Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP036448 Klebsiella pneumoniae strain KPNIH45 plasmid pKPC-e4b7, complete sequence 0 crisprs NA 0 0 4 0
CP036449 Klebsiella pneumoniae strain KPNIH45 plasmid pKPC-610e, complete sequence 0 crisprs NA 0 0 0 0
CP036447 Klebsiella pneumoniae strain KPNIH45 plasmid unnamed2, complete sequence 0 crisprs RT 0 0 2 0
CP036446 Klebsiella pneumoniae strain KPNIH45 plasmid unnamed1, complete sequence 0 crisprs cas3 0 0 1 0
CP036450 Klebsiella pneumoniae strain KPNIH45 chromosome, complete genome 2 crisprs DEDDh,cas3,WYL,DinG,RT,csa3 0 1 12 0

Results visualization

1. CP036448
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 7690 6 Enterobacteria_phage(66.67%) transposase NA
DBSCAN-SWA_2 14606 : 19245 4 Escherichia_phage(50.0%) transposase NA
DBSCAN-SWA_3 26102 : 31101 9 Salmonella_phage(25.0%) NA NA
DBSCAN-SWA_4 49006 : 49693 1 Bacillus_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP036447
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 4548 : 54491 51 Escherichia_phage(46.15%) transposase,integrase attL 9760:9819|attR 42949:44279
DBSCAN-SWA_2 61573 : 71011 10 Escherichia_phage(42.86%) integrase attL 59157:59174|attR 74588:74605
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. CP036450
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP036450_1 1133550-1133635 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP036450_2 1925194-1925271 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP036450_3 3.1|4388001|37|CP036450|CRISPRCasFinder 4388001-4388037 37 MH178096 Aeromonas phage AsXd-1, complete genome 10850-10886 5 0.865

1. spacer 3.1|4388001|37|CP036450|CRISPRCasFinder matches to MH178096 (Aeromonas phage AsXd-1, complete genome) position: , mismatch: 5, identity: 0.865

caggtagtgaatctcctgcaccaggtagtgaacgatt	CRISPR spacer
tacggggtgaatctgctgcaccaggtagtgaacgatt	Protospacer
.* * .******** **********************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1384560 : 1396214 13 Enterobacteria_phage(70.0%) integrase attL 1372694:1372708|attR 1395751:1395765
DBSCAN-SWA_2 1605768 : 1650889 70 uncultured_Caudovirales_phage(30.77%) integrase,tRNA,terminase,lysis,tail,head attL 1608651:1608697|attR 1651045:1651091
DBSCAN-SWA_3 2018766 : 2077229 68 Salmonella_phage(70.21%) integrase,plate,portal,transposase,tail,capsid,head attL 2018674:2018692|attR 2057374:2057392
DBSCAN-SWA_4 2092917 : 2102381 9 Dickeya_phage(16.67%) protease,tRNA NA
DBSCAN-SWA_5 2537047 : 2576819 56 uncultured_Caudovirales_phage(34.04%) integrase,lysis,protease,transposase,tail,head attL 2535128:2535142|attR 2544068:2544082
DBSCAN-SWA_6 2631902 : 2696245 76 Escherichia_phage(17.54%) integrase,tRNA,terminase,holin,transposase,tail attL 2631099:2631115|attR 2640266:2640282
DBSCAN-SWA_7 2862814 : 2873701 9 Escherichia_phage(87.5%) NA NA
DBSCAN-SWA_8 3805846 : 3818127 11 Escherichia_phage(22.22%) NA NA
DBSCAN-SWA_9 3858952 : 3865857 6 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_10 4165643 : 4239869 82 Salmonella_phage(37.25%) integrase,tRNA,terminase,holin,transposase,tail,capsid attL 4171291:4171308|attR 4238858:4238875
DBSCAN-SWA_11 4314890 : 4394612 87 Enterobacteria_phage(27.08%) integrase,tRNA,terminase,portal,holin,protease,tail,capsid,head attL 4321333:4321349|attR 4404333:4404349
DBSCAN-SWA_12 5116674 : 5186052 75 uncultured_Caudovirales_phage(61.11%) integrase,tRNA,terminase,protease,tail,capsid,portal,head attL 5152433:5152450|attR 5168428:5168445
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. CP036446
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 17329 : 57656 50 Escherichia_phage(25.0%) transposase,integrase attL 23477:23493|attR 43583:43599
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage