRT 9375-9406 32 NZ_CP013524 Rhizobium phaseoli strain R744 plasmid pRphaR744b, complete sequence 262634-262665 8 0.75
CP027025_1 1.9|9375|32|CP027025|CRT 9375-9406 32 NZ_CP020908 Rhizobium etli strain NXC12 plasmid pRetNXC12b, complete sequence 187140-187171 8 0.75
CP027025_1 1.9|9375|32|CP027025|CRT 9375-9406 32 NC_021907 Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1b, complete sequence 189665-189696 8 0.75
CP027025_1 1.9|9375|32|CP027025|CRT 9375-9406 32 NZ_CP021128 Rhizobium sp. Kim5 plasmid pRetKim5d, complete sequence 605386-605417 8 0.75
CP027025_1 1.9|9375|32|CP027025|CRT 9375-9406 32 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 2252567-2252598 8 0.75
CP027025_1 1.9|9375|32|CP027025|CRT 9375-9406 32 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 516289-516320 8 0.75
CP027025_1 1.9|9375|32|CP027025|CRT 9375-9406 32 CP007645 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803d, complete sequence 663802-663833 8 0.75
CP027025_1 1.9|9375|32|CP027025|CRT 9375-9406 32 NZ_CP016560 Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence 173545-173576 8 0.75
CP027025_1 1.9|9375|32|CP027025|CRT 9375-9406 32 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 29887-29918 8 0.75
CP027025_1 1.9|9375|32|CP027025|CRT 9375-9406 32 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 2186263-2186294 8 0.75
CP027025_1 1.9|9375|32|CP027025|CRT 9375-9406 32 KY006853 Erythrobacter phage vB_EliS_R6L, complete genome 46274-46305 8 0.75
CP027025_1 1.9|9375|32|CP027025|CRT 9375-9406 32 NZ_LR134461 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 19, complete sequence 79852-79883 8 0.75
CP027025_1 1.9|9375|32|CP027025|CRT 9375-9406 32 NC_008537 Arthrobacter sp. FB24 plasmid 1, complete sequence 109297-109328 8 0.75
CP027025_1 1.10|9436|32|CP027025|CRT 9436-9467 32 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 1265815-1265846 8 0.75
CP027025_1 1.10|9436|32|CP027025|CRT 9436-9467 32 NZ_CP023068 Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence 601639-601670 8 0.75
CP027025_1 1.10|9436|32|CP027025|CRT 9436-9467 32 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 592226-592257 8 0.75
CP027025_1 1.10|9436|32|CP027025|CRT 9436-9467 32 NZ_CP021028 Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence 16794-16825 8 0.75
CP027025_1 1.12|9008|31|CP027025|CRISPRCasFinder 9008-9038 31 NZ_CP045548 Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence 135534-135564 8 0.742
CP027025_1 1.14|9130|31|CP027025|CRISPRCasFinder 9130-9160 31 NC_049478 Arthrobacter phage Mufasa8, complete genome 39671-39701 8 0.742
CP027025_1 1.17|9314|31|CP027025|CRISPRCasFinder 9314-9344 31 MN871455 UNVERIFIED: Pseudomonas phage Pa-B, complete genome 4170-4200 8 0.742
CP027025_1 1.18|9375|31|CP027025|CRISPRCasFinder 9375-9405 31 NZ_LR134465 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence 401817-401847 8 0.742
CP027025_1 1.18|9375|31|CP027025|CRISPRCasFinder 9375-9405 31 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 930437-930467 8 0.742
CP027025_1 1.18|9375|31|CP027025|CRISPRCasFinder 9375-9405 31 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 1935478-1935508 8 0.742
CP027025_1 1.18|9375|31|CP027025|CRISPRCasFinder 9375-9405 31 NZ_CP013345 Sphingopyxis macrogoltabida strain 203N plasmid unnamed1, complete sequence 44488-44518 8 0.742
CP027025_1 1.18|9375|31|CP027025|CRISPRCasFinder 9375-9405 31 NC_011368 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence 174397-174427 8 0.742
CP027025_1 1.18|9375|31|CP027025|CRISPRCasFinder 9375-9405 31 NZ_CP032325 Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence 259832-259862 8 0.742
CP027025_1 1.18|9375|31|CP027025|CRISPRCasFinder 9375-9405 31 NZ_CP027299 Streptomyces sp. SGAir0924 plasmid unnamed_5 120954-120984 8 0.742
CP027025_1 1.18|9375|31|CP027025|CRISPRCasFinder 9375-9405 31 NZ_AP019802 Thermus thermophilus strain HC11 plasmid pHC11, complete sequence 146788-146818 8 0.742
CP027025_1 1.18|9375|31|CP027025|CRISPRCasFinder 9375-9405 31 NZ_CP024310 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence 478111-478141 8 0.742
CP027025_1 1.18|9375|31|CP027025|CRISPRCasFinder 9375-9405 31 NZ_CP024312 Rhizobium sp. NXC24 plasmid pRspNXC24a, complete sequence 113447-113477 8 0.742
CP027025_1 1.18|9375|31|CP027025|CRISPRCasFinder 9375-9405 31 NZ_CP045548 Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence 142764-142794 8 0.742
CP027025_1 1.19|9436|31|CP027025|CRISPRCasFinder 9436-9466 31 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 1265816-1265846 8 0.742
CP027025_1 1.19|9436|31|CP027025|CRISPRCasFinder 9436-9466 31 NZ_CP023068 Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence 601640-601670 8 0.742
CP027025_1 1.19|9436|31|CP027025|CRISPRCasFinder 9436-9466 31 NZ_CP021028 Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence 16795-16825 8 0.742
CP027025_1 1.20|9377|28|CP027025|PILER-CR 9377-9404 28 NC_047905 Streptomyces phage Attoomi, complete genome 26395-26422 8 0.714
CP027025_2 2.2|18105|32|CP027025|CRISPRCasFinder,CRT 18105-18136 32 NC_024994 Gluconacetobacter europaeus plasmid pGE2 genomic DNA, complete sequence, strain: KGMA0119 4246-4277 8 0.75
CP027025_2 2.3|18166|32|CP027025|CRISPRCasFinder,CRT 18166-18197 32 NZ_KY494864 Pseudomonas aeruginosa strain FFUP_PS_37 plasmid pJB37, complete sequence 285500-285531 8 0.75
CP027025_2 2.3|18166|32|CP027025|CRISPRCasFinder,CRT 18166-18197 32 NZ_CP034911 Ensifer alkalisoli strain YIC4027 plasmid unnamed, complete sequence 292585-292616 8 0.75
CP027025_2 2.3|18166|32|CP027025|CRISPRCasFinder,CRT 18166-18197 32 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 530161-530192 8 0.75
CP027025_2 2.3|18166|32|CP027025|CRISPRCasFinder,CRT 18166-18197 32 NZ_CP039991 Pseudomonas aeruginosa strain T2101 plasmid pBT2101, complete sequence 392197-392228 8 0.75
CP027025_2 2.3|18166|32|CP027025|CRISPRCasFinder,CRT 18166-18197 32 NZ_MN433457 Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence 4601-4632 8 0.75
CP027025_2 2.3|18166|32|CP027025|CRISPRCasFinder,CRT 18166-18197 32 NZ_CP029096 Pseudomonas aeruginosa strain AR439 plasmid unnamed2, complete sequence 403968-403999 8 0.75
CP027025_2 2.3|18166|32|CP027025|CRISPRCasFinder,CRT 18166-18197 32 NZ_CP045003 Pseudomonas aeruginosa strain PAG5 plasmid pPAG5, complete sequence 269081-269112 8 0.75
CP027025_2 2.3|18166|32|CP027025|CRISPRCasFinder,CRT 18166-18197 32 MF344569 Pseudomonas aeruginosa plasmid p12939-PER, complete sequence 446379-446410 8 0.75
CP027025_2 2.3|18166|32|CP027025|CRISPRCasFinder,CRT 18166-18197 32 MF344570 Pseudomonas aeruginosa plasmid pA681-IMP, complete sequence 385152-385183 8 0.75
CP027025_2 2.3|18166|32|CP027025|CRISPRCasFinder,CRT 18166-18197 32 CP027478 Pseudomonas koreensis strain P19E3 plasmid p1, complete sequence 28591-28622 8 0.75
CP027025_2 2.3|18166|32|CP027025|CRISPRCasFinder,CRT 18166-18197 32 NZ_CP040126 Pseudomonas aeruginosa strain PA298 plasmid pBM908, complete sequence 282983-283014 8 0.75
CP027025_2 2.3|18166|32|CP027025|CRISPRCasFinder,CRT 18166-18197 32 NZ_CP015879 Pseudomonas citronellolis strain SJTE-3 plasmid pRBL16, complete sequence 255916-255947 8 0.75
CP027025_2 2.3|18166|32|CP027025|CRISPRCasFinder,CRT 18166-18197 32 NZ_CP016215 Pseudomonas aeruginosa strain PA121617 plasmid pBM413, complete sequence 358319-358350 8 0.75
CP027025_2 2.3|18166|32|CP027025|CRISPRCasFinder,CRT 18166-18197 32 NZ_KY883660 Pseudomonas putida strain SY153 plasmid pSY153-MDR, complete sequence 414758-414789 8 0.75
CP027025_2 2.5|18288|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 18288-18319 32 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 62456-62487 8 0.75
CP027025_2 2.6|18349|32|CP027025|CRISPRCasFinder,CRT 18349-18380 32 MN369748 Mycobacterium phage Miko, complete genome 43661-43692 8 0.75
CP027025_2 2.6|18349|32|CP027025|CRISPRCasFinder,CRT 18349-18380 32 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 639630-639661 8 0.75
CP027025_2 2.6|18349|32|CP027025|CRISPRCasFinder,CRT 18349-18380 32 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 1877297-1877328 8 0.75
CP027025_2 2.6|18349|32|CP027025|CRISPRCasFinder,CRT 18349-18380 32 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 655341-655372 8 0.75
CP027025_2 2.6|18349|32|CP027025|CRISPRCasFinder,CRT 18349-18380 32 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 525691-525722 8 0.75
CP027025_2 2.6|18349|32|CP027025|CRISPRCasFinder,CRT 18349-18380 32 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 297572-297603 8 0.75
CP027025_2 2.6|18349|32|CP027025|CRISPRCasFinder,CRT 18349-18380 32 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 639480-639511 8 0.75
CP027025_2 2.6|18349|32|CP027025|CRISPRCasFinder,CRT 18349-18380 32 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 639458-639489 8 0.75
CP027025_2 2.6|18349|32|CP027025|CRISPRCasFinder,CRT 18349-18380 32 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 519595-519626 8 0.75
CP027025_2 2.6|18349|32|CP027025|CRISPRCasFinder,CRT 18349-18380 32 NZ_CP022081 Burkholderia cepacia strain FDAARGOS_345 plasmid unnamed1, complete sequence 105853-105884 8 0.75
CP027025_2 2.6|18349|32|CP027025|CRISPRCasFinder,CRT 18349-18380 32 NZ_CP022081 Burkholderia cepacia strain FDAARGOS_345 plasmid unnamed1, complete sequence 196988-197019 8 0.75
CP027025_2 2.6|18349|32|CP027025|CRISPRCasFinder,CRT 18349-18380 32 NZ_CP054606 Sulfitobacter pseudonitzschiae strain H46 plasmid unnamed7, complete sequence 91260-91291 8 0.75
CP027025_2 2.6|18349|32|CP027025|CRISPRCasFinder,CRT 18349-18380 32 NZ_CP023519 Burkholderia cepacia strain FDAARGOS_388 plasmid unnamed1, complete sequence 15161-15192 8 0.75
CP027025_2 2.6|18349|32|CP027025|CRISPRCasFinder,CRT 18349-18380 32 NZ_CP023519 Burkholderia cepacia strain FDAARGOS_388 plasmid unnamed1, complete sequence 128192-128223 8 0.75
CP027025_2 2.6|18349|32|CP027025|CRISPRCasFinder,CRT 18349-18380 32 NZ_CP032313 Pannonibacter phragmitetus BB plasmid p.BB_1, complete sequence 297024-297055 8 0.75
CP027025_2 2.6|18349|32|CP027025|CRISPRCasFinder,CRT 18349-18380 32 NZ_CP007745 Burkholderia cepacia ATCC 25416 plasmid unnamed, complete sequence 40118-40149 8 0.75
CP027025_2 2.6|18349|32|CP027025|CRISPRCasFinder,CRT 18349-18380 32 NZ_CP007745 Burkholderia cepacia ATCC 25416 plasmid unnamed, complete sequence 152106-152137 8 0.75
CP027025_2 2.6|18349|32|CP027025|CRISPRCasFinder,CRT 18349-18380 32 NZ_CP012984 Burkholderia cepacia ATCC 25416 strain UCB 717 plasmid pBC25416 52689-52720 8 0.75
CP027025_2 2.6|18349|32|CP027025|CRISPRCasFinder,CRT 18349-18380 32 NZ_CP012984 Burkholderia cepacia ATCC 25416 strain UCB 717 plasmid pBC25416 143824-143855 8 0.75
CP027025_2 2.6|18349|32|CP027025|CRISPRCasFinder,CRT 18349-18380 32 NZ_CP020372 Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence 421668-421699 8 0.75
CP027025_2 2.6|18349|32|CP027025|CRISPRCasFinder,CRT 18349-18380 32 NZ_CP020331 Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence 424133-424164 8 0.75
CP027025_2 2.6|18349|32|CP027025|CRISPRCasFinder,CRT 18349-18380 32 NZ_CP034556 Burkholderia cepacia ATCC 25416 plasmid unnamed1, complete sequence 42834-42865 8 0.75
CP027025_2 2.6|18349|32|CP027025|CRISPRCasFinder,CRT 18349-18380 32 NZ_CP034556 Burkholderia cepacia ATCC 25416 plasmid unnamed1, complete sequence 155869-155900 8 0.75
CP027025_2 2.7|18353|28|CP027025|PILER-CR 18353-18380 28 NC_048047 Caulobacter phage CcrBL9, complete genome 125704-125731 8 0.714
CP027025_3 3.1|18592|32|CP027025|CRISPRCasFinder,CRT 18592-18623 32 MG707188 Pseudomonas phage TC7, partial genome 19993-20024 8 0.75
CP027025_3 3.1|18592|32|CP027025|CRISPRCasFinder,CRT 18592-18623 32 NC_031091 Pseudomonas phage MD8, complete genome 32480-32511 8 0.75
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP019603 Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence 446851-446882 8 0.75
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 844355-844386 8 0.75
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 686013-686044 8 0.75
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_LR134453 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 11, complete sequence 16564-16595 8 0.75
CP027025_3 3.10|19158|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19158-19189 32 NZ_CP053441 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence 274790-274821 8 0.75
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1083139-1083170 8 0.75
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 988929-988960 8 0.75
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1052912-1052943 8 0.75
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 988026-988057 8 0.75
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 988921-988952 8 0.75
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 988277-988308 8 0.75
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 988912-988943 8 0.75
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1083238-1083269 8 0.75
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1083233-1083264 8 0.75
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1083217-1083248 8 0.75
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 393078-393109 8 0.75
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 931784-931815 8 0.75
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 JX100810 Caulobacter phage CcrColossus, complete genome 44676-44707 8 0.75
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NZ_CP041045 Paracoccus sp. AK26 plasmid pAK1, complete sequence 440569-440600 8 0.75
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NZ_CP049158 Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence 1359560-1359591 8 0.75
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NZ_CP049318 Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence 1364228-1364259 8 0.75
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NZ_CP021027 Rhizobium sp. TAL182 plasmid pRetTAL182c, complete sequence 429863-429894 8 0.75
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NZ_CP013555 Rhizobium phaseoli strain N931 plasmid pRphaN931c, complete sequence 442447-442478 8 0.75
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NZ_CP013561 Rhizobium phaseoli strain N841 plasmid pRphaN841d, complete sequence 422118-422149 8 0.75
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NZ_CP013578 Rhizobium phaseoli strain N671 plasmid pRphaN671d, complete sequence 448549-448580 8 0.75
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NZ_CP013530 Rhizobium phaseoli strain R723 plasmid pRphaR723c, complete sequence 418201-418232 8 0.75
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NZ_CP013535 Rhizobium phaseoli strain R650 plasmid pRphaR650c, complete sequence 423913-423944 8 0.75
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NZ_CP013540 Rhizobium phaseoli strain R630 plasmid pRphaR630c, complete sequence 431219-431250 8 0.75
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NZ_CP013566 Rhizobium phaseoli strain N831 plasmid pRphaN831c, complete sequence 442160-442191 8 0.75
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NZ_CP013583 Rhizobium phaseoli strain N261 plasmid pRphaN261c, complete sequence 418201-418232 8 0.75
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NZ_CP013572 Rhizobium phaseoli strain N771 plasmid pRphaN671d, complete sequence 448549-448580 8 0.75
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NZ_CP021125 Rhizobium sp. Kim5 plasmid pRetKim5a, complete sequence 420798-420829 8 0.75
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NZ_CP013514 Rhizobium sp. N1314 plasmid pRspN1314c, complete sequence 422126-422157 8 0.75
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NZ_CP031954 Phaeobacter inhibens strain 2.10 plasmid unnamed2, complete sequence 36801-36832 8 0.75
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NC_018423 Phaeobacter inhibens 2.10 plasmid pPGA2_95, complete sequence 36687-36718 8 0.75
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NZ_CP013604 Rhizobium sp. N731 plasmid pRspN731c, complete sequence 422128-422159 8 0.75
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NZ_CP017243 Rhizobium etli 8C-3 plasmid pRsp8C3b, complete sequence 427288-427319 8 0.75
CP027025_3 3.12|19280|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19280-19311 32 NZ_CP017077 Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence 174657-174688 8 0.75
CP027025_3 3.12|19280|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19280-19311 32 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 217575-217606 8 0.75
CP027025_3 3.12|19280|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19280-19311 32 KC252997 Halovirus PH1, complete genome 16374-16405 8 0.75
CP027025_3 3.16|19524|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19524-19555 32 NZ_CP033036 Agrobacterium fabrum strain 12D13 plasmid pAt12D13a, complete sequence 178970-179001 8 0.75
CP027025_3 3.16|19524|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19524-19555 32 NC_009621 Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence 368568-368599 8 0.75
CP027025_3 3.20|19769|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19769-19800 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 133908-133939 8 0.75
CP027025_3 3.20|19769|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19769-19800 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1679209-1679240 8 0.75
CP027025_3 3.20|19769|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19769-19800 32 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 610918-610949 8 0.75
CP027025_4 4.2|28389|31|CP027025|CRT 28389-28419 31 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 558880-558910 8 0.742
CP027025_4 4.3|28449|32|CP027025|CRT 28449-28480 32 NZ_CP030197 Salmonella enterica strain SA20051401 plasmid pSA20051401.1, complete sequence 111526-111557 8 0.75
CP027025_4 4.3|28449|32|CP027025|CRT 28449-28480 32 NZ_CP024864 Escherichia coli strain AR_0015 plasmid unitig_2_pilon, complete sequence 72294-72325 8 0.75
CP027025_4 4.3|28449|32|CP027025|CRT 28449-28480 32 NZ_CP030177 Salmonella enterica subsp. enterica serovar Milwaukee str. SA19950795 plasmid pIncFII.2, complete sequence 101359-101390 8 0.75
CP027025_4 4.3|28449|32|CP027025|CRT 28449-28480 32 NC_011413 Escherichia coli SE11 plasmid pSE11-2, complete sequence 46788-46819 8 0.75
CP027025_4 4.3|28449|32|CP027025|CRT 28449-28480 32 NZ_CP030785 Escherichia albertii strain 2012EL-1823B plasmid unnamed2, complete sequence 34209-34240 8 0.75
CP027025_4 4.3|28449|32|CP027025|CRT 28449-28480 32 CP054565 Escherichia coli strain SCU-478 isolate rectal swab from healthy college student plasmid pSCU-478-1, complete sequence 77508-77539 8 0.75
CP027025_4 4.3|28449|32|CP027025|CRT 28449-28480 32 NZ_CP032813 Escherichia coli strain ERL03-1416 plasmid pERL03-1416-2, complete sequence 32293-32324 8 0.75
CP027025_4 4.3|28449|32|CP027025|CRT 28449-28480 32 NZ_CP010201 Escherichia coli strain M10 plasmid A, complete sequence 17666-17697 8 0.75
CP027025_5 5.2|28695|32|CP027025|CRISPRCasFinder 28695-28726 32 MN234228 Mycobacterium phage Tourach, complete genome 77843-77874 8 0.75
CP027025_5 5.2|28695|32|CP027025|CRISPRCasFinder 28695-28726 32 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 621297-621328 8 0.75
CP027025_5 5.3|28756|32|CP027025|CRISPRCasFinder 28756-28787 32 NZ_CP024425 Paracoccus yeei strain TT13 plasmid pTT13-3, complete sequence 127415-127446 8 0.75
CP027025_5 5.3|28756|32|CP027025|CRISPRCasFinder 28756-28787 32 NZ_CP022992 Paraburkholderia aromaticivorans strain BN5 plasmid pBN2, complete sequence 164295-164326 8 0.75
CP027025_5 5.3|28756|32|CP027025|CRISPRCasFinder 28756-28787 32 NZ_CP029777 Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed3, complete sequence 356089-356120 8 0.75
CP027025_5 5.3|28756|32|CP027025|CRISPRCasFinder 28756-28787 32 NZ_CP046255 Sphingobium sp. CAP-1 plasmid p2, complete sequence 3274-3305 8 0.75
CP027025_5 5.3|28756|32|CP027025|CRISPRCasFinder 28756-28787 32 NZ_CP046255 Sphingobium sp. CAP-1 plasmid p2, complete sequence 13692-13723 8 0.75
CP027025_5 5.3|28756|32|CP027025|CRISPRCasFinder 28756-28787 32 NZ_CP009431 Sphingopyxis macrogoltabida strain 203 plasmid unnamed, complete sequence 124151-124182 8 0.75
CP027025_5 5.4|28817|32|CP027025|CRISPRCasFinder 28817-28848 32 MK450421 Streptomyces phage Vash, complete genome 37865-37896 8 0.75
CP027025_5 5.5|28878|32|CP027025|CRISPRCasFinder 28878-28909 32 NZ_LR134461 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 19, complete sequence 119230-119261 8 0.75
CP027025_5 5.5|28878|32|CP027025|CRISPRCasFinder 28878-28909 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2639374-2639405 8 0.75
CP027025_5 5.5|28878|32|CP027025|CRISPRCasFinder 28878-28909 32 NZ_CP016619 Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence 191578-191609 8 0.75
CP027025_5 5.8|29061|32|CP027025|CRISPRCasFinder 29061-29092 32 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 389349-389380 8 0.75
CP027025_5 5.9|29122|32|CP027025|CRISPRCasFinder 29122-29153 32 NZ_CP015882 Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence 1089641-1089672 8 0.75
CP027025_5 5.9|29122|32|CP027025|CRISPRCasFinder 29122-29153 32 NZ_CP030264 Ensifer adhaerens strain Corn53 plasmid AB, complete sequence 1373083-1373114 8 0.75
CP027025_5 5.13|29395|32|CP027025|CRISPRCasFinder 29395-29426 32 NZ_CP019603 Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence 446851-446882 8 0.75
CP027025_5 5.13|29395|32|CP027025|CRISPRCasFinder 29395-29426 32 NZ_CP021409 Celeribacter manganoxidans strain DY25 plasmid pDY25-E, complete sequence 3267-3298 8 0.75
CP027025_5 5.13|29395|32|CP027025|CRISPRCasFinder 29395-29426 32 NZ_CP029835 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence 175512-175543 8 0.75
CP027025_5 5.13|29395|32|CP027025|CRISPRCasFinder 29395-29426 32 NZ_CP015043 Rhodovulum sp. P5 plasmid pRGUI04, complete sequence 57531-57562 8 0.75
CP027025_5 5.13|29395|32|CP027025|CRISPRCasFinder 29395-29426 32 CP000622 Burkholderia phage phiE255, complete genome 30378-30409 8 0.75
CP027025_5 5.13|29395|32|CP027025|CRISPRCasFinder 29395-29426 32 NC_009237 Burkholderia phage phiE255 chromosome, complete genome 30378-30409 8 0.75
CP027025_5 5.14|29456|32|CP027025|CRISPRCasFinder 29456-29487 32 MN693615 Marine virus AFVG_250M1187, complete genome 27727-27758 8 0.75
CP027025_5 5.14|29456|32|CP027025|CRISPRCasFinder 29456-29487 32 MN694069 Marine virus AFVG_250M891, complete genome 12586-12617 8 0.75
CP027025_5 5.14|29456|32|CP027025|CRISPRCasFinder 29456-29487 32 MN694089 Marine virus AFVG_250M217, complete genome 29037-29068 8 0.75
CP027025_5 5.14|29456|32|CP027025|CRISPRCasFinder 29456-29487 32 MN694653 Marine virus AFVG_250M216, complete genome 29507-29538 8 0.75
CP027025_6 6.1|30573|31|CP027025|PILER-CR 30573-30603 31 NZ_CP033726 Clavibacter michiganensis subsp. michiganensis strain UF1 plasmid pCM2U-F1, complete sequence 70824-70854 8 0.742
CP027025_6 6.1|30573|31|CP027025|PILER-CR 30573-30603 31 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1779396-1779426 8 0.742
CP027025_6 6.1|30573|31|CP027025|PILER-CR 30573-30603 31 NZ_CP029836 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed6, complete sequence 79412-79442 8 0.742
CP027025_6 6.1|30573|31|CP027025|PILER-CR 30573-30603 31 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 33866-33896 8 0.742
CP027025_6 6.2|30634|31|CP027025|PILER-CR 30634-30664 31 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 937725-937755 8 0.742
CP027025_6 6.2|30634|31|CP027025|PILER-CR 30634-30664 31 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 715959-715989 8 0.742
CP027025_6 6.2|30634|31|CP027025|PILER-CR 30634-30664 31 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 168907-168937 8 0.742
CP027025_6 6.2|30634|31|CP027025|PILER-CR 30634-30664 31 NZ_CP032341 Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence 142589-142619 8 0.742
CP027025_6 6.2|30634|31|CP027025|PILER-CR 30634-30664 31 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 179289-179319 8 0.742
CP027025_6 6.2|30634|31|CP027025|PILER-CR 30634-30664 31 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 97452-97482 8 0.742
CP027025_6 6.2|30634|31|CP027025|PILER-CR 30634-30664 31 NZ_CP042998 Aquisphaera giovannonii strain OJF2 plasmid pOJF2_1, complete sequence 3448-3478 8 0.742
CP027025_6 6.3|30572|32|CP027025|CRISPRCasFinder,CRT 30572-30603 32 NZ_CP033726 Clavibacter michiganensis subsp. michiganensis strain UF1 plasmid pCM2U-F1, complete sequence 70823-70854 8 0.75
CP027025_6 6.5|30694|32|CP027025|CRISPRCasFinder,CRT 30694-30725 32 NZ_CP021374 Rhizobium sp. ACO-34A plasmid pRACO34Ab, complete sequence 207582-207613 8 0.75
CP027025_6 6.5|30694|32|CP027025|CRISPRCasFinder,CRT 30694-30725 32 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 595623-595654 8 0.75
CP027025_6 6.5|30694|32|CP027025|CRISPRCasFinder,CRT 30694-30725 32 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 595661-595692 8 0.75
CP027025_6 6.5|30694|32|CP027025|CRISPRCasFinder,CRT 30694-30725 32 MH047631 Microbacterium phage Triscuit, complete genome 27273-27304 8 0.75
CP027025_7 7.1|30879|32|CP027025|CRISPRCasFinder,CRT 30879-30910 32 LN997844 Streptomyces reticuli genome assembly TUE45, plasmid : III 16729-16760 8 0.75
CP027025_7 7.2|30940|32|CP027025|CRISPRCasFinder,CRT 30940-30971 32 NZ_CP048398 Streptomyces sp. S4.7 plasmid pSSPS4.7a, complete sequence 1230-1261 8 0.75
CP027025_7 7.2|30940|32|CP027025|CRISPRCasFinder,CRT 30940-30971 32 NZ_CP021355 Rhodococcus sp. S2-17 plasmid pRB98, complete sequence 724231-724262 8 0.75
CP027025_7 7.3|31001|32|CP027025|CRISPRCasFinder,CRT 31001-31032 32 NZ_CP006990 Rhizobium sp. IE4771 plasmid pRetIE4771d, complete sequence 344206-344237 8 0.75
CP027025_7 7.3|31001|32|CP027025|CRISPRCasFinder,CRT 31001-31032 32 CP007644 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence 343316-343347 8 0.75
CP027025_7 7.3|31001|32|CP027025|CRISPRCasFinder,CRT 31001-31032 32 NZ_CP027239 Dietzia sp. oral taxon 368 strain W5195 plasmid unnamed1, complete sequence 110594-110625 8 0.75
CP027025_7 7.3|31001|32|CP027025|CRISPRCasFinder,CRT 31001-31032 32 NC_011962 Rhodobacter sphaeroides KD131 plasmid pRSKD131A, complete sequence 151110-151141 8 0.75
CP027025_7 7.5|31123|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 31123-31154 32 NZ_CP045412 Roseovarius sp. THAF8 plasmid pTHAF8_b, complete sequence 2910-2941 8 0.75
CP027025_8 8.1|31721|32|CP027025|CRISPRCasFinder 31721-31752 32 KY210139 Xanthomonas phage KPhi1, complete genome 719-750 8 0.75
CP027025_8 8.1|31721|32|CP027025|CRISPRCasFinder 31721-31752 32 MN908685 Microbacterium phage PauloDiaboli, complete genome 132984-133015 8 0.75
CP027025_8 8.1|31721|32|CP027025|CRISPRCasFinder 31721-31752 32 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 2109916-2109947 8 0.75
CP027025_1 1.1|8886|32|CP027025|CRT 8886-8917 32 NZ_CP030772 Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence 942867-942898 9 0.719
CP027025_1 1.1|8886|32|CP027025|CRT 8886-8917 32 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 916496-916527 9 0.719
CP027025_1 1.1|8886|32|CP027025|CRT 8886-8917 32 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 518256-518287 9 0.719
CP027025_1 1.1|8886|32|CP027025|CRT 8886-8917 32 NZ_CP016560 Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence 175512-175543 9 0.719
CP027025_1 1.3|9008|32|CP027025|CRT 9008-9039 32 NZ_CP045548 Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence 135533-135564 9 0.719
CP027025_1 1.3|9008|32|CP027025|CRT 9008-9039 32 NZ_CP015737 Shinella sp. HZN7 plasmid pShin-01, complete sequence 178314-178345 9 0.719
CP027025_1 1.5|9130|32|CP027025|CRT 9130-9161 32 NC_049478 Arthrobacter phage Mufasa8, complete genome 39670-39701 9 0.719
CP027025_1 1.8|9314|32|CP027025|CRT 9314-9345 32 NC_023284 Streptomyces sp. F2 plasmid pFRL4, complete sequence 57793-57824 9 0.719
CP027025_1 1.8|9314|32|CP027025|CRT 9314-9345 32 AP021850 Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome 31565-31596 9 0.719
CP027025_1 1.9|9375|32|CP027025|CRT 9375-9406 32 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 930437-930468 9 0.719
CP027025_1 1.9|9375|32|CP027025|CRT 9375-9406 32 NZ_CP013345 Sphingopyxis macrogoltabida strain 203N plasmid unnamed1, complete sequence 44487-44518 9 0.719
CP027025_1 1.9|9375|32|CP027025|CRT 9375-9406 32 NC_011368 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence 174396-174427 9 0.719
CP027025_1 1.9|9375|32|CP027025|CRT 9375-9406 32 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 1935478-1935509 9 0.719
CP027025_1 1.9|9375|32|CP027025|CRT 9375-9406 32 MN813693 Mycobacterium phage Imvubu, complete genome 22701-22732 9 0.719
CP027025_1 1.9|9375|32|CP027025|CRT 9375-9406 32 NZ_CP032325 Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence 259831-259862 9 0.719
CP027025_1 1.9|9375|32|CP027025|CRT 9375-9406 32 NZ_CP027299 Streptomyces sp. SGAir0924 plasmid unnamed_5 120954-120985 9 0.719
CP027025_1 1.9|9375|32|CP027025|CRT 9375-9406 32 NZ_AP019802 Thermus thermophilus strain HC11 plasmid pHC11, complete sequence 146787-146818 9 0.719
CP027025_1 1.9|9375|32|CP027025|CRT 9375-9406 32 NZ_CP024312 Rhizobium sp. NXC24 plasmid pRspNXC24a, complete sequence 113446-113477 9 0.719
CP027025_1 1.9|9375|32|CP027025|CRT 9375-9406 32 NZ_CP045548 Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence 142763-142794 9 0.719
CP027025_1 1.10|9436|32|CP027025|CRT 9436-9467 32 NZ_CP050093 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence 19707-19738 9 0.719
CP027025_1 1.10|9436|32|CP027025|CRT 9436-9467 32 NZ_CP050082 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence 20700-20731 9 0.719
CP027025_1 1.10|9436|32|CP027025|CRT 9436-9467 32 NC_008384 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence 19713-19744 9 0.719
CP027025_1 1.10|9436|32|CP027025|CRT 9436-9467 32 NZ_CP025014 Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence 19726-19757 9 0.719
CP027025_1 1.10|9436|32|CP027025|CRT 9436-9467 32 NZ_CP049732 Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence 19654-19685 9 0.719
CP027025_1 1.10|9436|32|CP027025|CRT 9436-9467 32 NZ_CP053441 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence 19551-19582 9 0.719
CP027025_1 1.10|9436|32|CP027025|CRT 9436-9467 32 NZ_CP013503 Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence 16772-16803 9 0.719
CP027025_1 1.10|9436|32|CP027025|CRT 9436-9467 32 NZ_CP048282 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence 19631-19662 9 0.719
CP027025_1 1.10|9436|32|CP027025|CRT 9436-9467 32 NZ_CP013509 Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence 16772-16803 9 0.719
CP027025_1 1.10|9436|32|CP027025|CRT 9436-9467 32 NZ_CP013520 Rhizobium sp. N113 plasmid pRspN113c, complete sequence 16772-16803 9 0.719
CP027025_1 1.10|9436|32|CP027025|CRT 9436-9467 32 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 584729-584760 9 0.719
CP027025_1 1.10|9436|32|CP027025|CRT 9436-9467 32 NZ_CP013493 Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence 16772-16803 9 0.719
CP027025_1 1.10|9436|32|CP027025|CRT 9436-9467 32 NZ_CP013516 Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence 16772-16803 9 0.719
CP027025_1 1.10|9436|32|CP027025|CRT 9436-9467 32 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 1632364-1632395 9 0.719
CP027025_1 1.10|9436|32|CP027025|CRT 9436-9467 32 NZ_CP053208 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence 19652-19683 9 0.719
CP027025_1 1.12|9008|31|CP027025|CRISPRCasFinder 9008-9038 31 NC_019848 Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence 207943-207973 9 0.71
CP027025_1 1.12|9008|31|CP027025|CRISPRCasFinder 9008-9038 31 NZ_CP015737 Shinella sp. HZN7 plasmid pShin-01, complete sequence 178315-178345 9 0.71
CP027025_1 1.13|9069|31|CP027025|CRISPRCasFinder 9069-9099 31 NZ_AP015030 Pseudomonas putida strain KF715 plasmid pKF715A, complete sequence 101591-101621 9 0.71
CP027025_1 1.17|9314|31|CP027025|CRISPRCasFinder 9314-9344 31 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 729528-729558 9 0.71
CP027025_1 1.17|9314|31|CP027025|CRISPRCasFinder 9314-9344 31 NZ_CP020952 Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence 608873-608903 9 0.71
CP027025_1 1.17|9314|31|CP027025|CRISPRCasFinder 9314-9344 31 AP021850 Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome 31566-31596 9 0.71
CP027025_1 1.18|9375|31|CP027025|CRISPRCasFinder 9375-9405 31 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 795901-795931 9 0.71
CP027025_1 1.18|9375|31|CP027025|CRISPRCasFinder 9375-9405 31 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 479022-479052 9 0.71
CP027025_1 1.18|9375|31|CP027025|CRISPRCasFinder 9375-9405 31 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 644664-644694 9 0.71
CP027025_1 1.18|9375|31|CP027025|CRISPRCasFinder 9375-9405 31 MN813693 Mycobacterium phage Imvubu, complete genome 22702-22732 9 0.71
CP027025_1 1.18|9375|31|CP027025|CRISPRCasFinder 9375-9405 31 NZ_CP011515 Mitsuaria sp. 7 plasmid, complete sequence 72970-73000 9 0.71
CP027025_1 1.18|9375|31|CP027025|CRISPRCasFinder 9375-9405 31 NZ_CP030264 Ensifer adhaerens strain Corn53 plasmid AB, complete sequence 128216-128246 9 0.71
CP027025_1 1.18|9375|31|CP027025|CRISPRCasFinder 9375-9405 31 NC_008537 Arthrobacter sp. FB24 plasmid 1, complete sequence 109298-109328 9 0.71
CP027025_1 1.18|9375|31|CP027025|CRISPRCasFinder 9375-9405 31 NZ_CP003988 Streptomyces sp. 769 plasmid pSGZL, complete sequence 79268-79298 9 0.71
CP027025_1 1.18|9375|31|CP027025|CRISPRCasFinder 9375-9405 31 NZ_CP015882 Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence 780415-780445 9 0.71
CP027025_1 1.18|9375|31|CP027025|CRISPRCasFinder 9375-9405 31 NZ_CP021082 Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence 520473-520503 9 0.71
CP027025_1 1.19|9436|31|CP027025|CRISPRCasFinder 9436-9466 31 NZ_CP050093 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence 19708-19738 9 0.71
CP027025_1 1.19|9436|31|CP027025|CRISPRCasFinder 9436-9466 31 NZ_CP050082 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence 20701-20731 9 0.71
CP027025_1 1.19|9436|31|CP027025|CRISPRCasFinder 9436-9466 31 NC_008384 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence 19714-19744 9 0.71
CP027025_1 1.19|9436|31|CP027025|CRISPRCasFinder 9436-9466 31 NZ_CP025014 Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence 19727-19757 9 0.71
CP027025_1 1.19|9436|31|CP027025|CRISPRCasFinder 9436-9466 31 NZ_CP049732 Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence 19655-19685 9 0.71
CP027025_1 1.19|9436|31|CP027025|CRISPRCasFinder 9436-9466 31 NZ_CP053441 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence 19552-19582 9 0.71
CP027025_1 1.19|9436|31|CP027025|CRISPRCasFinder 9436-9466 31 NZ_CP013503 Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence 16773-16803 9 0.71
CP027025_1 1.19|9436|31|CP027025|CRISPRCasFinder 9436-9466 31 NZ_CP048282 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence 19632-19662 9 0.71
CP027025_1 1.19|9436|31|CP027025|CRISPRCasFinder 9436-9466 31 NZ_CP013509 Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence 16773-16803 9 0.71
CP027025_1 1.19|9436|31|CP027025|CRISPRCasFinder 9436-9466 31 NZ_CP013520 Rhizobium sp. N113 plasmid pRspN113c, complete sequence 16773-16803 9 0.71
CP027025_1 1.19|9436|31|CP027025|CRISPRCasFinder 9436-9466 31 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 584730-584760 9 0.71
CP027025_1 1.19|9436|31|CP027025|CRISPRCasFinder 9436-9466 31 NZ_CP013493 Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence 16773-16803 9 0.71
CP027025_1 1.19|9436|31|CP027025|CRISPRCasFinder 9436-9466 31 NZ_CP013516 Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence 16773-16803 9 0.71
CP027025_1 1.19|9436|31|CP027025|CRISPRCasFinder 9436-9466 31 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 1632364-1632394 9 0.71
CP027025_1 1.19|9436|31|CP027025|CRISPRCasFinder 9436-9466 31 NZ_CP021082 Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence 502545-502575 9 0.71
CP027025_1 1.19|9436|31|CP027025|CRISPRCasFinder 9436-9466 31 NZ_CP053208 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence 19653-19683 9 0.71
CP027025_2 2.1|18044|32|CP027025|CRISPRCasFinder,CRT 18044-18075 32 NZ_CP015221 Rhodococcus sp. PBTS 2 plasmid unnamed1, complete sequence 116860-116891 9 0.719
CP027025_2 2.2|18105|32|CP027025|CRISPRCasFinder,CRT 18105-18136 32 CP006583 Mesorhizobium huakuii 7653R plasmid pMHb, complete sequence 283653-283684 9 0.719
CP027025_2 2.3|18166|32|CP027025|CRISPRCasFinder,CRT 18166-18197 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 385357-385388 9 0.719
CP027025_2 2.3|18166|32|CP027025|CRISPRCasFinder,CRT 18166-18197 32 MN369741 Mycobacterium phage LoneWolf, complete genome 37365-37396 9 0.719
CP027025_2 2.4|18227|32|CP027025|CRISPRCasFinder,CRT 18227-18258 32 NZ_CP020445 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed5, complete sequence 66167-66198 9 0.719
CP027025_2 2.4|18227|32|CP027025|CRISPRCasFinder,CRT 18227-18258 32 NZ_CP044079 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence 80017-80048 9 0.719
CP027025_2 2.4|18227|32|CP027025|CRISPRCasFinder,CRT 18227-18258 32 NZ_CP031079 Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence 341331-341362 9 0.719
CP027025_2 2.5|18288|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 18288-18319 32 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 658650-658681 9 0.719
CP027025_2 2.6|18349|32|CP027025|CRISPRCasFinder,CRT 18349-18380 32 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 42052-42083 9 0.719
CP027025_2 2.6|18349|32|CP027025|CRISPRCasFinder,CRT 18349-18380 32 NZ_CP007144 Hymenobacter swuensis DY53 plasmid pHsw1, complete sequence 295434-295465 9 0.719
CP027025_2 2.6|18349|32|CP027025|CRISPRCasFinder,CRT 18349-18380 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1304903-1304934 9 0.719
CP027025_2 2.6|18349|32|CP027025|CRISPRCasFinder,CRT 18349-18380 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 508631-508662 9 0.719
CP027025_3 3.3|18743|32|CP027025|CRISPRCasFinder,CRT 18743-18774 32 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 888582-888613 9 0.719
CP027025_3 3.3|18743|32|CP027025|CRISPRCasFinder,CRT 18743-18774 32 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 218501-218532 9 0.719
CP027025_3 3.3|18743|32|CP027025|CRISPRCasFinder,CRT 18743-18774 32 NZ_CP032342 Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence 242560-242591 9 0.719
CP027025_3 3.3|18743|32|CP027025|CRISPRCasFinder,CRT 18743-18774 32 NZ_CP033321 Azospirillum brasilense strain Cd plasmid p3, complete sequence 79791-79822 9 0.719
CP027025_3 3.3|18743|32|CP027025|CRISPRCasFinder,CRT 18743-18774 32 NZ_CP033315 Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence 138346-138377 9 0.719
CP027025_3 3.5|18865|32|CP027025|CRISPRCasFinder,CRT 18865-18896 32 NZ_CP020040 Streptomyces sp. 3211 isolate 3 plasmid p3211-1, complete sequence 278509-278540 9 0.719
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP029835 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence 175512-175543 9 0.719
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP015043 Rhodovulum sp. P5 plasmid pRGUI04, complete sequence 57531-57562 9 0.719
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP021409 Celeribacter manganoxidans strain DY25 plasmid pDY25-E, complete sequence 3267-3298 9 0.719
CP027025_3 3.7|18987|32|CP027025|CRISPRCasFinder,CRT 18987-19018 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1955986-1956017 9 0.719
CP027025_3 3.8|19048|32|CP027025|CRISPRCasFinder,CRT 19048-19079 32 NZ_CP017043 Selenomonas sp. oral taxon 920 strain W5150 plasmid unnamed1, complete sequence 8380-8411 9 0.719
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 518089-518120 9 0.719
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 582081-582112 9 0.719
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 CP042595 Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence 212944-212975 9 0.719
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 1465414-1465445 9 0.719
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NC_015951 Streptomyces violaceusniger Tu 4113 plasmid pSTRVI01, complete sequence 223236-223267 9 0.719
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NZ_CP017148 Bosea vaviloviae strain Vaf18 plasmid unnamed1, complete sequence 330858-330889 9 0.719
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 537488-537519 9 0.719
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NC_020548 Azoarcus sp. KH32C plasmid pAZKH, complete sequence 315159-315190 9 0.719
CP027025_3 3.12|19280|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19280-19311 32 NZ_CP010408 Streptomyces vietnamensis strain GIMV4.0001 plasmid pSVL1, complete sequence 220652-220683 9 0.719
CP027025_3 3.14|19402|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19402-19433 32 NZ_CP016618 Microvirga ossetica strain V5/3m plasmid unnamed3, complete sequence 446149-446180 9 0.719
CP027025_3 3.16|19524|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19524-19555 32 NZ_AP022566 Mycolicibacterium alvei strain JCM 12272 plasmid pJCM12272, complete sequence 22413-22444 9 0.719
CP027025_3 3.17|19585|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19585-19616 32 NC_014840 Pantoea sp. At-9b plasmid pPAT9B03, complete sequence 282497-282528 9 0.719
CP027025_3 3.19|19708|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19708-19739 32 NZ_CP013109 Sinorhizobium americanum strain CFNEI 73 plasmid B, complete sequence 526487-526518 9 0.719
CP027025_3 3.19|19708|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19708-19739 32 NZ_CP013053 Sinorhizobium americanum CCGM7 plasmid B, complete sequence 487066-487097 9 0.719
CP027025_3 3.20|19769|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19769-19800 32 NZ_CP017303 Rhodococcus sp. YL-1 plasmid pYLL1 sequence 23808-23839 9 0.719
CP027025_3 3.20|19769|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19769-19800 32 NC_016588 Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence 99269-99300 9 0.719
CP027025_3 3.20|19769|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19769-19800 32 NZ_CP020900 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence 94128-94159 9 0.719
CP027025_3 3.20|19769|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19769-19800 32 NZ_CP013526 Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence 313746-313777 9 0.719
CP027025_3 3.20|19769|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19769-19800 32 NZ_CP013556 Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence 326510-326541 9 0.719
CP027025_3 3.20|19769|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19769-19800 32 NZ_CP013589 Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence 316504-316535 9 0.719
CP027025_3 3.20|19769|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19769-19800 32 NZ_CP013562 Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence 359059-359090 9 0.719
CP027025_3 3.20|19769|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19769-19800 32 NZ_CP013579 Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence 313687-313718 9 0.719
CP027025_3 3.20|19769|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19769-19800 32 NZ_CP013531 Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence 333142-333173 9 0.719
CP027025_3 3.20|19769|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19769-19800 32 NZ_CP013536 Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence 587836-587867 9 0.719
CP027025_3 3.20|19769|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19769-19800 32 NZ_CP013541 Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence 319932-319963 9 0.719
CP027025_3 3.20|19769|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19769-19800 32 NZ_CP013546 Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence 328107-328138 9 0.719
CP027025_3 3.20|19769|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19769-19800 32 NZ_CP013567 Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence 326510-326541 9 0.719
CP027025_3 3.20|19769|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19769-19800 32 NZ_CP013584 Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence 333142-333173 9 0.719
CP027025_3 3.20|19769|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19769-19800 32 NZ_CP013573 Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence 313687-313718 9 0.719
CP027025_3 3.20|19769|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19769-19800 32 NC_010997 Rhizobium etli CIAT 652 plasmid pC, complete sequence 313250-313281 9 0.719
CP027025_3 3.20|19769|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19769-19800 32 CP000663 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA02, complete sequence 111328-111359 9 0.719
CP027025_4 4.1|28330|30|CP027025|CRT 28330-28359 30 NC_017385 Ketogulonicigenium vulgare WSH-001 plasmid 2, complete sequence 15530-15559 9 0.7
CP027025_4 4.1|28330|30|CP027025|CRT 28330-28359 30 NC_014626 Ketogulonicigenium vulgare Y25 plasmid pYP12, complete sequence 66532-66561 9 0.7
CP027025_4 4.1|28330|30|CP027025|CRT 28330-28359 30 NZ_CP012910 Ketogulonicigenium vulgare strain Hbe602 plasmid 2, complete sequence 229457-229486 9 0.7
CP027025_4 4.2|28389|31|CP027025|CRT 28389-28419 31 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 459050-459080 9 0.71
CP027025_4 4.2|28389|31|CP027025|CRT 28389-28419 31 NZ_CP036407 Komagataeibacter saccharivorans strain JH1 plasmid p92689, complete sequence 79000-79030 9 0.71
CP027025_5 5.2|28695|32|CP027025|CRISPRCasFinder 28695-28726 32 NC_011879 Pseudarthrobacter chlorophenolicus A6 plasmid pACHL01, complete sequence 51214-51245 9 0.719
CP027025_5 5.3|28756|32|CP027025|CRISPRCasFinder 28756-28787 32 NC_015951 Streptomyces violaceusniger Tu 4113 plasmid pSTRVI01, complete sequence 120943-120974 9 0.719
CP027025_5 5.3|28756|32|CP027025|CRISPRCasFinder 28756-28787 32 MH588547 Caulobacter phage CcrSC, complete genome 101313-101344 9 0.719
CP027025_5 5.5|28878|32|CP027025|CRISPRCasFinder 28878-28909 32 CP003958 Rhodococcus opacus PD630 plasmid 9, complete sequence 12106-12137 9 0.719
CP027025_5 5.5|28878|32|CP027025|CRISPRCasFinder 28878-28909 32 CP003952 Rhodococcus opacus PD630 plasmid 3, complete sequence 52925-52956 9 0.719
CP027025_5 5.6|28939|32|CP027025|CRISPRCasFinder 28939-28970 32 NZ_CP049837 Gordonia terrae strain RL-JC02 plasmid pPAE01, complete sequence 1292-1323 9 0.719
CP027025_5 5.9|29122|32|CP027025|CRISPRCasFinder 29122-29153 32 NZ_CP015204 Rhodococcus sp. 008 plasmid pR8C1, complete sequence 45952-45983 9 0.719
CP027025_5 5.9|29122|32|CP027025|CRISPRCasFinder 29122-29153 32 NC_007486 Rhodococcus erythropolis PR4 plasmid pREC1, complete sequence 82955-82986 9 0.719
CP027025_5 5.9|29122|32|CP027025|CRISPRCasFinder 29122-29153 32 NZ_CP042916 Rhodococcus qingshengii strain RL1 plasmid unnamed1, complete sequence 46336-46367 9 0.719
CP027025_5 5.9|29122|32|CP027025|CRISPRCasFinder 29122-29153 32 NZ_CP042916 Rhodococcus qingshengii strain RL1 plasmid unnamed1, complete sequence 131062-131093 9 0.719
CP027025_5 5.9|29122|32|CP027025|CRISPRCasFinder 29122-29153 32 MT024862 Microbacterium phage Alakazam, complete genome 14899-14930 9 0.719
CP027025_5 5.9|29122|32|CP027025|CRISPRCasFinder 29122-29153 32 MN586028 Gordonia phage MelBins, complete genome 6099-6130 9 0.719
CP027025_5 5.12|29334|32|CP027025|CRISPRCasFinder 29334-29365 32 AP014315 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S31-C66, *** SEQUENCING IN PROGRESS *** 17111-17142 9 0.719
CP027025_5 5.13|29395|32|CP027025|CRISPRCasFinder 29395-29426 32 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 844355-844386 9 0.719
CP027025_5 5.13|29395|32|CP027025|CRISPRCasFinder 29395-29426 32 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 686013-686044 9 0.719
CP027025_5 5.13|29395|32|CP027025|CRISPRCasFinder 29395-29426 32 NZ_CP020883 Xanthomonas citri pv. citri strain TX160042 plasmid unnamed1, complete sequence 57436-57467 9 0.719
CP027025_5 5.14|29456|32|CP027025|CRISPRCasFinder 29456-29487 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 80940-80971 9 0.719
CP027025_5 5.14|29456|32|CP027025|CRISPRCasFinder 29456-29487 32 NC_023286 Streptomyces sp. F12 plasmid pFRL6, complete sequence 372993-373024 9 0.719
CP027025_5 5.14|29456|32|CP027025|CRISPRCasFinder 29456-29487 32 NZ_CP023713 Rhodococcus ruber strain YC-YT1 plasmid unnamed2, complete sequence 64485-64516 9 0.719
CP027025_5 5.14|29456|32|CP027025|CRISPRCasFinder 29456-29487 32 KY653127 Corynebacterium phage IME1320_01, complete genome 10909-10940 9 0.719
CP027025_6 6.1|30573|31|CP027025|PILER-CR 30573-30603 31 NZ_LT984809 Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence 50088-50118 9 0.71
CP027025_6 6.3|30572|32|CP027025|CRISPRCasFinder,CRT 30572-30603 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1779396-1779427 9 0.719
CP027025_6 6.3|30572|32|CP027025|CRISPRCasFinder,CRT 30572-30603 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 33865-33896 9 0.719
CP027025_6 6.4|30633|32|CP027025|CRISPRCasFinder,CRT 30633-30664 32 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 937724-937755 9 0.719
CP027025_6 6.4|30633|32|CP027025|CRISPRCasFinder,CRT 30633-30664 32 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 715959-715990 9 0.719
CP027025_6 6.4|30633|32|CP027025|CRISPRCasFinder,CRT 30633-30664 32 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 168907-168938 9 0.719
CP027025_6 6.4|30633|32|CP027025|CRISPRCasFinder,CRT 30633-30664 32 NZ_CP032341 Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence 142588-142619 9 0.719
CP027025_6 6.4|30633|32|CP027025|CRISPRCasFinder,CRT 30633-30664 32 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 179289-179320 9 0.719
CP027025_6 6.4|30633|32|CP027025|CRISPRCasFinder,CRT 30633-30664 32 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 97452-97483 9 0.719
CP027025_6 6.4|30633|32|CP027025|CRISPRCasFinder,CRT 30633-30664 32 NZ_CP042998 Aquisphaera giovannonii strain OJF2 plasmid pOJF2_1, complete sequence 3448-3479 9 0.719
CP027025_7 7.1|30879|32|CP027025|CRISPRCasFinder,CRT 30879-30910 32 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 443735-443766 9 0.719
CP027025_7 7.1|30879|32|CP027025|CRISPRCasFinder,CRT 30879-30910 32 NZ_CP020900 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence 1037615-1037646 9 0.719
CP027025_7 7.1|30879|32|CP027025|CRISPRCasFinder,CRT 30879-30910 32 NZ_CP013526 Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence 538846-538877 9 0.719
CP027025_7 7.1|30879|32|CP027025|CRISPRCasFinder,CRT 30879-30910 32 NZ_CP013531 Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence 564720-564751 9 0.719
CP027025_7 7.1|30879|32|CP027025|CRISPRCasFinder,CRT 30879-30910 32 NZ_CP013536 Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence 366795-366826 9 0.719
CP027025_7 7.1|30879|32|CP027025|CRISPRCasFinder,CRT 30879-30910 32 NZ_CP013541 Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence 551520-551551 9 0.719
CP027025_7 7.1|30879|32|CP027025|CRISPRCasFinder,CRT 30879-30910 32 NZ_CP013584 Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence 564720-564751 9 0.719
CP027025_7 7.1|30879|32|CP027025|CRISPRCasFinder,CRT 30879-30910 32 NZ_CP054616 Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence 134356-134387 9 0.719
CP027025_7 7.2|30940|32|CP027025|CRISPRCasFinder,CRT 30940-30971 32 NZ_CP021919 Sagittula sp. P11 plasmid unnamed5, complete sequence 19210-19241 9 0.719
CP027025_7 7.2|30940|32|CP027025|CRISPRCasFinder,CRT 30940-30971 32 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 1846201-1846232 9 0.719
CP027025_7 7.2|30940|32|CP027025|CRISPRCasFinder,CRT 30940-30971 32 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 226578-226609 9 0.719
CP027025_7 7.2|30940|32|CP027025|CRISPRCasFinder,CRT 30940-30971 32 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 246428-246459 9 0.719
CP027025_7 7.2|30940|32|CP027025|CRISPRCasFinder,CRT 30940-30971 32 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 405220-405251 9 0.719
CP027025_7 7.2|30940|32|CP027025|CRISPRCasFinder,CRT 30940-30971 32 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 1711426-1711457 9 0.719
CP027025_7 7.2|30940|32|CP027025|CRISPRCasFinder,CRT 30940-30971 32 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 382649-382680 9 0.719
CP027025_7 7.2|30940|32|CP027025|CRISPRCasFinder,CRT 30940-30971 32 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 186696-186727 9 0.719
CP027025_7 7.2|30940|32|CP027025|CRISPRCasFinder,CRT 30940-30971 32 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 841241-841272 9 0.719
CP027025_7 7.2|30940|32|CP027025|CRISPRCasFinder,CRT 30940-30971 32 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 83140-83171 9 0.719
CP027025_7 7.2|30940|32|CP027025|CRISPRCasFinder,CRT 30940-30971 32 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 227664-227695 9 0.719
CP027025_7 7.2|30940|32|CP027025|CRISPRCasFinder,CRT 30940-30971 32 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 226797-226828 9 0.719
CP027025_7 7.2|30940|32|CP027025|CRISPRCasFinder,CRT 30940-30971 32 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 223536-223567 9 0.719
CP027025_7 7.2|30940|32|CP027025|CRISPRCasFinder,CRT 30940-30971 32 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 227920-227951 9 0.719
CP027025_7 7.2|30940|32|CP027025|CRISPRCasFinder,CRT 30940-30971 32 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 229182-229213 9 0.719
CP027025_7 7.2|30940|32|CP027025|CRISPRCasFinder,CRT 30940-30971 32 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 222579-222610 9 0.719
CP027025_7 7.2|30940|32|CP027025|CRISPRCasFinder,CRT 30940-30971 32 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 229182-229213 9 0.719
CP027025_7 7.2|30940|32|CP027025|CRISPRCasFinder,CRT 30940-30971 32 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 222579-222610 9 0.719
CP027025_7 7.2|30940|32|CP027025|CRISPRCasFinder,CRT 30940-30971 32 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 229182-229213 9 0.719
CP027025_7 7.2|30940|32|CP027025|CRISPRCasFinder,CRT 30940-30971 32 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 229182-229213 9 0.719
CP027025_7 7.2|30940|32|CP027025|CRISPRCasFinder,CRT 30940-30971 32 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 229182-229213 9 0.719
CP027025_7 7.2|30940|32|CP027025|CRISPRCasFinder,CRT 30940-30971 32 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 222579-222610 9 0.719
CP027025_7 7.2|30940|32|CP027025|CRISPRCasFinder,CRT 30940-30971 32 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 227693-227724 9 0.719
CP027025_7 7.2|30940|32|CP027025|CRISPRCasFinder,CRT 30940-30971 32 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 222579-222610 9 0.719
CP027025_7 7.2|30940|32|CP027025|CRISPRCasFinder,CRT 30940-30971 32 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 272752-272783 9 0.719
CP027025_7 7.2|30940|32|CP027025|CRISPRCasFinder,CRT 30940-30971 32 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 222579-222610 9 0.719
CP027025_7 7.2|30940|32|CP027025|CRISPRCasFinder,CRT 30940-30971 32 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 222579-222610 9 0.719
CP027025_7 7.2|30940|32|CP027025|CRISPRCasFinder,CRT 30940-30971 32 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 229182-229213 9 0.719
CP027025_7 7.3|31001|32|CP027025|CRISPRCasFinder,CRT 31001-31032 32 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 798643-798674 9 0.719
CP027025_7 7.5|31123|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 31123-31154 32 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 263077-263108 9 0.719
CP027025_8 8.1|31721|32|CP027025|CRISPRCasFinder 31721-31752 32 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 1250506-1250537 9 0.719
CP027025_8 8.1|31721|32|CP027025|CRISPRCasFinder 31721-31752 32 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 36061-36092 9 0.719
CP027025_8 8.1|31721|32|CP027025|CRISPRCasFinder 31721-31752 32 NZ_CP054030 Rhizobium sp. JKLM19E plasmid pPR19E03 281549-281580 9 0.719
CP027025_8 8.2|31782|32|CP027025|CRISPRCasFinder 31782-31813 32 NZ_CP042264 Litoreibacter sp. LN3S51 plasmid unnamed3, complete sequence 214306-214337 9 0.719
CP027025_8 8.2|31782|32|CP027025|CRISPRCasFinder 31782-31813 32 NZ_CP024310 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence 1489607-1489638 9 0.719
CP027025_8 8.2|31782|32|CP027025|CRISPRCasFinder 31782-31813 32 NZ_CP023064 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence 1305813-1305844 9 0.719
CP027025_1 1.3|9008|32|CP027025|CRT 9008-9039 32 NC_019848 Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence 207942-207973 10 0.688
CP027025_1 1.4|9069|32|CP027025|CRT 9069-9100 32 NZ_AP015030 Pseudomonas putida strain KF715 plasmid pKF715A, complete sequence 101590-101621 10 0.688
CP027025_1 1.8|9314|32|CP027025|CRT 9314-9345 32 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 729527-729558 10 0.688
CP027025_1 1.8|9314|32|CP027025|CRT 9314-9345 32 NZ_CP020952 Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence 608872-608903 10 0.688
CP027025_1 1.9|9375|32|CP027025|CRT 9375-9406 32 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 479021-479052 10 0.688
CP027025_1 1.9|9375|32|CP027025|CRT 9375-9406 32 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 644664-644695 10 0.688
CP027025_1 1.9|9375|32|CP027025|CRT 9375-9406 32 NZ_CP011515 Mitsuaria sp. 7 plasmid, complete sequence 72970-73001 10 0.688
CP027025_1 1.9|9375|32|CP027025|CRT 9375-9406 32 NZ_CP003988 Streptomyces sp. 769 plasmid pSGZL, complete sequence 79267-79298 10 0.688
CP027025_1 1.9|9375|32|CP027025|CRT 9375-9406 32 NZ_CP015882 Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence 780414-780445 10 0.688
CP027025_1 1.9|9375|32|CP027025|CRT 9375-9406 32 NZ_CP030264 Ensifer adhaerens strain Corn53 plasmid AB, complete sequence 128216-128247 10 0.688
CP027025_1 1.9|9375|32|CP027025|CRT 9375-9406 32 NZ_CP021082 Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence 520472-520503 10 0.688
CP027025_1 1.10|9436|32|CP027025|CRT 9436-9467 32 NC_016624 Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence 146999-147030 10 0.688
CP027025_1 1.10|9436|32|CP027025|CRT 9436-9467 32 NC_020548 Azoarcus sp. KH32C plasmid pAZKH, complete sequence 671306-671337 10 0.688
CP027025_1 1.10|9436|32|CP027025|CRT 9436-9467 32 NZ_CP021082 Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence 502545-502576 10 0.688
CP027025_1 1.12|9008|31|CP027025|CRISPRCasFinder 9008-9038 31 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 317777-317807 10 0.677
CP027025_1 1.17|9314|31|CP027025|CRISPRCasFinder 9314-9344 31 NZ_CP013635 Rhizobium sp. N324 plasmid pRspN324e, complete sequence 545713-545743 10 0.677
CP027025_1 1.17|9314|31|CP027025|CRISPRCasFinder 9314-9344 31 NZ_CP013526 Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence 1124417-1124447 10 0.677
CP027025_1 1.17|9314|31|CP027025|CRISPRCasFinder 9314-9344 31 NZ_CP013556 Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence 1088552-1088582 10 0.677
CP027025_1 1.17|9314|31|CP027025|CRISPRCasFinder 9314-9344 31 NZ_CP013589 Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence 977083-977113 10 0.677
CP027025_1 1.17|9314|31|CP027025|CRISPRCasFinder 9314-9344 31 NZ_CP013562 Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence 1124124-1124154 10 0.677
CP027025_1 1.17|9314|31|CP027025|CRISPRCasFinder 9314-9344 31 NZ_CP013579 Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence 1111963-1111993 10 0.677
CP027025_1 1.17|9314|31|CP027025|CRISPRCasFinder 9314-9344 31 NZ_CP013536 Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence 913492-913522 10 0.677
CP027025_1 1.17|9314|31|CP027025|CRISPRCasFinder 9314-9344 31 NZ_CP013541 Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence 1067073-1067103 10 0.677
CP027025_1 1.17|9314|31|CP027025|CRISPRCasFinder 9314-9344 31 NZ_CP013546 Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence 1003319-1003349 10 0.677
CP027025_1 1.17|9314|31|CP027025|CRISPRCasFinder 9314-9344 31 NZ_CP013567 Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence 1088552-1088582 10 0.677
CP027025_1 1.17|9314|31|CP027025|CRISPRCasFinder 9314-9344 31 NZ_CP013573 Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence 1111963-1111993 10 0.677
CP027025_1 1.17|9314|31|CP027025|CRISPRCasFinder 9314-9344 31 NC_010997 Rhizobium etli CIAT 652 plasmid pC, complete sequence 1020425-1020455 10 0.677
CP027025_1 1.17|9314|31|CP027025|CRISPRCasFinder 9314-9344 31 NZ_CP020900 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence 527093-527123 10 0.677
CP027025_1 1.18|9375|31|CP027025|CRISPRCasFinder 9375-9405 31 NZ_CP018784 Curtobacterium pusillum strain AA3 plasmid pCPAA3, complete sequence 267724-267754 10 0.677
CP027025_1 1.19|9436|31|CP027025|CRISPRCasFinder 9436-9466 31 NC_016624 Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence 146999-147029 10 0.677
CP027025_1 1.19|9436|31|CP027025|CRISPRCasFinder 9436-9466 31 NC_020548 Azoarcus sp. KH32C plasmid pAZKH, complete sequence 671306-671336 10 0.677
CP027025_2 2.4|18227|32|CP027025|CRISPRCasFinder,CRT 18227-18258 32 NZ_CP024426 Paracoccus yeei strain TT13 plasmid pTT13-4, complete sequence 126382-126413 10 0.688
CP027025_2 2.5|18288|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 18288-18319 32 NZ_CP049244 Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence 1137791-1137822 10 0.688
CP027025_2 2.5|18288|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 18288-18319 32 NZ_CP013588 Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence 361894-361925 10 0.688
CP027025_2 2.6|18349|32|CP027025|CRISPRCasFinder,CRT 18349-18380 32 NZ_CP016463 Bosea sp. RAC05 plasmid pBSY19_1, complete sequence 116248-116279 10 0.688
CP027025_3 3.3|18743|32|CP027025|CRISPRCasFinder,CRT 18743-18774 32 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 764484-764515 10 0.688
CP027025_3 3.3|18743|32|CP027025|CRISPRCasFinder,CRT 18743-18774 32 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 227515-227546 10 0.688
CP027025_3 3.4|18804|32|CP027025|CRISPRCasFinder,CRT 18804-18835 32 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 181199-181230 10 0.688
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 1458885-1458916 10 0.688
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1171165-1171196 10 0.688
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 884102-884133 10 0.688
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 1787745-1787776 10 0.688
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 647363-647394 10 0.688
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 1257436-1257467 10 0.688
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1426994-1427025 10 0.688
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 996646-996677 10 0.688
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 1562906-1562937 10 0.688
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 1172028-1172059 10 0.688
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 1479605-1479636 10 0.688
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1878326-1878357 10 0.688
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 1682544-1682575 10 0.688
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 1356294-1356325 10 0.688
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1177115-1177146 10 0.688
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1209937-1209968 10 0.688
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1173858-1173889 10 0.688
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 1359742-1359773 10 0.688
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 1853062-1853093 10 0.688
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 1142771-1142802 10 0.688
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 815568-815599 10 0.688
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 1359709-1359740 10 0.688
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1229969-1230000 10 0.688
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 1358514-1358545 10 0.688
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 1152587-1152618 10 0.688
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1229969-1230000 10 0.688
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 1358551-1358582 10 0.688
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1229969-1230000 10 0.688
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 1152610-1152641 10 0.688
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1229973-1230004 10 0.688
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 1358551-1358582 10 0.688
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 1358540-1358571 10 0.688
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 1152610-1152641 10 0.688
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 1358540-1358571 10 0.688
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 1152610-1152641 10 0.688
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1229968-1229999 10 0.688
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 1240423-1240454 10 0.688
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 1359707-1359738 10 0.688
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 1152610-1152641 10 0.688
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 1152610-1152641 10 0.688
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 1358551-1358582 10 0.688
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 787426-787457 10 0.688
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 1358562-1358593 10 0.688
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 1358540-1358571 10 0.688
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 787426-787457 10 0.688
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1142600-1142631 10 0.688
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1192726-1192757 10 0.688
CP027025_3 3.6|18926|32|CP027025|CRISPRCasFinder,CRT 18926-18957 32 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1055494-1055525 10 0.688
CP027025_3 3.10|19158|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19158-19189 32 NZ_CP048287 Paenibacillus sp. 14171R-81 plasmid unnamed1, complete sequence 191772-191803 10 0.688
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NZ_LN832562 Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence 119025-119056 10 0.688
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 486122-486153 10 0.688
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 610698-610729 10 0.688
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NC_011368 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence 226164-226195 10 0.688
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 670595-670626 10 0.688
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NC_024366 Mycobacterium phage OkiRoe, complete genome 54361-54392 10 0.688
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NZ_CP015867 Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence 588956-588987 10 0.688
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NZ_CP041766 Tomitella sp. HY188 plasmid unnamed, complete sequence 47264-47295 10 0.688
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NZ_CP015813 Microbacterium chocolatum strain SIT 101 plasmid 3, complete sequence 13305-13336 10 0.688
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 330490-330521 10 0.688
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 AB276040 Ralstonia phage RSA1 DNA, complete genome 2381-2412 10 0.688
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 U46938 Mycobacterium phage DS6A, Spe1/NheI G fragment sequence 9214-9245 10 0.688
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NC_009382 Ralstonia phage phiRSA1, complete genome 2381-2412 10 0.688
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 JN698994 Mycobacterium phage DS6A, complete genome 50270-50301 10 0.688
CP027025_3 3.16|19524|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19524-19555 32 NZ_CP029832 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence 459498-459529 10 0.688
CP027025_3 3.17|19585|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19585-19616 32 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1141878-1141909 10 0.688
CP027025_3 3.20|19769|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19769-19800 32 NZ_CP049700 Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2a, complete sequence 293527-293558 10 0.688
CP027025_5 5.2|28695|32|CP027025|CRISPRCasFinder 28695-28726 32 NC_017324 Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence 470376-470407 10 0.688
CP027025_5 5.2|28695|32|CP027025|CRISPRCasFinder 28695-28726 32 NC_004683 Mycobacterium phage Che9c, complete genome 53610-53641 10 0.688
CP027025_5 5.2|28695|32|CP027025|CRISPRCasFinder 28695-28726 32 AY129333 Mycobacterium virus Che9c, complete genome 53610-53641 10 0.688
CP027025_5 5.5|28878|32|CP027025|CRISPRCasFinder 28878-28909 32 NZ_HG938354 Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence 1118215-1118246 10 0.688
CP027025_5 5.5|28878|32|CP027025|CRISPRCasFinder 28878-28909 32 NC_018022 Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence 286223-286254 10 0.688
CP027025_5 5.6|28939|32|CP027025|CRISPRCasFinder 28939-28970 32 NC_019387 Thermus oshimai JL-2 plasmid pTHEOS01, complete sequence 161257-161288 10 0.688
CP027025_5 5.9|29122|32|CP027025|CRISPRCasFinder 29122-29153 32 MN204492 Streptomyces phage GirlPower, complete genome 24994-25025 10 0.688
CP027025_5 5.9|29122|32|CP027025|CRISPRCasFinder 29122-29153 32 MK433268 Streptomyces phage Popy, complete genome 24023-24054 10 0.688
CP027025_5 5.9|29122|32|CP027025|CRISPRCasFinder 29122-29153 32 MF467948 Streptomyces phage DrGrey, complete genome 24023-24054 10 0.688
CP027025_5 5.9|29122|32|CP027025|CRISPRCasFinder 29122-29153 32 MN586054 Streptomyces phage FrodoSwaggins, complete genome 24023-24054 10 0.688
CP027025_5 5.9|29122|32|CP027025|CRISPRCasFinder 29122-29153 32 MN204504 Streptomyces phage Soshi, complete genome 24029-24060 10 0.688
CP027025_5 5.13|29395|32|CP027025|CRISPRCasFinder 29395-29426 32 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 647363-647394 10 0.688
CP027025_5 5.13|29395|32|CP027025|CRISPRCasFinder 29395-29426 32 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 1853062-1853093 10 0.688
CP027025_5 5.13|29395|32|CP027025|CRISPRCasFinder 29395-29426 32 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 1229969-1230000 10 0.688
CP027025_5 5.13|29395|32|CP027025|CRISPRCasFinder 29395-29426 32 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 1229969-1230000 10 0.688
CP027025_5 5.13|29395|32|CP027025|CRISPRCasFinder 29395-29426 32 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 1229969-1230000 10 0.688
CP027025_5 5.13|29395|32|CP027025|CRISPRCasFinder 29395-29426 32 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 1229973-1230004 10 0.688
CP027025_5 5.13|29395|32|CP027025|CRISPRCasFinder 29395-29426 32 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 1229968-1229999 10 0.688
CP027025_5 5.13|29395|32|CP027025|CRISPRCasFinder 29395-29426 32 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 1458885-1458916 10 0.688
CP027025_5 5.13|29395|32|CP027025|CRISPRCasFinder 29395-29426 32 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1142600-1142631 10 0.688
CP027025_5 5.13|29395|32|CP027025|CRISPRCasFinder 29395-29426 32 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1171165-1171196 10 0.688
CP027025_5 5.13|29395|32|CP027025|CRISPRCasFinder 29395-29426 32 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1192726-1192757 10 0.688
CP027025_5 5.13|29395|32|CP027025|CRISPRCasFinder 29395-29426 32 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1055494-1055525 10 0.688
CP027025_5 5.13|29395|32|CP027025|CRISPRCasFinder 29395-29426 32 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 884102-884133 10 0.688
CP027025_5 5.13|29395|32|CP027025|CRISPRCasFinder 29395-29426 32 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 1787745-1787776 10 0.688
CP027025_5 5.13|29395|32|CP027025|CRISPRCasFinder 29395-29426 32 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1239573-1239604 10 0.688
CP027025_5 5.13|29395|32|CP027025|CRISPRCasFinder 29395-29426 32 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 1697368-1697399 10 0.688
CP027025_5 5.14|29456|32|CP027025|CRISPRCasFinder 29456-29487 32 MN693478 Marine virus AFVG_25M14, complete genome 21304-21335 10 0.688
CP027025_6 6.3|30572|32|CP027025|CRISPRCasFinder,CRT 30572-30603 32 NZ_LT984809 Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence 50088-50119 10 0.688
CP027025_6 6.5|30694|32|CP027025|CRISPRCasFinder,CRT 30694-30725 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5802349-5802380 10 0.688
CP027025_6 6.5|30694|32|CP027025|CRISPRCasFinder,CRT 30694-30725 32 MH651167 Gordonia phage Angelique, complete genome 25987-26018 10 0.688
CP027025_7 7.2|30940|32|CP027025|CRISPRCasFinder,CRT 30940-30971 32 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 425850-425881 10 0.688
CP027025_7 7.2|30940|32|CP027025|CRISPRCasFinder,CRT 30940-30971 32 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 621370-621401 10 0.688
CP027025_7 7.2|30940|32|CP027025|CRISPRCasFinder,CRT 30940-30971 32 KY365739 Streptomyces phage BabyGotBac, complete genome 34041-34072 10 0.688
CP027025_7 7.2|30940|32|CP027025|CRISPRCasFinder,CRT 30940-30971 32 MH178382 Streptomyces phage Salete, complete genome 34038-34069 10 0.688
CP027025_7 7.2|30940|32|CP027025|CRISPRCasFinder,CRT 30940-30971 32 KU189325 Streptomyces phage Maih, complete genome 34040-34071 10 0.688
CP027025_7 7.2|30940|32|CP027025|CRISPRCasFinder,CRT 30940-30971 32 MH178381 Streptomyces phage BayC, complete genome 34038-34069 10 0.688
CP027025_7 7.2|30940|32|CP027025|CRISPRCasFinder,CRT 30940-30971 32 KP876466 Streptomyces phage TP1604, complete genome 34041-34072 10 0.688
CP027025_7 7.3|31001|32|CP027025|CRISPRCasFinder,CRT 31001-31032 32 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1385997-1386028 10 0.688
CP027025_8 8.1|31721|32|CP027025|CRISPRCasFinder 31721-31752 32 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 313087-313118 10 0.688
CP027025_8 8.2|31782|32|CP027025|CRISPRCasFinder 31782-31813 32 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 1357702-1357733 10 0.688
CP027025_1 1.1|8886|32|CP027025|CRT 8886-8917 32 NZ_CP020040 Streptomyces sp. 3211 isolate 3 plasmid p3211-1, complete sequence 254882-254913 11 0.656
CP027025_1 1.1|8886|32|CP027025|CRT 8886-8917 32 NC_006552 Pseudomonas phage F116, complete genome 30102-30133 11 0.656
CP027025_1 1.1|8886|32|CP027025|CRT 8886-8917 32 MK511040 Pseudomonas phage CF63, partial genome 34039-34070 11 0.656
CP027025_1 1.1|8886|32|CP027025|CRT 8886-8917 32 MF490237 Pseudomonas phage vB_PaeP_E220, complete genome 43693-43724 11 0.656
CP027025_1 1.1|8886|32|CP027025|CRT 8886-8917 32 KM389216 UNVERIFIED: Pseudomonas phage F_ET605sp/Pa1651 clone contig00001 genomic sequence 37125-37156 11 0.656
CP027025_1 1.1|8886|32|CP027025|CRT 8886-8917 32 AY625898 Pseudomonas aeruginosa phage F116, complete genome 30102-30133 11 0.656
CP027025_1 1.1|8886|32|CP027025|CRT 8886-8917 32 KM389247 UNVERIFIED: Pseudomonas phage JBD90 clone contig00001 genomic sequence 18709-18740 11 0.656
CP027025_1 1.1|8886|32|CP027025|CRT 8886-8917 32 LT603684 Pseudomonas phage phiC725A genome assembly 29425-29456 11 0.656
CP027025_1 1.3|9008|32|CP027025|CRT 9008-9039 32 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 317776-317807 11 0.656
CP027025_1 1.8|9314|32|CP027025|CRT 9314-9345 32 NZ_CP013635 Rhizobium sp. N324 plasmid pRspN324e, complete sequence 545712-545743 11 0.656
CP027025_1 1.8|9314|32|CP027025|CRT 9314-9345 32 NZ_CP020900 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence 527093-527124 11 0.656
CP027025_1 1.8|9314|32|CP027025|CRT 9314-9345 32 NZ_CP013526 Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence 1124416-1124447 11 0.656
CP027025_1 1.8|9314|32|CP027025|CRT 9314-9345 32 NZ_CP013556 Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence 1088551-1088582 11 0.656
CP027025_1 1.8|9314|32|CP027025|CRT 9314-9345 32 NZ_CP013589 Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence 977082-977113 11 0.656
CP027025_1 1.8|9314|32|CP027025|CRT 9314-9345 32 NZ_CP013562 Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence 1124123-1124154 11 0.656
CP027025_1 1.8|9314|32|CP027025|CRT 9314-9345 32 NZ_CP013579 Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence 1111962-1111993 11 0.656
CP027025_1 1.8|9314|32|CP027025|CRT 9314-9345 32 NZ_CP013536 Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence 913491-913522 11 0.656
CP027025_1 1.8|9314|32|CP027025|CRT 9314-9345 32 NZ_CP013541 Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence 1067072-1067103 11 0.656
CP027025_1 1.8|9314|32|CP027025|CRT 9314-9345 32 NZ_CP013546 Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence 1003318-1003349 11 0.656
CP027025_1 1.8|9314|32|CP027025|CRT 9314-9345 32 NZ_CP013567 Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence 1088551-1088582 11 0.656
CP027025_1 1.8|9314|32|CP027025|CRT 9314-9345 32 NZ_CP013573 Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence 1111962-1111993 11 0.656
CP027025_1 1.8|9314|32|CP027025|CRT 9314-9345 32 NC_010997 Rhizobium etli CIAT 652 plasmid pC, complete sequence 1020424-1020455 11 0.656
CP027025_1 1.9|9375|32|CP027025|CRT 9375-9406 32 NZ_CP018784 Curtobacterium pusillum strain AA3 plasmid pCPAA3, complete sequence 267724-267755 11 0.656
CP027025_2 2.3|18166|32|CP027025|CRISPRCasFinder,CRT 18166-18197 32 KT997836 Uncultured Mediterranean phage uvDeep-CGR0-AD1-C123, complete genome 14636-14667 11 0.656
CP027025_2 2.6|18349|32|CP027025|CRISPRCasFinder,CRT 18349-18380 32 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 1313795-1313826 11 0.656
CP027025_2 2.6|18349|32|CP027025|CRISPRCasFinder,CRT 18349-18380 32 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1077920-1077951 11 0.656
CP027025_2 2.6|18349|32|CP027025|CRISPRCasFinder,CRT 18349-18380 32 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 572041-572072 11 0.656
CP027025_2 2.6|18349|32|CP027025|CRISPRCasFinder,CRT 18349-18380 32 NZ_CP033321 Azospirillum brasilense strain Cd plasmid p3, complete sequence 277821-277852 11 0.656
CP027025_2 2.6|18349|32|CP027025|CRISPRCasFinder,CRT 18349-18380 32 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 1390900-1390931 11 0.656
CP027025_2 2.6|18349|32|CP027025|CRISPRCasFinder,CRT 18349-18380 32 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 1560345-1560376 11 0.656
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NC_007960 Nitrobacter hamburgensis X14 plasmid 2, complete sequence 89799-89830 11 0.656
CP027025_3 3.16|19524|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19524-19555 32 NZ_CP020951 Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence 90346-90377 11 0.656
CP027025_3 3.16|19524|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19524-19555 32 AP014720 Arthrobacter sp. Hiyo8 plasmid pHiyo8-1 DNA, complete genome, strain: Hiyo8 420-451 11 0.656
CP027025_5 5.3|28756|32|CP027025|CRISPRCasFinder 28756-28787 32 AP017627 Pleomorphomonas sp. SM30 plasmid pSM30-1 DNA, complete genome 38972-39003 11 0.656
CP027025_5 5.12|29334|32|CP027025|CRISPRCasFinder 29334-29365 32 NC_009427 Novosphingobium aromaticivorans DSM 12444 plasmid pNL2, complete sequence 29516-29547 11 0.656
CP027025_8 8.1|31721|32|CP027025|CRISPRCasFinder 31721-31752 32 NC_008010 Deinococcus geothermalis DSM 11300 plasmid pDGEO01, complete sequence 443873-443904 11 0.656
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NZ_LR594660 Variovorax sp. PBL-H6 plasmid 2 596611-596642 12 0.625
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NZ_LR594667 Variovorax sp. SRS16 plasmid 2 241547-241578 12 0.625
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1019234-1019265 12 0.625
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NZ_LR594690 Variovorax sp. WDL1 plasmid 2 244523-244554 12 0.625
CP027025_3 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR 19219-19250 32 NZ_LR594672 Variovorax sp. PBL-E5 plasmid 2 241547-241578 12 0.625

1. spacer 1.1|8886|32|CP027025|CRT matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

aagcccaggtccgggccctggacgaaccagga	CRISPR spacer
aagcccaggtccgggccctggacgaaccagga	Protospacer
********************************

2. spacer 1.2|8947|32|CP027025|CRT matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

gtcgaggagcggtccaccgagtgggaggcgaa	CRISPR spacer
gtcgaggagcggtccaccgagtgggaggcgaa	Protospacer
********************************

3. spacer 1.3|9008|32|CP027025|CRT matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

aacgtgtcgaggccgatctgcgcgtacttgtt	CRISPR spacer
aacgtgtcgaggccgatctgcgcgtacttgtt	Protospacer
********************************

4. spacer 1.4|9069|32|CP027025|CRT matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

gtgtcgccaagcgagaggcgcgtcgtgatggc	CRISPR spacer
gtgtcgccaagcgagaggcgcgtcgtgatggc	Protospacer
********************************

5. spacer 1.5|9130|32|CP027025|CRT matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

gtagtcctcgaaggacagcagggtcgtggcga	CRISPR spacer
gtagtcctcgaaggacagcagggtcgtggcga	Protospacer
********************************

6. spacer 1.6|9191|33|CP027025|CRT matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

gtccgtcttcgggtcgtcctcgaacacctccca	CRISPR spacer
gtccgtcttcgggtcgtcctcgaacacctccca	Protospacer
*********************************

7. spacer 1.7|9253|32|CP027025|CRT matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

tcggcacgagcgcctgacgtggtcgacttcgt	CRISPR spacer
tcggcacgagcgcctgacgtggtcgacttcgt	Protospacer
********************************

8. spacer 1.8|9314|32|CP027025|CRT matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

cgtgccgtccgtgaggccgtgttcgacgagct	CRISPR spacer
cgtgccgtccgtgaggccgtgttcgacgagct	Protospacer
********************************

9. spacer 1.9|9375|32|CP027025|CRT matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

agcgccaccgcgccgcggacggcctcgatcgt	CRISPR spacer
agcgccaccgcgccgcggacggcctcgatcgt	Protospacer
********************************

10. spacer 1.10|9436|32|CP027025|CRT matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

ccccagctcgtcgcctacagcgccggagtcct	CRISPR spacer
ccccagctcgtcgcctacagcgccggagtcct	Protospacer
********************************

11. spacer 1.11|8947|31|CP027025|CRISPRCasFinder matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

gtcgaggagcggtccaccgagtgggaggcga	CRISPR spacer
gtcgaggagcggtccaccgagtgggaggcga	Protospacer
*******************************

12. spacer 1.12|9008|31|CP027025|CRISPRCasFinder matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

aacgtgtcgaggccgatctgcgcgtacttgt	CRISPR spacer
aacgtgtcgaggccgatctgcgcgtacttgt	Protospacer
*******************************

13. spacer 1.13|9069|31|CP027025|CRISPRCasFinder matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

gtgtcgccaagcgagaggcgcgtcgtgatgg	CRISPR spacer
gtgtcgccaagcgagaggcgcgtcgtgatgg	Protospacer
*******************************

14. spacer 1.14|9130|31|CP027025|CRISPRCasFinder matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

gtagtcctcgaaggacagcagggtcgtggcg	CRISPR spacer
gtagtcctcgaaggacagcagggtcgtggcg	Protospacer
*******************************

15. spacer 1.15|9191|32|CP027025|CRISPRCasFinder matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

gtccgtcttcgggtcgtcctcgaacacctccc	CRISPR spacer
gtccgtcttcgggtcgtcctcgaacacctccc	Protospacer
********************************

16. spacer 1.16|9253|31|CP027025|CRISPRCasFinder matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

tcggcacgagcgcctgacgtggtcgacttcg	CRISPR spacer
tcggcacgagcgcctgacgtggtcgacttcg	Protospacer
*******************************

17. spacer 1.17|9314|31|CP027025|CRISPRCasFinder matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

cgtgccgtccgtgaggccgtgttcgacgagc	CRISPR spacer
cgtgccgtccgtgaggccgtgttcgacgagc	Protospacer
*******************************

18. spacer 1.18|9375|31|CP027025|CRISPRCasFinder matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

agcgccaccgcgccgcggacggcctcgatcg	CRISPR spacer
agcgccaccgcgccgcggacggcctcgatcg	Protospacer
*******************************

19. spacer 1.19|9436|31|CP027025|CRISPRCasFinder matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

ccccagctcgtcgcctacagcgccggagtcc	CRISPR spacer
ccccagctcgtcgcctacagcgccggagtcc	Protospacer
*******************************

20. spacer 1.20|9377|28|CP027025|PILER-CR matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

agcgccaccgcgccgcggacggcctcga	CRISPR spacer
agcgccaccgcgccgcggacggcctcga	Protospacer
****************************

21. spacer 1.21|9438|28|CP027025|PILER-CR matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

ccccagctcgtcgcctacagcgccggag	CRISPR spacer
ccccagctcgtcgcctacagcgccggag	Protospacer
****************************

22. spacer 2.1|18044|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

ggtgacggtcacgggcggtgctcctgggcggt	CRISPR spacer
ggtgacggtcacgggcggtgctcctgggcggt	Protospacer
********************************

23. spacer 2.2|18105|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

acgcagctcctccaggccgggcctgacggcct	CRISPR spacer
acgcagctcctccaggccgggcctgacggcct	Protospacer
********************************

24. spacer 2.3|18166|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

ctctggttgagtacgacgacgagcagggtctc	CRISPR spacer
ctctggttgagtacgacgacgagcagggtctc	Protospacer
********************************

25. spacer 2.4|18227|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

ggatcgcgccgtcacatgcgggtgggcggctt	CRISPR spacer
ggatcgcgccgtcacatgcgggtgggcggctt	Protospacer
********************************

26. spacer 2.5|18288|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

taccggacggcgctggaggccggtccgatcca	CRISPR spacer
taccggacggcgctggaggccggtccgatcca	Protospacer
********************************

27. spacer 2.6|18349|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

agtaccagcgccccggacgcggcgacctgcat	CRISPR spacer
agtaccagcgccccggacgcggcgacctgcat	Protospacer
********************************

28. spacer 2.7|18353|28|CP027025|PILER-CR matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

agtaccagcgccccggacgcggcgacct	CRISPR spacer
agtaccagcgccccggacgcggcgacct	Protospacer
****************************

29. spacer 3.1|18592|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

cgtcgggcggggtcactggcggactcccaacg	CRISPR spacer
cgtcgggcggggtcactggcggactcccaacg	Protospacer
********************************

30. spacer 3.3|18743|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

ccatacgtcagcgtcgcgccaccgccagccgg	CRISPR spacer
ccatacgtcagcgtcgcgccaccgccagccgg	Protospacer
********************************

31. spacer 3.4|18804|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

atagtcctcgaaggacagcaaggtcgtggcga	CRISPR spacer
atagtcctcgaaggacagcaaggtcgtggcga	Protospacer
********************************

32. spacer 3.5|18865|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

ctcaggtccaccgacaacttcgcggccgacac	CRISPR spacer
ctcaggtccaccgacaacttcgcggccgacac	Protospacer
********************************

33. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
gccgcagccgcccgcgcggcaggccacggaga	Protospacer
********************************

34. spacer 3.7|18987|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

cttttcaggaggctggaggcgcgcaacgcgtc	CRISPR spacer
cttttcaggaggctggaggcgcgcaacgcgtc	Protospacer
********************************

35. spacer 3.8|19048|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

cgcgtttgccccttgcagccccgattcatccg	CRISPR spacer
cgcgtttgccccttgcagccccgattcatccg	Protospacer
********************************

36. spacer 3.9|19109|20|CP027025|CRISPRCasFinder,CRT matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

gcgacgagggcggccgcgct	CRISPR spacer
gcgacgagggcggccgcgct	Protospacer
********************

37. spacer 3.10|19158|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

gagggcgtgtagctctcctcgaagggggtgcc	CRISPR spacer
gagggcgtgtagctctcctcgaagggggtgcc	Protospacer
********************************

38. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

tctgcggcggccggcgccgggccgcgcttggg	CRISPR spacer
tctgcggcggccggcgccgggccgcgcttggg	Protospacer
********************************

39. spacer 3.12|19280|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

ggacgacgagcagggcgagcgtggacacggtg	CRISPR spacer
ggacgacgagcagggcgagcgtggacacggtg	Protospacer
********************************

40. spacer 3.13|19341|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

acggcgtgcgtgcagtgtgcacagagcggaaa	CRISPR spacer
acggcgtgcgtgcagtgtgcacagagcggaaa	Protospacer
********************************

41. spacer 3.14|19402|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

ccggtcttcgacagtctggggaacacgacgtg	CRISPR spacer
ccggtcttcgacagtctggggaacacgacgtg	Protospacer
********************************

42. spacer 3.15|19463|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

cacgcccggttccgaggagcgccggacgcggc	CRISPR spacer
cacgcccggttccgaggagcgccggacgcggc	Protospacer
********************************

43. spacer 3.16|19524|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

ggcgggatgtcgaggcgttcgatgccggtggt	CRISPR spacer
ggcgggatgtcgaggcgttcgatgccggtggt	Protospacer
********************************

44. spacer 3.17|19585|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

gactcggagaggatctccaggttgtcttcctt	CRISPR spacer
gactcggagaggatctccaggttgtcttcctt	Protospacer
********************************

45. spacer 3.18|19646|33|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

ttaactgttcccgttcgtagccgtaacggtccg	CRISPR spacer
ttaactgttcccgttcgtagccgtaacggtccg	Protospacer
*********************************

46. spacer 3.19|19708|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

gcctcccagccggagggcagactcgtcgtgaa	CRISPR spacer
gcctcccagccggagggcagactcgtcgtgaa	Protospacer
********************************

47. spacer 3.20|19769|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

aagtgctcggcgatccgcaggcggcggaggct	CRISPR spacer
aagtgctcggcgatccgcaggcggcggaggct	Protospacer
********************************

48. spacer 3.21|19830|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

cggattacccgacggggcttctttgtgaaggg	CRISPR spacer
cggattacccgacggggcttctttgtgaaggg	Protospacer
********************************

49. spacer 4.1|28330|30|CP027025|CRT matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

agcggtggtcgcgttccatatggccaccgt	CRISPR spacer
agcggtggtcgcgttccatatggccaccgt	Protospacer
******************************

50. spacer 4.2|28389|31|CP027025|CRT matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

gagcgggcatcgtcggggccggggagcgtgt	CRISPR spacer
gagcgggcatcgtcggggccggggagcgtgt	Protospacer
*******************************

51. spacer 4.3|28449|32|CP027025|CRT matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

gcttcacggacccgccgagcaccattgttggc	CRISPR spacer
gcttcacggacccgccgagcaccattgttggc	Protospacer
********************************

52. spacer 5.1|28634|32|CP027025|CRISPRCasFinder matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

agggagacggccaggtcccgggaataggagac	CRISPR spacer
agggagacggccaggtcccgggaataggagac	Protospacer
********************************

53. spacer 5.2|28695|32|CP027025|CRISPRCasFinder matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

agggtacccgcagcgtggccctgctcgatgcg	CRISPR spacer
agggtacccgcagcgtggccctgctcgatgcg	Protospacer
********************************

54. spacer 5.3|28756|32|CP027025|CRISPRCasFinder matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

cggccgacgtgcaggtggcgcagtcgagccgg	CRISPR spacer
cggccgacgtgcaggtggcgcagtcgagccgg	Protospacer
********************************

55. spacer 5.4|28817|32|CP027025|CRISPRCasFinder matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

ttgaccagcaccttccggtcgttggtccggta	CRISPR spacer
ttgaccagcaccttccggtcgttggtccggta	Protospacer
********************************

56. spacer 5.5|28878|32|CP027025|CRISPRCasFinder matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

gtcaccaccgtcgacgacggggccttcaccgc	CRISPR spacer
gtcaccaccgtcgacgacggggccttcaccgc	Protospacer
********************************

57. spacer 5.6|28939|32|CP027025|CRISPRCasFinder matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccccggtacgaggtcggccaggtgcg	CRISPR spacer
acggggccccggtacgaggtcggccaggtgcg	Protospacer
********************************

58. spacer 5.7|29000|32|CP027025|CRISPRCasFinder matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

atccagatgcccggctcggaccgcatgaacat	CRISPR spacer
atccagatgcccggctcggaccgcatgaacat	Protospacer
********************************

59. spacer 5.8|29061|32|CP027025|CRISPRCasFinder matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

gccgacatggagaagatggacttcccctcgat	CRISPR spacer
gccgacatggagaagatggacttcccctcgat	Protospacer
********************************

60. spacer 5.9|29122|32|CP027025|CRISPRCasFinder matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

gacaccgtcaccaccttcatcgcgaacgtgca	CRISPR spacer
gacaccgtcaccaccttcatcgcgaacgtgca	Protospacer
********************************

61. spacer 5.11|29273|32|CP027025|CRISPRCasFinder matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

gtagtcctcgaatgacagcagggtcgtggcga	CRISPR spacer
gtagtcctcgaatgacagcagggtcgtggcga	Protospacer
********************************

62. spacer 5.12|29334|32|CP027025|CRISPRCasFinder matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

ttcgcgggatcgacgacgaaatggttctcgat	CRISPR spacer
ttcgcgggatcgacgacgaaatggttctcgat	Protospacer
********************************

63. spacer 5.13|29395|32|CP027025|CRISPRCasFinder matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

gccgcagccgcccgcgcggcaggccacggagg	CRISPR spacer
gccgcagccgcccgcgcggcaggccacggagg	Protospacer
********************************

64. spacer 5.14|29456|32|CP027025|CRISPRCasFinder matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccccgtgtccacctggcccaccaccgcgt	CRISPR spacer
ccgccccgtgtccacctggcccaccaccgcgt	Protospacer
********************************

65. spacer 5.15|29517|33|CP027025|CRISPRCasFinder matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

ctcggccgacttggtgaacacgttggcgttgtg	CRISPR spacer
ctcggccgacttggtgaacacgttggcgttgtg	Protospacer
*********************************

66. spacer 6.1|30573|31|CP027025|PILER-CR matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

acatcaccgtccggatctcccgcgaggcgac	CRISPR spacer
acatcaccgtccggatctcccgcgaggcgac	Protospacer
*******************************

67. spacer 6.2|30634|31|CP027025|PILER-CR matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

tgccttcgaagacgaccgtcgccaggtcgta	CRISPR spacer
tgccttcgaagacgaccgtcgccaggtcgta	Protospacer
*******************************

68. spacer 6.3|30572|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

gacatcaccgtccggatctcccgcgaggcgac	CRISPR spacer
gacatcaccgtccggatctcccgcgaggcgac	Protospacer
********************************

69. spacer 6.4|30633|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

ttgccttcgaagacgaccgtcgccaggtcgta	CRISPR spacer
ttgccttcgaagacgaccgtcgccaggtcgta	Protospacer
********************************

70. spacer 6.5|30694|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

gccttgaacacgctgacgaagatgctgccgac	CRISPR spacer
gccttgaacacgctgacgaagatgctgccgac	Protospacer
********************************

71. spacer 7.1|30879|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

ccacgccgccgcctggtcgccagggaagtcgc	CRISPR spacer
ccacgccgccgcctggtcgccagggaagtcgc	Protospacer
********************************

72. spacer 7.2|30940|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

gacagaccgccgagggcgatccggacggagtt	CRISPR spacer
gacagaccgccgagggcgatccggacggagtt	Protospacer
********************************

73. spacer 7.3|31001|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

gcagccccgatgacggccgcccactcgcctac	CRISPR spacer
gcagccccgatgacggccgcccactcgcctac	Protospacer
********************************

74. spacer 7.4|31062|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

cggctcatgcaccgcgagcagacgtggacgtt	CRISPR spacer
cggctcatgcaccgcgagcagacgtggacgtt	Protospacer
********************************

75. spacer 7.5|31123|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

tcgaccggcccgcgcccgtactcggccggcag	CRISPR spacer
tcgaccggcccgcgcccgtactcggccggcag	Protospacer
********************************

76. spacer 7.6|31184|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

gccgagctcctcgggaacctcttccgcgccct	CRISPR spacer
gccgagctcctcgggaacctcttccgcgccct	Protospacer
********************************

77. spacer 7.7|31245|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

ggcttcgtcgtgtcctgtcccggccggccacc	CRISPR spacer
ggcttcgtcgtgtcctgtcccggccggccacc	Protospacer
********************************

78. spacer 7.8|31306|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

cccggccgggctctcacacaccgaccggggcc	CRISPR spacer
cccggccgggctctcacacaccgaccggggcc	Protospacer
********************************

79. spacer 8.1|31721|32|CP027025|CRISPRCasFinder matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

gtcttgccctgccagtccttgcggcccttggt	CRISPR spacer
gtcttgccctgccagtccttgcggcccttggt	Protospacer
********************************

80. spacer 8.2|31782|32|CP027025|CRISPRCasFinder matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 0, identity: 1.0

agcggttccgcgcccatctcgaagttggacag	CRISPR spacer
agcggttccgcgcccatctcgaagttggacag	Protospacer
********************************

81. spacer 1.5|9130|32|CP027025|CRT matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 1, identity: 0.969

gtagtcctcgaaggacagcagggtcgtggcga	CRISPR spacer
gtagtcctcgaatgacagcagggtcgtggcga	Protospacer
************ *******************

82. spacer 1.14|9130|31|CP027025|CRISPRCasFinder matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 1, identity: 0.968

gtagtcctcgaaggacagcagggtcgtggcg	CRISPR spacer
gtagtcctcgaatgacagcagggtcgtggcg	Protospacer
************ ******************

83. spacer 3.2|18653|61|CP027025|CRISPRCasFinder,CRT matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 1, identity: 0.984

ggatgacctctttgccagcctcgcccaccaggcccaccacgggccggcccacgatcccgc	CRISPR spacer
ggatgacctctttgccagcctcgcccaccaggcccaccacgggccggcccacgatcccgc	Protospacer
************************************************************

84. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 1, identity: 0.969

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
gccgcagccgcccgcgcggcaggccacggagg	Protospacer
*******************************.

85. spacer 3.9|19109|20|CP027025|CRISPRCasFinder,CRT matches to NC_012807 (Methylorubrum extorquens AM1 plasmid p1META1, complete sequence) position: , mismatch: 1, identity: 0.95

gcgacgagggcggccgcgct	CRISPR spacer
gcgacgagggcggccgcgca	Protospacer
******************* 

86. spacer 3.12|19280|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 1, identity: 0.969

ggacgacgagcagggcgagcgtggacacggtg	CRISPR spacer
ggacgacgagcagggcgagcgtggacacggta	Protospacer
*******************************.

87. spacer 5.10|29183|61|CP027025|CRISPRCasFinder matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 1, identity: 0.984

ggataacctctttgccggcctcgcccaccaggcccaccacgggccggtccacgatcccgc	CRISPR spacer
ggataacctctttgccggcctcgcccaccaggcccaccacgggccggtccacgatcccgc	Protospacer
************************************************************

88. spacer 5.11|29273|32|CP027025|CRISPRCasFinder matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 1, identity: 0.969

gtagtcctcgaatgacagcagggtcgtggcga	CRISPR spacer
gtagtcctcgaaggacagcagggtcgtggcga	Protospacer
************ *******************

89. spacer 5.13|29395|32|CP027025|CRISPRCasFinder matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 1, identity: 0.969

gccgcagccgcccgcgcggcaggccacggagg	CRISPR spacer
gccgcagccgcccgcgcggcaggccacggaga	Protospacer
*******************************.

90. spacer 1.5|9130|32|CP027025|CRT matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.938

gtagtcctcgaaggacagcagggtcgtggcga	CRISPR spacer
atagtcctcgaaggacagcaaggtcgtggcga	Protospacer
.*******************.***********

91. spacer 1.14|9130|31|CP027025|CRISPRCasFinder matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.935

gtagtcctcgaaggacagcagggtcgtggcg	CRISPR spacer
atagtcctcgaaggacagcaaggtcgtggcg	Protospacer
.*******************.**********

92. spacer 2.1|18044|32|CP027025|CRISPRCasFinder,CRT matches to MT711975 (Streptomyces phage Alderaan, complete genome) position: , mismatch: 2, identity: 0.938

ggtgacggtcacgggcggtgctcctgggcggt	CRISPR spacer
ggtgacggtcacgggcggttctcctgtgcggt	Protospacer
******************* ****** *****

93. spacer 2.1|18044|32|CP027025|CRISPRCasFinder,CRT matches to KY092481 (Streptomyces phage PapayaSalad, complete genome) position: , mismatch: 2, identity: 0.938

ggtgacggtcacgggcggtgctcctgggcggt	CRISPR spacer
ggtgacggtcacgggcggttctcctgtgcggt	Protospacer
******************* ****** *****

94. spacer 3.4|18804|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.938

atagtcctcgaaggacagcaaggtcgtggcga	CRISPR spacer
gtagtcctcgaaggacagcagggtcgtggcga	Protospacer
.*******************.***********

95. spacer 5.3|28756|32|CP027025|CRISPRCasFinder matches to NC_023316 (Streptomyces sp. 14R-10 plasmid pZL1, complete sequence) position: , mismatch: 2, identity: 0.938

cggccgacgtgcaggtggcgcagtcgagccgg	CRISPR spacer
cggccgccgtgcaggtggcgcagccgagccgg	Protospacer
****** ****************.********

96. spacer 5.12|29334|32|CP027025|CRISPRCasFinder matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 2, identity: 0.938

ttcgcgggatcgacgacgaaatggttctcgat	CRISPR spacer
ttcgcggggtcgacgacgaaatgattctcgat	Protospacer
********.**************.********

97. spacer 5.12|29334|32|CP027025|CRISPRCasFinder matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 2, identity: 0.938

ttcgcgggatcgacgacgaaatggttctcgat	CRISPR spacer
ttcgcggggtcgacgacgaaatgattctcgat	Protospacer
********.**************.********

98. spacer 7.1|30879|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.938

ccacgccgccgcctggtcgccagggaagtcgc	CRISPR spacer
ccacaccgccgcctggtcgccggggaagtcgc	Protospacer
****.****************.**********

99. spacer 1.20|9377|28|CP027025|PILER-CR matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 3, identity: 0.893

agcgccaccgcgccgcggacggcctcga	CRISPR spacer
agcgcgaccgcgccgcggaccgcctcgt	Protospacer
***** ************** ****** 

100. spacer 3.4|18804|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 3, identity: 0.906

atagtcctcgaaggacagcaaggtcgtggcga	CRISPR spacer
gtagtcctcgaatgacagcagggtcgtggcga	Protospacer
.*********** *******.***********

101. spacer 5.11|29273|32|CP027025|CRISPRCasFinder matches to NZ_CP027025 (Streptomyces sp. WAC00288 plasmid p3, complete sequence) position: , mismatch: 3, identity: 0.906

gtagtcctcgaatgacagcagggtcgtggcga	CRISPR spacer
atagtcctcgaaggacagcaaggtcgtggcga	Protospacer
.*********** *******.***********

102. spacer 1.3|9008|32|CP027025|CRT matches to NZ_CP006990 (Rhizobium sp. IE4771 plasmid pRetIE4771d, complete sequence) position: , mismatch: 4, identity: 0.875

aacgtgtcgaggccgatctgcgcgt-acttgtt	CRISPR spacer
aacgtctcgagaccgatctgcgcgtcactcgt-	Protospacer
***** *****.************* ***.** 

103. spacer 1.3|9008|32|CP027025|CRT matches to NZ_CP020911 (Rhizobium etli strain NXC12 plasmid pRetNXC12e, complete sequence) position: , mismatch: 4, identity: 0.875

aacgtgtcgaggccgatctgcgcgt-acttgtt	CRISPR spacer
aacgtctcgagaccgatctgcgcgtcactcgt-	Protospacer
***** *****.************* ***.** 

104. spacer 1.3|9008|32|CP027025|CRT matches to NZ_CP021127 (Rhizobium sp. Kim5 plasmid pRetKim5c, complete sequence) position: , mismatch: 4, identity: 0.875

aacgtgtcgaggccgatctgcgcgt-acttgtt	CRISPR spacer
aacgtctcgagaccgatctgcgcgtcactcgt-	Protospacer
***** *****.************* ***.** 

105. spacer 1.3|9008|32|CP027025|CRT matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 4, identity: 0.875

aacgtgtcgaggccgatctgcgcgt-acttgtt	CRISPR spacer
aacgtctcgagaccgatctgcgcgtcactcgt-	Protospacer
***** *****.************* ***.** 

106. spacer 1.12|9008|31|CP027025|CRISPRCasFinder matches to NZ_CP006990 (Rhizobium sp. IE4771 plasmid pRetIE4771d, complete sequence) position: , mismatch: 4, identity: 0.871

aacgtgtcgaggccgatctgcgcgt-acttgt	CRISPR spacer
aacgtctcgagaccgatctgcgcgtcactcg-	Protospacer
***** *****.************* ***.* 

107. spacer 1.12|9008|31|CP027025|CRISPRCasFinder matches to NZ_CP020911 (Rhizobium etli strain NXC12 plasmid pRetNXC12e, complete sequence) position: , mismatch: 4, identity: 0.871

aacgtgtcgaggccgatctgcgcgt-acttgt	CRISPR spacer
aacgtctcgagaccgatctgcgcgtcactcg-	Protospacer
***** *****.************* ***.* 

108. spacer 1.12|9008|31|CP027025|CRISPRCasFinder matches to NZ_CP021127 (Rhizobium sp. Kim5 plasmid pRetKim5c, complete sequence) position: , mismatch: 4, identity: 0.871

aacgtgtcgaggccgatctgcgcgt-acttgt	CRISPR spacer
aacgtctcgagaccgatctgcgcgtcactcg-	Protospacer
***** *****.************* ***.* 

109. spacer 1.12|9008|31|CP027025|CRISPRCasFinder matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 4, identity: 0.871

aacgtgtcgaggccgatctgcgcgt-acttgt	CRISPR spacer
aacgtctcgagaccgatctgcgcgtcactcg-	Protospacer
***** *****.************* ***.* 

110. spacer 1.18|9375|31|CP027025|CRISPRCasFinder matches to NC_014159 (Tsukamurella paurometabola DSM 20162 plasmid pTpau01, complete sequence) position: , mismatch: 4, identity: 0.871

agcgc-caccgcgccgcggacggcctcgatcg-	CRISPR spacer
-acgcgcaccgcgccgcggacggcgtcg-tcgt	Protospacer
 .*** ****************** *** *** 

111. spacer 1.20|9377|28|CP027025|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.857

agcgccaccgcgccgcggacggcctcga	CRISPR spacer
cgcgccactgcgcggcggacggcctcgg	Protospacer
 *******.**** *************.

112. spacer 1.20|9377|28|CP027025|PILER-CR matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 4, identity: 0.857

agcgccaccgcgccgcggacggcctcga	CRISPR spacer
acctccaccgcgcagcggaccgcctcga	Protospacer
* * ********* ****** *******

113. spacer 1.20|9377|28|CP027025|PILER-CR matches to NC_014159 (Tsukamurella paurometabola DSM 20162 plasmid pTpau01, complete sequence) position: , mismatch: 4, identity: 0.857

agcgc-caccgcgccgcggacggcctcga	CRISPR spacer
-acgcgcaccgcgccgcggacggcgtcgt	Protospacer
 .*** ****************** *** 

114. spacer 1.20|9377|28|CP027025|PILER-CR matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 4, identity: 0.857

agcgccaccgcgccgcggacggcctcga	CRISPR spacer
accgcgaccgcgccgcggaccgcctcca	Protospacer
* *** ************** ***** *

115. spacer 1.20|9377|28|CP027025|PILER-CR matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 4, identity: 0.857

agcgccaccgcgccgcggacggcctcga	CRISPR spacer
acctccaccgcgcagcggaccgcctcga	Protospacer
* * ********* ****** *******

116. spacer 1.20|9377|28|CP027025|PILER-CR matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 4, identity: 0.857

agcgccaccgcgccgcggacggcctcga	CRISPR spacer
acctccaccgcgcagcggaccgcctcga	Protospacer
* * ********* ****** *******

117. spacer 1.21|9438|28|CP027025|PILER-CR matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857

ccccagctcgtcgcctacagcgccggag	CRISPR spacer
ccccacctcgtcgcccacagcgccgccg	Protospacer
***** *********.*********  *

118. spacer 1.21|9438|28|CP027025|PILER-CR matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857

ccccagctcgtcgcctacagcgccggag	CRISPR spacer
ccccacctcgtcgcccacagcgccgccg	Protospacer
***** *********.*********  *

119. spacer 1.21|9438|28|CP027025|PILER-CR matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857

ccccagctcgtcgcctacagcgccggag	CRISPR spacer
ccccacctcgtcgcccacagcgccgccg	Protospacer
***** *********.*********  *

120. spacer 1.21|9438|28|CP027025|PILER-CR matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857

ccccagctcgtcgcctacagcgccggag	CRISPR spacer
ccccacctcgtcgcccacagcgccgccg	Protospacer
***** *********.*********  *

121. spacer 1.21|9438|28|CP027025|PILER-CR matches to KP966108 (Burkholderia phage vB_BceM_AP3, complete genome) position: , mismatch: 4, identity: 0.857

ccccagctcgtcgcctacagcgccggag	CRISPR spacer
ccccagctcgtcgcctccagcgcgcaag	Protospacer
**************** ******  .**

122. spacer 2.7|18353|28|CP027025|PILER-CR matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857

agtaccagcgccccggacgcggcgacct	CRISPR spacer
accaccggcgccccggacgcggcgaccg	Protospacer
* .***.******************** 

123. spacer 2.7|18353|28|CP027025|PILER-CR matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857

agtaccagcgccccggacgcggcgacct	CRISPR spacer
accaccggcgccccggacgcggcgaccg	Protospacer
* .***.******************** 

124. spacer 2.7|18353|28|CP027025|PILER-CR matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857

agtaccagcgccccggacgcggcgacct	CRISPR spacer
accaccggcgccccggacgcggcgaccg	Protospacer
* .***.******************** 

125. spacer 2.7|18353|28|CP027025|PILER-CR matches to NZ_CP016453 (Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence) position: , mismatch: 4, identity: 0.857

agtaccagcgccccggacgcggcgacct	CRISPR spacer
cgcaccagcgcctcgaacgcggcgacct	Protospacer
 *.*********.**.************

126. spacer 1.3|9008|32|CP027025|CRT matches to NZ_CP030354 (Novosphingobium sp. P6W plasmid pP6W1, complete sequence) position: , mismatch: 5, identity: 0.844

aacgtgtcgaggccgatctgcgcgtacttgtt	CRISPR spacer
atcgcgtcgagggcgatctgcgcgtactcggt	Protospacer
* **.******* ***************.* *

127. spacer 1.9|9375|32|CP027025|CRT matches to NZ_AP014659 (Bradyrhizobium diazoefficiens strain NK6 plasmid pNK6a, complete sequence) position: , mismatch: 5, identity: 0.844

agcgcca-ccgcgccgcggacggcctcgatcgt	CRISPR spacer
-tcgccagccgctccgcggatggcctcgatcat	Protospacer
  ***** **** *******.**********.*

128. spacer 1.9|9375|32|CP027025|CRT matches to NZ_CP049701 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence) position: , mismatch: 5, identity: 0.844

agcgcca-ccgcgccgcggacggcctcgatcgt	CRISPR spacer
-tcgccagccgctccgcggatggcctcgatcat	Protospacer
  ***** **** *******.**********.*

129. spacer 1.12|9008|31|CP027025|CRISPRCasFinder matches to NZ_CP030354 (Novosphingobium sp. P6W plasmid pP6W1, complete sequence) position: , mismatch: 5, identity: 0.839

aacgtgtcgaggccgatctgcgcgtacttgt	CRISPR spacer
atcgcgtcgagggcgatctgcgcgtactcgg	Protospacer
* **.******* ***************.* 

130. spacer 1.18|9375|31|CP027025|CRISPRCasFinder matches to NZ_AP014659 (Bradyrhizobium diazoefficiens strain NK6 plasmid pNK6a, complete sequence) position: , mismatch: 5, identity: 0.839

agcgcca-ccgcgccgcggacggcctcgatcg	CRISPR spacer
-tcgccagccgctccgcggatggcctcgatca	Protospacer
  ***** **** *******.**********.

131. spacer 1.18|9375|31|CP027025|CRISPRCasFinder matches to NZ_CP049701 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence) position: , mismatch: 5, identity: 0.839

agcgcca-ccgcgccgcggacggcctcgatcg	CRISPR spacer
-tcgccagccgctccgcggatggcctcgatca	Protospacer
  ***** **** *******.**********.

132. spacer 1.20|9377|28|CP027025|PILER-CR matches to NZ_CP006991 (Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence) position: , mismatch: 5, identity: 0.821

agcgccaccgcgccgcggacggcctcga	CRISPR spacer
gccgccaccgcctcgcggacggcctcgc	Protospacer
. ********* .************** 

133. spacer 1.20|9377|28|CP027025|PILER-CR matches to NC_007764 (Rhizobium etli CFN 42 plasmid p42c, complete sequence) position: , mismatch: 5, identity: 0.821

agcgccaccgcgccgcggacggcctcga	CRISPR spacer
gccgccaccgcctcgcggacggcctcgc	Protospacer
. ********* .************** 

134. spacer 1.20|9377|28|CP027025|PILER-CR matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 5, identity: 0.821

agcgccaccgcgccgcggacggcctcga	CRISPR spacer
cgtgccaccgcgccgcggacggtctcct	Protospacer
 *.*******************.***  

135. spacer 1.20|9377|28|CP027025|PILER-CR matches to NZ_CP013524 (Rhizobium phaseoli strain R744 plasmid pRphaR744b, complete sequence) position: , mismatch: 5, identity: 0.821

agcgccaccgcgccgcggacggcctcga	CRISPR spacer
ctcgccaccgcctcgcggacggcctcgc	Protospacer
  ********* .************** 

136. spacer 1.20|9377|28|CP027025|PILER-CR matches to NZ_CP020908 (Rhizobium etli strain NXC12 plasmid pRetNXC12b, complete sequence) position: , mismatch: 5, identity: 0.821

agcgccaccgcgccgcggacggcctcga	CRISPR spacer
gccgccaccgcctcgcggacggcctcgc	Protospacer
. ********* .************** 

137. spacer 1.20|9377|28|CP027025|PILER-CR matches to NC_021907 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1b, complete sequence) position: , mismatch: 5, identity: 0.821

agcgccaccgcgccgcggacggcctcga	CRISPR spacer
gccgccaccgcctcgcggacggcctcgc	Protospacer
. ********* .************** 

138. spacer 1.20|9377|28|CP027025|PILER-CR matches to NZ_CP021128 (Rhizobium sp. Kim5 plasmid pRetKim5d, complete sequence) position: , mismatch: 5, identity: 0.821

agcgccaccgcgccgcggacggcctcga	CRISPR spacer
gccgccaccgcctcgcggacggcctcgc	Protospacer
. ********* .************** 

139. spacer 1.20|9377|28|CP027025|PILER-CR matches to CP007645 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803d, complete sequence) position: , mismatch: 5, identity: 0.821

agcgccaccgcgccgcggacggcctcga	CRISPR spacer
gccgccaccgcctcgcggacggcctcgc	Protospacer
. ********* .************** 

140. spacer 1.20|9377|28|CP027025|PILER-CR matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 5, identity: 0.821

agcgccaccgcgccgcggacggcctcga	CRISPR spacer
cacgccaccgcgctgcggacggccgcgc	Protospacer
 .***********.********** ** 

141. spacer 1.20|9377|28|CP027025|PILER-CR matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 5, identity: 0.821

agcgccaccgcgccgcggacggcctcga	CRISPR spacer
cctgccaccacggcgcggacggcctcga	Protospacer
  .******.** ***************

142. spacer 1.20|9377|28|CP027025|PILER-CR matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 5, identity: 0.821

agcgccaccgcgccgcggacggcctcga	CRISPR spacer
atccacaccgagccgcgcacggcctcga	Protospacer
* *  ***** ****** **********

143. spacer 1.20|9377|28|CP027025|PILER-CR matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 5, identity: 0.821

agcgccaccgcgccgcggacggcctcga	CRISPR spacer
agcgccgccgcgccgcgggcggcggcgt	Protospacer
******.***********.****  ** 

144. spacer 1.20|9377|28|CP027025|PILER-CR matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 5, identity: 0.821

agcgccaccgcgccgcggacggcctcga	CRISPR spacer
agcgccgccgcgccgcgggcggcggcgt	Protospacer
******.***********.****  ** 

145. spacer 1.20|9377|28|CP027025|PILER-CR matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 5, identity: 0.821

agcgccaccgcgccgcggacggcctcga	CRISPR spacer
acttccaccgcgcagcggaccgcctcga	Protospacer
* . ********* ****** *******

146. spacer 1.20|9377|28|CP027025|PILER-CR matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 5, identity: 0.821

agcgccaccgcgccgcggacggcctcga	CRISPR spacer
agcgccgccgcgccgcgggcggcggcgt	Protospacer
******.***********.****  ** 

147. spacer 1.20|9377|28|CP027025|PILER-CR matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.821

agcgccaccgcgccgcggacggcctcga	CRISPR spacer
accgccagcgcgccgcggatggcctgaa	Protospacer
* ***** ***********.***** .*

148. spacer 1.20|9377|28|CP027025|PILER-CR matches to NZ_AP019802 (Thermus thermophilus strain HC11 plasmid pHC11, complete sequence) position: , mismatch: 5, identity: 0.821

agcgccaccgcgccgcggacggcctcga	CRISPR spacer
accctcaccccgccggggacggcctcga	Protospacer
* * .**** ***** ************

149. spacer 1.20|9377|28|CP027025|PILER-CR matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 5, identity: 0.821

agcgccaccgcgccgcggacggcctcga	CRISPR spacer
aaagcgaccgcgccgcggaccgcctcca	Protospacer
*. ** ************** ***** *

150. spacer 1.20|9377|28|CP027025|PILER-CR matches to NZ_CP034185 (Deinococcus sp. S14-83 strain S14-83T plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

agcgc-caccgcgccgcggacggcctcga	CRISPR spacer
-tcgcaaaccgcgccgctgacggcctcgc	Protospacer
  ***  ********** ********** 

151. spacer 1.20|9377|28|CP027025|PILER-CR matches to NZ_CP050991 (Chromobacterium violaceum strain FDAARGOS_635 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

agcgccaccgcgccgcggacggcctcga	CRISPR spacer
agcgccaccgcgccgccgacgtcggcgt	Protospacer
**************** **** *  ** 

152. spacer 1.20|9377|28|CP027025|PILER-CR matches to NZ_MG651603 (Chromobacterium violaceum strain ATCC 12472 plasmid pChV1, complete sequence) position: , mismatch: 5, identity: 0.821

agcgccaccgcgccgcggacggcctcga	CRISPR spacer
agcgccaccgcgccgccgacgtcggcgt	Protospacer
**************** **** *  ** 

153. spacer 1.20|9377|28|CP027025|PILER-CR matches to MT657335 (Gordonia phage Mariokart, complete genome) position: , mismatch: 5, identity: 0.821

agcgcc-accgcgccgcggacggcctcga	CRISPR spacer
-gcgttgaccgcgccgaggacggcctcgg	Protospacer
 ***.. ********* ***********.

154. spacer 1.21|9438|28|CP027025|PILER-CR matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 5, identity: 0.821

ccccagctcgtcgcctacagcgccggag	CRISPR spacer
ctccagcttgtcgcctccagcgccgccg	Protospacer
*.******.******* ********  *

155. spacer 2.7|18353|28|CP027025|PILER-CR matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

agtaccagcgccccggacgcggcgacct	CRISPR spacer
accaccggcgccccggacgcggccaccg	Protospacer
* .***.**************** *** 

156. spacer 2.7|18353|28|CP027025|PILER-CR matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

agtaccagcgccccggacgcggcgacct	CRISPR spacer
accaccggcgcaccggacgcggcgaccg	Protospacer
* .***.**** *************** 

157. spacer 2.7|18353|28|CP027025|PILER-CR matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

agtaccagcgccccggacgcggcgacct	CRISPR spacer
accaccggcgccccggacgcggccaccg	Protospacer
* .***.**************** *** 

158. spacer 2.7|18353|28|CP027025|PILER-CR matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

agtaccagcgccccggacgcggcgacct	CRISPR spacer
accaccggcgccccggacgcggccaccg	Protospacer
* .***.**************** *** 

159. spacer 2.7|18353|28|CP027025|PILER-CR matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 5, identity: 0.821

agtaccagcgccccggacgcggcgacct	CRISPR spacer
accaccggcgccccggacgcggccaccg	Protospacer
* .***.**************** *** 

160. spacer 2.7|18353|28|CP027025|PILER-CR matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

agtaccagcgccccggacgcggcgacct	CRISPR spacer
accaccggcgccccggacgcggccaccg	Protospacer
* .***.**************** *** 

161. spacer 2.7|18353|28|CP027025|PILER-CR matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 5, identity: 0.821

agtaccagcgccccggacgcggcgacct	CRISPR spacer
accaccggcgccccggacgcggccaccg	Protospacer
* .***.**************** *** 

162. spacer 2.7|18353|28|CP027025|PILER-CR matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 5, identity: 0.821

agtaccagcgccccggacgcggcgacct	CRISPR spacer
accaccggcgccccggacgcggccaccg	Protospacer
* .***.**************** *** 

163. spacer 2.7|18353|28|CP027025|PILER-CR matches to NZ_CP054606 (Sulfitobacter pseudonitzschiae strain H46 plasmid unnamed7, complete sequence) position: , mismatch: 5, identity: 0.821

agtaccagcgccccggacgcggcgacct	CRISPR spacer
cgcatcagcgcctcggacacggcgacct	Protospacer
 *.*.*******.*****.*********

164. spacer 5.12|29334|32|CP027025|CRISPRCasFinder matches to NZ_CP026654 (Streptomyces dengpaensis strain XZHG99 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.844

ttcgcgggatcgacgacgaaatggttctcgat	CRISPR spacer
ttgcccgggtcgacgacgaagtggttctcgat	Protospacer
**  * **.***********.***********

165. spacer 1.3|9008|32|CP027025|CRT matches to NZ_CP029234 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436d, complete sequence) position: , mismatch: 6, identity: 0.812

aacgtgtcgaggccgatctgcgcgtacttgtt	CRISPR spacer
accggatcgaggccgatctgcgcgggcttgat	Protospacer
* ** .****************** .**** *

166. spacer 1.3|9008|32|CP027025|CRT matches to NZ_CP013600 (Rhizobium sp. N741 plasmid pRspN741e, complete sequence) position: , mismatch: 6, identity: 0.812

aacgtgtcgaggccgatctgcgcgt-acttgtt	CRISPR spacer
agcgtctggaggccgatctgcgcgtcacccgt-	Protospacer
*.*** * ***************** **..** 

167. spacer 1.3|9008|32|CP027025|CRT matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 6, identity: 0.812

aacgtgtcgaggccgatctgcgcgt-acttgtt	CRISPR spacer
aacgtctcgagaccgatctgcgcctgacgcgt-	Protospacer
***** *****.*********** * ** .** 

168. spacer 1.3|9008|32|CP027025|CRT matches to NZ_CP013504 (Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence) position: , mismatch: 6, identity: 0.812

aacgtgtcgaggccgatctgcgcgt-acttgtt	CRISPR spacer
agcgtctggaggccgatctgcgcgtcacccgt-	Protospacer
*.*** * ***************** **..** 

169. spacer 1.3|9008|32|CP027025|CRT matches to NZ_CP013510 (Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence) position: , mismatch: 6, identity: 0.812

aacgtgtcgaggccgatctgcgcgt-acttgtt	CRISPR spacer
agcgtctggaggccgatctgcgcgtcacccgt-	Protospacer
*.*** * ***************** **..** 

170. spacer 1.3|9008|32|CP027025|CRT matches to NZ_CP013521 (Rhizobium sp. N113 plasmid pRspN113d, complete sequence) position: , mismatch: 6, identity: 0.812

aacgtgtcgaggccgatctgcgcgt-acttgtt	CRISPR spacer
agcgtctggaggccgatctgcgcgtcacccgt-	Protospacer
*.*** * ***************** **..** 

171. spacer 1.3|9008|32|CP027025|CRT matches to NZ_CP013494 (Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence) position: , mismatch: 6, identity: 0.812

aacgtgtcgaggccgatctgcgcgt-acttgtt	CRISPR spacer
agcgtctggaggccgatctgcgcgtcacccgt-	Protospacer
*.*** * ***************** **..** 

172. spacer 1.3|9008|32|CP027025|CRT matches to NZ_CP013594 (Rhizobium sp. N871 plasmid pRspN871d, complete sequence) position: , mismatch: 6, identity: 0.812

aacgtgtcgaggccgatctgcgcgt-acttgtt	CRISPR spacer
agcgtctggaggccgatctgcgcgtcacccgt-	Protospacer
*.*** * ***************** **..** 

173. spacer 1.4|9069|32|CP027025|CRT matches to NZ_CP034811 (Paracoccus sp. Arc7-R13 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

gtgtcgccaagcgagaggcgcgtcgtgatggc	CRISPR spacer
gaggcgccaagcgaaaggcgggtcgtgaatgc	Protospacer
* * **********.***** *******  **

174. spacer 1.9|9375|32|CP027025|CRT matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 6, identity: 0.812

agcgccaccgcgccgcggacggcctcg-atcgt	CRISPR spacer
cacgccaccgcgctgcggacggccgcgcagcg-	Protospacer
 .***********.********** ** * ** 

175. spacer 1.9|9375|32|CP027025|CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 6, identity: 0.812

agcgccaccgcgccgcggacggc--ctcgatcgt	CRISPR spacer
agcgccgccgcgccgcgggcggcggcgtgatc--	Protospacer
******.***********.****  * .****  

176. spacer 1.9|9375|32|CP027025|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 6, identity: 0.812

agcgccaccgcgccgcggacggc--ctcgatcgt	CRISPR spacer
agcgccgccgcgccgcgggcggcggcgtgatc--	Protospacer
******.***********.****  * .****  

177. spacer 1.9|9375|32|CP027025|CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 6, identity: 0.812

agcgccaccgcgccgcggacggcct-cgatcgt	CRISPR spacer
accgcgaccgcgccgcggaccgcctccagtcg-	Protospacer
* *** ************** **** *..*** 

178. spacer 1.9|9375|32|CP027025|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 6, identity: 0.812

agcgccaccgcgccgcggacggc--ctcgatcgt	CRISPR spacer
agcgccgccgcgccgcgggcggcggcgtgatc--	Protospacer
******.***********.****  * .****  

179. spacer 1.12|9008|31|CP027025|CRISPRCasFinder matches to NZ_CP029234 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436d, complete sequence) position: , mismatch: 6, identity: 0.806

aacgtgtcgaggccgatctgcgcgtacttgt	CRISPR spacer
accggatcgaggccgatctgcgcgggcttga	Protospacer
* ** .****************** .**** 

180. spacer 1.12|9008|31|CP027025|CRISPRCasFinder matches to NZ_CP013600 (Rhizobium sp. N741 plasmid pRspN741e, complete sequence) position: , mismatch: 6, identity: 0.806

aacgtgtcgaggccgatctgcgcgt-acttgt	CRISPR spacer
agcgtctggaggccgatctgcgcgtcacccg-	Protospacer
*.*** * ***************** **..* 

181. spacer 1.12|9008|31|CP027025|CRISPRCasFinder matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 6, identity: 0.806

aacgtgtcgaggccgatctgcgcgt-acttgt	CRISPR spacer
aacgtctcgagaccgatctgcgcctgacgcg-	Protospacer
***** *****.*********** * ** .* 

182. spacer 1.12|9008|31|CP027025|CRISPRCasFinder matches to NZ_CP013504 (Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence) position: , mismatch: 6, identity: 0.806

aacgtgtcgaggccgatctgcgcgt-acttgt	CRISPR spacer
agcgtctggaggccgatctgcgcgtcacccg-	Protospacer
*.*** * ***************** **..* 

183. spacer 1.12|9008|31|CP027025|CRISPRCasFinder matches to NZ_CP013510 (Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence) position: , mismatch: 6, identity: 0.806

aacgtgtcgaggccgatctgcgcgt-acttgt	CRISPR spacer
agcgtctggaggccgatctgcgcgtcacccg-	Protospacer
*.*** * ***************** **..* 

184. spacer 1.12|9008|31|CP027025|CRISPRCasFinder matches to NZ_CP013521 (Rhizobium sp. N113 plasmid pRspN113d, complete sequence) position: , mismatch: 6, identity: 0.806

aacgtgtcgaggccgatctgcgcgt-acttgt	CRISPR spacer
agcgtctggaggccgatctgcgcgtcacccg-	Protospacer
*.*** * ***************** **..* 

185. spacer 1.12|9008|31|CP027025|CRISPRCasFinder matches to NZ_CP013494 (Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence) position: , mismatch: 6, identity: 0.806

aacgtgtcgaggccgatctgcgcgt-acttgt	CRISPR spacer
agcgtctggaggccgatctgcgcgtcacccg-	Protospacer
*.*** * ***************** **..* 

186. spacer 1.12|9008|31|CP027025|CRISPRCasFinder matches to NZ_CP013594 (Rhizobium sp. N871 plasmid pRspN871d, complete sequence) position: , mismatch: 6, identity: 0.806

aacgtgtcgaggccgatctgcgcgt-acttgt	CRISPR spacer
agcgtctggaggccgatctgcgcgtcacccg-	Protospacer
*.*** * ***************** **..* 

187. spacer 1.13|9069|31|CP027025|CRISPRCasFinder matches to NZ_CP034811 (Paracoccus sp. Arc7-R13 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806

gtgtcgccaagcgagaggcgcgtcgtgatgg	CRISPR spacer
gaggcgccaagcgaaaggcgggtcgtgaatg	Protospacer
* * **********.***** *******  *

188. spacer 1.17|9314|31|CP027025|CRISPRCasFinder matches to NZ_CP021083 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence) position: , mismatch: 6, identity: 0.806

cgtgccgtccgtgaggccgtgttcgacgagc	CRISPR spacer
ggtgccgtccgtgaggccgcgttcgcaggcc	Protospacer
 ******************.*****  *. *

189. spacer 1.18|9375|31|CP027025|CRISPRCasFinder matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 6, identity: 0.806

agcgccaccgcgccgcggacggc--ctcgatcg	CRISPR spacer
agcgccgccgcgccgcgggcggcggcgtgat--	Protospacer
******.***********.****  * .***  

190. spacer 1.18|9375|31|CP027025|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 6, identity: 0.806

agcgccaccgcgccgcggacggc--ctcgatcg	CRISPR spacer
agcgccgccgcgccgcgggcggcggcgtgat--	Protospacer
******.***********.****  * .***  

191. spacer 1.18|9375|31|CP027025|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 6, identity: 0.806

agcgccaccgcgccgcggacggc--ctcgatcg	CRISPR spacer
agcgccgccgcgccgcgggcggcggcgtgat--	Protospacer
******.***********.****  * .***  

192. spacer 1.19|9436|31|CP027025|CRISPRCasFinder matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

ccccagctcgtcgcctacagcgccggagtcc	CRISPR spacer
ccccacctcgtcgcccacagcgccgccgccg	Protospacer
***** *********.*********  *.* 

193. spacer 1.19|9436|31|CP027025|CRISPRCasFinder matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

ccccagctcgtcgcctacagcgccggagtcc	CRISPR spacer
ccccacctcgtcgcccacagcgccgccgccg	Protospacer
***** *********.*********  *.* 

194. spacer 1.19|9436|31|CP027025|CRISPRCasFinder matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

ccccagctcgtcgcctacagcgccggagtcc	CRISPR spacer
ccccacctcgtcgcccacagcgccgccgccg	Protospacer
***** *********.*********  *.* 

195. spacer 1.19|9436|31|CP027025|CRISPRCasFinder matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

ccccagctcgtcgcctacagcgccggagtcc	CRISPR spacer
ccccacctcgtcgcccacagcgccgccgccg	Protospacer
***** *********.*********  *.* 

196. spacer 1.19|9436|31|CP027025|CRISPRCasFinder matches to KP966108 (Burkholderia phage vB_BceM_AP3, complete genome) position: , mismatch: 6, identity: 0.806

ccccagctcgtcgcctacagcgccggagtcc	CRISPR spacer
ccccagctcgtcgcctccagcgcgcaagcgc	Protospacer
**************** ******  .**. *

197. spacer 1.20|9377|28|CP027025|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.786

agcgccaccgcgccgcggacggcctcga	CRISPR spacer
acgaccaccgcgccggggacggccttgg	Protospacer
*  .*********** *********.*.

198. spacer 1.20|9377|28|CP027025|PILER-CR matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 6, identity: 0.786

agcgccaccgcgccgcggacggcctcga	CRISPR spacer
cgggtgaccgcgccgcggacggcctccc	Protospacer
 * *. ********************  

199. spacer 1.20|9377|28|CP027025|PILER-CR matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 6, identity: 0.786

agcgccaccgcgccgcggacggcctcga	CRISPR spacer
gctgccaccgcctcgcggacggcctcgc	Protospacer
. .******** .************** 

200. spacer 1.20|9377|28|CP027025|PILER-CR matches to MN813693 (Mycobacterium phage Imvubu, complete genome) position: , mismatch: 6, identity: 0.786

agcgccaccgcgccgcggacggcctcga	CRISPR spacer
ctggccaccgcgctgctgacggcctcgg	Protospacer
   **********.** **********.

201. spacer 1.20|9377|28|CP027025|PILER-CR matches to NZ_LR134454 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 12, complete sequence) position: , mismatch: 6, identity: 0.786

agcgccaccgcgccgcggacggcctcga	CRISPR spacer
cgcggcgccgcgccgcggacggcccggg	Protospacer
 *** *.*****************. *.

202. spacer 1.20|9377|28|CP027025|PILER-CR matches to NC_008537 (Arthrobacter sp. FB24 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.786

agcgccaccgcgccgcggacggcctcga	CRISPR spacer
cgcgcgaccgcgccgcggtcggccgtta	Protospacer
 **** ************ ***** . *

203. spacer 1.20|9377|28|CP027025|PILER-CR matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 6, identity: 0.786

agcgccaccgcgccgcggacggcctcga	CRISPR spacer
ccctgcaccgcgccgcgcacggccccga	Protospacer
  *  ************ ******.***

204. spacer 1.20|9377|28|CP027025|PILER-CR matches to MT446395 (UNVERIFIED: Escherichia virus TH21, complete genome) position: , mismatch: 6, identity: 0.786

agcgccaccgcgccgcggacggcctcga	CRISPR spacer
tgcgccaccgcgcggcggacggaacgga	Protospacer
 ************ ********  . **

205. spacer 1.20|9377|28|CP027025|PILER-CR matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 6, identity: 0.786

agcgccaccgcgccgcggacggcctcga	CRISPR spacer
tgcgccaccgcgacgcggacggtgacgg	Protospacer
 *********** *********.  **.

206. spacer 1.20|9377|28|CP027025|PILER-CR matches to NZ_CP011515 (Mitsuaria sp. 7 plasmid, complete sequence) position: , mismatch: 6, identity: 0.786

agcgccaccgcgccgcggacggcctcga	CRISPR spacer
tgcgccagcgcgccgaggacggccatgc	Protospacer
 ****** ******* ******** .* 

207. spacer 1.20|9377|28|CP027025|PILER-CR matches to NZ_LR134461 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 19, complete sequence) position: , mismatch: 6, identity: 0.786

agcgccaccgcgccgcggacggcctcga	CRISPR spacer
agcgtcaccgcggcgcggacggcgaagg	Protospacer
****.******* **********   *.

208. spacer 1.20|9377|28|CP027025|PILER-CR matches to NZ_CP027299 (Streptomyces sp. SGAir0924 plasmid unnamed_5) position: , mismatch: 6, identity: 0.786

agcgccaccgcgccgcggacggcctcga	CRISPR spacer
acggccactgcgccgcggccggcctcac	Protospacer
*  *****.********* *******. 

209. spacer 1.20|9377|28|CP027025|PILER-CR matches to MK376956 (Gordonia phage WilliamBoone, complete genome) position: , mismatch: 6, identity: 0.786

agcgccaccgcgccgcggacggcctcga	CRISPR spacer
aggagatccgcgccgcggccggcctcga	Protospacer
** .   *********** *********

210. spacer 1.21|9438|28|CP027025|PILER-CR matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 6, identity: 0.786

ccccagctcgtcgcctacagcgccggag	CRISPR spacer
acccagctcgacggctacagcgccgagc	Protospacer
 ********* ** ***********.. 

211. spacer 1.21|9438|28|CP027025|PILER-CR matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 6, identity: 0.786

ccccagctcgtcgcctacagcgccggag	CRISPR spacer
tcccagctcgacggctacagcgccgagc	Protospacer
.********* ** ***********.. 

212. spacer 1.21|9438|28|CP027025|PILER-CR matches to NZ_CP021028 (Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence) position: , mismatch: 6, identity: 0.786

ccccagctcgtcgcctacagcgccggag	CRISPR spacer
acccagctcgacggctacagcgcccaaa	Protospacer
 ********* ** ********** .*.

213. spacer 2.7|18353|28|CP027025|PILER-CR matches to NZ_CP017759 (Cupriavidus necator strain NH9 plasmid pENH92, complete sequence) position: , mismatch: 6, identity: 0.786

agtaccagcgccccggacgcggcgacct	CRISPR spacer
ctttgcagcgccccggacgcggcgtcca	Protospacer
  *  ******************* ** 

214. spacer 2.7|18353|28|CP027025|PILER-CR matches to NZ_CP007144 (Hymenobacter swuensis DY53 plasmid pHsw1, complete sequence) position: , mismatch: 6, identity: 0.786

agtaccagcgccccggacgcggcgacct	CRISPR spacer
ggcaccagcgccctggacgtggcgacgg	Protospacer
.*.**********.*****.******  

215. spacer 2.7|18353|28|CP027025|PILER-CR matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.786

agtaccagcgccccggacgcggcgacct	CRISPR spacer
agtgccagcgcctcggacgcggccccga	Protospacer
***.********.**********  *  

216. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044333 (Methylocystis parvus strain BRCS2 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

tctgcggcggccggcgccgggccgcgcttggg	CRISPR spacer
tccgcggcggccggcgccgcgccgcgcgtttt	Protospacer
**.**************** ******* *   

217. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034813 (Paracoccus sp. Arc7-R13 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

tctgcggcggccggcgccgggccgcgcttggg	CRISPR spacer
acgccggcggccagcgcctggccgcgcttgcg	Protospacer
 *  ********.***** *********** *

218. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 6, identity: 0.812

tctgcggcggccggcgccgggccg-cgcttggg	CRISPR spacer
cgtgcggctgccggagccgggccgccgcttcg-	Protospacer
. ****** ***** ********* ***** * 

219. spacer 3.16|19524|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020900 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence) position: , mismatch: 6, identity: 0.812

ggcgggatgtcgaggcgttcgatgccggtggt	CRISPR spacer
ggctggatgacgaggcgttcgatgccgcctat	Protospacer
*** ***** ***************** . .*

220. spacer 3.16|19524|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013526 (Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence) position: , mismatch: 6, identity: 0.812

ggcgggatgtcgaggcgttcgatgccggtggt	CRISPR spacer
ggctggatgacgaggcgttcgatgccgcctat	Protospacer
*** ***** ***************** . .*

221. spacer 3.16|19524|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013589 (Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence) position: , mismatch: 6, identity: 0.812

ggcgggatgtcgaggcgttcgatgccggtggt	CRISPR spacer
ggctggatgacgaggcgttcgatgccgcctat	Protospacer
*** ***** ***************** . .*

222. spacer 3.16|19524|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 6, identity: 0.812

ggcgggatgtcgaggcgttcgatgccggtggt	CRISPR spacer
ggctggatgacgaggcgttcgatgccgcctat	Protospacer
*** ***** ***************** . .*

223. spacer 3.16|19524|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 6, identity: 0.812

ggcgggatgtcgaggcgttcgatgccggtggt	CRISPR spacer
ggctggatgacgaggcgttcgatgccgcctat	Protospacer
*** ***** ***************** . .*

224. spacer 3.16|19524|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013536 (Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence) position: , mismatch: 6, identity: 0.812

ggcgggatgtcgaggcgttcgatgccggtggt	CRISPR spacer
ggctggatgacgaggcgttcgatgccgcctat	Protospacer
*** ***** ***************** . .*

225. spacer 3.16|19524|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 6, identity: 0.812

ggcgggatgtcgaggcgttcgatgccggtggt	CRISPR spacer
ggctggatgacgaggcgttcgatgccgcctat	Protospacer
*** ***** ***************** . .*

226. spacer 3.16|19524|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 6, identity: 0.812

ggcgggatgtcgaggcgttcgatgccggtggt	CRISPR spacer
ggctggatgacgaggcgttcgatgccgcctat	Protospacer
*** ***** ***************** . .*

227. spacer 3.16|19524|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 6, identity: 0.812

ggcgggatgtcgaggcgttcgatgccggtggt	CRISPR spacer
ggctggatgacgaggcgttcgatgccgcctat	Protospacer
*** ***** ***************** . .*

228. spacer 3.16|19524|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 6, identity: 0.812

ggcgggatgtcgaggcgttcgatgccggtggt	CRISPR spacer
ggctggatgacgaggcgttcgatgccgcctat	Protospacer
*** ***** ***************** . .*

229. spacer 3.16|19524|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NC_010997 (Rhizobium etli CIAT 652 plasmid pC, complete sequence) position: , mismatch: 6, identity: 0.812

ggcgggatgtcgaggcgttcgatgccggtggt	CRISPR spacer
ggctggatgacgaggcgttcgatgccgcctat	Protospacer
*** ***** ***************** . .*

230. spacer 7.3|31001|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP026529 (Sinorhizobium meliloti strain AK21 plasmid pSmeAK21b, complete sequence) position: , mismatch: 6, identity: 0.812

gcagccccgatgacggccgcccactcgcctac	CRISPR spacer
gcagccctgatgacggccgaccactgggccgc	Protospacer
*******.*********** ***** * *..*

231. spacer 7.5|31123|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045549 (Streptomyces sp. SYP-A7193 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

tcgaccggcccgcgcccgtactcggccggcag-	CRISPR spacer
aagacccgcccgcgccggtactcgg-cggcggc	Protospacer
  **** ********* ******** ****.* 

232. spacer 7.6|31184|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014599 (Yangia sp. CCB-MM3 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.812

gccgagctc---ctcgggaacctcttccgcgccct	CRISPR spacer
---gagatctcgctcggggacatcttccgcgccct	Protospacer
   *** **   ******.** *************

233. spacer 1.1|8886|32|CP027025|CRT matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 7, identity: 0.781

aagcccaggtccgggccctggacgaaccagga	CRISPR spacer
atgcccaggtccgcgccctggtcgatcaggaa	Protospacer
* *********** ******* *** * .*.*

234. spacer 1.8|9314|32|CP027025|CRT matches to NZ_CP021083 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence) position: , mismatch: 7, identity: 0.781

cgtgccgtccgtgaggccgtgttcgacgagct	CRISPR spacer
ggtgccgtccgtgaggccgcgttcgcaggcca	Protospacer
 ******************.*****  *. * 

235. spacer 1.8|9314|32|CP027025|CRT matches to NZ_CP010990 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence) position: , mismatch: 7, identity: 0.781

cgtgccgtccgtgaggccgtgttcgacgagct	CRISPR spacer
ggtgccgtccgcgaggtcgtgttccccgcggt	Protospacer
 **********.****.*******  ** * *

236. spacer 1.9|9375|32|CP027025|CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 7, identity: 0.781

agcgccaccgcgccgcggacggcctcgatcgt	CRISPR spacer
atccacaccgagccgcgcacggcctcgacctt	Protospacer
* *  ***** ****** **********.* *

237. spacer 1.9|9375|32|CP027025|CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 7, identity: 0.781

agcgccaccgcgccgcggacggcct-cgatcgt	CRISPR spacer
aaagcgaccgcgccgcggaccgcctccagtcg-	Protospacer
*. ** ************** **** *..*** 

238. spacer 1.10|9436|32|CP027025|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

ccccagctcgtcgcctacagcgccggagtcct	CRISPR spacer
ccccacctcgtcgcccacagcgccgccgccgc	Protospacer
***** *********.*********  *.* .

239. spacer 1.10|9436|32|CP027025|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

ccccagctcgtcgcctacagcgccggagtcct	CRISPR spacer
ccccacctcgtcgcccacagcgccgccgccgc	Protospacer
***** *********.*********  *.* .

240. spacer 1.10|9436|32|CP027025|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

ccccagctcgtcgcctacagcgccggagtcct	CRISPR spacer
ccccacctcgtcgcccacagcgccgccgccgc	Protospacer
***** *********.*********  *.* .

241. spacer 1.10|9436|32|CP027025|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

ccccagctcgtcgcctacagcgccggagtcct	CRISPR spacer
ccccacctcgtcgcccacagcgccgccgccgc	Protospacer
***** *********.*********  *.* .

242. spacer 1.10|9436|32|CP027025|CRT matches to KP966108 (Burkholderia phage vB_BceM_AP3, complete genome) position: , mismatch: 7, identity: 0.781

ccccagctcgtcgcctacagcgccggagtcct	CRISPR spacer
ccccagctcgtcgcctccagcgcgcaagcgcc	Protospacer
**************** ******  .**. *.

243. spacer 1.12|9008|31|CP027025|CRISPRCasFinder matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.774

-aacgtgtcgaggccgatctgcgcgtacttgt	CRISPR spacer
tggcg-gtcgcggccgatctgcccgtactgct	Protospacer
 ..** **** *********** ******  *

244. spacer 1.14|9130|31|CP027025|CRISPRCasFinder matches to NZ_CP045377 (Sulfitobacter sp. THAF37 plasmid pTHAF37_e, complete sequence) position: , mismatch: 7, identity: 0.774

--gtagtcctcgaaggacagcagggtcgtggcg	CRISPR spacer
caccag--gtcgatggacagcagggttgtggcg	Protospacer
   .**   **** ************.******

245. spacer 1.15|9191|32|CP027025|CRISPRCasFinder matches to KY006853 (Erythrobacter phage vB_EliS_R6L, complete genome) position: , mismatch: 7, identity: 0.781

---gtccgtcttcgggtcgtcctcgaacacctccc	CRISPR spacer
cgggtcgg---tcgcgtcgtcctcgaacgcctccg	Protospacer
   *** *   *** *************.***** 

246. spacer 1.17|9314|31|CP027025|CRISPRCasFinder matches to NC_023284 (Streptomyces sp. F2 plasmid pFRL4, complete sequence) position: , mismatch: 7, identity: 0.774

cgtgccgtccgtgaggccgtgttc---gacgagc	CRISPR spacer
ggtgccgtccgggagggcgtgttcccacacg---	Protospacer
 ********** **** *******    ***   

247. spacer 1.17|9314|31|CP027025|CRISPRCasFinder matches to KC292024 (Halovirus HHTV-2, complete genome) position: , mismatch: 7, identity: 0.774

cgtgccgtccgtgaggccgtgttcgacgagc	CRISPR spacer
gtagccctccgtgaggccgtgttcgttgacc	Protospacer
   *** ****************** .** *

248. spacer 1.17|9314|31|CP027025|CRISPRCasFinder matches to NZ_CP010990 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence) position: , mismatch: 7, identity: 0.774

cgtgccgtccgtgaggccgtgttcgacgagc	CRISPR spacer
ggtgccgtccgcgaggtcgtgttccccgcgg	Protospacer
 **********.****.*******  ** * 

249. spacer 1.18|9375|31|CP027025|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.774

agcgccaccgcgccgcggacggcctcgatcg	CRISPR spacer
cgcgccactgcgcggcggacggcctcggcga	Protospacer
 *******.**** *************.. .

250. spacer 1.18|9375|31|CP027025|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 7, identity: 0.774

agcgccaccgcgccgcggacggcctcgatcg	CRISPR spacer
gcctgccccgggccgccgacggcctcgatcg	Protospacer
. *  * *** ***** **************

251. spacer 1.18|9375|31|CP027025|CRISPRCasFinder matches to NZ_CP006991 (Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence) position: , mismatch: 7, identity: 0.774

agcgccaccgcgccgcggacggcctcgatcg	CRISPR spacer
gccgccaccgcctcgcggacggcctcgccct	Protospacer
. ********* .************** .* 

252. spacer 1.18|9375|31|CP027025|CRISPRCasFinder matches to NC_007764 (Rhizobium etli CFN 42 plasmid p42c, complete sequence) position: , mismatch: 7, identity: 0.774

agcgccaccgcgccgcggacggcctcgatcg	CRISPR spacer
gccgccaccgcctcgcggacggcctcgccct	Protospacer
. ********* .************** .* 

253. spacer 1.18|9375|31|CP027025|CRISPRCasFinder matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.774

agcgccaccgcgccgcggacggcctcgatcg	CRISPR spacer
cgtgccaccgcgccgcggacggtctcctgcc	Protospacer
 *.*******************.***   * 

254. spacer 1.18|9375|31|CP027025|CRISPRCasFinder matches to NZ_CP013524 (Rhizobium phaseoli strain R744 plasmid pRphaR744b, complete sequence) position: , mismatch: 7, identity: 0.774

agcgccaccgcgccgcggacggcctcgatcg	CRISPR spacer
ctcgccaccgcctcgcggacggcctcgccct	Protospacer
  ********* .************** .* 

255. spacer 1.18|9375|31|CP027025|CRISPRCasFinder matches to NZ_CP020908 (Rhizobium etli strain NXC12 plasmid pRetNXC12b, complete sequence) position: , mismatch: 7, identity: 0.774

agcgccaccgcgccgcggacggcctcgatcg	CRISPR spacer
gccgccaccgcctcgcggacggcctcgccct	Protospacer
. ********* .************** .* 

256. spacer 1.18|9375|31|CP027025|CRISPRCasFinder matches to NC_021907 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1b, complete sequence) position: , mismatch: 7, identity: 0.774

agcgccaccgcgccgcggacggcctcgatcg	CRISPR spacer
gccgccaccgcctcgcggacggcctcgccct	Protospacer
. ********* .************** .* 

257. spacer 1.18|9375|31|CP027025|CRISPRCasFinder matches to NZ_CP021128 (Rhizobium sp. Kim5 plasmid pRetKim5d, complete sequence) position: , mismatch: 7, identity: 0.774

agcgccaccgcgccgcggacggcctcgatcg	CRISPR spacer
gccgccaccgcctcgcggacggcctcgccct	Protospacer
. ********* .************** .* 

258. spacer 1.18|9375|31|CP027025|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 7, identity: 0.774

agcgccaccgcgccgcggacggcctcgatcg	CRISPR spacer
gcctgccccgggccgccgacggcctcgatcg	Protospacer
. *  * *** ***** **************

259. spacer 1.18|9375|31|CP027025|CRISPRCasFinder matches to CP007645 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803d, complete sequence) position: , mismatch: 7, identity: 0.774

agcgccaccgcgccgcggacggcctcgatcg	CRISPR spacer
gccgccaccgcctcgcggacggcctcgccct	Protospacer
. ********* .************** .* 

260. spacer 1.18|9375|31|CP027025|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 7, identity: 0.774

agcgccaccgcgccgcggacggcctcgatcg	CRISPR spacer
gcctgccccgggccgccgacggcctcgatcg	Protospacer
. *  * *** ***** **************

261. spacer 1.18|9375|31|CP027025|CRISPRCasFinder matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 7, identity: 0.774

agcgccaccgcgccgcggacggcctcgatcg	CRISPR spacer
acctccaccgcgcagcggaccgcctcgacga	Protospacer
* * ********* ****** *******. .

262. spacer 1.18|9375|31|CP027025|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 7, identity: 0.774

agcgccaccgcgccgcggacggcctcgatcg	CRISPR spacer
acctccaccgcgcagcggaccgcctcgacga	Protospacer
* * ********* ****** *******. .

263. spacer 1.18|9375|31|CP027025|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 7, identity: 0.774

agcgccaccgcgccgcggacggcctcgatcg	CRISPR spacer
acctccaccgcgcagcggaccgcctcgacga	Protospacer
* * ********* ****** *******. .

264. spacer 1.18|9375|31|CP027025|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 7, identity: 0.774

agcgccaccgcgccgcggacggcctcgatcg	CRISPR spacer
atccacaccgagccgcgcacggcctcgacct	Protospacer
* *  ***** ****** **********.* 

265. spacer 1.18|9375|31|CP027025|CRISPRCasFinder matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 7, identity: 0.774

agcgccaccgcgccgcggacggcctcgatcg	CRISPR spacer
accgcgaccgcgccgcggaccgcctccagtc	Protospacer
* *** ************** ***** * . 

266. spacer 1.18|9375|31|CP027025|CRISPRCasFinder matches to NZ_LR134461 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 19, complete sequence) position: , mismatch: 7, identity: 0.774

agcgccaccgcgccgcggacggcctcgatcg	CRISPR spacer
agcgtcaccgcggcgcggacggcgaagggcg	Protospacer
****.******* **********   *. **

267. spacer 1.19|9436|31|CP027025|CRISPRCasFinder matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 7, identity: 0.774

ccccagctcgtcgcctacagcgccggagtcc	CRISPR spacer
ctccagcttgtcgcctccagcgccgccgatc	Protospacer
*.******.******* ********  * .*

268. spacer 1.20|9377|28|CP027025|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.75

agcgccaccgcgccgcggacggcctcga	CRISPR spacer
gacgccaccgcgccgaggacggccaacg	Protospacer
..************* ********   .

269. spacer 1.20|9377|28|CP027025|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.75

agcgccaccgcgccgcggacggcctcga	CRISPR spacer
gcggccaccgcgccggggacggcccgca	Protospacer
.  ************ ********.  *

270. spacer 1.20|9377|28|CP027025|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.75

agcgccaccgcgccgcggacggcctcga	CRISPR spacer
ttgcccaccgcgcggcggacggcctggg	Protospacer
    ********* *********** *.

271. spacer 1.20|9377|28|CP027025|PILER-CR matches to NZ_CP003988 (Streptomyces sp. 769 plasmid pSGZL, complete sequence) position: , mismatch: 7, identity: 0.75

agcgccaccgcgccgcggacggcctcga	CRISPR spacer
tcttccagcgcggcgcggacggcctcgg	Protospacer
  . *** **** **************.

272. spacer 1.20|9377|28|CP027025|PILER-CR matches to NZ_CP015882 (Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence) position: , mismatch: 7, identity: 0.75

agcgccaccgcgccgcggacggcctcga	CRISPR spacer
agcgccagcgcgccgctgacggcaaaac	Protospacer
******* ******** ******   . 

273. spacer 1.20|9377|28|CP027025|PILER-CR matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 7, identity: 0.75

agcgccaccgcgccgcggacggcctcga	CRISPR spacer
agcgccagcgcgccgctgacggcaaaac	Protospacer
******* ******** ******   . 

274. spacer 1.21|9438|28|CP027025|PILER-CR matches to NZ_CP050093 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence) position: , mismatch: 7, identity: 0.75

ccccagctcgtcgcctacagcgccggag	CRISPR spacer
tcccagctcgacggctacagcgcccaga	Protospacer
.********* ** ********** ...

275. spacer 1.21|9438|28|CP027025|PILER-CR matches to NZ_CP050082 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence) position: , mismatch: 7, identity: 0.75

ccccagctcgtcgcctacagcgccggag	CRISPR spacer
acccagctcgacggctacagcgcccaga	Protospacer
 ********* ** ********** ...

276. spacer 1.21|9438|28|CP027025|PILER-CR matches to NC_008384 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence) position: , mismatch: 7, identity: 0.75

ccccagctcgtcgcctacagcgccggag	CRISPR spacer
tcccagctcgacggctacagcgcccaga	Protospacer
.********* ** ********** ...

277. spacer 1.21|9438|28|CP027025|PILER-CR matches to NZ_CP025014 (Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence) position: , mismatch: 7, identity: 0.75

ccccagctcgtcgcctacagcgccggag	CRISPR spacer
tcccagctcgacggctacagcgcccaga	Protospacer
.********* ** ********** ...

278. spacer 1.21|9438|28|CP027025|PILER-CR matches to NZ_CP049732 (Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence) position: , mismatch: 7, identity: 0.75

ccccagctcgtcgcctacagcgccggag	CRISPR spacer
acccagctcgacggctacagcgcccaga	Protospacer
 ********* ** ********** ...

279. spacer 1.21|9438|28|CP027025|PILER-CR matches to NZ_CP053441 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence) position: , mismatch: 7, identity: 0.75

ccccagctcgtcgcctacagcgccggag	CRISPR spacer
tcccagctcgacggctacagcgcccaga	Protospacer
.********* ** ********** ...

280. spacer 1.21|9438|28|CP027025|PILER-CR matches to NZ_CP013503 (Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence) position: , mismatch: 7, identity: 0.75

ccccagctcgtcgcctacagcgccggag	CRISPR spacer
acccagctcgacggctacagcgcccaga	Protospacer
 ********* ** ********** ...

281. spacer 1.21|9438|28|CP027025|PILER-CR matches to NZ_CP048282 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence) position: , mismatch: 7, identity: 0.75

ccccagctcgtcgcctacagcgccggag	CRISPR spacer
tcccagctcgacggctacagcgcccaga	Protospacer
.********* ** ********** ...

282. spacer 1.21|9438|28|CP027025|PILER-CR matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 7, identity: 0.75

ccccagctcgtcgcctacagcgccggag	CRISPR spacer
gaccagctcgtcgcctacggcgtcgtgc	Protospacer
  ****************.***.** . 

283. spacer 1.21|9438|28|CP027025|PILER-CR matches to NZ_CP013509 (Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence) position: , mismatch: 7, identity: 0.75

ccccagctcgtcgcctacagcgccggag	CRISPR spacer
acccagctcgacggctacagcgcccaga	Protospacer
 ********* ** ********** ...

284. spacer 1.21|9438|28|CP027025|PILER-CR matches to NZ_CP013520 (Rhizobium sp. N113 plasmid pRspN113c, complete sequence) position: , mismatch: 7, identity: 0.75

ccccagctcgtcgcctacagcgccggag	CRISPR spacer
acccagctcgacggctacagcgcccaga	Protospacer
 ********* ** ********** ...

285. spacer 1.21|9438|28|CP027025|PILER-CR matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 7, identity: 0.75

ccccagctcgtcgcctacagcgccggag	CRISPR spacer
acccagctcgacggctacagcgcccagc	Protospacer
 ********* ** ********** .. 

286. spacer 1.21|9438|28|CP027025|PILER-CR matches to NZ_CP013493 (Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence) position: , mismatch: 7, identity: 0.75

ccccagctcgtcgcctacagcgccggag	CRISPR spacer
acccagctcgacggctacagcgcccaga	Protospacer
 ********* ** ********** ...

287. spacer 1.21|9438|28|CP027025|PILER-CR matches to NZ_CP013516 (Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence) position: , mismatch: 7, identity: 0.75

ccccagctcgtcgcctacagcgccggag	CRISPR spacer
acccagctcgacggctacagcgcccaga	Protospacer
 ********* ** ********** ...

288. spacer 1.21|9438|28|CP027025|PILER-CR matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 7, identity: 0.75

ccccagctcgtcgcctacagcgccggag	CRISPR spacer
acccagctcgacggctacagcgcccagc	Protospacer
 ********* ** ********** .. 

289. spacer 1.21|9438|28|CP027025|PILER-CR matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 7, identity: 0.75

ccccagctcgtcgcctacagcgccggag	CRISPR spacer
gtccagcccgtcgcctgcagcgccgcgc	Protospacer
 .*****.********.******** . 

290. spacer 1.21|9438|28|CP027025|PILER-CR matches to NZ_CP053208 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence) position: , mismatch: 7, identity: 0.75

ccccagctcgtcgcctacagcgccggag	CRISPR spacer
acccagctcgacggctacagcgcccaga	Protospacer
 ********* ** ********** ...

291. spacer 2.1|18044|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 7, identity: 0.781

ggtgacggtcacgggcggtgctcctgggcggt	CRISPR spacer
gctcttgttcacgggtggtgctcctgggaggt	Protospacer
* *  .* *******.************ ***

292. spacer 2.1|18044|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 7, identity: 0.781

ggtgacggtcacgggcggtgctcctgggcggt	CRISPR spacer
gatgccggtcacgggcggggctcctcgcgggg	Protospacer
*.** ************* ****** *  ** 

293. spacer 2.5|18288|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134469 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 27, complete sequence) position: , mismatch: 7, identity: 0.781

taccggacggcgctggaggccggtccgatcca	CRISPR spacer
taccgggcggcgctggaggccggactcgacga	Protospacer
******.**************** *. . * *

294. spacer 2.6|18349|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

agtaccagcgccccggacgcggcgacctgcat	CRISPR spacer
accaccggcgccccggacgcggcgaccgaccg	Protospacer
* .***.******************** .*  

295. spacer 2.6|18349|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

agtaccagcgccccggacgcggcgacctgcat	CRISPR spacer
accaccggcgccccggacgcggcgaccgaccg	Protospacer
* .***.******************** .*  

296. spacer 2.6|18349|32|CP027025|CRISPRCasFinder,CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

agtaccagcgccccggacgcggcgacctgcat	CRISPR spacer
accaccggcgccccggacgcggcgaccgaccg	Protospacer
* .***.******************** .*  

297. spacer 2.6|18349|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP016453 (Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence) position: , mismatch: 7, identity: 0.781

agtaccagcgccccggacgcggcgacctgcat	CRISPR spacer
cgcaccagcgcctcgaacgcggcgacctcatt	Protospacer
 *.*********.**.************   *

298. spacer 2.6|18349|32|CP027025|CRISPRCasFinder,CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.781

agtaccagcgccccggacgcgg---cgacctgcat	CRISPR spacer
agtgccagcgcctcggacgcggccccgacgcg---	Protospacer
***.********.*********   **** .*   

299. spacer 2.7|18353|28|CP027025|PILER-CR matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 7, identity: 0.75

agtaccagcgccccggacgcggcgacct	CRISPR spacer
tccaccagcgacccggacccggcgacga	Protospacer
  .******* ******* *******  

300. spacer 2.7|18353|28|CP027025|PILER-CR matches to NZ_CP032313 (Pannonibacter phragmitetus BB plasmid p.BB_1, complete sequence) position: , mismatch: 7, identity: 0.75

agtaccagcgccccggacgcggcgacct	CRISPR spacer
caggccagcgcccgggacgcggtgaccg	Protospacer
 . .********* ********.**** 

301. spacer 2.7|18353|28|CP027025|PILER-CR matches to NZ_CP006369 (Aureimonas sp. AU20 plasmid pAU20b, complete sequence) position: , mismatch: 7, identity: 0.75

agtaccagcgccccggacgcggcgacct	CRISPR spacer
cccgccagcgcgccggacgcgacgaccg	Protospacer
  ..******* *********.***** 

302. spacer 2.7|18353|28|CP027025|PILER-CR matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.75

agtaccagcgccccggacgcggcgacct	CRISPR spacer
tcgaccagcgacccggacccggcgacga	Protospacer
   ******* ******* *******  

303. spacer 2.7|18353|28|CP027025|PILER-CR matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.75

agtaccagcgccccggacgcggcgacct	CRISPR spacer
tcgaccagcgacccggacccggcgacga	Protospacer
   ******* ******* *******  

304. spacer 2.7|18353|28|CP027025|PILER-CR matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.75

agtaccagcgccccggacgcggcgacct	CRISPR spacer
tcgaccagcgacccggacccggcgacga	Protospacer
   ******* ******* *******  

305. spacer 2.7|18353|28|CP027025|PILER-CR matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.75

agtaccagcgccccggacgcggcgacct	CRISPR spacer
tcgaccagcgacccggacccggcgacga	Protospacer
   ******* ******* *******  

306. spacer 2.7|18353|28|CP027025|PILER-CR matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.75

agtaccagcgccccggacgcggcgacct	CRISPR spacer
tcgaccagcgacccggacccggcgacga	Protospacer
   ******* ******* *******  

307. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to LT599585 (Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid) position: , mismatch: 7, identity: 0.781

gccgcagccgcccgcgcggcagg-----ccacggaga	CRISPR spacer
gccgcagtcgcccgcgaggcaggcgtatccac-----	Protospacer
*******.******** ******     ****     

308. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
ggcgagcgcgcccgtgcggcaggcctcggaga	Protospacer
* ** .  ******.********** ******

309. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to CP000622 (Burkholderia phage phiE255, complete genome) position: , mismatch: 7, identity: 0.781

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
gcgcaagcagcgcgcgcggcaggccacggcaa	Protospacer
**   *** ** ***************** .*

310. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NC_009237 (Burkholderia phage phiE255 chromosome, complete genome) position: , mismatch: 7, identity: 0.781

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
gcgcaagcagcgcgcgcggcaggccacggcaa	Protospacer
**   *** ** ***************** .*

311. spacer 3.10|19158|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

gagggcgtgtagctctcctcgaagggggtgcc----	CRISPR spacer
gagggcatgtagctctgctcgaa----atgccacag	Protospacer
******.********* ******    .****    

312. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NC_018452 (Burkholderia phage DC1, complete genome) position: , mismatch: 7, identity: 0.781

tctgcggcggccggcgccgggccgcgcttggg	CRISPR spacer
ggtgcggcggccggcgccgcgccgggctgctg	Protospacer
  ***************** **** ***   *

313. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to AB981169 (Ralstonia phage RSY1 DNA, complete genome) position: , mismatch: 7, identity: 0.781

tctgcggcggccggcgccgggccgcgcttggg	CRISPR spacer
gttgcggcggccggcgcctgggcgcgcgcggc	Protospacer
 .**************** ** ***** .** 

314. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020909 (Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence) position: , mismatch: 7, identity: 0.781

tctgcggcggccggcgccgggccgcgcttggg	CRISPR spacer
tcagcggcggccggcgcctggccaggcattgc	Protospacer
** *************** ****. ** * * 

315. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NC_021908 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence) position: , mismatch: 7, identity: 0.781

tctgcggcggccggcgccgggccgcgcttggg	CRISPR spacer
tcagcggcggccggcgcctggccaggcattgc	Protospacer
** *************** ****. ** * * 

316. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

tctgcggcggccggcgccgggccg-cgcttggg	CRISPR spacer
gctgcgtcggccggcgccggtccgacgatccg-	Protospacer
 ***** ************* *** ** *. * 

317. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 7, identity: 0.781

tctgcggcg-gccggcgccgggccgcgcttggg	CRISPR spacer
-cggttgtgtgccggtgccgggccgcgcatggg	Protospacer
 * *. *.* *****.************ ****

318. spacer 3.12|19280|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 7, identity: 0.781

ggacgacgagcagggcgagcgtggaca-cggtg	CRISPR spacer
ggacggcgagcacggcgagcgtgaagagcagc-	Protospacer
*****.****** **********.* * *.*. 

319. spacer 3.13|19341|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to MK059749 (Mycobacterium phage CRB2, complete genome) position: , mismatch: 7, identity: 0.781

acggcgtgcgtgcagtgtgcacagagcggaaa	CRISPR spacer
acggcgggcgtgcagtgggcacagatacgatc	Protospacer
****** ********** *******   **  

320. spacer 3.16|19524|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035512 (Haematobacter massiliensis strain OT1 plasmid pOT1-2, complete sequence) position: , mismatch: 7, identity: 0.781

ggcgggat-gtcgaggcgttcgatgccggtggt	CRISPR spacer
-ccgagttcgtcgaggcgatcgaagccggtggc	Protospacer
  **.* * ********* **** ********.

321. spacer 3.17|19585|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NC_029046 (Sinorhizobium phage phiLM21, complete genome) position: , mismatch: 7, identity: 0.781

gactcggag---aggatctccaggttgtcttcctt	CRISPR spacer
---ttgaagagcaggatcgccaggctgtcttcctt	Protospacer
   *.*.**   ****** *****.**********

322. spacer 3.18|19646|33|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013256 (Kocuria flava strain HO-9041 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.788

ttaactgttcccgttcgtagccgtaacggtccg	CRISPR spacer
tgaggtagtcccggtcgtagccgtaccggtccg	Protospacer
* *. *. ***** *********** *******

323. spacer 3.18|19646|33|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024583 (Roseomonas sp. FDAARGOS_362 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.788

ttaactgttcccgttcgtagccgtaacggtccg	CRISPR spacer
tgatgtagtcccggtcgtagccgtaagggtccg	Protospacer
* *  *. ***** ************ ******

324. spacer 3.20|19769|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 7, identity: 0.781

aagtgctcggcgatccgcaggcggcggaggct	CRISPR spacer
gcgtcctcggcgacccgcaggcggcggagcgc	Protospacer
. ** ********.***************  .

325. spacer 3.20|19769|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015216 (Rhodobacter sphaeroides strain MBTLJ-13 plasmid e, complete sequence) position: , mismatch: 7, identity: 0.781

aagtgctcggcgatccgcaggcggcggaggct	CRISPR spacer
cgcagctcggcgatgcgcaggcggcggcggcg	Protospacer
 .  ********** ************ *** 

326. spacer 3.20|19769|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034650 (Xanthomonas vasicola strain NCPPB 1060 plasmid pXVH29, complete sequence) position: , mismatch: 7, identity: 0.781

aagtgctc-ggcgatccgcaggcggcggaggct	CRISPR spacer
-agcgtgcgggcaatccgcaggcggcggtggcg	Protospacer
 **.*. * ***.*************** *** 

327. spacer 3.20|19769|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034652 (Xanthomonas vasicola strain NCPPB 1060 plasmid pXVH14, complete sequence) position: , mismatch: 7, identity: 0.781

aagtgctc-ggcgatccgcaggcggcggaggct	CRISPR spacer
-agcgtgcgggcaatccgcaggcggcggtggcg	Protospacer
 **.*. * ***.*************** *** 

328. spacer 4.2|28389|31|CP027025|CRT matches to NZ_CP020540 (Sphingobium herbicidovorans strain MH plasmid pSHV1, complete sequence) position: , mismatch: 7, identity: 0.774

gagcggg---catcgtcggggccggggagcgtgt	CRISPR spacer
---cgcgcaccatcgtcggggccggtgagcgtcg	Protospacer
   ** *   *************** ******  

329. spacer 4.2|28389|31|CP027025|CRT matches to NC_008741 (Desulfovibrio vulgaris DP4 plasmid pDVUL01, complete sequence) position: , mismatch: 7, identity: 0.774

gagcgggcatcgtcggggccggggagcgtgt	CRISPR spacer
gacggctcatcgtcggggctggcgagcgtga	Protospacer
**  *  ************.** ******* 

330. spacer 4.3|28449|32|CP027025|CRT matches to NZ_CP032697 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525a, complete sequence) position: , mismatch: 7, identity: 0.781

gcttcacgg---acccgccgagcaccattgttggc	CRISPR spacer
---tgaaggccaacccgccgaacaccgttgttggc	Protospacer
   * * **   *********.****.********

331. spacer 5.2|28695|32|CP027025|CRISPRCasFinder matches to NZ_CP018231 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed3) position: , mismatch: 7, identity: 0.781

agggtacccgcagcgtggccctgctcgatgcg	CRISPR spacer
ggacgacccgcagcgtggccctgaccgatgcc	Protospacer
.*.  ****************** .****** 

332. spacer 5.2|28695|32|CP027025|CRISPRCasFinder matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 7, identity: 0.781

agggtacccgcagcgtggccctgctcgatgcg	CRISPR spacer
ggacgacccgcagcgtggccctgaccgatgcc	Protospacer
.*.  ****************** .****** 

333. spacer 5.2|28695|32|CP027025|CRISPRCasFinder matches to NZ_CP016292 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.781

agggtacccgcagcgtggccctgctcgatgcg	CRISPR spacer
ggacgacccgcagcgtggccctgaccgatgcc	Protospacer
.*.  ****************** .****** 

334. spacer 5.2|28695|32|CP027025|CRISPRCasFinder matches to NZ_CP014598 (Yangia sp. CCB-MM3 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

agggtacccgcagcgtggccctgctcgatgcg	CRISPR spacer
tcagcgcccgccgcgtggcccttctcgatgcg	Protospacer
  .*..***** ********** *********

335. spacer 5.2|28695|32|CP027025|CRISPRCasFinder matches to NZ_CP032676 (Rhodococcus rhodochrous strain ATCC BAA870 plasmid pNit, complete sequence) position: , mismatch: 7, identity: 0.781

agggtacccgcagcgtggccctgctcgatgcg	CRISPR spacer
cccgtacccgcagccgggccctgctcgacccg	Protospacer
   ***********  ************. **

336. spacer 5.4|28817|32|CP027025|CRISPRCasFinder matches to MK112543 (Mycobacterium Phage Kalb97, complete genome) position: , mismatch: 7, identity: 0.781

ttgaccagcaccttccggtcgttggt--ccggta	CRISPR spacer
ctgacgagcaccttcgggtcgttggcgaccga--	Protospacer
.**** ********* *********.  ***.  

337. spacer 5.4|28817|32|CP027025|CRISPRCasFinder matches to MK967399 (Mycobacterium phage Groupthink, complete genome) position: , mismatch: 7, identity: 0.781

ttgaccagcaccttccggtcgttggt--ccggta	CRISPR spacer
ctgacgagcaccttcgggtcgttggcgaccga--	Protospacer
.**** ********* *********.  ***.  

338. spacer 5.4|28817|32|CP027025|CRISPRCasFinder matches to MK310140 (Mycobacterium phage Gemma, complete genome) position: , mismatch: 7, identity: 0.781

ttgaccagcaccttccggtcgttggt--ccggta	CRISPR spacer
ctgacgagcaccttcgggtcgttggcgaccga--	Protospacer
.**** ********* *********.  ***.  

339. spacer 5.4|28817|32|CP027025|CRISPRCasFinder matches to KY965063 (Mycobacterium phage PurpleHaze, complete genome) position: , mismatch: 7, identity: 0.781

ttgaccagcaccttccggtcgttggt--ccggta	CRISPR spacer
ctgacgagcaccttcgggtcgttggcgaccga--	Protospacer
.**** ********* *********.  ***.  

340. spacer 5.4|28817|32|CP027025|CRISPRCasFinder matches to MT657331 (Mycobacterium phage Manu, complete genome) position: , mismatch: 7, identity: 0.781

ttgaccagcaccttccggtcgttggt--ccggta	CRISPR spacer
ctgacgagcaccttcgggtcgttggcgaccga--	Protospacer
.**** ********* *********.  ***.  

341. spacer 5.4|28817|32|CP027025|CRISPRCasFinder matches to MK494128 (Mycobacterium phage Heliosoles, complete genome) position: , mismatch: 7, identity: 0.781

ttgaccagcaccttccggtcgttggt--ccggta	CRISPR spacer
ctgacgagcaccttcgggtcgttggcgaccga--	Protospacer
.**** ********* *********.  ***.  

342. spacer 5.4|28817|32|CP027025|CRISPRCasFinder matches to MH450124 (Mycobacterium phage Marius, complete genome) position: , mismatch: 7, identity: 0.781

ttgaccagcaccttccggtcgttggt--ccggta	CRISPR spacer
ctgacgagcaccttcgggtcgttggcgaccga--	Protospacer
.**** ********* *********.  ***.  

343. spacer 5.4|28817|32|CP027025|CRISPRCasFinder matches to MH450126 (Mycobacterium phage PhishRPhriends, complete genome) position: , mismatch: 7, identity: 0.781

ttgaccagcaccttccggtcgttggt--ccggta	CRISPR spacer
ctgacgagcaccttcgggtcgttggcgaccga--	Protospacer
.**** ********* *********.  ***.  

344. spacer 5.6|28939|32|CP027025|CRISPRCasFinder matches to NZ_CP049837 (Gordonia terrae strain RL-JC02 plasmid pPAE01, complete sequence) position: , mismatch: 7, identity: 0.781

acggggccccggtacgaggtcggccaggtgcg	CRISPR spacer
ggcgggccccggtatgaggtcggcccggtgta	Protospacer
.  ***********.********** ****..

345. spacer 5.6|28939|32|CP027025|CRISPRCasFinder matches to NZ_CP043961 (Streptomyces tendae strain 139 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

acggggccccggtacgaggtcggccaggtgcg	CRISPR spacer
acggggccccggtacgacgtgggccacaccct	Protospacer
***************** ** ***** .. * 

346. spacer 5.9|29122|32|CP027025|CRISPRCasFinder matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 7, identity: 0.781

gacaccgtcaccaccttcatcgcgaacgtgca-	CRISPR spacer
cgcaccgtcaccaccgtcaccgcgatca-gcac	Protospacer
 .************* ***.***** *. *** 

347. spacer 5.13|29395|32|CP027025|CRISPRCasFinder matches to LT599585 (Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid) position: , mismatch: 7, identity: 0.781

gccgcagccgcccgcgcggcagg-----ccacggagg	CRISPR spacer
gccgcagtcgcccgcgaggcaggcgtatccac-----	Protospacer
*******.******** ******     ****     

348. spacer 6.5|30694|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 7, identity: 0.781

gccttgaacacgctgacgaagatgctgccgac	CRISPR spacer
gccatgaacacgctgatgaagatggtccttat	Protospacer
*** ************.******* * *. *.

349. spacer 7.1|30879|32|CP027025|CRISPRCasFinder,CRT matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 7, identity: 0.781

ccacgccg--ccgcctggtcgccagggaagtcgc	CRISPR spacer
--ataccggcccacctggtcgccatggaagtcga	Protospacer
  *..***  **.*********** ******** 

350. spacer 7.2|30940|32|CP027025|CRISPRCasFinder,CRT matches to NZ_LR134450 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence) position: , mismatch: 7, identity: 0.781

gacagaccgccgagggcgatccggacggagtt	CRISPR spacer
gtccgtccgccgacggcgatccggccggagcc	Protospacer
* * * ******* ********** *****..

351. spacer 7.2|30940|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP022420 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-5, complete sequence) position: , mismatch: 7, identity: 0.781

gacagaccgccgagggcgatccggacggagtt	CRISPR spacer
gaagacccgccgagggcgatccggatcgagct	Protospacer
** .. *******************. ***.*

352. spacer 7.2|30940|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP031599 (Roseovarius indicus strain DSM 26383 plasmid pRIdsm_01, complete sequence) position: , mismatch: 7, identity: 0.781

gacagaccgccgagggcgatccggacggagtt	CRISPR spacer
gaagacccgccgagggcgatccggatcgagct	Protospacer
** .. *******************. ***.*

353. spacer 7.2|30940|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP031600 (Roseovarius indicus strain DSM 26383 plasmid pRIdsm_02, complete sequence) position: , mismatch: 7, identity: 0.781

gacagaccgccgagggcgatccggacggagtt	CRISPR spacer
gaagacccgccgagggcgatccggatcgagct	Protospacer
** .. *******************. ***.*

354. spacer 7.2|30940|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP031601 (Roseovarius indicus strain DSM 26383 plasmid pRIdsm_03, complete sequence) position: , mismatch: 7, identity: 0.781

gacagaccgccgagggcgatccggacggagtt	CRISPR spacer
gaagacccgccgagggcgatccggatcgagct	Protospacer
** .. *******************. ***.*

355. spacer 7.3|31001|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP023712 (Rhodococcus ruber strain YC-YT1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

gcagccccgatgacggccgcccact-cgcctac	CRISPR spacer
gcagccccgatgaccaccgcccaccgcgtcgg-	Protospacer
************** .********. **.* . 

356. spacer 7.6|31184|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP006993 (Methylobacterium sp. AMS5 plasmid pAMS5a, complete sequence) position: , mismatch: 7, identity: 0.781

gccgagctcctcgggaacctcttccgcgccct	CRISPR spacer
gaccggcagctccggaacctcttcctcgccct	Protospacer
* * .**  *** ************ ******

357. spacer 1.1|8886|32|CP027025|CRT matches to NZ_CP013744 (Streptomyces sp. CdTB01 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

aagcccaggtccgggccctggacgaaccagga	CRISPR spacer
gcgcacaggtgcgggccctggacgaacaccgc	Protospacer
. ** ***** ****************   * 

358. spacer 1.1|8886|32|CP027025|CRT matches to MT723933 (Streptomyces phage Keanu, complete genome) position: , mismatch: 8, identity: 0.75

aagcccaggtccgggccctggacgaaccagga	CRISPR spacer
ttgcccaggaccgggccctggtcgaacggcca	Protospacer
  ******* *********** ***** .  *

359. spacer 1.1|8886|32|CP027025|CRT matches to MK411746 (Arthrobacter phage Sonali, complete genome) position: , mismatch: 8, identity: 0.75

aagcccaggtccgggccctggacgaaccagga	CRISPR spacer
tcgccgaggtccgggccctggccgaggaggga	Protospacer
  *** *************** ***.  .***

360. spacer 1.3|9008|32|CP027025|CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75

-aacgtgtcgaggccgatctgcgcgtacttgtt	CRISPR spacer
tggcg-gtcgcggccgatctgcccgtactgctg	Protospacer
 ..** **** *********** ******  * 

361. spacer 1.5|9130|32|CP027025|CRT matches to NZ_CP045377 (Sulfitobacter sp. THAF37 plasmid pTHAF37_e, complete sequence) position: , mismatch: 8, identity: 0.75

--gtagtcctcgaaggacagcagggtcgtggcga	CRISPR spacer
caccag--gtcgatggacagcagggttgtggcgt	Protospacer
   .**   **** ************.****** 

362. spacer 1.8|9314|32|CP027025|CRT matches to MN871455 (UNVERIFIED: Pseudomonas phage Pa-B, complete genome) position: , mismatch: 8, identity: 0.75

cgtgccgtccgtgaggccgtgttcgacgagct	CRISPR spacer
cgtgccatcagtgaggccgtgttccggggtat	Protospacer
******.** ************** . *.  *

363. spacer 1.9|9375|32|CP027025|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75

agcgccaccgcgccgcggacggcctcgatcgt	CRISPR spacer
cgcgccactgcgcggcggacggcctcggcgag	Protospacer
 *******.**** *************.. . 

364. spacer 1.9|9375|32|CP027025|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.75

agcgccaccgcgccgcggacggcctcgatcgt	CRISPR spacer
gcctgccccgggccgccgacggcctcgatcgc	Protospacer
. *  * *** ***** **************.

365. spacer 1.9|9375|32|CP027025|CRT matches to NZ_CP006991 (Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence) position: , mismatch: 8, identity: 0.75

agcgccaccgcgccgcggacggcctcgatcgt	CRISPR spacer
gccgccaccgcctcgcggacggcctcgccctc	Protospacer
. ********* .************** .* .

366. spacer 1.9|9375|32|CP027025|CRT matches to NC_007764 (Rhizobium etli CFN 42 plasmid p42c, complete sequence) position: , mismatch: 8, identity: 0.75

agcgccaccgcgccgcggacggcctcgatcgt	CRISPR spacer
gccgccaccgcctcgcggacggcctcgccctc	Protospacer
. ********* .************** .* .

367. spacer 1.9|9375|32|CP027025|CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.75

agcgccaccgcgccgcggacggcctcgatcgt	CRISPR spacer
cgtgccaccgcgccgcggacggtctcctgccc	Protospacer
 *.*******************.***   * .

368. spacer 1.9|9375|32|CP027025|CRT matches to NZ_CP013524 (Rhizobium phaseoli strain R744 plasmid pRphaR744b, complete sequence) position: , mismatch: 8, identity: 0.75

agcgccaccgcgccgcggacggcctcgatcgt	CRISPR spacer
ctcgccaccgcctcgcggacggcctcgccctc	Protospacer
  ********* .************** .* .

369. spacer 1.9|9375|32|CP027025|CRT matches to NZ_CP020908 (Rhizobium etli strain NXC12 plasmid pRetNXC12b, complete sequence) position: , mismatch: 8, identity: 0.75

agcgccaccgcgccgcggacggcctcgatcgt	CRISPR spacer
gccgccaccgcctcgcggacggcctcgccctc	Protospacer
. ********* .************** .* .

370. spacer 1.9|9375|32|CP027025|CRT matches to NC_021907 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1b, complete sequence) position: , mismatch: 8, identity: 0.75

agcgccaccgcgccgcggacggcctcgatcgt	CRISPR spacer
gccgccaccgcctcgcggacggcctcgccctc	Protospacer
. ********* .************** .* .

371. spacer 1.9|9375|32|CP027025|CRT matches to NZ_CP021128 (Rhizobium sp. Kim5 plasmid pRetKim5d, complete sequence) position: , mismatch: 8, identity: 0.75

agcgccaccgcgccgcggacggcctcgatcgt	CRISPR spacer
gccgccaccgcctcgcggacggcctcgccctc	Protospacer
. ********* .************** .* .

372. spacer 1.9|9375|32|CP027025|CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 8, identity: 0.75

agcgccaccgcgccgcggacggcctcgatcgt	CRISPR spacer
acctccaccgcgcagcggaccgcctcgacgac	Protospacer
* * ********* ****** *******. ..

373. spacer 1.9|9375|32|CP027025|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 8, identity: 0.75

agcgccaccgcgccgcggacggcctcgatcgt	CRISPR spacer
gcctgccccgggccgccgacggcctcgatcgc	Protospacer
. *  * *** ***** **************.

374. spacer 1.9|9375|32|CP027025|CRT matches to CP007645 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803d, complete sequence) position: , mismatch: 8, identity: 0.75

agcgccaccgcgccgcggacggcctcgatcgt	CRISPR spacer
gccgccaccgcctcgcggacggcctcgccctc	Protospacer
. ********* .************** .* .

375. spacer 1.9|9375|32|CP027025|CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 8, identity: 0.75

agcgccaccgcgccgcggacggcctcgatcgt	CRISPR spacer
gcctgccccgggccgccgacggcctcgatcgc	Protospacer
. *  * *** ***** **************.

376. spacer 1.9|9375|32|CP027025|CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 8, identity: 0.75

agcgccaccgcgccgcggacggcctcgatcgt	CRISPR spacer
acctccaccgcgcagcggaccgcctcgacgac	Protospacer
* * ********* ****** *******. ..

377. spacer 1.9|9375|32|CP027025|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 8, identity: 0.75

agcgccaccgcgccgcggacggcctcgatcgt	CRISPR spacer
acctccaccgcgcagcggaccgcctcgacgac	Protospacer
* * ********* ****** *******. ..

378. spacer 1.9|9375|32|CP027025|CRT matches to KY006853 (Erythrobacter phage vB_EliS_R6L, complete genome) position: , mismatch: 8, identity: 0.75

agcgccaccgcgccgcggacggcctcgatcgt	CRISPR spacer
gcgaccgtcgcggcgcagacggcctcgatcgt	Protospacer
.  .**..**** ***.***************

379. spacer 1.9|9375|32|CP027025|CRT matches to NZ_LR134461 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 19, complete sequence) position: , mismatch: 8, identity: 0.75

agcgccaccgcgccgcggacggcctcgatcgt	CRISPR spacer
agcgtcaccgcggcgcggacggcgaagggcgg	Protospacer
****.******* **********   *. ** 

380. spacer 1.9|9375|32|CP027025|CRT matches to NC_008537 (Arthrobacter sp. FB24 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75

agcgccaccgcgccgcggacggcc-tcgatcgt	CRISPR spacer
cgcgcgaccgcgccgcggtcggccgttagacg-	Protospacer
 **** ************ ***** *... ** 

381. spacer 1.10|9436|32|CP027025|CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 8, identity: 0.75

ccccagctcgtcgcctacagcgccggagtcct	CRISPR spacer
acccagctcgacggctacagcgccgagcgcat	Protospacer
 ********* ** ***********..  * *

382. spacer 1.10|9436|32|CP027025|CRT matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 8, identity: 0.75

ccccagctcgtcgcctacagcgccggagtcct	CRISPR spacer
tcccagctcgacggctacagcgccgagcgcat	Protospacer
.********* ** ***********..  * *

383. spacer 1.10|9436|32|CP027025|CRT matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 8, identity: 0.75

ccccagctcgtcgcctacagcgccggagtcct	CRISPR spacer
ctccagcttgtcgcctccagcgccgccgatcg	Protospacer
*.******.******* ********  * .* 

384. spacer 1.10|9436|32|CP027025|CRT matches to NZ_CP021028 (Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence) position: , mismatch: 8, identity: 0.75

ccccagctcgtcgcctacagcgccggagtcct	CRISPR spacer
acccagctcgacggctacagcgcccaaaacat	Protospacer
 ********* ** ********** .*. * *

385. spacer 1.12|9008|31|CP027025|CRISPRCasFinder matches to NZ_CP045548 (Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

aacgtgtcgaggccgatctgcgcgtacttgt	CRISPR spacer
gcgctgccgaggccgatctgcgagtactgga	Protospacer
.   **.*************** ***** * 

386. spacer 1.14|9130|31|CP027025|CRISPRCasFinder matches to NC_049478 (Arthrobacter phage Mufasa8, complete genome) position: , mismatch: 8, identity: 0.742

gtagtcctcgaaggacagcagggtcgtggcg	CRISPR spacer
cgtgtcctcggtggacagcagggtcgcgcgg	Protospacer
   *******. **************.*  *

387. spacer 1.17|9314|31|CP027025|CRISPRCasFinder matches to MN871455 (UNVERIFIED: Pseudomonas phage Pa-B, complete genome) position: , mismatch: 8, identity: 0.742

cgtgccgtccgtgaggccgtgttcgacgagc	CRISPR spacer
cgtgccatcagtgaggccgtgttccggggta	Protospacer
******.** ************** . *.  

388. spacer 1.18|9375|31|CP027025|CRISPRCasFinder matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 8, identity: 0.742

agcgccaccgcgccgcggacggcctcgatcg	CRISPR spacer
cacgccaccgcgctgcggacggccgcgcagc	Protospacer
 .***********.********** **    

389. spacer 1.18|9375|31|CP027025|CRISPRCasFinder matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 8, identity: 0.742

agcgccaccgcgccgcggacggcctcgatcg	CRISPR spacer
cctgccaccacggcgcggacggcctcgacgc	Protospacer
  .******.** ***************.  

390. spacer 1.18|9375|31|CP027025|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 8, identity: 0.742

agcgccaccgcgccgcggacggcctcgatcg	CRISPR spacer
acttccaccgcgcagcggaccgcctcgacga	Protospacer
* . ********* ****** *******. .

391. spacer 1.18|9375|31|CP027025|CRISPRCasFinder matches to NZ_CP013345 (Sphingopyxis macrogoltabida strain 203N plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

agcgccaccgcgccgcggacggcctcgatcg	CRISPR spacer
tgaacgcccgcgccgcggacggcgccgatca	Protospacer
 * .*  **************** .*****.

392. spacer 1.18|9375|31|CP027025|CRISPRCasFinder matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 8, identity: 0.742

agcgccaccgcgccgcggacggcctcgatcg	CRISPR spacer
gctgccaccgcctcgcggacggcctcgccct	Protospacer
. .******** .************** .* 

393. spacer 1.18|9375|31|CP027025|CRISPRCasFinder matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 8, identity: 0.742

agcgccaccgcgccgcggacggcctcgatcg	CRISPR spacer
accgccagcgcgccgcggatggcctgaacaa	Protospacer
* ***** ***********.***** .*. .

394. spacer 1.18|9375|31|CP027025|CRISPRCasFinder matches to NZ_CP027299 (Streptomyces sp. SGAir0924 plasmid unnamed_5) position: , mismatch: 8, identity: 0.742

agcgccaccgcgccgcggacggcctcgatcg	CRISPR spacer
acggccactgcgccgcggccggcctcaccct	Protospacer
*  *****.********* *******. .* 

395. spacer 1.18|9375|31|CP027025|CRISPRCasFinder matches to NZ_AP019802 (Thermus thermophilus strain HC11 plasmid pHC11, complete sequence) position: , mismatch: 8, identity: 0.742

agcgccaccgcgccgcggacggcctcgatcg	CRISPR spacer
accctcaccccgccggggacggcctcgaggt	Protospacer
* * .**** ***** ************   

396. spacer 1.18|9375|31|CP027025|CRISPRCasFinder matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 8, identity: 0.742

agcgccaccgcgccgcggacggcctcgatcg	CRISPR spacer
aaagcgaccgcgccgcggaccgcctccagtc	Protospacer
*. ** ************** ***** * . 

397. spacer 1.18|9375|31|CP027025|CRISPRCasFinder matches to NZ_CP024312 (Rhizobium sp. NXC24 plasmid pRspNXC24a, complete sequence) position: , mismatch: 8, identity: 0.742

agcgccaccgcgccgcggacggcctcgatcg	CRISPR spacer
ggcaagctcgcgccgcggacggtctagatcg	Protospacer
.**.   .**************.** *****

398. spacer 1.18|9375|31|CP027025|CRISPRCasFinder matches to NZ_CP045548 (Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

agcgccaccgcgccgcggacggcctcgatcg	CRISPR spacer
gccccggccgcgtcgcggaaggcctcgatct	Protospacer
. * * .*****.****** ********** 

399. spacer 1.19|9436|31|CP027025|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 8, identity: 0.742

ccccagctcgtcgcctacagcgccggagtcc	CRISPR spacer
acccagctcgacggctacagcgccgagcgca	Protospacer
 ********* ** ***********..  * 

400. spacer 1.19|9436|31|CP027025|CRISPRCasFinder matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 8, identity: 0.742

ccccagctcgtcgcctacagcgccggagtcc	CRISPR spacer
tcccagctcgacggctacagcgccgagcgca	Protospacer
.********* ** ***********..  * 

401. spacer 1.19|9436|31|CP027025|CRISPRCasFinder matches to NZ_CP021028 (Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence) position: , mismatch: 8, identity: 0.742

ccccagctcgtcgcctacagcgccggagtcc	CRISPR spacer
acccagctcgacggctacagcgcccaaaaca	Protospacer
 ********* ** ********** .*. * 

402. spacer 1.20|9377|28|CP027025|PILER-CR matches to NC_047905 (Streptomyces phage Attoomi, complete genome) position: , mismatch: 8, identity: 0.714

agcgccaccgcgccgcggacggcctcga	CRISPR spacer
caggccaccgcgccccggacggcccacg	Protospacer
 . *********** *********.  .

403. spacer 2.2|18105|32|CP027025|CRISPRCasFinder,CRT matches to NC_024994 (Gluconacetobacter europaeus plasmid pGE2 genomic DNA, complete sequence, strain: KGMA0119) position: , mismatch: 8, identity: 0.75

acgcagctc------ctccaggccgggcctgacggcct	CRISPR spacer
------ctcgtatcgctccagtccggtcctgacggcct	Protospacer
      ***      ****** **** ***********

404. spacer 2.3|18166|32|CP027025|CRISPRCasFinder,CRT matches to NZ_KY494864 (Pseudomonas aeruginosa strain FFUP_PS_37 plasmid pJB37, complete sequence) position: , mismatch: 8, identity: 0.75

ctctggttgagtacgacgacgagcagggtctc	CRISPR spacer
cgacggttgagtacgatgaagagcaggatatg	Protospacer
*  .************.** *******.* * 

405. spacer 2.3|18166|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP034911 (Ensifer alkalisoli strain YIC4027 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

ctctggttgagtacgacgacgagcagggtctc	CRISPR spacer
gccacgctgagttcgaccacgagcagggtcgc	Protospacer
 .*  *.***** **** ************ *

406. spacer 2.3|18166|32|CP027025|CRISPRCasFinder,CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 8, identity: 0.75

ctctggttgagtacgacgacgagcagggtctc	CRISPR spacer
ctctgctggagtacgacgacgaggatgaaaac	Protospacer
***** * *************** * *.   *

407. spacer 2.3|18166|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP039991 (Pseudomonas aeruginosa strain T2101 plasmid pBT2101, complete sequence) position: , mismatch: 8, identity: 0.75

ctctggttgagtacgacgacgagcagggtctc	CRISPR spacer
cgacggttgagtacgatgaagagcaggatatg	Protospacer
*  .************.** *******.* * 

408. spacer 2.3|18166|32|CP027025|CRISPRCasFinder,CRT matches to NZ_MN433457 (Pseudomonas aeruginosa strain PAB546 plasmid pNK546-KPC, complete sequence) position: , mismatch: 8, identity: 0.75

ctctggttgagtacgacgacgagcagggtctc	CRISPR spacer
cgacggttgagtacgatgaagagcaggatatg	Protospacer
*  .************.** *******.* * 

409. spacer 2.3|18166|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP029096 (Pseudomonas aeruginosa strain AR439 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

ctctggttgagtacgacgacgagcagggtctc	CRISPR spacer
cgacggttgagtacgatgaagagcaggatatg	Protospacer
*  .************.** *******.* * 

410. spacer 2.3|18166|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP045003 (Pseudomonas aeruginosa strain PAG5 plasmid pPAG5, complete sequence) position: , mismatch: 8, identity: 0.75

ctctggttgagtacgacgacgagcagggtctc	CRISPR spacer
cgacggttgagtacgatgaagagcaggatatg	Protospacer
*  .************.** *******.* * 

411. spacer 2.3|18166|32|CP027025|CRISPRCasFinder,CRT matches to MF344569 (Pseudomonas aeruginosa plasmid p12939-PER, complete sequence) position: , mismatch: 8, identity: 0.75

ctctggttgagtacgacgacgagcagggtctc	CRISPR spacer
cgacggttgagtacgatgaagagcaggatatg	Protospacer
*  .************.** *******.* * 

412. spacer 2.3|18166|32|CP027025|CRISPRCasFinder,CRT matches to MF344570 (Pseudomonas aeruginosa plasmid pA681-IMP, complete sequence) position: , mismatch: 8, identity: 0.75

ctctggttgagtacgacgacgagcagggtctc	CRISPR spacer
cgacggttgagtacgatgaagagcaggatatg	Protospacer
*  .************.** *******.* * 

413. spacer 2.3|18166|32|CP027025|CRISPRCasFinder,CRT matches to CP027478 (Pseudomonas koreensis strain P19E3 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75

ctctggttgagtacgacgacgagcagggtctc	CRISPR spacer
cgacggttgagtacgatgaagagcaggatatg	Protospacer
*  .************.** *******.* * 

414. spacer 2.3|18166|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP040126 (Pseudomonas aeruginosa strain PA298 plasmid pBM908, complete sequence) position: , mismatch: 8, identity: 0.75

ctctggttgagtacgacgacgagcagggtctc	CRISPR spacer
cgacggttgagtacgatgaagagcaggatatg	Protospacer
*  .************.** *******.* * 

415. spacer 2.3|18166|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP015879 (Pseudomonas citronellolis strain SJTE-3 plasmid pRBL16, complete sequence) position: , mismatch: 8, identity: 0.75

ctctggttgagtacgacgacgagcagggtctc	CRISPR spacer
cgacggttgagtacgatgaagagcaggatatg	Protospacer
*  .************.** *******.* * 

416. spacer 2.3|18166|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP016215 (Pseudomonas aeruginosa strain PA121617 plasmid pBM413, complete sequence) position: , mismatch: 8, identity: 0.75

ctctggttgagtacgacgacgagcagggtctc	CRISPR spacer
cgacggttgagtacgatgaagagcaggatatg	Protospacer
*  .************.** *******.* * 

417. spacer 2.3|18166|32|CP027025|CRISPRCasFinder,CRT matches to NZ_KY883660 (Pseudomonas putida strain SY153 plasmid pSY153-MDR, complete sequence) position: , mismatch: 8, identity: 0.75

ctctggttgagtacgacgacgagcagggtctc	CRISPR spacer
cgacggttgagtacgatgaagagcaggatatg	Protospacer
*  .************.** *******.* * 

418. spacer 2.5|18288|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 8, identity: 0.75

taccggacggcgctggaggccggtccgatcca	CRISPR spacer
tatgcgcgggcgctggaggccgatccgaccct	Protospacer
**.  *  **************.*****.** 

419. spacer 2.6|18349|32|CP027025|CRISPRCasFinder,CRT matches to MN369748 (Mycobacterium phage Miko, complete genome) position: , mismatch: 8, identity: 0.75

agtaccagcgccccggacgcggcgacctgcat	CRISPR spacer
tggttgagcgcctcggacacggcgacctgcaa	Protospacer
 *  . ******.*****.************ 

420. spacer 2.6|18349|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

agtaccagcgccccggacgcggcgacctgcat	CRISPR spacer
accaccggcgccccggacgcggccaccgaccg	Protospacer
* .***.**************** *** .*  

421. spacer 2.6|18349|32|CP027025|CRISPRCasFinder,CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 8, identity: 0.75

agtaccagcgccccggacgcggcgacctgcat	CRISPR spacer
accaccggcgccccggacgcggccaccgaccg	Protospacer
* .***.**************** *** .*  

422. spacer 2.6|18349|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

agtaccagcgccccggacgcggcgacctgcat	CRISPR spacer
accaccggcgcaccggacgcggcgaccgaccg	Protospacer
* .***.**** *************** .*  

423. spacer 2.6|18349|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

agtaccagcgccccggacgcggcgacctgcat	CRISPR spacer
accaccggcgccccggacgcggccaccgaccg	Protospacer
* .***.**************** *** .*  

424. spacer 2.6|18349|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

agtaccagcgccccggacgcggcgacctgcat	CRISPR spacer
accaccggcgccccggacgcggccaccgaccg	Protospacer
* .***.**************** *** .*  

425. spacer 2.6|18349|32|CP027025|CRISPRCasFinder,CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75

agtaccagcgccccggacgcggcgacctgcat	CRISPR spacer
accaccggcgccccggacgcggccaccgaccg	Protospacer
* .***.**************** *** .*  

426. spacer 2.6|18349|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

agtaccagcgccccggacgcggcgacctgcat	CRISPR spacer
accaccggcgccccggacgcggccaccgaccg	Protospacer
* .***.**************** *** .*  

427. spacer 2.6|18349|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75

agtaccagcgccccggacgcggcgacctgcat	CRISPR spacer
accaccggcgccccggacgcggccaccgaccg	Protospacer
* .***.**************** *** .*  

428. spacer 2.6|18349|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP022081 (Burkholderia cepacia strain FDAARGOS_345 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

-agtaccagcgccccggacgcggcgacctgcat	CRISPR spacer
ttgtg-cggcgccccggccgcgtcgacctgcgg	Protospacer
  **. *.********* **** ********. 

429. spacer 2.6|18349|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP022081 (Burkholderia cepacia strain FDAARGOS_345 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

-agtaccagcgccccggacgcggcgacctgcat	CRISPR spacer
tcgtg-cggcgccccggccgcgtcgacctgcgg	Protospacer
  **. *.********* **** ********. 

430. spacer 2.6|18349|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP054606 (Sulfitobacter pseudonitzschiae strain H46 plasmid unnamed7, complete sequence) position: , mismatch: 8, identity: 0.75

agtaccagcgccccggacgcggcgacctgcat	CRISPR spacer
cgcatcagcgcctcggacacggcgaccttggt	Protospacer
 *.*.*******.*****.*********  .*

431. spacer 2.6|18349|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP023519 (Burkholderia cepacia strain FDAARGOS_388 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

-agtaccagcgccccggacgcggcgacctgcat	CRISPR spacer
ttgtg-cggcgccccggccgcgtcgacctgcgg	Protospacer
  **. *.********* **** ********. 

432. spacer 2.6|18349|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP023519 (Burkholderia cepacia strain FDAARGOS_388 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

-agtaccagcgccccggacgcggcgacctgcat	CRISPR spacer
tcgtg-cggcgccccggccgcgtcgacctgcgg	Protospacer
  **. *.********* **** ********. 

433. spacer 2.6|18349|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP032313 (Pannonibacter phragmitetus BB plasmid p.BB_1, complete sequence) position: , mismatch: 8, identity: 0.75

agtaccagcgccccggacgcggcgacc-tgcat	CRISPR spacer
caggccagcgcccgggacgcggtgaccgtgga-	Protospacer
 . .********* ********.**** ** * 

434. spacer 2.6|18349|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP007745 (Burkholderia cepacia ATCC 25416 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

-agtaccagcgccccggacgcggcgacctgcat	CRISPR spacer
ttgtg-cggcgccccggccgcgtcgacctgcgg	Protospacer
  **. *.********* **** ********. 

435. spacer 2.6|18349|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP007745 (Burkholderia cepacia ATCC 25416 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

-agtaccagcgccccggacgcggcgacctgcat	CRISPR spacer
tcgtg-cggcgccccggccgcgtcgacctgcgg	Protospacer
  **. *.********* **** ********. 

436. spacer 2.6|18349|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP012984 (Burkholderia cepacia ATCC 25416 strain UCB 717 plasmid pBC25416) position: , mismatch: 8, identity: 0.75

-agtaccagcgccccggacgcggcgacctgcat	CRISPR spacer
ttgtg-cggcgccccggccgcgtcgacctgcgg	Protospacer
  **. *.********* **** ********. 

437. spacer 2.6|18349|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP012984 (Burkholderia cepacia ATCC 25416 strain UCB 717 plasmid pBC25416) position: , mismatch: 8, identity: 0.75

-agtaccagcgccccggacgcggcgacctgcat	CRISPR spacer
tcgtg-cggcgccccggccgcgtcgacctgcgg	Protospacer
  **. *.********* **** ********. 

438. spacer 2.6|18349|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP020372 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence) position: , mismatch: 8, identity: 0.75

agtaccagc-gccccggacgcggcgacctgcat	CRISPR spacer
-ctgatggcggccccggacgaggcgaccttcat	Protospacer
  *. ..** ********** ******** ***

439. spacer 2.6|18349|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 8, identity: 0.75

agtaccagcgccccggacgcggcgacctgcat	CRISPR spacer
agatcgagcgccccggcctcggcgacctgtcg	Protospacer
**  * ********** * **********.  

440. spacer 2.6|18349|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP034556 (Burkholderia cepacia ATCC 25416 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

-agtaccagcgccccggacgcggcgacctgcat	CRISPR spacer
tcgtg-cggcgccccggccgcgtcgacctgcgg	Protospacer
  **. *.********* **** ********. 

441. spacer 2.6|18349|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP034556 (Burkholderia cepacia ATCC 25416 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

-agtaccagcgccccggacgcggcgacctgcat	CRISPR spacer
ttgtg-cggcgccccggccgcgtcgacctgcgg	Protospacer
  **. *.********* **** ********. 

442. spacer 2.7|18353|28|CP027025|PILER-CR matches to NC_048047 (Caulobacter phage CcrBL9, complete genome) position: , mismatch: 8, identity: 0.714

agtaccagcgccccggacgcggcgacct	CRISPR spacer
gccaccagcgcctcggacgcggcgtagg	Protospacer
. .*********.***********    

443. spacer 3.1|18592|32|CP027025|CRISPRCasFinder,CRT matches to MG707188 (Pseudomonas phage TC7, partial genome) position: , mismatch: 8, identity: 0.75

cgtcgggcggggtcactggcggactcccaacg	CRISPR spacer
cgccgggctgggtcactggcggactagatagc	Protospacer
**.***** ****************    *  

444. spacer 3.1|18592|32|CP027025|CRISPRCasFinder,CRT matches to NC_031091 (Pseudomonas phage MD8, complete genome) position: , mismatch: 8, identity: 0.75

cgtcgggcggggtcactggcggactcccaacg	CRISPR spacer
cgccgggctgggtcactggcggactagatagc	Protospacer
**.***** ****************    *  

445. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP019603 (Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence) position: , mismatch: 8, identity: 0.75

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
ggggcaggcgcccgcgcggcaggccgcgatcc	Protospacer
*  **** *****************.**.   

446. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.75

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
gccgcagccgcccgcccggctggcggtcagga	Protospacer
*************** **** *** .. ..**

447. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
ctaccagccggccgcccggcaggccacgtgga	Protospacer
 .  ****** **** ************ .**

448. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_LR134453 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 11, complete sequence) position: , mismatch: 8, identity: 0.75

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
gacgggcaggcccgcgccgcaggcctcggaga	Protospacer
* ** .   ******** ******* ******

449. spacer 3.10|19158|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053441 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence) position: , mismatch: 8, identity: 0.75

gagggcgtgtagctctcctcgaagggggtgcc	CRISPR spacer
cagggcgtgtcgatctcctcgaaggcgaaggt	Protospacer
 ********* * ************ *. * .

450. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tctgcggcggccggcgccgggccgcgcttggg	CRISPR spacer
gctgcggcggccggcgacgggacgcgccatct	Protospacer
 *************** **** *****.    

451. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tctgcggcggccggcgccgggccgcgcttggg	CRISPR spacer
gctgcggcggccggcgacgggacgcgccatct	Protospacer
 *************** **** *****.    

452. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tctgcggcggccggcgccgggccgcgcttggg	CRISPR spacer
gctgcggcggccggcgacgggacgcgccatct	Protospacer
 *************** **** *****.    

453. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 8, identity: 0.75

tctgcggcggccggcgccgggccgcgcttggg	CRISPR spacer
gctgcggcggccggcgacgggacgcgccatct	Protospacer
 *************** **** *****.    

454. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tctgcggcggccggcgccgggccgcgcttggg	CRISPR spacer
gctgcggcggccggcgacgggacgcgccatct	Protospacer
 *************** **** *****.    

455. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tctgcggcggccggcgccgggccgcgcttggg	CRISPR spacer
gctgcggcggccggcgacgggacgcgccatct	Protospacer
 *************** **** *****.    

456. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tctgcggcggccggcgccgggccgcgcttggg	CRISPR spacer
gctgcggcggccggcgacgggacgcgccatct	Protospacer
 *************** **** *****.    

457. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tctgcggcggccggcgccgggccgcgcttggg	CRISPR spacer
gctgcggcggccggcgacgggacgcgccatct	Protospacer
 *************** **** *****.    

458. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tctgcggcggccggcgccgggccgcgcttggg	CRISPR spacer
gctgcggcggccggcgacgggacgcgccatct	Protospacer
 *************** **** *****.    

459. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tctgcggcggccggcgccgggccgcgcttggg	CRISPR spacer
gctgcggcggccggcgacgggacgcgccatct	Protospacer
 *************** **** *****.    

460. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 8, identity: 0.75

tctgcggcggccggcgccgggccgcgcttggg	CRISPR spacer
ttgccggcggccagcgccgggccgagcttcca	Protospacer
*.  ********.*********** ****  .

461. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 8, identity: 0.75

tctgcggcggccggcgccgggccgcgcttggg	CRISPR spacer
ttgccggcggccagcgccgggccgagcttcca	Protospacer
*.  ********.*********** ****  .

462. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to JX100810 (Caulobacter phage CcrColossus, complete genome) position: , mismatch: 8, identity: 0.75

tctgcggcggccggcgccgggccgcgcttggg	CRISPR spacer
accttgccggccggcgccgcgccgcgcttgac	Protospacer
 *. .* ************ **********. 

463. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 8, identity: 0.75

tctgcggcggccggcgccgggccgcgcttggg	CRISPR spacer
tggccgggggccggggccgggccgcgctgcgt	Protospacer
*   *** ****** *************  * 

464. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 8, identity: 0.75

tctgcggcggccggcgccgggccgcgcttggg	CRISPR spacer
attccggcggccggcgccacgccgcgcatcgc	Protospacer
 .* **************. ******* * * 

465. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 8, identity: 0.75

tctgcggcggccggcgccgggccgcgcttggg	CRISPR spacer
attccggcggccggcgccacgccgcgcatcgc	Protospacer
 .* **************. ******* * * 

466. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021027 (Rhizobium sp. TAL182 plasmid pRetTAL182c, complete sequence) position: , mismatch: 8, identity: 0.75

tctgcggcggccggcgccggg----ccgcgcttggg	CRISPR spacer
tctgcggcggccgccgccgcgcctaccacgtt----	Protospacer
************* ***** *    **.**.*    

467. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013555 (Rhizobium phaseoli strain N931 plasmid pRphaN931c, complete sequence) position: , mismatch: 8, identity: 0.75

tctgcggcggccggcgccggg----ccgcgcttggg	CRISPR spacer
tctgcggcggccgccgccgcgcctaccacgtt----	Protospacer
************* ***** *    **.**.*    

468. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013561 (Rhizobium phaseoli strain N841 plasmid pRphaN841d, complete sequence) position: , mismatch: 8, identity: 0.75

tctgcggcggccggcgccggg----ccgcgcttggg	CRISPR spacer
tctgcggcggccgccgccgcgcctaccacgtt----	Protospacer
************* ***** *    **.**.*    

469. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013578 (Rhizobium phaseoli strain N671 plasmid pRphaN671d, complete sequence) position: , mismatch: 8, identity: 0.75

tctgcggcggccggcgccggg----ccgcgcttggg	CRISPR spacer
tctgcggcggccgccgccgcgcctaccacgtt----	Protospacer
************* ***** *    **.**.*    

470. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013530 (Rhizobium phaseoli strain R723 plasmid pRphaR723c, complete sequence) position: , mismatch: 8, identity: 0.75

tctgcggcggccggcgccggg----ccgcgcttggg	CRISPR spacer
tctgcggcggccgccgccgcgcctaccacgtt----	Protospacer
************* ***** *    **.**.*    

471. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013535 (Rhizobium phaseoli strain R650 plasmid pRphaR650c, complete sequence) position: , mismatch: 8, identity: 0.75

tctgcggcggccggcgccggg----ccgcgcttggg	CRISPR spacer
tctgcggcggccgccgccgcgcctaccacgtt----	Protospacer
************* ***** *    **.**.*    

472. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013540 (Rhizobium phaseoli strain R630 plasmid pRphaR630c, complete sequence) position: , mismatch: 8, identity: 0.75

tctgcggcggccggcgccggg----ccgcgcttggg	CRISPR spacer
tctgcggcggccgccgccgcgcctaccacgtt----	Protospacer
************* ***** *    **.**.*    

473. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013566 (Rhizobium phaseoli strain N831 plasmid pRphaN831c, complete sequence) position: , mismatch: 8, identity: 0.75

tctgcggcggccggcgccggg----ccgcgcttggg	CRISPR spacer
tctgcggcggccgccgccgcgcctaccacgtt----	Protospacer
************* ***** *    **.**.*    

474. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013583 (Rhizobium phaseoli strain N261 plasmid pRphaN261c, complete sequence) position: , mismatch: 8, identity: 0.75

tctgcggcggccggcgccggg----ccgcgcttggg	CRISPR spacer
tctgcggcggccgccgccgcgcctaccacgtt----	Protospacer
************* ***** *    **.**.*    

475. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013572 (Rhizobium phaseoli strain N771 plasmid pRphaN671d, complete sequence) position: , mismatch: 8, identity: 0.75

tctgcggcggccggcgccggg----ccgcgcttggg	CRISPR spacer
tctgcggcggccgccgccgcgcctaccacgtt----	Protospacer
************* ***** *    **.**.*    

476. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021125 (Rhizobium sp. Kim5 plasmid pRetKim5a, complete sequence) position: , mismatch: 8, identity: 0.75

tctgcggcggccggcgccggg----ccgcgcttggg	CRISPR spacer
tctgcggcggccgccgccgcgcctaccacgtt----	Protospacer
************* ***** *    **.**.*    

477. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013514 (Rhizobium sp. N1314 plasmid pRspN1314c, complete sequence) position: , mismatch: 8, identity: 0.75

tctgcggcggccggcgccggg----ccgcgcttggg	CRISPR spacer
tctgcggcggccgccgccgcgcctaccacgtt----	Protospacer
************* ***** *    **.**.*    

478. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031954 (Phaeobacter inhibens strain 2.10 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

tctgcggcggccggcgccgggccgcgcttggg---	CRISPR spacer
cgcgcggcgggcggggccgggccgcg---gggctg	Protospacer
. .******* *** ***********   ***   

479. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NC_018423 (Phaeobacter inhibens 2.10 plasmid pPGA2_95, complete sequence) position: , mismatch: 8, identity: 0.75

tctgcggcggccggcgccgggccgcgcttggg---	CRISPR spacer
cgcgcggcgggcggggccgggccgcg---gggctg	Protospacer
. .******* *** ***********   ***   

480. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013604 (Rhizobium sp. N731 plasmid pRspN731c, complete sequence) position: , mismatch: 8, identity: 0.75

tctgcggcggccggcgccggg----ccgcgcttggg	CRISPR spacer
tctgcggcggccgccgccgcgcctaccacgtt----	Protospacer
************* ***** *    **.**.*    

481. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017243 (Rhizobium etli 8C-3 plasmid pRsp8C3b, complete sequence) position: , mismatch: 8, identity: 0.75

tctgcggcggccggcgccggg----ccgcgcttggg	CRISPR spacer
tctgcggcggccgccgccgcgcctaccacgtt----	Protospacer
************* ***** *    **.**.*    

482. spacer 3.12|19280|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 8, identity: 0.75

ggacgacgagcagggcgagcgtggacacggtg	CRISPR spacer
attcggcgagcaggtcgagcgtggaccggctg	Protospacer
.  **.******** ***********  * **

483. spacer 3.12|19280|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 8, identity: 0.75

ggacgacgagcagggcgagcgtggacacggtg	CRISPR spacer
ggacggcgaggagggcgagcgtgagcgctttc	Protospacer
*****.**** ************..*.*  * 

484. spacer 3.12|19280|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to KC252997 (Halovirus PH1, complete genome) position: , mismatch: 8, identity: 0.75

ggacgacgagcagggcgagcgtggacacggtg	CRISPR spacer
cgacgatgagcaggacgagcgtggtctggagg	Protospacer
 *****.*******.********* *  *. *

485. spacer 3.16|19524|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033036 (Agrobacterium fabrum strain 12D13 plasmid pAt12D13a, complete sequence) position: , mismatch: 8, identity: 0.75

ggcgggat-gtcgaggcgttcgatgccggtggt	CRISPR spacer
-acgctttggtcgaggcgttcgatgcccatggc	Protospacer
 .**   * ****************** .***.

486. spacer 3.16|19524|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NC_009621 (Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence) position: , mismatch: 8, identity: 0.75

ggcgggatgtcgaggcgttcgatgccggtggt	CRISPR spacer
ggcgggaggtcgcggcgttcgattgaagtcct	Protospacer
******* **** **********   .**  *

487. spacer 3.20|19769|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.75

aagtgctcggcgatccgcaggcggcggaggct	CRISPR spacer
ccgaccgcggcgatccgccggcggccgaggcc	Protospacer
  *  * *********** ****** *****.

488. spacer 3.20|19769|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.75

aagtgctcggcgatccgcaggcggcggaggct	CRISPR spacer
ccgaccgcggcgatccgccggcggccgaggcc	Protospacer
  *  * *********** ****** *****.

489. spacer 3.20|19769|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

aagtgct----cggcgatccgcaggcggcggaggct	CRISPR spacer
----gctacgccggcgaaccgcaggaggcggagggc	Protospacer
    ***    ****** ******* ******** .

490. spacer 4.2|28389|31|CP027025|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.742

gagcgggcatcgtcggggccggggagcgtgt	CRISPR spacer
gcacgggcatcgtcgaggccggcgagcacca	Protospacer
* .************.****** ****..  

491. spacer 4.3|28449|32|CP027025|CRT matches to NZ_CP030197 (Salmonella enterica strain SA20051401 plasmid pSA20051401.1, complete sequence) position: , mismatch: 8, identity: 0.75

gcttcacggacccgccgagcaccattgttggc	CRISPR spacer
acgtcacggacccgctgtgcaccatttcctgc	Protospacer
.* ************.* ******** .. **

492. spacer 4.3|28449|32|CP027025|CRT matches to NZ_CP024864 (Escherichia coli strain AR_0015 plasmid unitig_2_pilon, complete sequence) position: , mismatch: 8, identity: 0.75

gcttcacggacccgccgagcaccattgttggc	CRISPR spacer
acgtcacggacccgctgtgcaccatttcctgc	Protospacer
.* ************.* ******** .. **

493. spacer 4.3|28449|32|CP027025|CRT matches to NZ_CP030177 (Salmonella enterica subsp. enterica serovar Milwaukee str. SA19950795 plasmid pIncFII.2, complete sequence) position: , mismatch: 8, identity: 0.75

gcttcacggacccgccgagcaccattgttggc	CRISPR spacer
acgtcacggacccgctgtgcaccatttcctgc	Protospacer
.* ************.* ******** .. **

494. spacer 4.3|28449|32|CP027025|CRT matches to NC_011413 (Escherichia coli SE11 plasmid pSE11-2, complete sequence) position: , mismatch: 8, identity: 0.75

gcttcacggacccgccgagcaccattgttggc	CRISPR spacer
acgtcacggacccgctgtgcaccatttcctgc	Protospacer
.* ************.* ******** .. **

495. spacer 4.3|28449|32|CP027025|CRT matches to NZ_CP030785 (Escherichia albertii strain 2012EL-1823B plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

gcttcacggacccgccgagcaccattgttggc	CRISPR spacer
acgtcacggacccgctgtgcaccatttcctgc	Protospacer
.* ************.* ******** .. **

496. spacer 4.3|28449|32|CP027025|CRT matches to CP054565 (Escherichia coli strain SCU-478 isolate rectal swab from healthy college student plasmid pSCU-478-1, complete sequence) position: , mismatch: 8, identity: 0.75

gcttcacggacccgccgagcaccattgttggc	CRISPR spacer
acgtcacggacccgctgtgcaccatttcctgc	Protospacer
.* ************.* ******** .. **

497. spacer 4.3|28449|32|CP027025|CRT matches to NZ_CP032813 (Escherichia coli strain ERL03-1416 plasmid pERL03-1416-2, complete sequence) position: , mismatch: 8, identity: 0.75

gcttcacggacccgccgagcaccattgttggc	CRISPR spacer
acgtcacggacccgctgtgcaccatttcctgc	Protospacer
.* ************.* ******** .. **

498. spacer 4.3|28449|32|CP027025|CRT matches to NZ_CP010201 (Escherichia coli strain M10 plasmid A, complete sequence) position: , mismatch: 8, identity: 0.75

gcttcacggacccgccgagcaccattgttggc	CRISPR spacer
acgtcacggacccgctgtgcaccatttcctgc	Protospacer
.* ************.* ******** .. **

499. spacer 5.2|28695|32|CP027025|CRISPRCasFinder matches to MN234228 (Mycobacterium phage Tourach, complete genome) position: , mismatch: 8, identity: 0.75

agggtacccgcagcgtggccctgctcgatgcg	CRISPR spacer
cgaaaacgcgcagcgtggccctcctcgatcag	Protospacer
 *.. ** ************** ******  *

500. spacer 5.2|28695|32|CP027025|CRISPRCasFinder matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75

agggtacccgcagcgtggccctgctcgatgcg	CRISPR spacer
agtacacccgcagcgtggccctggccgagcgg	Protospacer
** ..****************** .***   *

501. spacer 5.3|28756|32|CP027025|CRISPRCasFinder matches to NZ_CP024425 (Paracoccus yeei strain TT13 plasmid pTT13-3, complete sequence) position: , mismatch: 8, identity: 0.75

cggccgacgtgcaggtggcgcagtcgagccgg	CRISPR spacer
ttaaggacgtgcaggtagcgcagtcgaacctg	Protospacer
. .  ***********.**********.** *

502. spacer 5.3|28756|32|CP027025|CRISPRCasFinder matches to NZ_CP022992 (Paraburkholderia aromaticivorans strain BN5 plasmid pBN2, complete sequence) position: , mismatch: 8, identity: 0.75

cggccgacgtgcaggtggcgcagtcgagccgg	CRISPR spacer
aagccgacatgcaggtggcgcagacgcctcag	Protospacer
 .******.************** **  .*.*

503. spacer 5.3|28756|32|CP027025|CRISPRCasFinder matches to NZ_CP029777 (Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75

cggccgacgtgcaggtggcgcag----tcgagccgg	CRISPR spacer
cggtctacgtgcaggtggcgcagggcctcacg----	Protospacer
***.* *****************    **. *    

504. spacer 5.3|28756|32|CP027025|CRISPRCasFinder matches to NZ_CP046255 (Sphingobium sp. CAP-1 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.75

--cggccgacgtgcaggtggcgcagtcgagccgg	CRISPR spacer
tcctgct--cgtgcaggtggcgcggtcgatcctt	Protospacer
  * **.  **************.***** **  

505. spacer 5.3|28756|32|CP027025|CRISPRCasFinder matches to NZ_CP046255 (Sphingobium sp. CAP-1 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.75

--cggccgacgtgcaggtggcgcagtcgagccgg	CRISPR spacer
tcctgct--cgtgcaggtggcgcggtcgatcctt	Protospacer
  * **.  **************.***** **  

506. spacer 5.3|28756|32|CP027025|CRISPRCasFinder matches to NZ_CP009431 (Sphingopyxis macrogoltabida strain 203 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

cggccgacgtgcaggtggcgcagtcgagccgg--	CRISPR spacer
cggcggacgtgcaggtggcacag--ggggtgatt	Protospacer
**** **************.***  *.* .*.  

507. spacer 5.4|28817|32|CP027025|CRISPRCasFinder matches to MK450421 (Streptomyces phage Vash, complete genome) position: , mismatch: 8, identity: 0.75

ttgaccagcaccttccggtcgttggtc-cggta	CRISPR spacer
tcttccagcaccttccgcgcgttggtcaccat-	Protospacer
*.  *************  ******** * .* 

508. spacer 5.5|28878|32|CP027025|CRISPRCasFinder matches to NZ_LR134461 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 19, complete sequence) position: , mismatch: 8, identity: 0.75

gtcaccaccgtcgacgacggggccttcaccgc	CRISPR spacer
gcttccaccgtcgacgacgcggacttcacgaa	Protospacer
*.. *************** ** ****** . 

509. spacer 5.5|28878|32|CP027025|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75

gtcaccaccgtcgacgacggggccttcaccgc	CRISPR spacer
gagatcgtcgtcgacgacgggaccgtcaccgg	Protospacer
*  *.*..*************.** ****** 

510. spacer 5.5|28878|32|CP027025|CRISPRCasFinder matches to NZ_CP016619 (Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

gtcaccaccgtcgacgacggggccttcaccgc	CRISPR spacer
aacatcgaagtcgacgacggaaccttcaccgc	Protospacer
. **.*.  ***********..**********

511. spacer 5.8|29061|32|CP027025|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 8, identity: 0.75

gccgacatggagaagatggacttcccctcgat--	CRISPR spacer
cacgacccggagaagatggactt--cctcggccg	Protospacer
  **** .***************  *****..  

512. spacer 5.9|29122|32|CP027025|CRISPRCasFinder matches to NZ_CP015882 (Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence) position: , mismatch: 8, identity: 0.75

gacaccgtcaccaccttcatcgcgaacgtgca	CRISPR spacer
gacaccggcaacaccttcatcgccggccagga	Protospacer
******* ** ************ ..*  * *

513. spacer 5.9|29122|32|CP027025|CRISPRCasFinder matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 8, identity: 0.75

gacaccgtcaccaccttcatcgcgaacgtgca	CRISPR spacer
gacaccggcaacaccttcatcgccggccagga	Protospacer
******* ** ************ ..*  * *

514. spacer 5.13|29395|32|CP027025|CRISPRCasFinder matches to NZ_CP019603 (Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence) position: , mismatch: 8, identity: 0.75

gccgcagccgcccgcgcggcaggccacggagg	CRISPR spacer
ggggcaggcgcccgcgcggcaggccgcgatcc	Protospacer
*  **** *****************.**.   

515. spacer 5.13|29395|32|CP027025|CRISPRCasFinder matches to NZ_CP021409 (Celeribacter manganoxidans strain DY25 plasmid pDY25-E, complete sequence) position: , mismatch: 8, identity: 0.75

gccgcagccgcccgcgcggcaggccacggagg	CRISPR spacer
ctgcccgacgcccgcgcggcaggccgcgcagg	Protospacer
 .  * * *****************.** ***

516. spacer 5.13|29395|32|CP027025|CRISPRCasFinder matches to NZ_CP029835 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.75

gccgcagccgcccgcgcggcaggccacggagg	CRISPR spacer
cccgcagccgcccccgccgcaggccggcgccg	Protospacer
 ************ *** *******.  *  *

517. spacer 5.13|29395|32|CP027025|CRISPRCasFinder matches to NZ_CP015043 (Rhodovulum sp. P5 plasmid pRGUI04, complete sequence) position: , mismatch: 8, identity: 0.75

gccgcagccgcccgcgcggcaggccacggagg	CRISPR spacer
gccgcggccgcccgcgcggcgggcgtcttctg	Protospacer
*****.**************.***  *    *

518. spacer 5.13|29395|32|CP027025|CRISPRCasFinder matches to CP000622 (Burkholderia phage phiE255, complete genome) position: , mismatch: 8, identity: 0.75

gccgcagccgcccgcgcggcaggccacggagg	CRISPR spacer
gcgcaagcagcgcgcgcggcaggccacggcaa	Protospacer
**   *** ** ***************** ..

519. spacer 5.13|29395|32|CP027025|CRISPRCasFinder matches to NC_009237 (Burkholderia phage phiE255 chromosome, complete genome) position: , mismatch: 8, identity: 0.75

gccgcagccgcccgcgcggcaggccacggagg	CRISPR spacer
gcgcaagcagcgcgcgcggcaggccacggcaa	Protospacer
**   *** ** ***************** ..

520. spacer 5.14|29456|32|CP027025|CRISPRCasFinder matches to MN693615 (Marine virus AFVG_250M1187, complete genome) position: , mismatch: 8, identity: 0.75

ccgccccgtgtccacctggcccaccaccgcgt	CRISPR spacer
ttgtaccgtgaccacctgccccaccaccacct	Protospacer
..*. ***** ******* *********.* *

521. spacer 5.14|29456|32|CP027025|CRISPRCasFinder matches to MN694069 (Marine virus AFVG_250M891, complete genome) position: , mismatch: 8, identity: 0.75

ccgccccgtgtccacctggcccaccaccgcgt	CRISPR spacer
ttgtaccgtgaccacctgccccaccaccacct	Protospacer
..*. ***** ******* *********.* *

522. spacer 5.14|29456|32|CP027025|CRISPRCasFinder matches to MN694089 (Marine virus AFVG_250M217, complete genome) position: , mismatch: 8, identity: 0.75

ccgccccgtgtccacctggcccaccaccgcgt	CRISPR spacer
ttgtaccgtgaccacctgccccaccaccacct	Protospacer
..*. ***** ******* *********.* *

523. spacer 5.14|29456|32|CP027025|CRISPRCasFinder matches to MN694653 (Marine virus AFVG_250M216, complete genome) position: , mismatch: 8, identity: 0.75

ccgccccgtgtccacctggcccaccaccgcgt	CRISPR spacer
ttgtaccgtgaccacctgccccaccaccacct	Protospacer
..*. ***** ******* *********.* *

524. spacer 6.1|30573|31|CP027025|PILER-CR matches to NZ_CP033726 (Clavibacter michiganensis subsp. michiganensis strain UF1 plasmid pCM2U-F1, complete sequence) position: , mismatch: 8, identity: 0.742

acatcaccgtccggatctcccgcgaggcgac	CRISPR spacer
ccatcaccgtccggaccgcccgcgagcacct	Protospacer
 **************.* ********    .

525. spacer 6.1|30573|31|CP027025|PILER-CR matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.742

acatcaccgtccggatctcccgcgaggcgac	CRISPR spacer
ggctgacggtccggatctcccccgaggcgta	Protospacer
.  * ** ************* *******  

526. spacer 6.1|30573|31|CP027025|PILER-CR matches to NZ_CP029836 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed6, complete sequence) position: , mismatch: 8, identity: 0.742

acatcaccgtccggatctcccgcgaggcgac	CRISPR spacer
caatcaccgtccggatctcctgcgggcagta	Protospacer
  ******************.***.*  *  

527. spacer 6.1|30573|31|CP027025|PILER-CR matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.742

acatcaccgtccggatctcccgcgaggcgac	CRISPR spacer
ggctgacggtccggatctcccccgaggcgta	Protospacer
.  * ** ************* *******  

528. spacer 6.2|30634|31|CP027025|PILER-CR matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.742

tgccttcgaagacgaccgtcgccaggtcgta	CRISPR spacer
tcatccggaagacgacggtcggcaggtcgta	Protospacer
*  ... ********* **** *********

529. spacer 6.2|30634|31|CP027025|PILER-CR matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 8, identity: 0.742

tgccttcgaagacgaccgtcgccaggtcgta	CRISPR spacer
tcatccggaagacgacggtcggcaggtcgta	Protospacer
*  ... ********* **** *********

530. spacer 6.2|30634|31|CP027025|PILER-CR matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 8, identity: 0.742

tgccttcgaagacgaccgtcgccaggtcgta	CRISPR spacer
tcatccggaagacgacggtcggcaggtcgta	Protospacer
*  ... ********* **** *********

531. spacer 6.2|30634|31|CP027025|PILER-CR matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.742

tgccttcgaagacgaccgtcgccaggtcgta	CRISPR spacer
tcatccggaagacgacggtcggcaggtcgta	Protospacer
*  ... ********* **** *********

532. spacer 6.2|30634|31|CP027025|PILER-CR matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.742

tgccttcgaagacgaccgtcgccaggtcgta	CRISPR spacer
tcatccggaagacgacggtcggcaggtcgta	Protospacer
*  ... ********* **** *********

533. spacer 6.2|30634|31|CP027025|PILER-CR matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 8, identity: 0.742

tgccttcgaagacgaccgtcgccaggtcgta	CRISPR spacer
tcatccggaagacgacggtcggcaggtcgta	Protospacer
*  ... ********* **** *********

534. spacer 6.2|30634|31|CP027025|PILER-CR matches to NZ_CP042998 (Aquisphaera giovannonii strain OJF2 plasmid pOJF2_1, complete sequence) position: , mismatch: 8, identity: 0.742

tgccttcgaagacgaccgtcgccaggtcgta	CRISPR spacer
acctttcgaagacgcccggcgccaggtgatc	Protospacer
  *.********** *** ******** .* 

535. spacer 6.3|30572|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP033726 (Clavibacter michiganensis subsp. michiganensis strain UF1 plasmid pCM2U-F1, complete sequence) position: , mismatch: 8, identity: 0.75

gacatcaccgtccggatctcccgcgaggcgac	CRISPR spacer
gccatcaccgtccggaccgcccgcgagcacct	Protospacer
* **************.* ********    .

536. spacer 6.5|30694|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP021374 (Rhizobium sp. ACO-34A plasmid pRACO34Ab, complete sequence) position: , mismatch: 8, identity: 0.75

gccttgaacacgctgacgaagatgctgccgac	CRISPR spacer
tagttgaacacggtgacgaagatgctggttag	Protospacer
   ********* ************** . * 

537. spacer 6.5|30694|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

gccttgaacacgctgacgaagatgctgccgac	CRISPR spacer
ggagcaagcacgctgacgaagatcttgccgac	Protospacer
*   ..*.*************** .*******

538. spacer 6.5|30694|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

gccttgaacacgctgacgaagatgctgccgac	CRISPR spacer
ggagcaagcacgctgacgaagatcttgccgac	Protospacer
*   ..*.*************** .*******

539. spacer 6.5|30694|32|CP027025|CRISPRCasFinder,CRT matches to MH047631 (Microbacterium phage Triscuit, complete genome) position: , mismatch: 8, identity: 0.75

gccttgaacacgctgacgaagatgctgccgac	CRISPR spacer
ctggttaccacgctgactgagatgctgccgac	Protospacer
 .  * * ********* .*************

540. spacer 7.1|30879|32|CP027025|CRISPRCasFinder,CRT matches to LN997844 (Streptomyces reticuli genome assembly TUE45, plasmid : III) position: , mismatch: 8, identity: 0.75

ccacgccgccgcctggtcgccagggaagtcgc	CRISPR spacer
gcccgccgccgccaggccgccagggaagaaca	Protospacer
 * ********** **.***********    

541. spacer 7.2|30940|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP048398 (Streptomyces sp. S4.7 plasmid pSSPS4.7a, complete sequence) position: , mismatch: 8, identity: 0.75

gacagaccgccgagggcgatccggacggagtt	CRISPR spacer
gccgcaccgccgagggcgatgaggacggcgag	Protospacer
* *. ***************  ****** *  

542. spacer 7.2|30940|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP021355 (Rhodococcus sp. S2-17 plasmid pRB98, complete sequence) position: , mismatch: 8, identity: 0.75

gacagaccgccgagggcgatccggacggagtt	CRISPR spacer
agaagaccggcgagggcgatcaggaccggggt	Protospacer
.. ****** *********** **** *.* *

543. spacer 7.3|31001|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP006990 (Rhizobium sp. IE4771 plasmid pRetIE4771d, complete sequence) position: , mismatch: 8, identity: 0.75

gcagccccgatgacggccgcccactcgcctac	CRISPR spacer
gtcgccgcgatgacggccgccccctcggggcc	Protospacer
*. *** *************** ****    *

544. spacer 7.3|31001|32|CP027025|CRISPRCasFinder,CRT matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 8, identity: 0.75

gcagccccgatgacggccgcccactcgcctac	CRISPR spacer
gtcgccgcgatgacggccgccccctcggggcc	Protospacer
*. *** *************** ****    *

545. spacer 7.3|31001|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP027239 (Dietzia sp. oral taxon 368 strain W5195 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

gcagccccgatgacggccgcccactcgcctac	CRISPR spacer
ggctcgccaatgccggccgcccactcgccggc	Protospacer
*   * **.*** **************** .*

546. spacer 7.3|31001|32|CP027025|CRISPRCasFinder,CRT matches to NC_011962 (Rhodobacter sphaeroides KD131 plasmid pRSKD131A, complete sequence) position: , mismatch: 8, identity: 0.75

gcagccccgatgacggccgcccactcgcctac---	CRISPR spacer
gcaaccccgaggacggccgccca---gaccagacg	Protospacer
***.****** ************   * *.*    

547. spacer 7.5|31123|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045412 (Roseovarius sp. THAF8 plasmid pTHAF8_b, complete sequence) position: , mismatch: 8, identity: 0.75

--tcgaccggcccgcgcccgtactcggccggcag	CRISPR spacer
ggacga--agcgcgcgcccgtactcggccagccc	Protospacer
   ***  .** *****************.**  

548. spacer 8.1|31721|32|CP027025|CRISPRCasFinder matches to KY210139 (Xanthomonas phage KPhi1, complete genome) position: , mismatch: 8, identity: 0.75

gtcttgccctgccagtccttgcggcccttggt	CRISPR spacer
atcttgcgctgccggtccttgcggcctagcga	Protospacer
.****** *****.************.   * 

549. spacer 8.1|31721|32|CP027025|CRISPRCasFinder matches to MN908685 (Microbacterium phage PauloDiaboli, complete genome) position: , mismatch: 8, identity: 0.75

gtcttgccctgccagtccttgcggcccttggt	CRISPR spacer
gtcttgccctgcgcgtccttgcgggcgtcacg	Protospacer
************  ********** * *..  

550. spacer 8.1|31721|32|CP027025|CRISPRCasFinder matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 8, identity: 0.75

gtcttgccctgccagtccttgcggcccttggt	CRISPR spacer
cgcatgtcctgcccgtccttgcggcccgcgga	Protospacer
  * **.****** ************* .** 

551. spacer 1.1|8886|32|CP027025|CRT matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 9, identity: 0.719

aagcccaggtccgggccctggacgaaccagga	CRISPR spacer
gcgcccaggtcctcgccctggacgatgacggc	Protospacer
. **********  ***********    ** 

552. spacer 1.1|8886|32|CP027025|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 9, identity: 0.719

aagcccaggtccgggccctggacgaaccagga	CRISPR spacer
ggatccgcctccgggccccgcacgaaccagga	Protospacer
....**.  *********.* ***********

553. spacer 1.1|8886|32|CP027025|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 9, identity: 0.719

aagcccaggtccgggccctggacgaaccagga	CRISPR spacer
ggatccgcctccgggccccgcacgaaccagga	Protospacer
....**.  *********.* ***********

554. spacer 1.1|8886|32|CP027025|CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 9, identity: 0.719

aagcccaggtccgggccctggacgaaccagga	CRISPR spacer
ggatccgcctccgggccccgcacgaaccagga	Protospacer
....**.  *********.* ***********

555. spacer 1.3|9008|32|CP027025|CRT matches to NZ_CP045548 (Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

aacgtgtcgaggccgatctgcgcgtacttgtt	CRISPR spacer
gcgctgccgaggccgatctgcgagtactggaa	Protospacer
.   **.*************** ***** *  

556. spacer 1.3|9008|32|CP027025|CRT matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 9, identity: 0.719

aacgtgtcgaggccgatctgcgcgtacttgtt	CRISPR spacer
gtcgtgccgaggccgatctgctcgtggatcat	Protospacer
. ****.************** ***.  *  *

557. spacer 1.5|9130|32|CP027025|CRT matches to NC_049478 (Arthrobacter phage Mufasa8, complete genome) position: , mismatch: 9, identity: 0.719

gtagtcctcgaaggacagcagggtcgtggcga	CRISPR spacer
cgtgtcctcggtggacagcagggtcgcgcggg	Protospacer
   *******. **************.*  *.

558. spacer 1.8|9314|32|CP027025|CRT matches to NC_023284 (Streptomyces sp. F2 plasmid pFRL4, complete sequence) position: , mismatch: 9, identity: 0.719

cgtgccgtccgtgaggccgtgttcgacgagct	CRISPR spacer
ggtgccgtccgggagggcgtgttcccacacgt	Protospacer
 ********** **** *******    *  *

559. spacer 1.8|9314|32|CP027025|CRT matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 9, identity: 0.719

cgtgccgtccgtgaggccgtgttcgacgagct	CRISPR spacer
gatctgatccgtgacgccgtgctcgacgaggt	Protospacer
 .* . .******* ******.******** *

560. spacer 1.9|9375|32|CP027025|CRT matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 9, identity: 0.719

agcgccaccgcgccgcggacggcctcgatcgt	CRISPR spacer
cctgccaccacggcgcggacggcctcgacgcg	Protospacer
  .******.** ***************.   

561. spacer 1.9|9375|32|CP027025|CRT matches to NZ_CP013345 (Sphingopyxis macrogoltabida strain 203N plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

agcgccaccgcgccgcggacggcctcgatcgt	CRISPR spacer
tgaacgcccgcgccgcggacggcgccgatcaa	Protospacer
 * .*  **************** .*****. 

562. spacer 1.9|9375|32|CP027025|CRT matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 9, identity: 0.719

agcgccaccgcgccgcggacggcctcgatcgt	CRISPR spacer
gctgccaccgcctcgcggacggcctcgccctc	Protospacer
. .******** .************** .* .

563. spacer 1.9|9375|32|CP027025|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 9, identity: 0.719

agcgccaccgcgccgcggacggcctcgatcgt	CRISPR spacer
acttccaccgcgcagcggaccgcctcgacgac	Protospacer
* . ********* ****** *******. ..

564. spacer 1.9|9375|32|CP027025|CRT matches to MN813693 (Mycobacterium phage Imvubu, complete genome) position: , mismatch: 9, identity: 0.719

agcgccaccgcgccgcggacggcctcgatcgt	CRISPR spacer
ctggccaccgcgctgctgacggcctcggcgat	Protospacer
   **********.** **********.. .*

565. spacer 1.9|9375|32|CP027025|CRT matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 9, identity: 0.719

agcgccaccgcgccgcggacggcctcgatcgt	CRISPR spacer
accgccagcgcgccgcggatggcctgaacaac	Protospacer
* ***** ***********.***** .*. ..

566. spacer 1.9|9375|32|CP027025|CRT matches to NZ_CP027299 (Streptomyces sp. SGAir0924 plasmid unnamed_5) position: , mismatch: 9, identity: 0.719

agcgccaccgcgccgcggacggcctcgatcgt	CRISPR spacer
acggccactgcgccgcggccggcctcaccctc	Protospacer
*  *****.********* *******. .* .

567. spacer 1.9|9375|32|CP027025|CRT matches to NZ_AP019802 (Thermus thermophilus strain HC11 plasmid pHC11, complete sequence) position: , mismatch: 9, identity: 0.719

agcgccaccgcgccgcggacggcctcgatcgt	CRISPR spacer
accctcaccccgccggggacggcctcgaggta	Protospacer
* * .**** ***** ************    

568. spacer 1.9|9375|32|CP027025|CRT matches to NZ_CP024312 (Rhizobium sp. NXC24 plasmid pRspNXC24a, complete sequence) position: , mismatch: 9, identity: 0.719

agcgccaccgcgccgcggacggcctcgatcgt	CRISPR spacer
ggcaagctcgcgccgcggacggtctagatcga	Protospacer
.**.   .**************.** ***** 

569. spacer 1.9|9375|32|CP027025|CRT matches to NZ_CP045548 (Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

agcgccaccgcgccgcggacggcctcgatcgt	CRISPR spacer
gccccggccgcgtcgcggaaggcctcgatctc	Protospacer
. * * .*****.****** ********** .

570. spacer 1.10|9436|32|CP027025|CRT matches to NZ_CP050093 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence) position: , mismatch: 9, identity: 0.719

ccccagctcgtcgcctacagcgccggagtcct	CRISPR spacer
tcccagctcgacggctacagcgcccagaacat	Protospacer
.********* ** ********** ... * *

571. spacer 1.10|9436|32|CP027025|CRT matches to NZ_CP050082 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence) position: , mismatch: 9, identity: 0.719

ccccagctcgtcgcctacagcgccggagtcct	CRISPR spacer
acccagctcgacggctacagcgcccagaacat	Protospacer
 ********* ** ********** ... * *

572. spacer 1.10|9436|32|CP027025|CRT matches to NC_008384 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence) position: , mismatch: 9, identity: 0.719

ccccagctcgtcgcctacagcgccggagtcct	CRISPR spacer
tcccagctcgacggctacagcgcccagaacat	Protospacer
.********* ** ********** ... * *

573. spacer 1.10|9436|32|CP027025|CRT matches to NZ_CP025014 (Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence) position: , mismatch: 9, identity: 0.719

ccccagctcgtcgcctacagcgccggagtcct	CRISPR spacer
tcccagctcgacggctacagcgcccagaacat	Protospacer
.********* ** ********** ... * *

574. spacer 1.10|9436|32|CP027025|CRT matches to NZ_CP049732 (Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence) position: , mismatch: 9, identity: 0.719

ccccagctcgtcgcctacagcgccggagtcct	CRISPR spacer
acccagctcgacggctacagcgcccagaacat	Protospacer
 ********* ** ********** ... * *

575. spacer 1.10|9436|32|CP027025|CRT matches to NZ_CP053441 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence) position: , mismatch: 9, identity: 0.719

ccccagctcgtcgcctacagcgccggagtcct	CRISPR spacer
tcccagctcgacggctacagcgcccagaacat	Protospacer
.********* ** ********** ... * *

576. spacer 1.10|9436|32|CP027025|CRT matches to NZ_CP013503 (Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence) position: , mismatch: 9, identity: 0.719

ccccagctcgtcgcctacagcgccggagtcct	CRISPR spacer
acccagctcgacggctacagcgcccagaacat	Protospacer
 ********* ** ********** ... * *

577. spacer 1.10|9436|32|CP027025|CRT matches to NZ_CP048282 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence) position: , mismatch: 9, identity: 0.719

ccccagctcgtcgcctacagcgccggagtcct	CRISPR spacer
tcccagctcgacggctacagcgcccagaacat	Protospacer
.********* ** ********** ... * *

578. spacer 1.10|9436|32|CP027025|CRT matches to NZ_CP013509 (Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence) position: , mismatch: 9, identity: 0.719

ccccagctcgtcgcctacagcgccggagtcct	CRISPR spacer
acccagctcgacggctacagcgcccagaacat	Protospacer
 ********* ** ********** ... * *

579. spacer 1.10|9436|32|CP027025|CRT matches to NZ_CP013520 (Rhizobium sp. N113 plasmid pRspN113c, complete sequence) position: , mismatch: 9, identity: 0.719

ccccagctcgtcgcctacagcgccggagtcct	CRISPR spacer
acccagctcgacggctacagcgcccagaacat	Protospacer
 ********* ** ********** ... * *

580. spacer 1.10|9436|32|CP027025|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 9, identity: 0.719

ccccagctcgtcgcctacagcgccggagtcct	CRISPR spacer
acccagctcgacggctacagcgcccagcgcat	Protospacer
 ********* ** ********** ..  * *

581. spacer 1.10|9436|32|CP027025|CRT matches to NZ_CP013493 (Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence) position: , mismatch: 9, identity: 0.719

ccccagctcgtcgcctacagcgccggagtcct	CRISPR spacer
acccagctcgacggctacagcgcccagaacat	Protospacer
 ********* ** ********** ... * *

582. spacer 1.10|9436|32|CP027025|CRT matches to NZ_CP013516 (Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence) position: , mismatch: 9, identity: 0.719

ccccagctcgtcgcctacagcgccggagtcct	CRISPR spacer
acccagctcgacggctacagcgcccagaacat	Protospacer
 ********* ** ********** ... * *

583. spacer 1.10|9436|32|CP027025|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 9, identity: 0.719

ccccagctcgtcgcctacagcgccggagtcct	CRISPR spacer
acccagctcgacggctacagcgcccagcgcat	Protospacer
 ********* ** ********** ..  * *

584. spacer 1.10|9436|32|CP027025|CRT matches to NZ_CP053208 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence) position: , mismatch: 9, identity: 0.719

ccccagctcgtcgcctacagcgccggagtcct	CRISPR spacer
acccagctcgacggctacagcgcccagaacat	Protospacer
 ********* ** ********** ... * *

585. spacer 1.12|9008|31|CP027025|CRISPRCasFinder matches to NC_019848 (Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence) position: , mismatch: 9, identity: 0.71

aacgtgtcgaggccgatctgcgcgtacttgt	CRISPR spacer
ttattgtggagcccgatctgcgcgtaccagg	Protospacer
    *** *** ***************. * 

586. spacer 1.12|9008|31|CP027025|CRISPRCasFinder matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 9, identity: 0.71

aacgtgtcgaggccgatctgcgcgtacttgt	CRISPR spacer
gtcgtgccgaggccgatctgctcgtggatca	Protospacer
. ****.************** ***.  *  

587. spacer 1.13|9069|31|CP027025|CRISPRCasFinder matches to NZ_AP015030 (Pseudomonas putida strain KF715 plasmid pKF715A, complete sequence) position: , mismatch: 9, identity: 0.71

gtgtcgccaagcgagaggcgcgtcgtgatgg	CRISPR spacer
ttcatcccaatcgagaggcgcatcgtgattc	Protospacer
 *  . **** **********.*******  

588. spacer 1.17|9314|31|CP027025|CRISPRCasFinder matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 9, identity: 0.71

cgtgccgtccgtgaggccgtgttcgacgagc	CRISPR spacer
ttgctcgtccttgaggccgtgttcggcgaca	Protospacer
.   .***** **************.***  

589. spacer 1.17|9314|31|CP027025|CRISPRCasFinder matches to NZ_CP020952 (Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence) position: , mismatch: 9, identity: 0.71

cgtgccgtccgtgaggccgtgttcgacgagc	CRISPR spacer
ctgctcgtccttgaggccgtgttcggcggca	Protospacer
*   .***** **************.**.  

590. spacer 1.17|9314|31|CP027025|CRISPRCasFinder matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 9, identity: 0.71

cgtgccgtccgtgaggccgtgttcgacgagc	CRISPR spacer
gatctgatccgtgacgccgtgctcgacgagg	Protospacer
 .* . .******* ******.******** 

591. spacer 1.18|9375|31|CP027025|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.71

agcgccaccgcgccgcggacggcctcgatcg	CRISPR spacer
gacgccaccgcgccgaggacggccaacgcgg	Protospacer
..************* ********   .. *

592. spacer 1.18|9375|31|CP027025|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.71

agcgccaccgcgccgcggacggcctcgatcg	CRISPR spacer
gggaaatccgcgccacgggcggcctcgatca	Protospacer
.* .   *******.***.***********.

593. spacer 1.18|9375|31|CP027025|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 9, identity: 0.71

agcgccaccgcgccgcggacggcctcgatcg	CRISPR spacer
gggaaatccgcgccacgggcggcctcgatca	Protospacer
.* .   *******.***.***********.

594. spacer 1.18|9375|31|CP027025|CRISPRCasFinder matches to MN813693 (Mycobacterium phage Imvubu, complete genome) position: , mismatch: 9, identity: 0.71

agcgccaccgcgccgcggacggcctcgatcg	CRISPR spacer
ctggccaccgcgctgctgacggcctcggcga	Protospacer
   **********.** **********.. .

595. spacer 1.18|9375|31|CP027025|CRISPRCasFinder matches to NZ_CP011515 (Mitsuaria sp. 7 plasmid, complete sequence) position: , mismatch: 9, identity: 0.71

agcgccaccgcgccgcggacggcctcgatcg	CRISPR spacer
tgcgccagcgcgccgaggacggccatgccga	Protospacer
 ****** ******* ******** .* . .

596. spacer 1.18|9375|31|CP027025|CRISPRCasFinder matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 9, identity: 0.71

agcgccaccgcgccgcggacggcctcgatcg	CRISPR spacer
agcgccagcgcgccgctgacggcaaaaccgg	Protospacer
******* ******** ******   . . *

597. spacer 1.18|9375|31|CP027025|CRISPRCasFinder matches to NC_008537 (Arthrobacter sp. FB24 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.71

agcgccaccgcgccgcggacggcctcgatcg	CRISPR spacer
cgcgcgaccgcgccgcggtcggccgttagac	Protospacer
 **** ************ ***** . *   

598. spacer 1.18|9375|31|CP027025|CRISPRCasFinder matches to NZ_CP003988 (Streptomyces sp. 769 plasmid pSGZL, complete sequence) position: , mismatch: 9, identity: 0.71

agcgccaccgcgccgcggacggcctcgatcg	CRISPR spacer
tcttccagcgcggcgcggacggcctcggtga	Protospacer
  . *** **** **************.* .

599. spacer 1.18|9375|31|CP027025|CRISPRCasFinder matches to NZ_CP015882 (Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence) position: , mismatch: 9, identity: 0.71

agcgccaccgcgccgcggacggcctcgatcg	CRISPR spacer
agcgccagcgcgccgctgacggcaaaaccgg	Protospacer
******* ******** ******   . . *

600. spacer 1.18|9375|31|CP027025|CRISPRCasFinder matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 9, identity: 0.71

agcgccaccgcgccgcggacggcctcgatcg	CRISPR spacer
ccctgcaccgcgccgcgcacggccccgacgc	Protospacer
  *  ************ ******.***.  

601. spacer 1.19|9436|31|CP027025|CRISPRCasFinder matches to NZ_CP050093 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence) position: , mismatch: 9, identity: 0.71

ccccagctcgtcgcctacagcgccggagtcc	CRISPR spacer
tcccagctcgacggctacagcgcccagaaca	Protospacer
.********* ** ********** ... * 

602. spacer 1.19|9436|31|CP027025|CRISPRCasFinder matches to NZ_CP050082 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence) position: , mismatch: 9, identity: 0.71

ccccagctcgtcgcctacagcgccggagtcc	CRISPR spacer
acccagctcgacggctacagcgcccagaaca	Protospacer
 ********* ** ********** ... * 

603. spacer 1.19|9436|31|CP027025|CRISPRCasFinder matches to NC_008384 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence) position: , mismatch: 9, identity: 0.71

ccccagctcgtcgcctacagcgccggagtcc	CRISPR spacer
tcccagctcgacggctacagcgcccagaaca	Protospacer
.********* ** ********** ... * 

604. spacer 1.19|9436|31|CP027025|CRISPRCasFinder matches to NZ_CP025014 (Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence) position: , mismatch: 9, identity: 0.71

ccccagctcgtcgcctacagcgccggagtcc	CRISPR spacer
tcccagctcgacggctacagcgcccagaaca	Protospacer
.********* ** ********** ... * 

605. spacer 1.19|9436|31|CP027025|CRISPRCasFinder matches to NZ_CP049732 (Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence) position: , mismatch: 9, identity: 0.71

ccccagctcgtcgcctacagcgccggagtcc	CRISPR spacer
acccagctcgacggctacagcgcccagaaca	Protospacer
 ********* ** ********** ... * 

606. spacer 1.19|9436|31|CP027025|CRISPRCasFinder matches to NZ_CP053441 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence) position: , mismatch: 9, identity: 0.71

ccccagctcgtcgcctacagcgccggagtcc	CRISPR spacer
tcccagctcgacggctacagcgcccagaaca	Protospacer
.********* ** ********** ... * 

607. spacer 1.19|9436|31|CP027025|CRISPRCasFinder matches to NZ_CP013503 (Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence) position: , mismatch: 9, identity: 0.71

ccccagctcgtcgcctacagcgccggagtcc	CRISPR spacer
acccagctcgacggctacagcgcccagaaca	Protospacer
 ********* ** ********** ... * 

608. spacer 1.19|9436|31|CP027025|CRISPRCasFinder matches to NZ_CP048282 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence) position: , mismatch: 9, identity: 0.71

ccccagctcgtcgcctacagcgccggagtcc	CRISPR spacer
tcccagctcgacggctacagcgcccagaaca	Protospacer
.********* ** ********** ... * 

609. spacer 1.19|9436|31|CP027025|CRISPRCasFinder matches to NZ_CP013509 (Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence) position: , mismatch: 9, identity: 0.71

ccccagctcgtcgcctacagcgccggagtcc	CRISPR spacer
acccagctcgacggctacagcgcccagaaca	Protospacer
 ********* ** ********** ... * 

610. spacer 1.19|9436|31|CP027025|CRISPRCasFinder matches to NZ_CP013520 (Rhizobium sp. N113 plasmid pRspN113c, complete sequence) position: , mismatch: 9, identity: 0.71

ccccagctcgtcgcctacagcgccggagtcc	CRISPR spacer
acccagctcgacggctacagcgcccagaaca	Protospacer
 ********* ** ********** ... * 

611. spacer 1.19|9436|31|CP027025|CRISPRCasFinder matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 9, identity: 0.71

ccccagctcgtcgcctacagcgccggagtcc	CRISPR spacer
acccagctcgacggctacagcgcccagcgca	Protospacer
 ********* ** ********** ..  * 

612. spacer 1.19|9436|31|CP027025|CRISPRCasFinder matches to NZ_CP013493 (Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence) position: , mismatch: 9, identity: 0.71

ccccagctcgtcgcctacagcgccggagtcc	CRISPR spacer
acccagctcgacggctacagcgcccagaaca	Protospacer
 ********* ** ********** ... * 

613. spacer 1.19|9436|31|CP027025|CRISPRCasFinder matches to NZ_CP013516 (Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence) position: , mismatch: 9, identity: 0.71

ccccagctcgtcgcctacagcgccggagtcc	CRISPR spacer
acccagctcgacggctacagcgcccagaaca	Protospacer
 ********* ** ********** ... * 

614. spacer 1.19|9436|31|CP027025|CRISPRCasFinder matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 9, identity: 0.71

ccccagctcgtcgcctacagcgccggagtcc	CRISPR spacer
acccagctcgacggctacagcgcccagcgca	Protospacer
 ********* ** ********** ..  * 

615. spacer 1.19|9436|31|CP027025|CRISPRCasFinder matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 9, identity: 0.71

ccccagctcgtcgcctacagcgccggagtcc	CRISPR spacer
gtccagcccgtcgcctgcagcgccgcgccca	Protospacer
 .*****.********.******** . .* 

616. spacer 1.19|9436|31|CP027025|CRISPRCasFinder matches to NZ_CP053208 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence) position: , mismatch: 9, identity: 0.71

ccccagctcgtcgcctacagcgccggagtcc	CRISPR spacer
acccagctcgacggctacagcgcccagaaca	Protospacer
 ********* ** ********** ... * 

617. spacer 2.1|18044|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP015221 (Rhodococcus sp. PBTS 2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

ggtgacggtcacgggcggtgctcctgggcggt	CRISPR spacer
tgtgatggtcacggtcggtgctcctttgtccg	Protospacer
 ****.******** **********  *.   

618. spacer 2.2|18105|32|CP027025|CRISPRCasFinder,CRT matches to CP006583 (Mesorhizobium huakuii 7653R plasmid pMHb, complete sequence) position: , mismatch: 9, identity: 0.719

acgcagctcctccaggccgggcctgacggcct	CRISPR spacer
aatcagctccgccacgccgggcctgaggctga	Protospacer
*  ******* *** *********** * .  

619. spacer 2.3|18166|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

ctctggttgagtacgacgacgagcagggtctc	CRISPR spacer
tctccgatgagtacgacgacgagcagcgcctg	Protospacer
.... * ******************* *.** 

620. spacer 2.3|18166|32|CP027025|CRISPRCasFinder,CRT matches to MN369741 (Mycobacterium phage LoneWolf, complete genome) position: , mismatch: 9, identity: 0.719

ctctggttgagtacgacgacgagcagggtctc	CRISPR spacer
ctctggtcgagtacgccgacgagttcaagttc	Protospacer
*******.******* *******.  .. .**

621. spacer 2.4|18227|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP020445 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719

ggatcgcgccgtcacatgcgggtgggcggctt	CRISPR spacer
acccgccgccttcagatgcgggtgggcggctg	Protospacer
.  .  **** *** **************** 

622. spacer 2.4|18227|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP044079 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

ggatcgcgccgtcacatgcgggtgggcggctt	CRISPR spacer
acccgccgccttcagatgcgggtgggcggctg	Protospacer
.  .  **** *** **************** 

623. spacer 2.4|18227|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP031079 (Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence) position: , mismatch: 9, identity: 0.719

ggatcgcgccgtcacatgcgggtgggcggctt	CRISPR spacer
acccgccgccttcagatgcgggtgggcggctg	Protospacer
.  .  **** *** **************** 

624. spacer 2.5|18288|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719

taccggacggcgctggaggccggtccgatcca	CRISPR spacer
taccgggcggcgcgggaggccggactgcgggt	Protospacer
******.****** ********* *.*     

625. spacer 2.6|18349|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719

agtaccagcgccccggacgcggcgacctgcat	CRISPR spacer
ccctcgcgcgccccggacccggcgaccagcac	Protospacer
  . *  *********** ******** ***.

626. spacer 2.6|18349|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP007144 (Hymenobacter swuensis DY53 plasmid pHsw1, complete sequence) position: , mismatch: 9, identity: 0.719

agtaccagcgccccggacgcggcgacctgcat	CRISPR spacer
ggcaccagcgccctggacgtggcgacggacga	Protospacer
.*.**********.*****.******  .*. 

627. spacer 2.6|18349|32|CP027025|CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 9, identity: 0.719

agtaccagcgccccggacgcggcgacctgcat	CRISPR spacer
acggtgagcgccccggccgcggcgccctgggt	Protospacer
*  .. ********** ******* **** .*

628. spacer 2.6|18349|32|CP027025|CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 9, identity: 0.719

agtaccagcgccccggacgcggcgacctgcat	CRISPR spacer
acggtgagcgccccggccgcggcgccctgggt	Protospacer
*  .. ********** ******* **** .*

629. spacer 3.3|18743|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719

ccatacgtcagcgtcgcgccaccgccagccgg	CRISPR spacer
cgggatcgaagccgcgcgccaccgccagccgg	Protospacer
* . *.   ***  ******************

630. spacer 3.3|18743|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 9, identity: 0.719

ccatacgtcagcgtcgcgccaccgccagccgg	CRISPR spacer
cgggatcgaagccgcgcgccaccgccagccgg	Protospacer
* . *.   ***  ******************

631. spacer 3.3|18743|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.719

ccatacgtcagcgtcgcgccaccgccagccgg	CRISPR spacer
agctgggccagcgtcgcgccgccgcccgccgc	Protospacer
   *. *.************.***** **** 

632. spacer 3.3|18743|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.719

ccatacgtcagcgtcgcgccaccgccagccgg	CRISPR spacer
agctgggccagcgtcgcgccgccgcccgccgc	Protospacer
   *. *.************.***** **** 

633. spacer 3.3|18743|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.719

ccatacgtcagcgtcgcgccaccgccagccgg	CRISPR spacer
agctgggccagcgtcgcgccgccgcccgccgc	Protospacer
   *. *.************.***** **** 

634. spacer 3.5|18865|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP020040 (Streptomyces sp. 3211 isolate 3 plasmid p3211-1, complete sequence) position: , mismatch: 9, identity: 0.719

ctcaggtccaccgacaacttcgcggccgacac	CRISPR spacer
cagaccaccaccgacaacatcccggccgaccg	Protospacer
*  *   *********** ** ********  

635. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP029835 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
cccgcagccgcccccgccgcaggccggcgccg	Protospacer
 ************ *** *******.  *  .

636. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP015043 (Rhodovulum sp. P5 plasmid pRGUI04, complete sequence) position: , mismatch: 9, identity: 0.719

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
gccgcggccgcccgcgcggcgggcgtcttctg	Protospacer
*****.**************.***  *    .

637. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP021409 (Celeribacter manganoxidans strain DY25 plasmid pDY25-E, complete sequence) position: , mismatch: 9, identity: 0.719

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
ctgcccgacgcccgcgcggcaggccgcgcagg	Protospacer
 .  * * *****************.** **.

638. spacer 3.7|18987|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cttttcaggaggctggaggcgcgcaacgcgtc	CRISPR spacer
ccgcccgtcaggcggcaggcgcgcaacgcgtc	Protospacer
*. ..*.  **** * ****************

639. spacer 3.8|19048|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP017043 (Selenomonas sp. oral taxon 920 strain W5150 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

cgcgtttgccccttgcagccccgattcatccg	CRISPR spacer
gggcgttgccccctgcacccccgattcaagca	Protospacer
 *   *******.**** **********  *.

640. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719

tctgcggcggccggcgccgggccgcgcttggg	CRISPR spacer
gctgcggcggccggcgcctggacgatgacggc	Protospacer
 ***************** ** **    .** 

641. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 9, identity: 0.719

tctgcggcggccggcgccgggccgcgcttggg	CRISPR spacer
gctgcggcggccggcgcctggacgatgacggt	Protospacer
 ***************** ** **    .** 

642. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 9, identity: 0.719

tctgcggcggccggcgccgggccgcgcttggg	CRISPR spacer
ccggcggcgtccggcgccgtgccgcgcaccac	Protospacer
.* ****** ********* ******* . . 

643. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719

tctgcggcggccggcgccgggccgcgcttggg	CRISPR spacer
ggcgcggcggtcggcgccgggacgcgcaacga	Protospacer
  .*******.********** *****   *.

644. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NC_015951 (Streptomyces violaceusniger Tu 4113 plasmid pSTRVI01, complete sequence) position: , mismatch: 9, identity: 0.719

tctgcggcggccggcgccgggccgcgcttggg	CRISPR spacer
agcgtgccggccggggcctggccgcgcttgat	Protospacer
  .*.* ******* *** ***********. 

645. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017148 (Bosea vaviloviae strain Vaf18 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

tctgcggcggccggcgccgggccgcgcttggg	CRISPR spacer
ctggcggccgccggcgccgtgccgcgagtcga	Protospacer
.. ***** ********** ******  * *.

646. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 9, identity: 0.719

tctgcggcggccggcgccgggccgcgcttggg	CRISPR spacer
ctttcggccgccggcgccgggccgagccttac	Protospacer
..* **** *************** **.* . 

647. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NC_020548 (Azoarcus sp. KH32C plasmid pAZKH, complete sequence) position: , mismatch: 9, identity: 0.719

tctgcggcggccggcgccgggccgcgcttggg	CRISPR spacer
gcggcagcagccggcgccgggccgcgagatag	Protospacer
 * **.**.*****************    .*

648. spacer 3.12|19280|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010408 (Streptomyces vietnamensis strain GIMV4.0001 plasmid pSVL1, complete sequence) position: , mismatch: 9, identity: 0.719

ggacgacgagcagggcgagcgtggacacggtg	CRISPR spacer
aggaggagagcaggccgagggtggacacggcc	Protospacer
.*. *. ******* **** **********. 

649. spacer 3.14|19402|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016618 (Microvirga ossetica strain V5/3m plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719

ccggtcttcgacagtctggggaacacgacgtg	CRISPR spacer
ccggtctgcgacaggctggggaagagctggga	Protospacer
******* ****** ******** *    * .

650. spacer 3.16|19524|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022566 (Mycolicibacterium alvei strain JCM 12272 plasmid pJCM12272, complete sequence) position: , mismatch: 9, identity: 0.719

ggcgggatgtcgaggcgttcgatgccggtggt-	CRISPR spacer
atatggatgtcgaagcgatcgatgcc-gcgctg	Protospacer
.   *********.*** ******** *.* * 

651. spacer 3.17|19585|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NC_014840 (Pantoea sp. At-9b plasmid pPAT9B03, complete sequence) position: , mismatch: 9, identity: 0.719

gactcggagaggatctccaggttgtcttcctt	CRISPR spacer
gcatttccgaggatctccaggttgtactcctg	Protospacer
*  *.   ***************** .**** 

652. spacer 3.19|19708|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013109 (Sinorhizobium americanum strain CFNEI 73 plasmid B, complete sequence) position: , mismatch: 9, identity: 0.719

gcctcccagccggagggcagactcgtcgtgaa	CRISPR spacer
gctcttcagccggagggccgcctcgtcgtcct	Protospacer
**....************ * ********   

653. spacer 3.19|19708|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013053 (Sinorhizobium americanum CCGM7 plasmid B, complete sequence) position: , mismatch: 9, identity: 0.719

gcctcccagccggagggcagactcgtcgtgaa	CRISPR spacer
gctcttcagccggagggccgcctcgtcgtcct	Protospacer
**....************ * ********   

654. spacer 3.20|19769|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017303 (Rhodococcus sp. YL-1 plasmid pYLL1 sequence) position: , mismatch: 9, identity: 0.719

aagtgctcggcgatccgcaggcggcggaggct	CRISPR spacer
aagtgctcgtcgatcctcaggcggcatccaac	Protospacer
********* ****** ********.   . .

655. spacer 3.20|19769|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NC_016588 (Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence) position: , mismatch: 9, identity: 0.719

aagtgctcggcgatccgcaggcggcggaggct	CRISPR spacer
tgccggctggcgatccgctggcggcggaggcg	Protospacer
 . .* ..********** ************ 

656. spacer 3.20|19769|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020900 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence) position: , mismatch: 9, identity: 0.719

aagtgctcggcgatccgcaggcggcggaggct	CRISPR spacer
tgatgatcggcgttccgcaggcggcggcctcg	Protospacer
 ..** ****** **************   * 

657. spacer 3.20|19769|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013526 (Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence) position: , mismatch: 9, identity: 0.719

aagtgctcggcgatccgcaggcggcggaggct	CRISPR spacer
tgatgatcggcgttccgcaggcggcggcctcg	Protospacer
 ..** ****** **************   * 

658. spacer 3.20|19769|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013556 (Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence) position: , mismatch: 9, identity: 0.719

aagtgctcggcgatccgcaggcggcggaggct	CRISPR spacer
tgatgatcggcgttccgcaggcggcggcctcg	Protospacer
 ..** ****** **************   * 

659. spacer 3.20|19769|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013589 (Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence) position: , mismatch: 9, identity: 0.719

aagtgctcggcgatccgcaggcggcggaggct	CRISPR spacer
tgatgatcggcgttccgcaggcggcggcctcg	Protospacer
 ..** ****** **************   * 

660. spacer 3.20|19769|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013562 (Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence) position: , mismatch: 9, identity: 0.719

aagtgctcggcgatccgcaggcggcggaggct	CRISPR spacer
tgatgatcggcgttccgcaggcggcggcctcg	Protospacer
 ..** ****** **************   * 

661. spacer 3.20|19769|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 9, identity: 0.719

aagtgctcggcgatccgcaggcggcggaggct	CRISPR spacer
tgatgatcggcgttccgcaggcggcggcctcg	Protospacer
 ..** ****** **************   * 

662. spacer 3.20|19769|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 9, identity: 0.719

aagtgctcggcgatccgcaggcggcggaggct	CRISPR spacer
tgatgatcggcgttccgcaggcggcggcctcg	Protospacer
 ..** ****** **************   * 

663. spacer 3.20|19769|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013536 (Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence) position: , mismatch: 9, identity: 0.719

aagtgctcggcgatccgcaggcggcggaggct	CRISPR spacer
tgatgatcggcgttccgcaggcggcggcctcg	Protospacer
 ..** ****** **************   * 

664. spacer 3.20|19769|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 9, identity: 0.719

aagtgctcggcgatccgcaggcggcggaggct	CRISPR spacer
tgatgatcggcgttccgcaggcggcggcctcg	Protospacer
 ..** ****** **************   * 

665. spacer 3.20|19769|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 9, identity: 0.719

aagtgctcggcgatccgcaggcggcggaggct	CRISPR spacer
tgatgatcggcgttccgcaggcggcggcctcg	Protospacer
 ..** ****** **************   * 

666. spacer 3.20|19769|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013567 (Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence) position: , mismatch: 9, identity: 0.719

aagtgctcggcgatccgcaggcggcggaggct	CRISPR spacer
tgatgatcggcgttccgcaggcggcggcctcg	Protospacer
 ..** ****** **************   * 

667. spacer 3.20|19769|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 9, identity: 0.719

aagtgctcggcgatccgcaggcggcggaggct	CRISPR spacer
tgatgatcggcgttccgcaggcggcggcctcg	Protospacer
 ..** ****** **************   * 

668. spacer 3.20|19769|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 9, identity: 0.719

aagtgctcggcgatccgcaggcggcggaggct	CRISPR spacer
tgatgatcggcgttccgcaggcggcggcctcg	Protospacer
 ..** ****** **************   * 

669. spacer 3.20|19769|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NC_010997 (Rhizobium etli CIAT 652 plasmid pC, complete sequence) position: , mismatch: 9, identity: 0.719

aagtgctcggcgatccgcaggcggcggaggct	CRISPR spacer
tgatgatcggcgttccgcaggcggcggcctcg	Protospacer
 ..** ****** **************   * 

670. spacer 3.20|19769|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to CP000663 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA02, complete sequence) position: , mismatch: 9, identity: 0.719

aagtgctcggcgatccgcaggcggcggaggct	CRISPR spacer
cgaagccgggcgatccgcaggtggccgaggcg	Protospacer
 .. **. *************.*** ***** 

671. spacer 4.1|28330|30|CP027025|CRT matches to NC_017385 (Ketogulonicigenium vulgare WSH-001 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.7

agcggtggtcgcgttccatatggccaccgt	CRISPR spacer
gaacgtggtcgcgttcaatatggcctatct	Protospacer
..  ************ ********  . *

672. spacer 4.1|28330|30|CP027025|CRT matches to NC_014626 (Ketogulonicigenium vulgare Y25 plasmid pYP12, complete sequence) position: , mismatch: 9, identity: 0.7

agcggtggtcgcgttccatatggccaccgt	CRISPR spacer
gaacgtggtcgcgttcaatatggcctatct	Protospacer
..  ************ ********  . *

673. spacer 4.1|28330|30|CP027025|CRT matches to NZ_CP012910 (Ketogulonicigenium vulgare strain Hbe602 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.7

agcggtggtcgcgttccatatggccaccgt	CRISPR spacer
gaacgtggtcgcgttcaatatggcctatct	Protospacer
..  ************ ********  . *

674. spacer 4.2|28389|31|CP027025|CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 9, identity: 0.71

gagcgggcatcgtcggggccggggagcgtgt	CRISPR spacer
cgcggggcatcgtcggggcgggcgagctttc	Protospacer
 .  *************** ** **** * .

675. spacer 4.2|28389|31|CP027025|CRT matches to NZ_CP036407 (Komagataeibacter saccharivorans strain JH1 plasmid p92689, complete sequence) position: , mismatch: 9, identity: 0.71

gagcgggcatcgtcggggccggggagcgtgt	CRISPR spacer
ggattggcatcgtctgggcgggggagcggcg	Protospacer
*... ********* **** ********   

676. spacer 5.2|28695|32|CP027025|CRISPRCasFinder matches to NC_011879 (Pseudarthrobacter chlorophenolicus A6 plasmid pACHL01, complete sequence) position: , mismatch: 9, identity: 0.719

agggtacccgcagcgtggccctgctcgatgcg	CRISPR spacer
ggatgacccgcagcgcggccctgcccgagaca	Protospacer
.*.  **********.********.*** .*.

677. spacer 5.3|28756|32|CP027025|CRISPRCasFinder matches to NC_015951 (Streptomyces violaceusniger Tu 4113 plasmid pSTRVI01, complete sequence) position: , mismatch: 9, identity: 0.719

cggccgacgtgcaggtggcgcagtcgagccgg	CRISPR spacer
cggccgacgtgcatgcggcgcaggtccgggga	Protospacer
************* *.******* .  *  *.

678. spacer 5.3|28756|32|CP027025|CRISPRCasFinder matches to MH588547 (Caulobacter phage CcrSC, complete genome) position: , mismatch: 9, identity: 0.719

cggccgacgtgcaggtggcgcagtcgagccgg	CRISPR spacer
acgccgccatgcaggtggcgcagtcgcagatg	Protospacer
  **** *.***************** .   *

679. spacer 5.5|28878|32|CP027025|CRISPRCasFinder matches to CP003958 (Rhodococcus opacus PD630 plasmid 9, complete sequence) position: , mismatch: 9, identity: 0.719

gtcaccaccgtcgacgacggggccttcaccgc	CRISPR spacer
cttggtgccgtcgacgaccgggccgtcaccga	Protospacer
 *.. ..*********** ***** ****** 

680. spacer 5.5|28878|32|CP027025|CRISPRCasFinder matches to CP003952 (Rhodococcus opacus PD630 plasmid 3, complete sequence) position: , mismatch: 9, identity: 0.719

gtcaccaccgtcgacgacggggccttcaccgc	CRISPR spacer
cttggtgccgtcgacgaccgggccgtcaccga	Protospacer
 *.. ..*********** ***** ****** 

681. spacer 5.6|28939|32|CP027025|CRISPRCasFinder matches to NZ_CP049837 (Gordonia terrae strain RL-JC02 plasmid pPAE01, complete sequence) position: , mismatch: 9, identity: 0.719

acggggccccggtacgaggtcggccaggtgcg	CRISPR spacer
ggccgaccccggtatgaggtcggcccggtgta	Protospacer
.   *.********.********** ****..

682. spacer 5.9|29122|32|CP027025|CRISPRCasFinder matches to NZ_CP015204 (Rhodococcus sp. 008 plasmid pR8C1, complete sequence) position: , mismatch: 9, identity: 0.719

gacaccgtcaccaccttcatcgcgaacgtgca	CRISPR spacer
cgcaccgtcaccacctgcaccgcgaaccccag	Protospacer
 .************** **.******* .  .

683. spacer 5.9|29122|32|CP027025|CRISPRCasFinder matches to NC_007486 (Rhodococcus erythropolis PR4 plasmid pREC1, complete sequence) position: , mismatch: 9, identity: 0.719

gacaccgtcaccaccttcatcgcgaacgtgca	CRISPR spacer
cgcaccgtcaccacctgcaccgcgaaccccag	Protospacer
 .************** **.******* .  .

684. spacer 5.9|29122|32|CP027025|CRISPRCasFinder matches to NZ_CP042916 (Rhodococcus qingshengii strain RL1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

gacaccgtcaccaccttcatcgcgaacgtgca	CRISPR spacer
cgcaccgtcaccacctgcaccgcgaaccccag	Protospacer
 .************** **.******* .  .

685. spacer 5.9|29122|32|CP027025|CRISPRCasFinder matches to NZ_CP042916 (Rhodococcus qingshengii strain RL1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

gacaccgtcaccaccttcatcgcgaacgtgca	CRISPR spacer
cgcaccgtcaccacctgcaccgcgaaccccag	Protospacer
 .************** **.******* .  .

686. spacer 5.9|29122|32|CP027025|CRISPRCasFinder matches to MT024862 (Microbacterium phage Alakazam, complete genome) position: , mismatch: 9, identity: 0.719

gacaccgtcaccaccttcatcgcgaacgtgca	CRISPR spacer
tacaccgtcaccacgttcagcgcgctgggggc	Protospacer
 ************* **** ****   * *  

687. spacer 5.9|29122|32|CP027025|CRISPRCasFinder matches to MN586028 (Gordonia phage MelBins, complete genome) position: , mismatch: 9, identity: 0.719

gacaccgtcaccaccttcatcgcgaacgtgca	CRISPR spacer
cgcaccatcaccaccctcatcgcgaccacgtt	Protospacer
 .****.********.********* *..*. 

688. spacer 5.12|29334|32|CP027025|CRISPRCasFinder matches to AP014315 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S31-C66, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.719

-----ttcgcgggatcgacgacgaaatggttctcgat	CRISPR spacer
ccacatcc-----atcgacgacaaaattgttctcgaa	Protospacer
     *.*     *********.**** ******** 

689. spacer 5.13|29395|32|CP027025|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719

gccgcagccgcccgcgcggcaggccacggagg	CRISPR spacer
gccgcagccgcccgcccggctggcggtcagga	Protospacer
*************** **** *** .. ..*.

690. spacer 5.13|29395|32|CP027025|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

gccgcagccgcccgcgcggcaggccacggagg	CRISPR spacer
ctaccagccggccgcccggcaggccacgtgga	Protospacer
 .  ****** **** ************ .*.

691. spacer 5.13|29395|32|CP027025|CRISPRCasFinder matches to NZ_CP020883 (Xanthomonas citri pv. citri strain TX160042 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

gccgcagccgcccgcgcggcaggccacggagg	CRISPR spacer
gccgcagccgcgctcgcggcaggacttcatcg	Protospacer
*********** * ********* * . .  *

692. spacer 5.14|29456|32|CP027025|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719

ccgccccgtgtccacctggcccaccaccgcgt	CRISPR spacer
ttcgacggcgtccaccaggcccagcaccgcgt	Protospacer
..   * *.******* ****** ********

693. spacer 5.14|29456|32|CP027025|CRISPRCasFinder matches to NC_023286 (Streptomyces sp. F12 plasmid pFRL6, complete sequence) position: , mismatch: 9, identity: 0.719

ccgccccgtgtccacctggcccaccaccgcgt	CRISPR spacer
gatccccgtgtccacctcgcccagcaggtcgc	Protospacer
   ************** ***** **   **.

694. spacer 5.14|29456|32|CP027025|CRISPRCasFinder matches to NZ_CP023713 (Rhodococcus ruber strain YC-YT1 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

ccgccccgtgtccacctggcccaccaccgcgt	CRISPR spacer
caccggcgtgtccacctgacccacctccggcg	Protospacer
*  *  ************.****** ***   

695. spacer 5.14|29456|32|CP027025|CRISPRCasFinder matches to KY653127 (Corynebacterium phage IME1320_01, complete genome) position: , mismatch: 9, identity: 0.719

ccgccccgtgtccacctggcccaccaccgcgt	CRISPR spacer
gaccgacatgtccacctggcccaccagctcgc	Protospacer
   *  *.****************** * **.

696. spacer 6.1|30573|31|CP027025|PILER-CR matches to NZ_LT984809 (Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence) position: , mismatch: 9, identity: 0.71

acatcaccgtccggatctcccgcgaggcgac	CRISPR spacer
tcatcaccggccggatctcgcgcggtggtcg	Protospacer
 ******** ********* ****. *    

697. spacer 6.3|30572|32|CP027025|CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 9, identity: 0.719

gacatcaccgtccggatctcccgcgaggcgac	CRISPR spacer
cggctgacggtccggatctcccccgaggcgta	Protospacer
 .  * ** ************* *******  

698. spacer 6.3|30572|32|CP027025|CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 9, identity: 0.719

gacatcaccgtccggatctcccgcgaggcgac	CRISPR spacer
cggctgacggtccggatctcccccgaggcgta	Protospacer
 .  * ** ************* *******  

699. spacer 6.4|30633|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719

ttgccttcgaagacgaccgtcgccaggtcgta	CRISPR spacer
ctcatccggaagacgacggtcggcaggtcgta	Protospacer
.*  ... ********* **** *********

700. spacer 6.4|30633|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 9, identity: 0.719

ttgccttcgaagacgaccgtcgccaggtcgta	CRISPR spacer
ctcatccggaagacgacggtcggcaggtcgta	Protospacer
.*  ... ********* **** *********

701. spacer 6.4|30633|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 9, identity: 0.719

ttgccttcgaagacgaccgtcgccaggtcgta	CRISPR spacer
ctcatccggaagacgacggtcggcaggtcgta	Protospacer
.*  ... ********* **** *********

702. spacer 6.4|30633|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719

ttgccttcgaagacgaccgtcgccaggtcgta	CRISPR spacer
ctcatccggaagacgacggtcggcaggtcgta	Protospacer
.*  ... ********* **** *********

703. spacer 6.4|30633|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719

ttgccttcgaagacgaccgtcgccaggtcgta	CRISPR spacer
ctcatccggaagacgacggtcggcaggtcgta	Protospacer
.*  ... ********* **** *********

704. spacer 6.4|30633|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 9, identity: 0.719

ttgccttcgaagacgaccgtcgccaggtcgta	CRISPR spacer
ctcatccggaagacgacggtcggcaggtcgta	Protospacer
.*  ... ********* **** *********

705. spacer 6.4|30633|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP042998 (Aquisphaera giovannonii strain OJF2 plasmid pOJF2_1, complete sequence) position: , mismatch: 9, identity: 0.719

ttgccttcgaagacgaccgtcgccaggtcgta	CRISPR spacer
cacctttcgaagacgcccggcgccaggtgatc	Protospacer
.  *.********** *** ******** .* 

706. spacer 7.1|30879|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719

ccacgccgccgcctggtcgccagggaagtcgc	CRISPR spacer
gcgggccgccgccgggtcgcccgggaacacat	Protospacer
 *. ********* ******* *****  *..

707. spacer 7.1|30879|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP020900 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence) position: , mismatch: 9, identity: 0.719

ccacgccgccgcctggtcgccagggaagtcgc	CRISPR spacer
cagcagagccgcctggtcgccgaggaagtctg	Protospacer
* .*.  **************..*******  

708. spacer 7.1|30879|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP013526 (Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence) position: , mismatch: 9, identity: 0.719

ccacgccgccgcctggtcgccagggaagtcgc	CRISPR spacer
cagcagagccgcctggtcgccgaggaagtctg	Protospacer
* .*.  **************..*******  

709. spacer 7.1|30879|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 9, identity: 0.719

ccacgccgccgcctggtcgccagggaagtcgc	CRISPR spacer
cagcagagccgcctggtcgccgaggaagtctg	Protospacer
* .*.  **************..*******  

710. spacer 7.1|30879|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP013536 (Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence) position: , mismatch: 9, identity: 0.719

ccacgccgccgcctggtcgccagggaagtcgc	CRISPR spacer
cagcagagccgcctggtcgccgaggaagtctg	Protospacer
* .*.  **************..*******  

711. spacer 7.1|30879|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 9, identity: 0.719

ccacgccgccgcctggtcgccagggaagtcgc	CRISPR spacer
cagcagagccgcctggtcgccgaggaagtctg	Protospacer
* .*.  **************..*******  

712. spacer 7.1|30879|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 9, identity: 0.719

ccacgccgccgcctggtcgccagggaagtcgc	CRISPR spacer
cagcagagccgcctggtcgccgaggaagtctg	Protospacer
* .*.  **************..*******  

713. spacer 7.1|30879|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

ccacgccgccgcctggtcgccagggaagtcgc	CRISPR spacer
ttccggcgccgccgggtcgccagggatgctgg	Protospacer
.. ** ******* ************ *..* 

714. spacer 7.2|30940|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP021919 (Sagittula sp. P11 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719

gacagaccgccgagggcgatccggacggagtt	CRISPR spacer
agaagaccgccgagggcgatctggccgggacc	Protospacer
.. ******************.** ***....

715. spacer 7.2|30940|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 9, identity: 0.719

gacagaccgccgagggcgatccggacggagtt	CRISPR spacer
gacggcccgccgagggcgatccgcgcctcgcg	Protospacer
***.* ***************** .*   *. 

716. spacer 7.2|30940|32|CP027025|CRISPRCasFinder,CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gacagaccgccgagggcgatccggacggagtt	CRISPR spacer
gacggcccgccgagggcgatccgcgcctcgcg	Protospacer
***.* ***************** .*   *. 

717. spacer 7.2|30940|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gacagaccgccgagggcgatccggacggagtt	CRISPR spacer
gacggcccgccgagggcgatccgcgcctcgcg	Protospacer
***.* ***************** .*   *. 

718. spacer 7.2|30940|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gacagaccgccgagggcgatccggacggagtt	CRISPR spacer
gacggcccgccgagggcgatccgcgcctcgcg	Protospacer
***.* ***************** .*   *. 

719. spacer 7.2|30940|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gacagaccgccgagggcgatccggacggagtt	CRISPR spacer
gacggcccgccgagggcgatccgcgcctcgcg	Protospacer
***.* ***************** .*   *. 

720. spacer 7.2|30940|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gacagaccgccgagggcgatccggacggagtt	CRISPR spacer
gacggcccgccgagggcgatccgcgcctcgcg	Protospacer
***.* ***************** .*   *. 

721. spacer 7.2|30940|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gacagaccgccgagggcgatccggacggagtt	CRISPR spacer
gacggcccgccgagggcgatccgcgcctcgcg	Protospacer
***.* ***************** .*   *. 

722. spacer 7.2|30940|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gacagaccgccgagggcgatccggacggagtt	CRISPR spacer
gacggcccgccgagggcgatccgcgcctcgcg	Protospacer
***.* ***************** .*   *. 

723. spacer 7.2|30940|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 9, identity: 0.719

gacagaccgccgagggcgatccggacggagtt	CRISPR spacer
gacggcccgccgagggcgatccgcgcctcgcg	Protospacer
***.* ***************** .*   *. 

724. spacer 7.2|30940|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gacagaccgccgagggcgatccggacggagtt	CRISPR spacer
gacggcccgccgagggcgatccgcgcctcgcg	Protospacer
***.* ***************** .*   *. 

725. spacer 7.2|30940|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gacagaccgccgagggcgatccggacggagtt	CRISPR spacer
gacggcccgccgagggcgatccgcgcctcgcg	Protospacer
***.* ***************** .*   *. 

726. spacer 7.2|30940|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gacagaccgccgagggcgatccggacggagtt	CRISPR spacer
gacggcccgccgagggcgatccgcgcctcgcg	Protospacer
***.* ***************** .*   *. 

727. spacer 7.2|30940|32|CP027025|CRISPRCasFinder,CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gacagaccgccgagggcgatccggacggagtt	CRISPR spacer
gacggcccgccgagggcgatccgcgcctcgcg	Protospacer
***.* ***************** .*   *. 

728. spacer 7.2|30940|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

gacagaccgccgagggcgatccggacggagtt	CRISPR spacer
gacggcccgccgagggcgatccgcgcctcgcg	Protospacer
***.* ***************** .*   *. 

729. spacer 7.2|30940|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

gacagaccgccgagggcgatccggacggagtt	CRISPR spacer
gacggcccgccgagggcgatccgcgcctcgcg	Protospacer
***.* ***************** .*   *. 

730. spacer 7.2|30940|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

gacagaccgccgagggcgatccggacggagtt	CRISPR spacer
gacggcccgccgagggcgatccgcgcctcgcg	Protospacer
***.* ***************** .*   *. 

731. spacer 7.2|30940|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

gacagaccgccgagggcgatccggacggagtt	CRISPR spacer
gacggcccgccgagggcgatccgcgcctcgcg	Protospacer
***.* ***************** .*   *. 

732. spacer 7.2|30940|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

gacagaccgccgagggcgatccggacggagtt	CRISPR spacer
gacggcccgccgagggcgatccgcgcctcgcg	Protospacer
***.* ***************** .*   *. 

733. spacer 7.2|30940|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

gacagaccgccgagggcgatccggacggagtt	CRISPR spacer
gacggcccgccgagggcgatccgcgcctcgcg	Protospacer
***.* ***************** .*   *. 

734. spacer 7.2|30940|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

gacagaccgccgagggcgatccggacggagtt	CRISPR spacer
gacggcccgccgagggcgatccgcgcctcgcg	Protospacer
***.* ***************** .*   *. 

735. spacer 7.2|30940|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

gacagaccgccgagggcgatccggacggagtt	CRISPR spacer
gacggcccgccgagggcgatccgcgcctcgcg	Protospacer
***.* ***************** .*   *. 

736. spacer 7.2|30940|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

gacagaccgccgagggcgatccggacggagtt	CRISPR spacer
gacggcccgccgagggcgatccgcgcctcgcg	Protospacer
***.* ***************** .*   *. 

737. spacer 7.2|30940|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

gacagaccgccgagggcgatccggacggagtt	CRISPR spacer
gacggcccgccgagggcgatccgcgcctcgcg	Protospacer
***.* ***************** .*   *. 

738. spacer 7.2|30940|32|CP027025|CRISPRCasFinder,CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719

gacagaccgccgagggcgatccggacggagtt	CRISPR spacer
gacggcccgccgagggcgatccgcgcctcgcg	Protospacer
***.* ***************** .*   *. 

739. spacer 7.2|30940|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

gacagaccgccgagggcgatccggacggagtt	CRISPR spacer
gacggcccgccgagggcgatccgcgcctcgcg	Protospacer
***.* ***************** .*   *. 

740. spacer 7.2|30940|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

gacagaccgccgagggcgatccggacggagtt	CRISPR spacer
gacggcccgccgagggcgatccgcgcctcgcg	Protospacer
***.* ***************** .*   *. 

741. spacer 7.2|30940|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719

gacagaccgccgagggcgatccggacggagtt	CRISPR spacer
gacggcccgccgagggcgatccgcgcctcgcg	Protospacer
***.* ***************** .*   *. 

742. spacer 7.3|31001|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 9, identity: 0.719

gcagccccgatgacggccgcccactcgcctac	CRISPR spacer
acacggccgacgacgggcgcccactcgccccg	Protospacer
.**   ****.***** ************.  

743. spacer 7.5|31123|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719

tcgaccggcccgcgcccgtactcggccggcag	CRISPR spacer
aggaagagcccgcgcccgtgctcggcccgcgc	Protospacer
  **  .************.******* **. 

744. spacer 8.1|31721|32|CP027025|CRISPRCasFinder matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719

gtcttgccctgccagtccttgcggcccttggt	CRISPR spacer
cgctcctgctgccagaccttgcggccattggg	Protospacer
  **. . ******* ********** **** 

745. spacer 8.1|31721|32|CP027025|CRISPRCasFinder matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 9, identity: 0.719

gtcttgccctgccagtccttgcggcccttggt	CRISPR spacer
cgctcctgctgccagaccttgcggccattggg	Protospacer
  **. . ******* ********** **** 

746. spacer 8.1|31721|32|CP027025|CRISPRCasFinder matches to NZ_CP054030 (Rhizobium sp. JKLM19E plasmid pPR19E03) position: , mismatch: 9, identity: 0.719

gtcttgccctgccagtccttgcggcccttggt	CRISPR spacer
gtcttgtcctgccagcccttgcgcacggccgg	Protospacer
******.********.*******  *  . * 

747. spacer 8.2|31782|32|CP027025|CRISPRCasFinder matches to NZ_CP042264 (Litoreibacter sp. LN3S51 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719

agcggttccgcgcccatctcgaagttggacag	CRISPR spacer
cgcggttccgcgcgcttctcgaaggcgtcgtg	Protospacer
 ************ * ******** .*    *

748. spacer 8.2|31782|32|CP027025|CRISPRCasFinder matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 9, identity: 0.719

agcggttccgcgcccatctcgaagttggacag	CRISPR spacer
aacggatcagcgcccatctcgaagtcctgcgc	Protospacer
*.*** ** ****************.  .*. 

749. spacer 8.2|31782|32|CP027025|CRISPRCasFinder matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 9, identity: 0.719

agcggttccgcgcccatctcgaagttggacag	CRISPR spacer
aacggatcagcgcccatctcgaagtcctgcgc	Protospacer
*.*** ** ****************.  .*. 

750. spacer 1.3|9008|32|CP027025|CRT matches to NC_019848 (Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence) position: , mismatch: 10, identity: 0.688

aacgtgtcgaggccgatctgcgcgtacttgtt	CRISPR spacer
ttattgtggagcccgatctgcgcgtaccagga	Protospacer
    *** *** ***************. *  

751. spacer 1.4|9069|32|CP027025|CRT matches to NZ_AP015030 (Pseudomonas putida strain KF715 plasmid pKF715A, complete sequence) position: , mismatch: 10, identity: 0.688

gtgtcgccaagcgagaggcgcgtcgtgatggc	CRISPR spacer
ttcatcccaatcgagaggcgcatcgtgattca	Protospacer
 *  . **** **********.*******   

752. spacer 1.8|9314|32|CP027025|CRT matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 10, identity: 0.688

cgtgccgtccgtgaggccgtgttcgacgagct	CRISPR spacer
ttgctcgtccttgaggccgtgttcggcgacaa	Protospacer
.   .***** **************.***   

753. spacer 1.8|9314|32|CP027025|CRT matches to NZ_CP020952 (Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence) position: , mismatch: 10, identity: 0.688

cgtgccgtccgtgaggccgtgttcgacgagct	CRISPR spacer
ctgctcgtccttgaggccgtgttcggcggcaa	Protospacer
*   .***** **************.**.   

754. spacer 1.9|9375|32|CP027025|CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688

agcgccaccgcgccgcggacggcctcgatcgt	CRISPR spacer
gggaaatccgcgccacgggcggcctcgatcag	Protospacer
.* .   *******.***.***********. 

755. spacer 1.9|9375|32|CP027025|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 10, identity: 0.688

agcgccaccgcgccgcggacggcctcgatcgt	CRISPR spacer
gggaaatccgcgccacgggcggcctcgatcag	Protospacer
.* .   *******.***.***********. 

756. spacer 1.9|9375|32|CP027025|CRT matches to NZ_CP011515 (Mitsuaria sp. 7 plasmid, complete sequence) position: , mismatch: 10, identity: 0.688

agcgccaccgcgccgcggacggcctcgatcgt	CRISPR spacer
tgcgccagcgcgccgaggacggccatgccgac	Protospacer
 ****** ******* ******** .* . ..

757. spacer 1.9|9375|32|CP027025|CRT matches to NZ_CP003988 (Streptomyces sp. 769 plasmid pSGZL, complete sequence) position: , mismatch: 10, identity: 0.688

agcgccaccgcgccgcggacggcctcgatcgt	CRISPR spacer
tcttccagcgcggcgcggacggcctcggtgac	Protospacer
  . *** **** **************.* ..

758. spacer 1.9|9375|32|CP027025|CRT matches to NZ_CP015882 (Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence) position: , mismatch: 10, identity: 0.688

agcgccaccgcgccgcggacggcctcgatcgt	CRISPR spacer
agcgccagcgcgccgctgacggcaaaaccggc	Protospacer
******* ******** ******   . . *.

759. spacer 1.9|9375|32|CP027025|CRT matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 10, identity: 0.688

agcgccaccgcgccgcggacggcctcgatcgt	CRISPR spacer
agcgccagcgcgccgctgacggcaaaaccggc	Protospacer
******* ******** ******   . . *.

760. spacer 1.9|9375|32|CP027025|CRT matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 10, identity: 0.688

agcgccaccgcgccgcggacggcctcgatcgt	CRISPR spacer
ccctgcaccgcgccgcgcacggccccgacgcc	Protospacer
  *  ************ ******.***.  .

761. spacer 1.10|9436|32|CP027025|CRT matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 10, identity: 0.688

ccccagctcgtcgcctacagcgccggagtcct	CRISPR spacer
gaccagctcgtcgcctacggcgtcgtgccggt	Protospacer
  ****************.***.** . .  *

762. spacer 1.10|9436|32|CP027025|CRT matches to NC_020548 (Azoarcus sp. KH32C plasmid pAZKH, complete sequence) position: , mismatch: 10, identity: 0.688

ccccagctcgtcgcctacagcgccggagtcct	CRISPR spacer
gtgatcctcgtcgcccacagcgccggcgtgat	Protospacer
 .    *********.********** **  *

763. spacer 1.10|9436|32|CP027025|CRT matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 10, identity: 0.688

ccccagctcgtcgcctacagcgccggagtcct	CRISPR spacer
gtccagcccgtcgcctgcagcgccgcgcccag	Protospacer
 .*****.********.******** . .*  

764. spacer 1.12|9008|31|CP027025|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 10, identity: 0.677

aacgtgtcgaggccgatctgcgcgtacttgt	CRISPR spacer
aacgggtcgaggccgatcttcgccggacgaa	Protospacer
**** ************** ***  . . . 

765. spacer 1.17|9314|31|CP027025|CRISPRCasFinder matches to NZ_CP013635 (Rhizobium sp. N324 plasmid pRspN324e, complete sequence) position: , mismatch: 10, identity: 0.677

cgtgccgtccgtgaggccgtgttcgacgagc	CRISPR spacer
ttcctcgtccctgaggccgtgttcggcggcg	Protospacer
. . .***** **************.**.  

766. spacer 1.17|9314|31|CP027025|CRISPRCasFinder matches to NZ_CP013526 (Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence) position: , mismatch: 10, identity: 0.677

cgtgccgtccgtgaggccgtgttcgacgagc	CRISPR spacer
ttcctcgtccctgaggccgtgttcggcggcg	Protospacer
. . .***** **************.**.  

767. spacer 1.17|9314|31|CP027025|CRISPRCasFinder matches to NZ_CP013556 (Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence) position: , mismatch: 10, identity: 0.677

cgtgccgtccgtgaggccgtgttcgacgagc	CRISPR spacer
ttcctcgtccctgaggccgtgttcggcggcg	Protospacer
. . .***** **************.**.  

768. spacer 1.17|9314|31|CP027025|CRISPRCasFinder matches to NZ_CP013589 (Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence) position: , mismatch: 10, identity: 0.677

cgtgccgtccgtgaggccgtgttcgacgagc	CRISPR spacer
ttcctcgtccctgaggccgtgttcggcggcg	Protospacer
. . .***** **************.**.  

769. spacer 1.17|9314|31|CP027025|CRISPRCasFinder matches to NZ_CP013562 (Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence) position: , mismatch: 10, identity: 0.677

cgtgccgtccgtgaggccgtgttcgacgagc	CRISPR spacer
ttcctcgtccctgaggccgtgttcggcggcg	Protospacer
. . .***** **************.**.  

770. spacer 1.17|9314|31|CP027025|CRISPRCasFinder matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 10, identity: 0.677

cgtgccgtccgtgaggccgtgttcgacgagc	CRISPR spacer
ttcctcgtccctgaggccgtgttcggcggcg	Protospacer
. . .***** **************.**.  

771. spacer 1.17|9314|31|CP027025|CRISPRCasFinder matches to NZ_CP013536 (Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence) position: , mismatch: 10, identity: 0.677

cgtgccgtccgtgaggccgtgttcgacgagc	CRISPR spacer
ttcctcgtccctgaggccgtgttcggcggcg	Protospacer
. . .***** **************.**.  

772. spacer 1.17|9314|31|CP027025|CRISPRCasFinder matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 10, identity: 0.677

cgtgccgtccgtgaggccgtgttcgacgagc	CRISPR spacer
ttcctcgtccctgaggccgtgttcggcggcg	Protospacer
. . .***** **************.**.  

773. spacer 1.17|9314|31|CP027025|CRISPRCasFinder matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 10, identity: 0.677

cgtgccgtccgtgaggccgtgttcgacgagc	CRISPR spacer
ttcctcgtccctgaggccgtgttcggcggcg	Protospacer
. . .***** **************.**.  

774. spacer 1.17|9314|31|CP027025|CRISPRCasFinder matches to NZ_CP013567 (Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence) position: , mismatch: 10, identity: 0.677

cgtgccgtccgtgaggccgtgttcgacgagc	CRISPR spacer
ttcctcgtccctgaggccgtgttcggcggcg	Protospacer
. . .***** **************.**.  

775. spacer 1.17|9314|31|CP027025|CRISPRCasFinder matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 10, identity: 0.677

cgtgccgtccgtgaggccgtgttcgacgagc	CRISPR spacer
ttcctcgtccctgaggccgtgttcggcggcg	Protospacer
. . .***** **************.**.  

776. spacer 1.17|9314|31|CP027025|CRISPRCasFinder matches to NC_010997 (Rhizobium etli CIAT 652 plasmid pC, complete sequence) position: , mismatch: 10, identity: 0.677

cgtgccgtccgtgaggccgtgttcgacgagc	CRISPR spacer
ttcctcgtccctgaggccgtgttcggcggcg	Protospacer
. . .***** **************.**.  

777. spacer 1.17|9314|31|CP027025|CRISPRCasFinder matches to NZ_CP020900 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence) position: , mismatch: 10, identity: 0.677

cgtgccgtccgtgaggccgtgttcgacgagc	CRISPR spacer
ttcctcgtccctgaggccgtgttcggcggcg	Protospacer
. . .***** **************.**.  

778. spacer 1.18|9375|31|CP027025|CRISPRCasFinder matches to NZ_CP018784 (Curtobacterium pusillum strain AA3 plasmid pCPAA3, complete sequence) position: , mismatch: 10, identity: 0.677

agcgccaccgcgccgcggacggcctcgatcg	CRISPR spacer
gtgatgaccgcgccggggacggactcgatgc	Protospacer
.  .. ********* ****** ******  

779. spacer 1.19|9436|31|CP027025|CRISPRCasFinder matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 10, identity: 0.677

ccccagctcgtcgcctacagcgccggagtcc	CRISPR spacer
gaccagctcgtcgcctacggcgtcgtgccgg	Protospacer
  ****************.***.** . .  

780. spacer 1.19|9436|31|CP027025|CRISPRCasFinder matches to NC_020548 (Azoarcus sp. KH32C plasmid pAZKH, complete sequence) position: , mismatch: 10, identity: 0.677

ccccagctcgtcgcctacagcgccggagtcc	CRISPR spacer
gtgatcctcgtcgcccacagcgccggcgtga	Protospacer
 .    *********.********** **  

781. spacer 2.4|18227|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP024426 (Paracoccus yeei strain TT13 plasmid pTT13-4, complete sequence) position: , mismatch: 10, identity: 0.688

ggatcgcgccgtcacatgcgggtgggcggctt	CRISPR spacer
acccgccgccttcagatgcgggtgggcggccg	Protospacer
.  .  **** *** ***************. 

782. spacer 2.5|18288|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688

taccggacggcgctggaggccggtccgatcca	CRISPR spacer
gaccggacggcggtggaggcctgttttaaggc	Protospacer
 *********** ******** **.. *    

783. spacer 2.5|18288|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 10, identity: 0.688

taccggacggcgctggaggccggtccgatcca	CRISPR spacer
gtccggccggcgccggaggccggtcaggatgc	Protospacer
  **** ******.*********** *. .  

784. spacer 2.6|18349|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP016463 (Bosea sp. RAC05 plasmid pBSY19_1, complete sequence) position: , mismatch: 10, identity: 0.688

agtaccagcgccccggacgcggcgacctgcat	CRISPR spacer
gccgcaggcgccccggacgcagcgacgtgcga	Protospacer
. ..* .*************.***** ***. 

785. spacer 3.3|18743|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 10, identity: 0.688

ccatacgtcagcgtcgcgccaccgccagccgg	CRISPR spacer
cggggtcgaagccgcgcgccaccgccagccgg	Protospacer
* . ..   ***  ******************

786. spacer 3.3|18743|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.688

ccatacgtcagcgtcgcgccaccgccagccgg	CRISPR spacer
cggggtcgaagccgcgcgccaccgccagccgg	Protospacer
* . ..   ***  ******************

787. spacer 3.4|18804|32|CP027025|CRISPRCasFinder,CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 10, identity: 0.688

atagtcctcgaaggacagcaaggtcgtggcga	CRISPR spacer
gcgctgggcgaaggacggcaaggtcgtgccgg	Protospacer
... *   ********.*********** **.

788. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

789. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

790. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

791. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

792. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

793. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

794. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

795. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

796. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

797. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

798. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

799. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

800. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

801. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

802. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

803. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

804. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

805. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

806. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

807. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

808. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

809. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

810. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

811. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

812. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

813. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

814. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

815. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

816. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

817. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

818. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

819. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

820. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

821. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

822. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

823. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

824. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

825. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

826. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

827. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

828. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

829. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

830. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

831. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

832. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

833. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

834. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

835. spacer 3.6|18926|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggaga	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

836. spacer 3.10|19158|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP048287 (Paenibacillus sp. 14171R-81 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

gagggcgtgtagctctcctcgaagggggtgcc	CRISPR spacer
gtcacgatgtagctctccgcaaagggggtgat	Protospacer
*  .  .*********** *.********* .

837. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 10, identity: 0.688

tctgcggcggccggcgccgggccgcgcttggg	CRISPR spacer
gttgcggcgggcggcgcggggccgcctgccgt	Protospacer
 .******** ****** ******* . . * 

838. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.688

tctgcggcggccggcgccgggccgcgcttggg	CRISPR spacer
gacccggcggccggcaccgggccgctctgctc	Protospacer
  . ***********.********* **    

839. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 10, identity: 0.688

tctgcggcggccggcgccgggccgcgcttggg	CRISPR spacer
gacccggcggccggcaccgggccgctctgctc	Protospacer
  . ***********.********* **    

840. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 10, identity: 0.688

tctgcggcggccggcgccgggccgcgcttggg	CRISPR spacer
ggaagcgcggccggcggccggccgcgcttgcc	Protospacer
   .  ********** * ***********  

841. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

tctgcggcggccggcgccgggccgcgcttggg	CRISPR spacer
gaactggcggccagcgccgggctgcgctgcga	Protospacer
    .*******.*********.*****  *.

842. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NC_024366 (Mycobacterium phage OkiRoe, complete genome) position: , mismatch: 10, identity: 0.688

tctgcggcggccggcgccgggccgcgcttggg	CRISPR spacer
gtagcggcggccggcgccgtgcggcgcggaat	Protospacer
 . **************** ** ****  .. 

843. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 10, identity: 0.688

tctgcggcggccggcgccgggccgcgcttggg	CRISPR spacer
aggcgggcggccagcgccgggcggcgctgcgt	Protospacer
     *******.********* *****  * 

844. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP041766 (Tomitella sp. HY188 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

tctgcggcggccggcgccgggccgcgcttggg	CRISPR spacer
gcggcggcggccgccgccgcgccgcggactcc	Protospacer
 * ********** ***** ******  .   

845. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015813 (Microbacterium chocolatum strain SIT 101 plasmid 3, complete sequence) position: , mismatch: 10, identity: 0.688

tctgcggcggccggcgccgggccgcgcttggg	CRISPR spacer
gtcacggcggtcggcgccgagccgcgcgagca	Protospacer
 ...******.********.*******  * .

846. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.688

tctgcggcggccggcgccgggccgcgcttggg	CRISPR spacer
gacccggcgggcggcggcgggccgcgcgccga	Protospacer
  . ****** ***** ********** . *.

847. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to AB276040 (Ralstonia phage RSA1 DNA, complete genome) position: , mismatch: 10, identity: 0.688

tctgcggcggccggcgccgggccgcgcttggg	CRISPR spacer
gcttcggcggccggcgccggaccgtcatcttc	Protospacer
 ** ****************.***.  *.   

848. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to U46938 (Mycobacterium phage DS6A, Spe1/NheI G fragment sequence) position: , mismatch: 10, identity: 0.688

tctgcggcggccggcgccgggccgcgcttggg	CRISPR spacer
atgccggcggccggcgccgtgcggcgccgagc	Protospacer
 .  *************** ** ****. .* 

849. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NC_009382 (Ralstonia phage phiRSA1, complete genome) position: , mismatch: 10, identity: 0.688

tctgcggcggccggcgccgggccgcgcttggg	CRISPR spacer
gcttcggcggccggcgccggaccgtcatcttc	Protospacer
 ** ****************.***.  *.   

850. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to JN698994 (Mycobacterium phage DS6A, complete genome) position: , mismatch: 10, identity: 0.688

tctgcggcggccggcgccgggccgcgcttggg	CRISPR spacer
atgccggcggccggcgccgtgcggcgccgagc	Protospacer
 .  *************** ** ****. .* 

851. spacer 3.16|19524|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

ggcgggatgtcgaggcgttcgatgccggtggt	CRISPR spacer
ttgaagatgtcgaggcgttcgcggccggggcg	Protospacer
   ..****************  ***** *  

852. spacer 3.17|19585|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

gactcggagaggatctccaggttgtcttcctt	CRISPR spacer
ttctcggcggggatctccaggttgtcgaagaa	Protospacer
  ***** *.****************      

853. spacer 3.20|19769|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049700 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2a, complete sequence) position: , mismatch: 10, identity: 0.688

aagtgctcggcgatccgcaggcggcggaggct	CRISPR spacer
gaactgcgagccatccgcaggcggcggaagct	Protospacer
.*..  . .** ****************.***

854. spacer 5.2|28695|32|CP027025|CRISPRCasFinder matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 10, identity: 0.688

agggtacccgcagcgtggccctgctcgatgcg	CRISPR spacer
ctacgtcacggagcgtggccttgctcgatgcc	Protospacer
  .   * ** *********.********** 

855. spacer 5.2|28695|32|CP027025|CRISPRCasFinder matches to NC_004683 (Mycobacterium phage Che9c, complete genome) position: , mismatch: 10, identity: 0.688

agggtacccgcagcgtggccctgctcgatgcg	CRISPR spacer
gcgtctgccgcggcgttgccctgctcgatggt	Protospacer
. * .  ****.**** *************  

856. spacer 5.2|28695|32|CP027025|CRISPRCasFinder matches to AY129333 (Mycobacterium virus Che9c, complete genome) position: , mismatch: 10, identity: 0.688

agggtacccgcagcgtggccctgctcgatgcg	CRISPR spacer
gcgtctgccgcggcgttgccctgctcgatggt	Protospacer
. * .  ****.**** *************  

857. spacer 5.5|28878|32|CP027025|CRISPRCasFinder matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 10, identity: 0.688

gtcaccaccgtcgacgacggggccttcaccgc	CRISPR spacer
gtcacgaccgtcgaagacggggcaaaaatgat	Protospacer
***** ******** ********    *. ..

858. spacer 5.5|28878|32|CP027025|CRISPRCasFinder matches to NC_018022 (Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence) position: , mismatch: 10, identity: 0.688

gtcaccaccgtcgacgacggggccttcaccgc	CRISPR spacer
gtcaccaccgccgaggacggggcgggctggtt	Protospacer
**********.*** ********   *    .

859. spacer 5.6|28939|32|CP027025|CRISPRCasFinder matches to NC_019387 (Thermus oshimai JL-2 plasmid pTHEOS01, complete sequence) position: , mismatch: 10, identity: 0.688

acggggccccggtacgaggtcggccaggtgcg	CRISPR spacer
cccccttcccgggacgaggtgggccaggtggt	Protospacer
 *    .***** ******* *********  

860. spacer 5.9|29122|32|CP027025|CRISPRCasFinder matches to MN204492 (Streptomyces phage GirlPower, complete genome) position: , mismatch: 10, identity: 0.688

gacaccgtcaccaccttcatcgcgaacgtgca	CRISPR spacer
ctcaccgtcaacaccttcatcacgacgggatc	Protospacer
  ******** **********.***  * .. 

861. spacer 5.9|29122|32|CP027025|CRISPRCasFinder matches to MK433268 (Streptomyces phage Popy, complete genome) position: , mismatch: 10, identity: 0.688

gacaccgtcaccaccttcatcgcgaacgtgca	CRISPR spacer
ctcaccgtcaacaccttcatcacgacgggatc	Protospacer
  ******** **********.***  * .. 

862. spacer 5.9|29122|32|CP027025|CRISPRCasFinder matches to MF467948 (Streptomyces phage DrGrey, complete genome) position: , mismatch: 10, identity: 0.688

gacaccgtcaccaccttcatcgcgaacgtgca	CRISPR spacer
ctcaccgtcaacaccttcatcacgacgggatc	Protospacer
  ******** **********.***  * .. 

863. spacer 5.9|29122|32|CP027025|CRISPRCasFinder matches to MN586054 (Streptomyces phage FrodoSwaggins, complete genome) position: , mismatch: 10, identity: 0.688

gacaccgtcaccaccttcatcgcgaacgtgca	CRISPR spacer
ctcaccgtcaacaccttcatcacgacgggatc	Protospacer
  ******** **********.***  * .. 

864. spacer 5.9|29122|32|CP027025|CRISPRCasFinder matches to MN204504 (Streptomyces phage Soshi, complete genome) position: , mismatch: 10, identity: 0.688

gacaccgtcaccaccttcatcgcgaacgtgca	CRISPR spacer
ctcaccgtcaacaccttcatcacgacgggatc	Protospacer
  ******** **********.***  * .. 

865. spacer 5.13|29395|32|CP027025|CRISPRCasFinder matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggagg	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

866. spacer 5.13|29395|32|CP027025|CRISPRCasFinder matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggagg	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

867. spacer 5.13|29395|32|CP027025|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggagg	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

868. spacer 5.13|29395|32|CP027025|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggagg	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

869. spacer 5.13|29395|32|CP027025|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggagg	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

870. spacer 5.13|29395|32|CP027025|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggagg	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

871. spacer 5.13|29395|32|CP027025|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggagg	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

872. spacer 5.13|29395|32|CP027025|CRISPRCasFinder matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggagg	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

873. spacer 5.13|29395|32|CP027025|CRISPRCasFinder matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggagg	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

874. spacer 5.13|29395|32|CP027025|CRISPRCasFinder matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggagg	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

875. spacer 5.13|29395|32|CP027025|CRISPRCasFinder matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggagg	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

876. spacer 5.13|29395|32|CP027025|CRISPRCasFinder matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggagg	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

877. spacer 5.13|29395|32|CP027025|CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggagg	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

878. spacer 5.13|29395|32|CP027025|CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggagg	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

879. spacer 5.13|29395|32|CP027025|CRISPRCasFinder matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggagg	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

880. spacer 5.13|29395|32|CP027025|CRISPRCasFinder matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 10, identity: 0.688

gccgcagccgcccgcgcggcaggccacggagg	CRISPR spacer
cgcgcagcagcccgcgcggccggcccttggcc	Protospacer
  ****** *********** **** . *.  

881. spacer 5.14|29456|32|CP027025|CRISPRCasFinder matches to MN693478 (Marine virus AFVG_25M14, complete genome) position: , mismatch: 10, identity: 0.688

ccgccccgtgtccacctggcccaccaccgcgt	CRISPR spacer
ctctgccgtgtccacctcgtccaccaccagca	Protospacer
*. . ************ *.********.   

882. spacer 6.3|30572|32|CP027025|CRISPRCasFinder,CRT matches to NZ_LT984809 (Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence) position: , mismatch: 10, identity: 0.688

gacatcaccgtccggatctcccgcgaggcgac	CRISPR spacer
ctcatcaccggccggatctcgcgcggtggtcg	Protospacer
  ******** ********* ****. *    

883. spacer 6.5|30694|32|CP027025|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.688

gccttgaacacgctgacgaagatgctgccgac	CRISPR spacer
acgaacggcacggtgacgaagatgctggcgag	Protospacer
.*    ..**** ************** *** 

884. spacer 6.5|30694|32|CP027025|CRISPRCasFinder,CRT matches to MH651167 (Gordonia phage Angelique, complete genome) position: , mismatch: 10, identity: 0.688

gccttgaacacgctgacgaagatgctgccgac	CRISPR spacer
gggctgaccacgctgacgaagctgctgatctg	Protospacer
*  .*** ************* ***** .   

885. spacer 7.2|30940|32|CP027025|CRISPRCasFinder,CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.688

gacagaccgccgagggcgatccggacggagtt	CRISPR spacer
tgctgaccgccaagggcgatccggccgatcgc	Protospacer
 .* *******.************ **.   .

886. spacer 7.2|30940|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 10, identity: 0.688

gacagaccgccgagggcgatccggacggagtt	CRISPR spacer
tgctgaccgccaagggcgatccggccgatcgc	Protospacer
 .* *******.************ **.   .

887. spacer 7.2|30940|32|CP027025|CRISPRCasFinder,CRT matches to KY365739 (Streptomyces phage BabyGotBac, complete genome) position: , mismatch: 10, identity: 0.688

gacagaccgccgagggcgatccggacggagtt	CRISPR spacer
tgctgaccgccgagggcggtccggccgagtac	Protospacer
 .* **************.***** **..  .

888. spacer 7.2|30940|32|CP027025|CRISPRCasFinder,CRT matches to MH178382 (Streptomyces phage Salete, complete genome) position: , mismatch: 10, identity: 0.688

gacagaccgccgagggcgatccggacggagtt	CRISPR spacer
tgctgaccgccgagggcggtccggccgagtac	Protospacer
 .* **************.***** **..  .

889. spacer 7.2|30940|32|CP027025|CRISPRCasFinder,CRT matches to KU189325 (Streptomyces phage Maih, complete genome) position: , mismatch: 10, identity: 0.688

gacagaccgccgagggcgatccggacggagtt	CRISPR spacer
tgctgaccgccgagggcggtccggccgagtac	Protospacer
 .* **************.***** **..  .

890. spacer 7.2|30940|32|CP027025|CRISPRCasFinder,CRT matches to MH178381 (Streptomyces phage BayC, complete genome) position: , mismatch: 10, identity: 0.688

gacagaccgccgagggcgatccggacggagtt	CRISPR spacer
tgctgaccgccgagggcggtccggccgagtac	Protospacer
 .* **************.***** **..  .

891. spacer 7.2|30940|32|CP027025|CRISPRCasFinder,CRT matches to KP876466 (Streptomyces phage TP1604, complete genome) position: , mismatch: 10, identity: 0.688

gacagaccgccgagggcgatccggacggagtt	CRISPR spacer
tgctgaccgccgagggcggtccggccgagtac	Protospacer
 .* **************.***** **..  .

892. spacer 7.3|31001|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 10, identity: 0.688

gcagccccgatgacggccgcccactcgcctac	CRISPR spacer
acgcggccgacgacgggcgcccactcgccgcg	Protospacer
.*.   ****.***** ************   

893. spacer 8.1|31721|32|CP027025|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 10, identity: 0.688

gtcttgccctgccagtccttgcggcccttggt	CRISPR spacer
gtcttcccctgccagtccttacgcatgaccat	Protospacer
***** **************.**  .  . .*

894. spacer 8.2|31782|32|CP027025|CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 10, identity: 0.688

agcggttccgcgcccatctcgaagttggacag	CRISPR spacer
agcggttccgcgcccatcacgcagcctcctgc	Protospacer
****************** ** **..   .. 

895. spacer 1.1|8886|32|CP027025|CRT matches to NZ_CP020040 (Streptomyces sp. 3211 isolate 3 plasmid p3211-1, complete sequence) position: , mismatch: 11, identity: 0.656

aagcccaggtccgggccctggacgaaccagga	CRISPR spacer
cccaccagttcctggccctggacgaacggatc	Protospacer
    **** *** ************** ..  

896. spacer 1.1|8886|32|CP027025|CRT matches to NC_006552 (Pseudomonas phage F116, complete genome) position: , mismatch: 11, identity: 0.656

aagcccaggtccgggccctggacgaaccagga	CRISPR spacer
cggcccaggtcctgggcctggacgatgggaag	Protospacer
 .********** ** *********   ....

897. spacer 1.1|8886|32|CP027025|CRT matches to MK511040 (Pseudomonas phage CF63, partial genome) position: , mismatch: 11, identity: 0.656

aagcccaggtccgggccctggacgaaccagga	CRISPR spacer
cggcccaggtcctgggcctggacgatgggaag	Protospacer
 .********** ** *********   ....

898. spacer 1.1|8886|32|CP027025|CRT matches to MF490237 (Pseudomonas phage vB_PaeP_E220, complete genome) position: , mismatch: 11, identity: 0.656

aagcccaggtccgggccctggacgaaccagga	CRISPR spacer
cggcccaggtcctgggcctggacgatgggaag	Protospacer
 .********** ** *********   ....

899. spacer 1.1|8886|32|CP027025|CRT matches to KM389216 (UNVERIFIED: Pseudomonas phage F_ET605sp/Pa1651 clone contig00001 genomic sequence) position: , mismatch: 11, identity: 0.656

aagcccaggtccgggccctggacgaaccagga	CRISPR spacer
cggcccaggtcctgggcctggacgatgggaag	Protospacer
 .********** ** *********   ....

900. spacer 1.1|8886|32|CP027025|CRT matches to AY625898 (Pseudomonas aeruginosa phage F116, complete genome) position: , mismatch: 11, identity: 0.656

aagcccaggtccgggccctggacgaaccagga	CRISPR spacer
cggcccaggtcctgggcctggacgatgggaag	Protospacer
 .********** ** *********   ....

901. spacer 1.1|8886|32|CP027025|CRT matches to KM389247 (UNVERIFIED: Pseudomonas phage JBD90 clone contig00001 genomic sequence) position: , mismatch: 11, identity: 0.656

aagcccaggtccgggccctggacgaaccagga	CRISPR spacer
cggcccaggtcctgggcctggacgatgggaag	Protospacer
 .********** ** *********   ....

902. spacer 1.1|8886|32|CP027025|CRT matches to LT603684 (Pseudomonas phage phiC725A genome assembly) position: , mismatch: 11, identity: 0.656

aagcccaggtccgggccctggacgaaccagga	CRISPR spacer
cggcccaggtcctgggcctggacgatgggaag	Protospacer
 .********** ** *********   ....

903. spacer 1.3|9008|32|CP027025|CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 11, identity: 0.656

aacgtgtcgaggccgatctgcgcgtacttgtt	CRISPR spacer
aacgggtcgaggccgatcttcgccggacgaag	Protospacer
**** ************** ***  . . .  

904. spacer 1.8|9314|32|CP027025|CRT matches to NZ_CP013635 (Rhizobium sp. N324 plasmid pRspN324e, complete sequence) position: , mismatch: 11, identity: 0.656

cgtgccgtccgtgaggccgtgttcgacgagct	CRISPR spacer
ttcctcgtccctgaggccgtgttcggcggcga	Protospacer
. . .***** **************.**.   

905. spacer 1.8|9314|32|CP027025|CRT matches to NZ_CP020900 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence) position: , mismatch: 11, identity: 0.656

cgtgccgtccgtgaggccgtgttcgacgagct	CRISPR spacer
ttcctcgtccctgaggccgtgttcggcggcga	Protospacer
. . .***** **************.**.   

906. spacer 1.8|9314|32|CP027025|CRT matches to NZ_CP013526 (Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence) position: , mismatch: 11, identity: 0.656

cgtgccgtccgtgaggccgtgttcgacgagct	CRISPR spacer
ttcctcgtccctgaggccgtgttcggcggcga	Protospacer
. . .***** **************.**.   

907. spacer 1.8|9314|32|CP027025|CRT matches to NZ_CP013556 (Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence) position: , mismatch: 11, identity: 0.656

cgtgccgtccgtgaggccgtgttcgacgagct	CRISPR spacer
ttcctcgtccctgaggccgtgttcggcggcga	Protospacer
. . .***** **************.**.   

908. spacer 1.8|9314|32|CP027025|CRT matches to NZ_CP013589 (Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence) position: , mismatch: 11, identity: 0.656

cgtgccgtccgtgaggccgtgttcgacgagct	CRISPR spacer
ttcctcgtccctgaggccgtgttcggcggcga	Protospacer
. . .***** **************.**.   

909. spacer 1.8|9314|32|CP027025|CRT matches to NZ_CP013562 (Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence) position: , mismatch: 11, identity: 0.656

cgtgccgtccgtgaggccgtgttcgacgagct	CRISPR spacer
ttcctcgtccctgaggccgtgttcggcggcga	Protospacer
. . .***** **************.**.   

910. spacer 1.8|9314|32|CP027025|CRT matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 11, identity: 0.656

cgtgccgtccgtgaggccgtgttcgacgagct	CRISPR spacer
ttcctcgtccctgaggccgtgttcggcggcga	Protospacer
. . .***** **************.**.   

911. spacer 1.8|9314|32|CP027025|CRT matches to NZ_CP013536 (Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence) position: , mismatch: 11, identity: 0.656

cgtgccgtccgtgaggccgtgttcgacgagct	CRISPR spacer
ttcctcgtccctgaggccgtgttcggcggcga	Protospacer
. . .***** **************.**.   

912. spacer 1.8|9314|32|CP027025|CRT matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 11, identity: 0.656

cgtgccgtccgtgaggccgtgttcgacgagct	CRISPR spacer
ttcctcgtccctgaggccgtgttcggcggcga	Protospacer
. . .***** **************.**.   

913. spacer 1.8|9314|32|CP027025|CRT matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 11, identity: 0.656

cgtgccgtccgtgaggccgtgttcgacgagct	CRISPR spacer
ttcctcgtccctgaggccgtgttcggcggcga	Protospacer
. . .***** **************.**.   

914. spacer 1.8|9314|32|CP027025|CRT matches to NZ_CP013567 (Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence) position: , mismatch: 11, identity: 0.656

cgtgccgtccgtgaggccgtgttcgacgagct	CRISPR spacer
ttcctcgtccctgaggccgtgttcggcggcga	Protospacer
. . .***** **************.**.   

915. spacer 1.8|9314|32|CP027025|CRT matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 11, identity: 0.656

cgtgccgtccgtgaggccgtgttcgacgagct	CRISPR spacer
ttcctcgtccctgaggccgtgttcggcggcga	Protospacer
. . .***** **************.**.   

916. spacer 1.8|9314|32|CP027025|CRT matches to NC_010997 (Rhizobium etli CIAT 652 plasmid pC, complete sequence) position: , mismatch: 11, identity: 0.656

cgtgccgtccgtgaggccgtgttcgacgagct	CRISPR spacer
ttcctcgtccctgaggccgtgttcggcggcga	Protospacer
. . .***** **************.**.   

917. spacer 1.9|9375|32|CP027025|CRT matches to NZ_CP018784 (Curtobacterium pusillum strain AA3 plasmid pCPAA3, complete sequence) position: , mismatch: 11, identity: 0.656

agcgccaccgcgccgcggacggcctcgatcgt	CRISPR spacer
gtgatgaccgcgccggggacggactcgatgcc	Protospacer
.  .. ********* ****** ******  .

918. spacer 2.3|18166|32|CP027025|CRISPRCasFinder,CRT matches to KT997836 (Uncultured Mediterranean phage uvDeep-CGR0-AD1-C123, complete genome) position: , mismatch: 11, identity: 0.656

ctctggttgagtacgacgacgagcagggtctc	CRISPR spacer
acgcatccgagcgcgacgacgagcagggtctt	Protospacer
 . .. ..***..******************.

919. spacer 2.6|18349|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 11, identity: 0.656

agtaccagcgccccggacgcggcgacctgcat	CRISPR spacer
tcgaccagcgacccggacccggcgacgaaacc	Protospacer
   ******* ******* *******  .  .

920. spacer 2.6|18349|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 11, identity: 0.656

agtaccagcgccccggacgcggcgacctgcat	CRISPR spacer
tccaccagcgacccggacccggcgacgaagcc	Protospacer
  .******* ******* *******  .  .

921. spacer 2.6|18349|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 11, identity: 0.656

agtaccagcgccccggacgcggcgacctgcat	CRISPR spacer
tcgaccagcgacccggacccggcgacgaaacc	Protospacer
   ******* ******* *******  .  .

922. spacer 2.6|18349|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 11, identity: 0.656

agtaccagcgccccggacgcggcgacctgcat	CRISPR spacer
tcgaccagcgacccggacccggcgacgaaacc	Protospacer
   ******* ******* *******  .  .

923. spacer 2.6|18349|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 11, identity: 0.656

agtaccagcgccccggacgcggcgacctgcat	CRISPR spacer
tcgaccagcgacccggacccggcgacgaagcc	Protospacer
   ******* ******* *******  .  .

924. spacer 2.6|18349|32|CP027025|CRISPRCasFinder,CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 11, identity: 0.656

agtaccagcgccccggacgcggcgacctgcat	CRISPR spacer
tcgaccagcgacccggacccggcgacgaaacc	Protospacer
   ******* ******* *******  .  .

925. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NC_007960 (Nitrobacter hamburgensis X14 plasmid 2, complete sequence) position: , mismatch: 11, identity: 0.656

tctgcggcggccggcgccgggccgcgcttggg	CRISPR spacer
gactcggcggacggcgtcgggccgcgcgaaac	Protospacer
  . ****** *****.**********  .. 

926. spacer 3.16|19524|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 11, identity: 0.656

ggcgggatgtcgaggcgttcgatgccggtggt	CRISPR spacer
acgctgatgtcgcggctttcgatgccggaaag	Protospacer
.    ******* *** *********** .. 

927. spacer 3.16|19524|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to AP014720 (Arthrobacter sp. Hiyo8 plasmid pHiyo8-1 DNA, complete genome, strain: Hiyo8) position: , mismatch: 11, identity: 0.656

ggcgggatgtcgaggcgttcgatgccggtggt	CRISPR spacer
ctgaggatgccgacgcgttcgatgccgagccc	Protospacer
   .*****.*** *************.   .

928. spacer 5.3|28756|32|CP027025|CRISPRCasFinder matches to AP017627 (Pleomorphomonas sp. SM30 plasmid pSM30-1 DNA, complete genome) position: , mismatch: 11, identity: 0.656

cggccgacgtgcaggtggcgcagtcgagccgg	CRISPR spacer
cggccggcgagcaggtggcgcagctcgttgac	Protospacer
******.** *************.. . . . 

929. spacer 5.12|29334|32|CP027025|CRISPRCasFinder matches to NC_009427 (Novosphingobium aromaticivorans DSM 12444 plasmid pNL2, complete sequence) position: , mismatch: 11, identity: 0.656

ttcgcgggatcgacgacgaaatggttctcgat	CRISPR spacer
agcgcgggatcgacgtcgaagtggtagagcgc	Protospacer
  ************* ****.****     ..

930. spacer 8.1|31721|32|CP027025|CRISPRCasFinder matches to NC_008010 (Deinococcus geothermalis DSM 11300 plasmid pDGEO01, complete sequence) position: , mismatch: 11, identity: 0.656

gtcttgccctgccagtccttgcggcccttggt	CRISPR spacer
cggatgccctcccagtccgtgcggcccggctc	Protospacer
    ****** ******* ********    .

931. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR594660 (Variovorax sp. PBL-H6 plasmid 2) position: , mismatch: 12, identity: 0.625

--tctgcggcggccggcgccgggccgcgcttggg	CRISPR spacer
ccggtgcgcgggccggcgccggccggcgtgaa--	Protospacer
    ****  ************ * ***.  .  

932. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR594667 (Variovorax sp. SRS16 plasmid 2) position: , mismatch: 12, identity: 0.625

--tctgcggcggccggcgccgggccgcgcttggg	CRISPR spacer
ccggtgcgcgggccggcgccggccggcgtgaa--	Protospacer
    ****  ************ * ***.  .  

933. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 12, identity: 0.625

--tctgcggcggccggcgccgggccgcgcttggg	CRISPR spacer
cgactgcgcggcgcggcgccgggcgccgtgcg--	Protospacer
   *****  *  ***********  **. .*  

934. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR594690 (Variovorax sp. WDL1 plasmid 2) position: , mismatch: 12, identity: 0.625

--tctgcggcggccggcgccgggccgcgcttggg	CRISPR spacer
ccggtgcgcgggccggcgccggccggcgtgaa--	Protospacer
    ****  ************ * ***.  .  

935. spacer 3.11|19219|32|CP027025|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR594672 (Variovorax sp. PBL-E5 plasmid 2) position: , mismatch: 12, identity: 0.625

--tctgcggcggccggcgccgggccgcgcttggg	CRISPR spacer
ccggtgcgcgggccggcgccggccggcgtgaa--	Protospacer
    ****  ************ * ***.  .  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. CP027023
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027023_1 79343-79493 TypeI-E NA
2 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027023_2 90081-90467 TypeI-E NA
6 spacers
cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NZ_CP027023 Streptomyces sp. WAC00288 plasmid p1, complete sequence 79372-79403 0 1.0
CP027023_1 1.2|79433|32|CP027023|CRISPRCasFinder 79433-79464 32 NZ_CP027023 Streptomyces sp. WAC00288 plasmid p1, complete sequence 79433-79464 0 1.0
CP027023_2 2.1|90104|38|CP027023|CRISPRCasFinder 90104-90141 38 NZ_CP027023 Streptomyces sp. WAC00288 plasmid p1, complete sequence 90104-90141 0 1.0
CP027023_2 2.2|90165|38|CP027023|CRISPRCasFinder 90165-90202 38 NZ_CP027023 Streptomyces sp. WAC00288 plasmid p1, complete sequence 90165-90202 0 1.0
CP027023_2 2.3|90226|38|CP027023|CRISPRCasFinder 90226-90263 38 NZ_CP027023 Streptomyces sp. WAC00288 plasmid p1, complete sequence 90226-90263 0 1.0
CP027023_2 2.4|90287|36|CP027023|CRISPRCasFinder 90287-90322 36 NZ_CP027023 Streptomyces sp. WAC00288 plasmid p1, complete sequence 90287-90322 0 1.0
CP027023_2 2.5|90346|38|CP027023|CRISPRCasFinder 90346-90383 38 NZ_CP027023 Streptomyces sp. WAC00288 plasmid p1, complete sequence 90346-90383 0 1.0
CP027023_2 2.6|90407|38|CP027023|CRISPRCasFinder 90407-90444 38 NZ_CP027023 Streptomyces sp. WAC00288 plasmid p1, complete sequence 90407-90444 0 1.0
CP027023_2 2.7|90103|41|CP027023|PILER-CR 90103-90143 41 NZ_CP027023 Streptomyces sp. WAC00288 plasmid p1, complete sequence 90103-90143 0 1.0
CP027023_2 2.8|90164|41|CP027023|PILER-CR 90164-90204 41 NZ_CP027023 Streptomyces sp. WAC00288 plasmid p1, complete sequence 90164-90204 0 1.0
CP027023_2 2.9|90225|41|CP027023|PILER-CR 90225-90265 41 NZ_CP027023 Streptomyces sp. WAC00288 plasmid p1, complete sequence 90225-90265 0 1.0
CP027023_2 2.10|90286|39|CP027023|PILER-CR 90286-90324 39 NZ_CP027023 Streptomyces sp. WAC00288 plasmid p1, complete sequence 90286-90324 0 1.0
CP027023_2 2.11|90345|41|CP027023|PILER-CR 90345-90385 41 NZ_CP027023 Streptomyces sp. WAC00288 plasmid p1, complete sequence 90345-90385 0 1.0
CP027023_2 2.12|90105|39|CP027023|CRT 90105-90143 39 NZ_CP027023 Streptomyces sp. WAC00288 plasmid p1, complete sequence 90105-90143 0 1.0
CP027023_2 2.13|90166|39|CP027023|CRT 90166-90204 39 NZ_CP027023 Streptomyces sp. WAC00288 plasmid p1, complete sequence 90166-90204 0 1.0
CP027023_2 2.14|90227|39|CP027023|CRT 90227-90265 39 NZ_CP027023 Streptomyces sp. WAC00288 plasmid p1, complete sequence 90227-90265 0 1.0
CP027023_2 2.15|90288|37|CP027023|CRT 90288-90324 37 NZ_CP027023 Streptomyces sp. WAC00288 plasmid p1, complete sequence 90288-90324 0 1.0
CP027023_2 2.16|90347|39|CP027023|CRT 90347-90385 39 NZ_CP027023 Streptomyces sp. WAC00288 plasmid p1, complete sequence 90347-90385 0 1.0
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 445067-445098 5 0.844
CP027023_1 1.2|79433|32|CP027023|CRISPRCasFinder 79433-79464 32 CP042595 Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence 256054-256085 5 0.844
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 JQ067093 Pseudomonas phage PaMx74, partial genome 6939-6970 6 0.812
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NZ_CP012701 Sphingopyxis macrogoltabida strain EY-1 isolate activated sludge plasmid 1, complete sequence 53418-53449 6 0.812
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NZ_CP024313 Rhizobium sp. NXC24 plasmid pRspNXC24b, complete sequence 258297-258328 7 0.781
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NC_015169 Deinococcus proteolyticus MRP plasmid pDEIPR01, complete sequence 88297-88328 7 0.781
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 CP006583 Mesorhizobium huakuii 7653R plasmid pMHb, complete sequence 284797-284828 7 0.781
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 KP790011 Gordonia phage Gsput1, complete genome 40217-40248 7 0.781
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NZ_CP010408 Streptomyces vietnamensis strain GIMV4.0001 plasmid pSVL1, complete sequence 158578-158609 8 0.75
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 1326332-1326363 8 0.75
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NZ_CP045120 Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence 59465-59496 8 0.75
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 806040-806071 8 0.75
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 1687158-1687189 8 0.75
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 10178-10209 8 0.75
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1854284-1854315 8 0.75
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 420087-420118 8 0.75
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 508616-508647 8 0.75
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 610897-610928 8 0.75
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NZ_CP029833 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence 15177-15208 8 0.75
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NZ_CP016354 Prauserella marina strain DSM 45268 plasmid pPmarDSM45268, complete sequence 118388-118419 8 0.75
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NZ_CP017244 Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence 321976-322007 8 0.75
CP027023_1 1.2|79433|32|CP027023|CRISPRCasFinder 79433-79464 32 MH271298 Microbacterium phage Floof, complete genome 34862-34893 8 0.75
CP027023_1 1.2|79433|32|CP027023|CRISPRCasFinder 79433-79464 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1732842-1732873 8 0.75
CP027023_1 1.2|79433|32|CP027023|CRISPRCasFinder 79433-79464 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 80419-80450 8 0.75
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 38266-38297 9 0.719
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 91326-91357 9 0.719
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 840841-840872 9 0.719
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 JX006077 Saccharomonospora phage PIS 136, complete genome 20738-20769 9 0.719
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 920977-921008 9 0.719
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NZ_CP027239 Dietzia sp. oral taxon 368 strain W5195 plasmid unnamed1, complete sequence 44332-44363 9 0.719
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NZ_CP022424 Vitreoscilla filiformis strain ATCC 15551 plasmid pVF1, complete sequence 229019-229050 9 0.719
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 CP000662 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 809683-809714 9 0.719
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 AP017627 Pleomorphomonas sp. SM30 plasmid pSM30-1 DNA, complete genome 70675-70706 9 0.719
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NC_004808 Streptomyces rochei plasmid pSLA2-L DNA, complete sequence 92436-92467 9 0.719
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NC_008697 Nocardioides sp. JS614 plasmid pNOCA01, complete sequence 23947-23978 9 0.719
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NZ_CP014310 Burkholderia sp. PAMC 26561 plasmid unnamed3, complete sequence 24932-24963 9 0.719
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NZ_CP014310 Burkholderia sp. PAMC 26561 plasmid unnamed3, complete sequence 27871-27902 9 0.719
CP027023_1 1.2|79433|32|CP027023|CRISPRCasFinder 79433-79464 32 NC_014838 Pantoea sp. At-9b plasmid pPAT9B01, complete sequence 608036-608067 9 0.719
CP027023_1 1.2|79433|32|CP027023|CRISPRCasFinder 79433-79464 32 CP040467 Streptomyces albidoflavus strain UYFA156 plasmid unnamed, complete sequence 67529-67560 9 0.719
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NZ_CP050083 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence 269170-269201 10 0.688
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NZ_CP021033 Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence 345491-345522 10 0.688
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NZ_CP049733 Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence 260139-260170 10 0.688
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NZ_CP020900 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence 273946-273977 10 0.688
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NC_007763 Rhizobium etli CFN 42 plasmid p42b, complete sequence 179811-179842 10 0.688
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NZ_CP021025 Rhizobium sp. TAL182 plasmid pRetTAL182a, complete sequence 161828-161859 10 0.688
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NZ_CP013526 Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence 161637-161668 10 0.688
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NZ_CP013556 Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence 161635-161666 10 0.688
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NZ_CP020907 Rhizobium etli strain NXC12 plasmid pRetNXC12a, complete sequence 177883-177914 10 0.688
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NZ_CP013589 Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence 159020-159051 10 0.688
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NZ_CP013600 Rhizobium sp. N741 plasmid pRspN741e, complete sequence 267603-267634 10 0.688
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NZ_CP013562 Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence 161636-161667 10 0.688
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NZ_CP013579 Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence 162315-162346 10 0.688
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NZ_CP013531 Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence 160138-160169 10 0.688
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NZ_CP013536 Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence 741453-741484 10 0.688
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NZ_CP013541 Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence 165600-165631 10 0.688
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NZ_CP013546 Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence 172517-172548 10 0.688
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NZ_CP013567 Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence 161635-161666 10 0.688
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NC_021906 Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1a, complete sequence 176786-176817 10 0.688
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NZ_CP013504 Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence 267603-267634 10 0.688
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NZ_CP013584 Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence 160138-160169 10 0.688
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NZ_CP013510 Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence 266044-266075 10 0.688
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NZ_CP013521 Rhizobium sp. N113 plasmid pRspN113d, complete sequence 270291-270322 10 0.688
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NZ_CP013573 Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence 162315-162346 10 0.688
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NZ_CP013494 Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence 264409-264440 10 0.688
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NZ_CP013512 Rhizobium sp. N1314 plasmid pRspN1314a, complete sequence 157775-157806 10 0.688
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NZ_CP013594 Rhizobium sp. N871 plasmid pRspN871d, complete sequence 267603-267634 10 0.688
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NZ_CP005086 Sphingobium sp. TKS plasmid pTK2, complete sequence 142525-142556 10 0.688
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NC_010997 Rhizobium etli CIAT 652 plasmid pC, complete sequence 152858-152889 10 0.688
CP027023_1 1.1|79372|32|CP027023|CRISPRCasFinder 79372-79403 32 NZ_CP053207 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence 290950-290981 10 0.688
CP027023_1 1.2|79433|32|CP027023|CRISPRCasFinder 79433-79464 32 NC_021908 Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence 50088-50119 10 0.688
CP027023_1 1.2|79433|32|CP027023|CRISPRCasFinder 79433-79464 32 NC_014213 Meiothermus silvanus DSM 9946 plasmid pMESIL01, complete sequence 181535-181566 11 0.656

1. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NZ_CP027023 (Streptomyces sp. WAC00288 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
gcgagctgctcggcgagccgctccgcctccga	Protospacer
********************************

2. spacer 1.2|79433|32|CP027023|CRISPRCasFinder matches to NZ_CP027023 (Streptomyces sp. WAC00288 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

atcaggccctcctcgcggagcgcccggtgcac	CRISPR spacer
atcaggccctcctcgcggagcgcccggtgcac	Protospacer
********************************

3. spacer 2.1|90104|38|CP027023|CRISPRCasFinder matches to NZ_CP027023 (Streptomyces sp. WAC00288 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

ttgtcccccccaggtcacgggcggtttcaccctgcaac	CRISPR spacer
ttgtcccccccaggtcacgggcggtttcaccctgcaac	Protospacer
**************************************

4. spacer 2.2|90165|38|CP027023|CRISPRCasFinder matches to NZ_CP027023 (Streptomyces sp. WAC00288 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

tggacccatcggcgagtccctcggctacgagctcatca	CRISPR spacer
tggacccatcggcgagtccctcggctacgagctcatca	Protospacer
**************************************

5. spacer 2.3|90226|38|CP027023|CRISPRCasFinder matches to NZ_CP027023 (Streptomyces sp. WAC00288 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

ttgtccgaggatcttgtcctcgggggtcacgcgagtcg	CRISPR spacer
ttgtccgaggatcttgtcctcgggggtcacgcgagtcg	Protospacer
**************************************

6. spacer 2.4|90287|36|CP027023|CRISPRCasFinder matches to NZ_CP027023 (Streptomyces sp. WAC00288 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

gctccttatgcacggtctgatcaatgaacggcgagt	CRISPR spacer
gctccttatgcacggtctgatcaatgaacggcgagt	Protospacer
************************************

7. spacer 2.5|90346|38|CP027023|CRISPRCasFinder matches to NZ_CP027023 (Streptomyces sp. WAC00288 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

ttgctcggagcgccgcatcgacacggtgtggcgtaacc	CRISPR spacer
ttgctcggagcgccgcatcgacacggtgtggcgtaacc	Protospacer
**************************************

8. spacer 2.6|90407|38|CP027023|CRISPRCasFinder matches to NZ_CP027023 (Streptomyces sp. WAC00288 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

ttgctcagcaggcctcctgctcgcgttcgtcggtgcca	CRISPR spacer
ttgctcagcaggcctcctgctcgcgttcgtcggtgcca	Protospacer
**************************************

9. spacer 2.7|90103|41|CP027023|PILER-CR matches to NZ_CP027023 (Streptomyces sp. WAC00288 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

gttgtcccccccaggtcacgggcggtttcaccctgcaactg	CRISPR spacer
gttgtcccccccaggtcacgggcggtttcaccctgcaactg	Protospacer
*****************************************

10. spacer 2.8|90164|41|CP027023|PILER-CR matches to NZ_CP027023 (Streptomyces sp. WAC00288 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

atggacccatcggcgagtccctcggctacgagctcatcaac	CRISPR spacer
atggacccatcggcgagtccctcggctacgagctcatcaac	Protospacer
*****************************************

11. spacer 2.9|90225|41|CP027023|PILER-CR matches to NZ_CP027023 (Streptomyces sp. WAC00288 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

gttgtccgaggatcttgtcctcgggggtcacgcgagtcgcg	CRISPR spacer
gttgtccgaggatcttgtcctcgggggtcacgcgagtcgcg	Protospacer
*****************************************

12. spacer 2.10|90286|39|CP027023|PILER-CR matches to NZ_CP027023 (Streptomyces sp. WAC00288 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

ggctccttatgcacggtctgatcaatgaacggcgagtcg	CRISPR spacer
ggctccttatgcacggtctgatcaatgaacggcgagtcg	Protospacer
***************************************

13. spacer 2.11|90345|41|CP027023|PILER-CR matches to NZ_CP027023 (Streptomyces sp. WAC00288 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

gttgctcggagcgccgcatcgacacggtgtggcgtaacccc	CRISPR spacer
gttgctcggagcgccgcatcgacacggtgtggcgtaacccc	Protospacer
*****************************************

14. spacer 2.12|90105|39|CP027023|CRT matches to NZ_CP027023 (Streptomyces sp. WAC00288 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtcccccccaggtcacgggcggtttcaccctgcaactg	CRISPR spacer
tgtcccccccaggtcacgggcggtttcaccctgcaactg	Protospacer
***************************************

15. spacer 2.13|90166|39|CP027023|CRT matches to NZ_CP027023 (Streptomyces sp. WAC00288 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

ggacccatcggcgagtccctcggctacgagctcatcaac	CRISPR spacer
ggacccatcggcgagtccctcggctacgagctcatcaac	Protospacer
***************************************

16. spacer 2.14|90227|39|CP027023|CRT matches to NZ_CP027023 (Streptomyces sp. WAC00288 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

tgtccgaggatcttgtcctcgggggtcacgcgagtcgcg	CRISPR spacer
tgtccgaggatcttgtcctcgggggtcacgcgagtcgcg	Protospacer
***************************************

17. spacer 2.15|90288|37|CP027023|CRT matches to NZ_CP027023 (Streptomyces sp. WAC00288 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

ctccttatgcacggtctgatcaatgaacggcgagtcg	CRISPR spacer
ctccttatgcacggtctgatcaatgaacggcgagtcg	Protospacer
*************************************

18. spacer 2.16|90347|39|CP027023|CRT matches to NZ_CP027023 (Streptomyces sp. WAC00288 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

tgctcggagcgccgcatcgacacggtgtggcgtaacccc	CRISPR spacer
tgctcggagcgccgcatcgacacggtgtggcgtaacccc	Protospacer
***************************************

19. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.844

gcgagctgctcggcgagccgctc-cgcctccga	CRISPR spacer
gcgggctgctcgtcgagccgctcgcgacgccg-	Protospacer
***.******** ********** ** * *** 

20. spacer 1.2|79433|32|CP027023|CRISPRCasFinder matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 5, identity: 0.844

atcaggccctcctcgcggagcgcccggtgcac	CRISPR spacer
gtgacgccctcctcgcgcagcacccggtgcac	Protospacer
.* * ************ ***.**********

21. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to JQ067093 (Pseudomonas phage PaMx74, partial genome) position: , mismatch: 6, identity: 0.812

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
ccgagctgctcgacgaggcgctccgcctgggc	Protospacer
 ***********.**** **********  * 

22. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NZ_CP012701 (Sphingopyxis macrogoltabida strain EY-1 isolate activated sludge plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.812

gcgagc-tgctcggcgagccgctccgcctccga	CRISPR spacer
-cgggcgtcctcggcgtcccgctccgcctccgc	Protospacer
 **.** * *******  ************** 

23. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NZ_CP024313 (Rhizobium sp. NXC24 plasmid pRspNXC24b, complete sequence) position: , mismatch: 7, identity: 0.781

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
acgagctgctcggcgagctgttccgccacgtc	Protospacer
.*****************.*.****** *   

24. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NC_015169 (Deinococcus proteolyticus MRP plasmid pDEIPR01, complete sequence) position: , mismatch: 7, identity: 0.781

-gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
agcgggtc-ttcggccagccgctccgccgccga	Protospacer
 ***.*.. .***** ************ ****

25. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to CP006583 (Mesorhizobium huakuii 7653R plasmid pMHb, complete sequence) position: , mismatch: 7, identity: 0.781

gcgagctgctcggcgagccgct--ccgcctccga	CRISPR spacer
gcgatctgctcgtcgagccgctcgccaactct--	Protospacer
**** ******* *********  **. ***.  

26. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to KP790011 (Gordonia phage Gsput1, complete genome) position: , mismatch: 7, identity: 0.781

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
gccaccgcgtcagcgagccgctcagcctccga	Protospacer
** * *   **.*********** ********

27. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NZ_CP010408 (Streptomyces vietnamensis strain GIMV4.0001 plasmid pSVL1, complete sequence) position: , mismatch: 8, identity: 0.75

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
agcagctgctcggtgagccgcgccgcctcgtt	Protospacer
.  **********.******* *******   

28. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
tcgcccagcttggcgagccgctcggcctccag	Protospacer
 **  * ***.************ ******..

29. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NZ_CP045120 (Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
cggagctgctcggcgagcccctccacccctac	Protospacer
  ***************** ****.**.*.. 

30. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 8, identity: 0.75

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
tcgcccagcttggcgagccgctcggcctccag	Protospacer
 **  * ***.************ ******..

31. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 8, identity: 0.75

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
tcgagcggctcggccagccgctcctcgagcgt	Protospacer
 ***** ******* ********* *   ** 

32. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 8, identity: 0.75

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
tccgggtgctgggcgatccgctccgcctccag	Protospacer
 * .* **** ***** *************..

33. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 8, identity: 0.75

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
tccggctgctcggccagacgctccgccagcca	Protospacer
 * .********** ** *********  * *

34. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
tccggctgctcggccagacgctccgccagcca	Protospacer
 * .********** ** *********  * *

35. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
tcgcccagcttggcgagccgctcggcctccag	Protospacer
 **  * ***.************ ******..

36. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 8, identity: 0.75

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
tcgcccagcttggcgagccgctcggcctccag	Protospacer
 **  * ***.************ ******..

37. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NZ_CP029833 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75

-gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
tgccgg-tgctgggcgcgccgctccgcctcatc	Protospacer
 ** .* **** **** *************   

38. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NZ_CP016354 (Prauserella marina strain DSM 45268 plasmid pPmarDSM45268, complete sequence) position: , mismatch: 8, identity: 0.75

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
gcttcgtgctcggcgatccgctgcgcctcggc	Protospacer
**    ********** ***** ****** * 

39. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 8, identity: 0.75

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
ttgaggaactcggcgagccgctccgtcttcgg	Protospacer
 .***  .*****************.**.**.

40. spacer 1.2|79433|32|CP027023|CRISPRCasFinder matches to MH271298 (Microbacterium phage Floof, complete genome) position: , mismatch: 8, identity: 0.75

atcaggccctcctcgcggagcgcccggtgcac	CRISPR spacer
ttcaggcccgcctcgcggagcgcctggaagta	Protospacer
 ******** **************.** .   

41. spacer 1.2|79433|32|CP027023|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.75

atcaggccctcctcgcggagcgcccggtgcac	CRISPR spacer
ttcaggcccgcctcgcggagcggcccgggaga	Protospacer
 ******** ************ ** * * . 

42. spacer 1.2|79433|32|CP027023|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.75

atcaggccctcctcgcggagcgcccggtgcac	CRISPR spacer
ttcaggcccgcctcgcggagcggcccgggaga	Protospacer
 ******** ************ ** * * . 

43. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
gcgagctgctcgtcgcgccgctctacccggcg	Protospacer
************ ** *******..**.   .

44. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
gcgagctgctcgtcgcgccgctctacccggcg	Protospacer
************ ** *******..**.   .

45. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.719

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
gcctcgtgctcggcgaggcgctcggcctcgtc	Protospacer
**    *********** ***** *****   

46. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to JX006077 (Saccharomonospora phage PIS 136, complete genome) position: , mismatch: 9, identity: 0.719

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
cgttcctgctcggcgcgctgctccgcctccag	Protospacer
     ********** **.***********..

47. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
acctgctgctcggcgagctgctccaccacacg	Protospacer
.*  **************.*****.** *  .

48. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NZ_CP027239 (Dietzia sp. oral taxon 368 strain W5195 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
gtcttctgctcggcgtgccgctctgccttggt	Protospacer
*.   ********** *******.****. * 

49. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NZ_CP022424 (Vitreoscilla filiformis strain ATCC 15551 plasmid pVF1, complete sequence) position: , mismatch: 9, identity: 0.719

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
cccggctgctcggccagccgctgcgccacgtc	Protospacer
 * .********** ******* **** *   

50. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 9, identity: 0.719

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
cctgggtgcccggcgagccgatccgcctcatc	Protospacer
 * .* ***.********** ********   

51. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to AP017627 (Pleomorphomonas sp. SM30 plasmid pSM30-1 DNA, complete genome) position: , mismatch: 9, identity: 0.719

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
cggagatcctcggcgagccgctccggcccgcc	Protospacer
  *** * ***************** *.*   

52. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NC_004808 (Streptomyces rochei plasmid pSLA2-L DNA, complete sequence) position: , mismatch: 9, identity: 0.719

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
gcgggctgctcggcgagccggtcgaggaacgt	Protospacer
***.**************** ** .    ** 

53. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NC_008697 (Nocardioides sp. JS614 plasmid pNOCA01, complete sequence) position: , mismatch: 9, identity: 0.719

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
cgcagctgctcggcgaaccactccgcggccct	Protospacer
   *************.**.******  **  

54. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NZ_CP014310 (Burkholderia sp. PAMC 26561 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
gcgagctgctcgtcgaggcgctcaatccgctt	Protospacer
************ **** ***** ..*. *  

55. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NZ_CP014310 (Burkholderia sp. PAMC 26561 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
gcgagctgctcgtcgaggcgctcaatccgctt	Protospacer
************ **** ***** ..*. *  

56. spacer 1.2|79433|32|CP027023|CRISPRCasFinder matches to NC_014838 (Pantoea sp. At-9b plasmid pPAT9B01, complete sequence) position: , mismatch: 9, identity: 0.719

atcaggccctcctcgcggagcgcccggtgcac	CRISPR spacer
agtttgccctgctcgcgcagcgcccggttctg	Protospacer
* .  ***** ****** ********** *  

57. spacer 1.2|79433|32|CP027023|CRISPRCasFinder matches to CP040467 (Streptomyces albidoflavus strain UYFA156 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

atcaggccctcctcgcggagcgcccggtgcac	CRISPR spacer
tcgccgccctcctcgcggagcaccccgtcgac	Protospacer
 .   ****************.*** **  **

58. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 10, identity: 0.688

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
ccgatctgctcggcgagccgttcctggctcat	Protospacer
 *** ***************.***   ..*. 

59. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NZ_CP021033 (Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence) position: , mismatch: 10, identity: 0.688

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
ccgatctggtcggcgagccgctcctggctcat	Protospacer
 *** *** ***************   ..*. 

60. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 10, identity: 0.688

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
ccgatctgctcggcgagccgttcctggctcat	Protospacer
 *** ***************.***   ..*. 

61. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NZ_CP020900 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence) position: , mismatch: 10, identity: 0.688

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
ccgatctgctcggcaagccgctcctggctcat	Protospacer
 *** *********.*********   ..*. 

62. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NC_007763 (Rhizobium etli CFN 42 plasmid p42b, complete sequence) position: , mismatch: 10, identity: 0.688

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
ccgatctgctcggcaagccgctcctggctcat	Protospacer
 *** *********.*********   ..*. 

63. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NZ_CP021025 (Rhizobium sp. TAL182 plasmid pRetTAL182a, complete sequence) position: , mismatch: 10, identity: 0.688

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
ccgatctgctcggcaagccgctcctggctcat	Protospacer
 *** *********.*********   ..*. 

64. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NZ_CP013526 (Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence) position: , mismatch: 10, identity: 0.688

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
ccgatctgctcggcaagccgctcctggctcat	Protospacer
 *** *********.*********   ..*. 

65. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NZ_CP013556 (Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence) position: , mismatch: 10, identity: 0.688

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
ccgatctgctcggcaagccgctcctggctcat	Protospacer
 *** *********.*********   ..*. 

66. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NZ_CP020907 (Rhizobium etli strain NXC12 plasmid pRetNXC12a, complete sequence) position: , mismatch: 10, identity: 0.688

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
ccgatctgctcggcaagccgctcctggctcat	Protospacer
 *** *********.*********   ..*. 

67. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NZ_CP013589 (Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence) position: , mismatch: 10, identity: 0.688

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
ccgatctgctcggcaagccgctcctggctcat	Protospacer
 *** *********.*********   ..*. 

68. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NZ_CP013600 (Rhizobium sp. N741 plasmid pRspN741e, complete sequence) position: , mismatch: 10, identity: 0.688

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
ccgatctgctcggcaagccgctcctggctcat	Protospacer
 *** *********.*********   ..*. 

69. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NZ_CP013562 (Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence) position: , mismatch: 10, identity: 0.688

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
ccgatctgctcggcaagccgctcctggctcat	Protospacer
 *** *********.*********   ..*. 

70. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 10, identity: 0.688

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
ccgatctgctcggcaagccgctcctggctcat	Protospacer
 *** *********.*********   ..*. 

71. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 10, identity: 0.688

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
ccgatctgctcggcaagccgctcctggctcat	Protospacer
 *** *********.*********   ..*. 

72. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NZ_CP013536 (Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence) position: , mismatch: 10, identity: 0.688

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
ccgatctgctcggcaagccgctcctggctcat	Protospacer
 *** *********.*********   ..*. 

73. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 10, identity: 0.688

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
ccgatctgctcggcaagccgctcctggctcat	Protospacer
 *** *********.*********   ..*. 

74. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 10, identity: 0.688

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
ccgatctgctcggcaagccgctcctggctcat	Protospacer
 *** *********.*********   ..*. 

75. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NZ_CP013567 (Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence) position: , mismatch: 10, identity: 0.688

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
ccgatctgctcggcaagccgctcctggctcat	Protospacer
 *** *********.*********   ..*. 

76. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NC_021906 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1a, complete sequence) position: , mismatch: 10, identity: 0.688

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
ccgatctgctcggcaagccgctcctggctcat	Protospacer
 *** *********.*********   ..*. 

77. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NZ_CP013504 (Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence) position: , mismatch: 10, identity: 0.688

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
ccgatctgctcggcaagccgctcctggctcat	Protospacer
 *** *********.*********   ..*. 

78. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 10, identity: 0.688

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
ccgatctgctcggcaagccgctcctggctcat	Protospacer
 *** *********.*********   ..*. 

79. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NZ_CP013510 (Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence) position: , mismatch: 10, identity: 0.688

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
ccgatctgctcggcaagccgctcctggctcat	Protospacer
 *** *********.*********   ..*. 

80. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NZ_CP013521 (Rhizobium sp. N113 plasmid pRspN113d, complete sequence) position: , mismatch: 10, identity: 0.688

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
ccgatctgctcggcaagccgctcctggctcat	Protospacer
 *** *********.*********   ..*. 

81. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 10, identity: 0.688

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
ccgatctgctcggcaagccgctcctggctcat	Protospacer
 *** *********.*********   ..*. 

82. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NZ_CP013494 (Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence) position: , mismatch: 10, identity: 0.688

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
ccgatctgctcggcaagccgctcctggctcat	Protospacer
 *** *********.*********   ..*. 

83. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NZ_CP013512 (Rhizobium sp. N1314 plasmid pRspN1314a, complete sequence) position: , mismatch: 10, identity: 0.688

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
ccgatctgctcggcaagccgctcctggctcat	Protospacer
 *** *********.*********   ..*. 

84. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NZ_CP013594 (Rhizobium sp. N871 plasmid pRspN871d, complete sequence) position: , mismatch: 10, identity: 0.688

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
ccgatctgctcggcaagccgctcctggctcat	Protospacer
 *** *********.*********   ..*. 

85. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NZ_CP005086 (Sphingobium sp. TKS plasmid pTK2, complete sequence) position: , mismatch: 10, identity: 0.688

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
cgctgatgctcggcgatgcgctccgcctctat	Protospacer
    * **********  ***********.. 

86. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NC_010997 (Rhizobium etli CIAT 652 plasmid pC, complete sequence) position: , mismatch: 10, identity: 0.688

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
ccgatctgctcggcaagccgctcctggctcat	Protospacer
 *** *********.*********   ..*. 

87. spacer 1.1|79372|32|CP027023|CRISPRCasFinder matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 10, identity: 0.688

gcgagctgctcggcgagccgctccgcctccga	CRISPR spacer
ccgatctgctcggcgagccgttcctggctcat	Protospacer
 *** ***************.***   ..*. 

88. spacer 1.2|79433|32|CP027023|CRISPRCasFinder matches to NC_021908 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence) position: , mismatch: 10, identity: 0.688

atcaggccctcctcgcggagcgcccggtgcac	CRISPR spacer
acgtaatcctcctcgcggagcgccaggagctt	Protospacer
*.  ...***************** ** ** .

89. spacer 1.2|79433|32|CP027023|CRISPRCasFinder matches to NC_014213 (Meiothermus silvanus DSM 9946 plasmid pMESIL01, complete sequence) position: , mismatch: 11, identity: 0.656

atcaggccctcctcgcggagcgcccggtgcac	CRISPR spacer
cccaggccctcctggaggagcgccctacctgg	Protospacer
 .*********** * ********* .. .. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage