Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP025710 Escherichia coli strain YDC107 plasmid pYDC107_70, complete sequence 0 crisprs NA 0 0 1 0
CP025711 Escherichia coli strain YDC107 plasmid pYDC107_41, complete sequence 0 crisprs NA 0 0 0 0
CP025712 Escherichia phage YDC107_1 chromosome, complete genome 0 crisprs NA 0 0 1 0
CP025713 Escherichia phage YDC107_2 chromosome, complete genome 0 crisprs NA 0 0 1 0
CP025709 Escherichia coli strain YDC107 plasmid pYDC107_85 0 crisprs NA 0 0 0 0
CP025708 Escherichia coli strain YDC107 plasmid pYDC107_184, complete sequence 0 crisprs csa3 0 0 2 0
CP025707 Escherichia coli strain YDC107 chromosome, complete genome 3 crisprs DinG,DEDDh,c2c9_V-U4,cas3,csa3,cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,PD-DExK,RT 0 13 12 0

Results visualization

1. CP025710
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 51496 59 Enterobacteria_phage(28.57%) integrase,transposase attL 15191:15250|attR 50387:50996
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP025708
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1262 : 90988 106 Escherichia_phage(36.67%) integrase,transposase,protease attL 45225:45284|attR 68060:68880
DBSCAN-SWA_2 129266 : 178379 50 Shigella_phage(23.81%) integrase,transposase attL 145991:146005|attR 180161:180175
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. CP025712
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 310 : 46299 67 Escherichia_phage(100.0%) portal,head,lysis,tail,terminase,capsid,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. CP025713
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 6 : 18578 44 Escherichia_phage(95.45%) integrase,tail attL 6206:6220|attR 14043:14057
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. CP025707
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025707_1 1356025-1356599 TypeI-E I-E
9 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025707_2 1383738-1384376 Unclear I-E
10 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025707_3 3126104-3126253 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP025707_1 1.1|1356051|35|CP025707|CRT 1356051-1356085 35 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 246934-246968 0 1.0
CP025707_1 1.14|1356356|32|CP025707|PILER-CR,CRISPRCasFinder 1356356-1356387 32 NZ_CP037443 Klebsiella sp. PO552 plasmid p2, complete sequence 42679-42710 1 0.969
CP025707_1 1.6|1356356|35|CP025707|CRT 1356356-1356390 35 NZ_CP037443 Klebsiella sp. PO552 plasmid p2, complete sequence 42676-42710 2 0.943
CP025707_2 2.2|1383828|32|CP025707|CRISPRCasFinder,CRT 1383828-1383859 32 KT898133 Aeromonas phage phiARM81ld, complete genome 45655-45686 2 0.938
CP025707_2 2.14|1384316|30|CP025707|PILER-CR 1384316-1384345 30 NC_008712 Paenarthrobacter aurescens TC1 plasmid pTC1, complete sequence 320389-320418 5 0.833
CP025707_2 2.8|1384194|32|CP025707|CRISPRCasFinder,CRT 1384194-1384225 32 NC_016040 Sulfobacillus thermotolerans strain Y0017 plasmid pY0017, complete sequence 37866-37897 6 0.812
CP025707_2 2.12|1384194|30|CP025707|PILER-CR 1384194-1384223 30 NC_016040 Sulfobacillus thermotolerans strain Y0017 plasmid pY0017, complete sequence 37868-37897 6 0.8
CP025707_1 1.12|1356234|32|CP025707|PILER-CR,CRISPRCasFinder 1356234-1356265 32 MT110073 Stenotrophomonas phage vB_SmaS_DLP_3, complete genome 39410-39441 7 0.781
CP025707_2 2.6|1384072|32|CP025707|CRISPRCasFinder,CRT 1384072-1384103 32 KC821619 Cellulophaga phage phi18:1, complete genome 6924-6955 7 0.781
CP025707_2 2.6|1384072|32|CP025707|CRISPRCasFinder,CRT 1384072-1384103 32 KC821627 Cellulophaga phage phi18:2, complete genome 6924-6955 7 0.781
CP025707_2 2.14|1384316|30|CP025707|PILER-CR 1384316-1384345 30 NZ_CP045381 Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence 107507-107536 7 0.767
CP025707_2 2.14|1384316|30|CP025707|PILER-CR 1384316-1384345 30 NZ_CP019631 Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence 199281-199310 7 0.767
CP025707_1 1.11|1356173|32|CP025707|PILER-CR,CRISPRCasFinder 1356173-1356204 32 NZ_CP044084 Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence 347859-347890 8 0.75
CP025707_2 2.2|1383828|32|CP025707|CRISPRCasFinder,CRT 1383828-1383859 32 MN901520 Halorubrum coriense virus Hardycor2, complete genome 16524-16555 8 0.75
CP025707_2 2.7|1384133|32|CP025707|CRISPRCasFinder,CRT 1384133-1384164 32 MN855878 Bacteriophage sp. isolate 336, complete genome 5171-5202 8 0.75
CP025707_2 2.10|1384316|32|CP025707|CRISPRCasFinder,CRT 1384316-1384347 32 NZ_CP045381 Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence 107507-107538 8 0.75
CP025707_2 2.10|1384316|32|CP025707|CRISPRCasFinder,CRT 1384316-1384347 32 NZ_CP019631 Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence 199281-199312 8 0.75
CP025707_1 1.10|1356112|32|CP025707|PILER-CR,CRISPRCasFinder 1356112-1356143 32 NZ_CP016293 Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence 11267-11298 9 0.719
CP025707_1 1.14|1356356|32|CP025707|PILER-CR,CRISPRCasFinder 1356356-1356387 32 NZ_CP019063 Rahnella sp. ERMR1:05 plasmid unnamed1, complete sequence 287201-287232 9 0.719
CP025707_2 2.6|1384072|32|CP025707|CRISPRCasFinder,CRT 1384072-1384103 32 NZ_CP020483 Campylobacter helveticus strain ATCC 51209 plasmid pHELV-5, complete sequence 383-414 9 0.719

1. spacer 1.1|1356051|35|CP025707|CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

caagtgatgtccatcatcgcatccagtgcgtccgg	CRISPR spacer
caagtgatgtccatcatcgcatccagtgcgtccgg	Protospacer
***********************************

2. spacer 1.14|1356356|32|CP025707|PILER-CR,CRISPRCasFinder matches to NZ_CP037443 (Klebsiella sp. PO552 plasmid p2, complete sequence) position: , mismatch: 1, identity: 0.969

atgagattaaaatactcagtactcttactcgc	CRISPR spacer
atgagattaaaatactcagcactcttactcgc	Protospacer
*******************.************

3. spacer 1.6|1356356|35|CP025707|CRT matches to NZ_CP037443 (Klebsiella sp. PO552 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.943

atgagattaaaatactcagtactcttactcgccga	CRISPR spacer
atgagattaaaatactcagcactcttactcgccgt	Protospacer
*******************.************** 

4. spacer 2.2|1383828|32|CP025707|CRISPRCasFinder,CRT matches to KT898133 (Aeromonas phage phiARM81ld, complete genome) position: , mismatch: 2, identity: 0.938

acgaacgcggcacaccagggcgtctcatcgtc	CRISPR spacer
acgaacgcggcgcaccagggcgtctcgtcgtc	Protospacer
***********.**************.*****

5. spacer 2.14|1384316|30|CP025707|PILER-CR matches to NC_008712 (Paenarthrobacter aurescens TC1 plasmid pTC1, complete sequence) position: , mismatch: 5, identity: 0.833

aaggtcgcggggacgccacgggcagtcaat	CRISPR spacer
caggtcggcgggacgccacgggcagtcgac	Protospacer
 ******  ******************.*.

6. spacer 2.8|1384194|32|CP025707|CRISPRCasFinder,CRT matches to NC_016040 (Sulfobacillus thermotolerans strain Y0017 plasmid pY0017, complete sequence) position: , mismatch: 6, identity: 0.812

gagagcgaggggagattccggcagggcgtgca	CRISPR spacer
aatcgtgaggggatcttccggcagggcgtgca	Protospacer
.*  *.*******  *****************

7. spacer 2.12|1384194|30|CP025707|PILER-CR matches to NC_016040 (Sulfobacillus thermotolerans strain Y0017 plasmid pY0017, complete sequence) position: , mismatch: 6, identity: 0.8

gagagcgaggggagattccggcagggcgtg	CRISPR spacer
aatcgtgaggggatcttccggcagggcgtg	Protospacer
.*  *.*******  ***************

8. spacer 1.12|1356234|32|CP025707|PILER-CR,CRISPRCasFinder matches to MT110073 (Stenotrophomonas phage vB_SmaS_DLP_3, complete genome) position: , mismatch: 7, identity: 0.781

gatcgcctgctccagcgtcactccctgcccct	CRISPR spacer
gttcgcctgctccagcgtcaatgccccctccc	Protospacer
* ****************** * **. *.**.

9. spacer 2.6|1384072|32|CP025707|CRISPRCasFinder,CRT matches to KC821619 (Cellulophaga phage phi18:1, complete genome) position: , mismatch: 7, identity: 0.781

gccgcgttattttccctgaaaacaataaagct	CRISPR spacer
gcggttttattttccctgaaaagaaaaaagag	Protospacer
** *. **************** ** ****  

10. spacer 2.6|1384072|32|CP025707|CRISPRCasFinder,CRT matches to KC821627 (Cellulophaga phage phi18:2, complete genome) position: , mismatch: 7, identity: 0.781

gccgcgttattttccctgaaaacaataaagct	CRISPR spacer
gcggttttattttccctgaaaagaaaaaagag	Protospacer
** *. **************** ** ****  

11. spacer 2.14|1384316|30|CP025707|PILER-CR matches to NZ_CP045381 (Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence) position: , mismatch: 7, identity: 0.767

aaggtcgcggggacgccacgggcagtcaat	CRISPR spacer
gatttcgctgggaccccacgggcagtcgac	Protospacer
.*  **** ***** ************.*.

12. spacer 2.14|1384316|30|CP025707|PILER-CR matches to NZ_CP019631 (Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

aaggtcgcggggacgccacgggcagtcaat	CRISPR spacer
gatttcgctgggaccccacgggcagtcgac	Protospacer
.*  **** ***** ************.*.

13. spacer 1.11|1356173|32|CP025707|PILER-CR,CRISPRCasFinder matches to NZ_CP044084 (Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

gttgaggtcgataagtacgaacggtttccctg	CRISPR spacer
gaagaggtcgatgagtacgaatggttacagcg	Protospacer
*  *********.********.**** *  .*

14. spacer 2.2|1383828|32|CP025707|CRISPRCasFinder,CRT matches to MN901520 (Halorubrum coriense virus Hardycor2, complete genome) position: , mismatch: 8, identity: 0.75

acgaacgcggcacaccagggcgtctcatcgtc--	CRISPR spacer
ccgaacgcggcacacccgagcg--tcggcggcgg	Protospacer
 *************** *.***  **. ** *  

15. spacer 2.7|1384133|32|CP025707|CRISPRCasFinder,CRT matches to MN855878 (Bacteriophage sp. isolate 336, complete genome) position: , mismatch: 8, identity: 0.75

taatatccc----tggcgataatcaaccggcttact	CRISPR spacer
----acgccatggtggcgataatcatcctgcttact	Protospacer
    *. **    ************ ** *******

16. spacer 2.10|1384316|32|CP025707|CRISPRCasFinder,CRT matches to NZ_CP045381 (Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence) position: , mismatch: 8, identity: 0.75

aaggtcgcggggacgccacgggcagtcaatgt	CRISPR spacer
gatttcgctgggaccccacgggcagtcgacgg	Protospacer
.*  **** ***** ************.*.* 

17. spacer 2.10|1384316|32|CP025707|CRISPRCasFinder,CRT matches to NZ_CP019631 (Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

aaggtcgcggggacgccacgggcagtcaatgt	CRISPR spacer
gatttcgctgggaccccacgggcagtcgacgg	Protospacer
.*  **** ***** ************.*.* 

18. spacer 1.10|1356112|32|CP025707|PILER-CR,CRISPRCasFinder matches to NZ_CP016293 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719

gtcaataggcggcgtcccgtagccgtcccctt	CRISPR spacer
gtgctctggcggcgtgccgtagccatccccga	Protospacer
**   . ******** ********.*****  

19. spacer 1.14|1356356|32|CP025707|PILER-CR,CRISPRCasFinder matches to NZ_CP019063 (Rahnella sp. ERMR1:05 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

atgagattaaaatactcagtactcttactcgc	CRISPR spacer
cgggaattaacatactcggtactcttaccgtc	Protospacer
  *..***** ******.**********.  *

20. spacer 2.6|1384072|32|CP025707|CRISPRCasFinder,CRT matches to NZ_CP020483 (Campylobacter helveticus strain ATCC 51209 plasmid pHELV-5, complete sequence) position: , mismatch: 9, identity: 0.719

gccgcgttattttccctgaaaacaataaagct	CRISPR spacer
tagcctttattttcactcaaaacaataaaagt	Protospacer
    * ******** ** ***********. *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 155 : 75407 101 Escherichia_phage(44.44%) tail,transposase,head,lysis,capsid,portal,terminase,integrase attL 45318:45333|attR 61544:61559
DBSCAN-SWA_2 445880 : 513332 50 Bacillus_phage(25.0%) integrase,transposase attL 444980:444996|attR 497354:497370
DBSCAN-SWA_3 562462 : 569980 7 Escherichia_phage(42.86%) NA NA
DBSCAN-SWA_4 660321 : 669764 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_5 1073086 : 1116165 55 Escherichia_phage(61.11%) protease,tail,head,terminase,integrase attL 1074925:1074941|attR 1113051:1113067
DBSCAN-SWA_6 1332587 : 1339727 6 Escherichia_phage(83.33%) NA NA
DBSCAN-SWA_7 1607987 : 1691362 84 Enterobacteria_phage(28.12%) integrase,tRNA,protease,transposase attL 1657440:1657487|attR 1688180:1688227
DBSCAN-SWA_8 3122637 : 3182013 57 Shigella_phage(25.0%) integrase,transposase,tRNA,holin attL 3152274:3152288|attR 3168238:3168252
DBSCAN-SWA_9 3276751 : 3358529 95 Enterobacteria_phage(38.1%) protease,tail,transposase,head,lysis,capsid,portal,terminase,integrase attL 3296056:3296071|attR 3347912:3347927
DBSCAN-SWA_10 4633818 : 4697183 76 Escherichia_phage(38.18%) tail,tRNA,transposase,head,lysis,capsid,portal,terminase,integrase attL 4624733:4624748|attR 4643559:4643574
DBSCAN-SWA_11 4916496 : 5023856 108 Escherichia_phage(47.46%) tail,tRNA,transposase,lysis,terminase,coat,integrase,holin attL 4915947:4915963|attR 4996393:4996409
DBSCAN-SWA_12 5174630 : 5198133 25 Enterobacteria_phage(60.87%) capsid,tail,head NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage