Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 8 crisprs csa3,cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2 1 126 0 0
CP029338 Streptomyces sp. SM17 chromosome, complete genome 31 crisprs WYL,cas4,c2c9_V-U4,DEDDh,Cas9_archaeal,csa3,cas3,DinG,cas3HD,cas8e,cse2gr11,cas7,cas5,cas6e 5 20 2 0
CP029340 Streptomyces sp. SM17 plasmid pSM17B, complete sequence 0 crisprs NA 0 0 0 0
CP029341 Streptomyces sp. SM17 plasmid pSM17C, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. CP029339
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029339_1 83804-85349 TypeI-E NA
25 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029339_2 86665-86937 TypeI-E NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029339_3 87496-87699 TypeI-E NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029339_4 88846-90033 TypeI-E NA
19 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029339_5 90280-90429 TypeI-E NA
2 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029339_6 93196-93613 TypeI-E NA
6 spacers
cas3,cas8e,cse2gr11,cas7,cas5

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029339_7 97942-99367 TypeI-E NA
23 spacers
cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029339_8 109686-111420 TypeI-E NA
28 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP029339_6 6.4|93431|34|CP029339|CRISPRCasFinder,CRT,PILER-CR 93431-93464 34 CP029340.1 8574-8607 0 1.0
CP029339_6 6.4|93431|34|CP029339|CRISPRCasFinder,CRT,PILER-CR 93431-93464 34 CP029340.1 23268-23301 0 1.0

1. spacer 6.4|93431|34|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to position: 8574-8607, mismatch: 0, identity: 1.0

gatgcccccggcgacgacgtagcagtacccgggc	CRISPR spacer
gatgcccccggcgacgacgtagcagtacccgggc	Protospacer
**********************************

2. spacer 6.4|93431|34|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to position: 23268-23301, mismatch: 0, identity: 1.0

gatgcccccggcgacgacgtagcagtacccgggc	CRISPR spacer
gatgcccccggcgacgacgtagcagtacccgggc	Protospacer
**********************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP029339_1 1.1|83832|31|CP029339|CRISPRCasFinder,CRT 83832-83862 31 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 83832-83862 0 1.0
CP029339_1 1.2|83891|33|CP029339|CRISPRCasFinder,CRT 83891-83923 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 73868-73900 0 1.0
CP029339_1 1.2|83891|33|CP029339|CRISPRCasFinder,CRT 83891-83923 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 83891-83923 0 1.0
CP029339_1 1.2|83891|33|CP029339|CRISPRCasFinder,CRT 83891-83923 33 NC_010311 Streptomyces sp. HK1 plasmid pSHK1, complete sequence 88242-88274 0 1.0
CP029339_1 1.3|83952|33|CP029339|CRISPRCasFinder,CRT 83952-83984 33 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 107682-107714 0 1.0
CP029339_1 1.3|83952|33|CP029339|CRISPRCasFinder,CRT 83952-83984 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 83952-83984 0 1.0
CP029339_1 1.4|84013|33|CP029339|CRISPRCasFinder,CRT 84013-84045 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 84013-84045 0 1.0
CP029339_1 1.4|84013|33|CP029339|CRISPRCasFinder,CRT 84013-84045 33 NC_010311 Streptomyces sp. HK1 plasmid pSHK1, complete sequence 92978-93010 0 1.0
CP029339_1 1.4|84013|33|CP029339|CRISPRCasFinder,CRT 84013-84045 33 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 107621-107653 0 1.0
CP029339_1 1.5|84074|33|CP029339|CRISPRCasFinder,CRT 84074-84106 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 84074-84106 0 1.0
CP029339_1 1.5|84074|33|CP029339|CRISPRCasFinder,CRT 84074-84106 33 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 107560-107592 0 1.0
CP029339_1 1.6|84135|33|CP029339|CRISPRCasFinder,CRT 84135-84167 33 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 107499-107531 0 1.0
CP029339_1 1.6|84135|33|CP029339|CRISPRCasFinder,CRT 84135-84167 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 84135-84167 0 1.0
CP029339_1 1.7|84196|33|CP029339|CRISPRCasFinder,CRT 84196-84228 33 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 107438-107470 0 1.0
CP029339_1 1.7|84196|33|CP029339|CRISPRCasFinder,CRT 84196-84228 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 84196-84228 0 1.0
CP029339_1 1.8|84257|33|CP029339|CRISPRCasFinder,CRT 84257-84289 33 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 107377-107409 0 1.0
CP029339_1 1.8|84257|33|CP029339|CRISPRCasFinder,CRT 84257-84289 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 84257-84289 0 1.0
CP029339_1 1.9|84318|33|CP029339|CRISPRCasFinder,CRT 84318-84350 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 84318-84350 0 1.0
CP029339_1 1.9|84318|33|CP029339|CRISPRCasFinder,CRT 84318-84350 33 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 107316-107348 0 1.0
CP029339_1 1.10|84379|33|CP029339|CRISPRCasFinder,CRT 84379-84411 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 84379-84411 0 1.0
CP029339_1 1.10|84379|33|CP029339|CRISPRCasFinder,CRT 84379-84411 33 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 107255-107287 0 1.0
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 84440-84472 0 1.0
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 107194-107226 0 1.0
CP029339_1 1.12|84501|33|CP029339|CRISPRCasFinder,CRT 84501-84533 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 84501-84533 0 1.0
CP029339_1 1.12|84501|33|CP029339|CRISPRCasFinder,CRT 84501-84533 33 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 107133-107165 0 1.0
CP029339_1 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR 84562-84588 27 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 84562-84588 0 1.0
CP029339_1 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR 84562-84588 27 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 107078-107104 0 1.0
CP029339_1 1.14|84617|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 84617-84649 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 84617-84649 0 1.0
CP029339_1 1.14|84617|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 84617-84649 33 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 107017-107049 0 1.0
CP029339_1 1.15|84678|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 84678-84710 33 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 106956-106988 0 1.0
CP029339_1 1.15|84678|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 84678-84710 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 67954-67986 0 1.0
CP029339_1 1.15|84678|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 84678-84710 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 84678-84710 0 1.0
CP029339_1 1.16|84739|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 84739-84771 33 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 106895-106927 0 1.0
CP029339_1 1.16|84739|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 84739-84771 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 84739-84771 0 1.0
CP029339_1 1.17|84800|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 84800-84832 33 ASHF01000034 Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence 98372-98404 0 1.0
CP029339_1 1.17|84800|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 84800-84832 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 84800-84832 0 1.0
CP029339_1 1.17|84800|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 84800-84832 33 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 106834-106866 0 1.0
CP029339_1 1.18|84861|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 84861-84893 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 84861-84893 0 1.0
CP029339_1 1.19|84922|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 84922-84954 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 84922-84954 0 1.0
CP029339_1 1.20|84983|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 84983-85015 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 84983-85015 0 1.0
CP029339_1 1.20|84983|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 84983-85015 33 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 106773-106805 0 1.0
CP029339_1 1.21|85044|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 85044-85076 33 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 106712-106744 0 1.0
CP029339_1 1.21|85044|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 85044-85076 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 85044-85076 0 1.0
CP029339_1 1.22|85105|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 85105-85137 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 85105-85137 0 1.0
CP029339_1 1.22|85105|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 85105-85137 33 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 106651-106683 0 1.0
CP029339_1 1.23|85166|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 85166-85198 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 85166-85198 0 1.0
CP029339_1 1.23|85166|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 85166-85198 33 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 106590-106622 0 1.0
CP029339_1 1.24|85227|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 85227-85259 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 85227-85259 0 1.0
CP029339_1 1.25|85288|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 85288-85320 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 85288-85320 0 1.0
CP029339_1 1.26|83952|37|CP029339|PILER-CR 83952-83988 37 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 107678-107714 0 1.0
CP029339_1 1.26|83952|37|CP029339|PILER-CR 83952-83988 37 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 83952-83988 0 1.0
CP029339_1 1.27|84013|37|CP029339|PILER-CR 84013-84049 37 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 84013-84049 0 1.0
CP029339_1 1.27|84013|37|CP029339|PILER-CR 84013-84049 37 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 107617-107653 0 1.0
CP029339_1 1.28|84074|37|CP029339|PILER-CR 84074-84110 37 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 84074-84110 0 1.0
CP029339_1 1.28|84074|37|CP029339|PILER-CR 84074-84110 37 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 107556-107592 0 1.0
CP029339_1 1.29|84135|37|CP029339|PILER-CR 84135-84171 37 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 84135-84171 0 1.0
CP029339_1 1.29|84135|37|CP029339|PILER-CR 84135-84171 37 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 107495-107531 0 1.0
CP029339_1 1.30|84196|37|CP029339|PILER-CR 84196-84232 37 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 84196-84232 0 1.0
CP029339_1 1.30|84196|37|CP029339|PILER-CR 84196-84232 37 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 107434-107470 0 1.0
CP029339_1 1.31|84257|37|CP029339|PILER-CR 84257-84293 37 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 84257-84293 0 1.0
CP029339_1 1.31|84257|37|CP029339|PILER-CR 84257-84293 37 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 107373-107409 0 1.0
CP029339_1 1.32|84318|37|CP029339|PILER-CR 84318-84354 37 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 107312-107348 0 1.0
CP029339_1 1.32|84318|37|CP029339|PILER-CR 84318-84354 37 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 84318-84354 0 1.0
CP029339_2 2.1|86693|33|CP029339|CRT 86693-86725 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 86693-86725 0 1.0
CP029339_2 2.1|86693|33|CP029339|CRT 86693-86725 33 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 105008-105040 0 1.0
CP029339_2 2.2|86754|33|CP029339|CRT,CRISPRCasFinder 86754-86786 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 86754-86786 0 1.0
CP029339_2 2.2|86754|33|CP029339|CRT,CRISPRCasFinder 86754-86786 33 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 104947-104979 0 1.0
CP029339_2 2.3|86815|33|CP029339|CRT,CRISPRCasFinder 86815-86847 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 86815-86847 0 1.0
CP029339_2 2.3|86815|33|CP029339|CRT,CRISPRCasFinder 86815-86847 33 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 104886-104918 0 1.0
CP029339_2 2.4|86876|33|CP029339|CRT,CRISPRCasFinder 86876-86908 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 86876-86908 0 1.0
CP029339_2 2.4|86876|33|CP029339|CRT,CRISPRCasFinder 86876-86908 33 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 104825-104857 0 1.0
CP029339_3 3.1|87516|41|CP029339|CRT 87516-87556 41 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 67649-67689 0 1.0
CP029339_3 3.1|87516|41|CP029339|CRT 87516-87556 41 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 87516-87556 0 1.0
CP029339_3 3.1|87516|41|CP029339|CRT 87516-87556 41 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 104177-104217 0 1.0
CP029339_3 3.2|87577|41|CP029339|CRT 87577-87617 41 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 104116-104156 0 1.0
CP029339_3 3.2|87577|41|CP029339|CRT 87577-87617 41 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 67710-67750 0 1.0
CP029339_3 3.2|87577|41|CP029339|CRT 87577-87617 41 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 87577-87617 0 1.0
CP029339_3 3.3|87638|41|CP029339|CRT 87638-87678 41 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 103933-103973 0 1.0
CP029339_3 3.3|87638|41|CP029339|CRT 87638-87678 41 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 87638-87678 0 1.0
CP029339_3 3.4|87577|33|CP029339|CRISPRCasFinder 87577-87609 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 67710-67742 0 1.0
CP029339_3 3.4|87577|33|CP029339|CRISPRCasFinder 87577-87609 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 87577-87609 0 1.0
CP029339_3 3.4|87577|33|CP029339|CRISPRCasFinder 87577-87609 33 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 104124-104156 0 1.0
CP029339_3 3.5|87638|33|CP029339|CRISPRCasFinder 87638-87670 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 87638-87670 0 1.0
CP029339_3 3.5|87638|33|CP029339|CRISPRCasFinder 87638-87670 33 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 103941-103973 0 1.0
CP029339_4 4.1|88874|33|CP029339|CRISPRCasFinder,CRT 88874-88906 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 88874-88906 0 1.0
CP029339_4 4.1|88874|33|CP029339|CRISPRCasFinder,CRT 88874-88906 33 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 102705-102737 0 1.0
CP029339_4 4.2|88935|33|CP029339|CRISPRCasFinder,CRT 88935-88967 33 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 102644-102676 0 1.0
CP029339_4 4.2|88935|33|CP029339|CRISPRCasFinder,CRT 88935-88967 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 88935-88967 0 1.0
CP029339_4 4.3|88996|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 88996-89028 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 88996-89028 0 1.0
CP029339_4 4.4|89057|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 89057-89089 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 89057-89089 0 1.0
CP029339_4 4.5|89118|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 89118-89150 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 89118-89150 0 1.0
CP029339_4 4.6|89179|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 89179-89211 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 89179-89211 0 1.0
CP029339_4 4.7|89240|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 89240-89272 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 89240-89272 0 1.0
CP029339_4 4.8|89301|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 89301-89333 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 89301-89333 0 1.0
CP029339_4 4.9|89362|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 89362-89394 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 89362-89394 0 1.0
CP029339_4 4.10|89423|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 89423-89455 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 89423-89455 0 1.0
CP029339_4 4.11|89484|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 89484-89516 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 89484-89516 0 1.0
CP029339_4 4.12|89545|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 89545-89577 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 89545-89577 0 1.0
CP029339_4 4.13|89606|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 89606-89638 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 89606-89638 0 1.0
CP029339_4 4.14|89667|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 89667-89699 33 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 100727-100759 0 1.0
CP029339_4 4.14|89667|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 89667-89699 33 NC_019307 Streptomyces sp. W75 plasmid pCQ4, complete sequence 30757-30789 0 1.0
CP029339_4 4.14|89667|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 89667-89699 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 89667-89699 0 1.0
CP029339_4 4.15|89728|33|CP029339|CRISPRCasFinder,CRT 89728-89760 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 89728-89760 0 1.0
CP029339_4 4.16|89789|33|CP029339|CRISPRCasFinder,CRT 89789-89821 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 89789-89821 0 1.0
CP029339_4 4.17|89850|33|CP029339|CRISPRCasFinder,CRT 89850-89882 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 89850-89882 0 1.0
CP029339_4 4.17|89850|33|CP029339|CRISPRCasFinder,CRT 89850-89882 33 NC_019307 Streptomyces sp. W75 plasmid pCQ4, complete sequence 37215-37247 0 1.0
CP029339_4 4.18|89911|33|CP029339|CRISPRCasFinder,CRT 89911-89943 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 89911-89943 0 1.0
CP029339_4 4.19|89972|33|CP029339|CRISPRCasFinder,CRT 89972-90004 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 89972-90004 0 1.0
CP029339_4 4.21|89789|32|CP029339|PILER-CR 89789-89820 32 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 89789-89820 0 1.0
CP029339_4 4.22|89850|32|CP029339|PILER-CR 89850-89881 32 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 89850-89881 0 1.0
CP029339_4 4.22|89850|32|CP029339|PILER-CR 89850-89881 32 NC_019307 Streptomyces sp. W75 plasmid pCQ4, complete sequence 37216-37247 0 1.0
CP029339_4 4.23|89911|32|CP029339|PILER-CR 89911-89942 32 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 89911-89942 0 1.0
CP029339_4 4.24|89972|32|CP029339|PILER-CR 89972-90003 32 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 89972-90003 0 1.0
CP029339_5 5.1|90308|33|CP029339|CRISPRCasFinder 90308-90340 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 90308-90340 0 1.0
CP029339_5 5.2|90369|33|CP029339|CRISPRCasFinder 90369-90401 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 69941-69973 0 1.0
CP029339_5 5.2|90369|33|CP029339|CRISPRCasFinder 90369-90401 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 90369-90401 0 1.0
CP029339_6 6.1|93224|57|CP029339|CRISPRCasFinder,CRT 93224-93280 57 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 93224-93280 0 1.0
CP029339_6 6.2|93309|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 93309-93341 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 93309-93341 0 1.0
CP029339_6 6.3|93370|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 93370-93402 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 93370-93402 0 1.0
CP029339_6 6.4|93431|34|CP029339|CRISPRCasFinder,CRT,PILER-CR 93431-93464 34 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 93431-93464 0 1.0
CP029339_6 6.4|93431|34|CP029339|CRISPRCasFinder,CRT,PILER-CR 93431-93464 34 NZ_CP029340 Streptomyces sp. SM17 plasmid pSM17B, complete sequence 8574-8607 0 1.0
CP029339_6 6.4|93431|34|CP029339|CRISPRCasFinder,CRT,PILER-CR 93431-93464 34 NZ_CP029340 Streptomyces sp. SM17 plasmid pSM17B, complete sequence 23268-23301 0 1.0
CP029339_6 6.4|93431|34|CP029339|CRISPRCasFinder,CRT,PILER-CR 93431-93464 34 NC_013667 Streptomyces sp. Y27 plasmid pWTY27, complete sequence 9215-9248 0 1.0
CP029339_6 6.5|93493|32|CP029339|CRISPRCasFinder,CRT,PILER-CR 93493-93524 32 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 93493-93524 0 1.0
CP029339_6 6.5|93493|32|CP029339|CRISPRCasFinder,CRT,PILER-CR 93493-93524 32 NC_013449 Streptomyces sp. W9 plasmid pCQ3, complete sequence 50554-50585 0 1.0
CP029339_6 6.6|93553|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 93553-93585 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 93553-93585 0 1.0
CP029339_7 7.1|97970|28|CP029339|CRT 97970-97997 28 NC_010311 Streptomyces sp. HK1 plasmid pSHK1, complete sequence 84640-84667 0 1.0
CP029339_7 7.1|97970|28|CP029339|CRT 97970-97997 28 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 79877-79904 0 1.0
CP029339_7 7.1|97970|28|CP029339|CRT 97970-97997 28 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 97970-97997 0 1.0
CP029339_7 7.2|98026|33|CP029339|CRT 98026-98058 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 79933-79965 0 1.0
CP029339_7 7.2|98026|33|CP029339|CRT 98026-98058 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 98026-98058 0 1.0
CP029339_7 7.3|98087|32|CP029339|CRT,CRISPRCasFinder 98087-98118 32 NC_010311 Streptomyces sp. HK1 plasmid pSHK1, complete sequence 84519-84550 0 1.0
CP029339_7 7.3|98087|32|CP029339|CRT,CRISPRCasFinder 98087-98118 32 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 79994-80025 0 1.0
CP029339_7 7.3|98087|32|CP029339|CRT,CRISPRCasFinder 98087-98118 32 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 98087-98118 0 1.0
CP029339_7 7.4|98147|34|CP029339|CRT,CRISPRCasFinder 98147-98180 34 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 98147-98180 0 1.0
CP029339_7 7.5|98209|33|CP029339|CRT,CRISPRCasFinder 98209-98241 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 98209-98241 0 1.0
CP029339_7 7.6|98270|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98270-98302 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 98270-98302 0 1.0
CP029339_7 7.7|98331|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98331-98363 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 98331-98363 0 1.0
CP029339_7 7.8|98392|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98392-98424 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 98392-98424 0 1.0
CP029339_7 7.9|98453|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98453-98485 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 98453-98485 0 1.0
CP029339_7 7.10|98514|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98514-98546 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 98514-98546 0 1.0
CP029339_7 7.11|98575|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98575-98607 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 98575-98607 0 1.0
CP029339_7 7.12|98636|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98636-98668 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 98636-98668 0 1.0
CP029339_7 7.13|98697|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98697-98729 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 98697-98729 0 1.0
CP029339_7 7.14|98758|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98758-98790 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 98758-98790 0 1.0
CP029339_7 7.15|98819|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98819-98851 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 98819-98851 0 1.0
CP029339_7 7.16|98880|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98880-98912 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 98880-98912 0 1.0
CP029339_7 7.17|98941|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98941-98973 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 98941-98973 0 1.0
CP029339_7 7.18|99002|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 99002-99034 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 99002-99034 0 1.0
CP029339_7 7.19|99063|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 99063-99095 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 99063-99095 0 1.0
CP029339_7 7.20|99124|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 99124-99156 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 99124-99156 0 1.0
CP029339_7 7.21|99185|33|CP029339|CRT,CRISPRCasFinder 99185-99217 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 99185-99217 0 1.0
CP029339_7 7.22|99246|33|CP029339|CRT,CRISPRCasFinder 99246-99278 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 99246-99278 0 1.0
CP029339_7 7.23|99307|33|CP029339|CRT,CRISPRCasFinder 99307-99339 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 99307-99339 0 1.0
CP029339_8 8.1|109714|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 109714-109746 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 109714-109746 0 1.0
CP029339_8 8.2|109775|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 109775-109807 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 109775-109807 0 1.0
CP029339_8 8.3|109836|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 109836-109868 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 109836-109868 0 1.0
CP029339_8 8.4|109897|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 109897-109929 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 109897-109929 0 1.0
CP029339_8 8.5|109958|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 109958-109990 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 109958-109990 0 1.0
CP029339_8 8.6|110019|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110019-110051 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 110019-110051 0 1.0
CP029339_8 8.6|110019|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110019-110051 33 NC_019307 Streptomyces sp. W75 plasmid pCQ4, complete sequence 35437-35469 0 1.0
CP029339_8 8.7|110080|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110080-110112 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 110080-110112 0 1.0
CP029339_8 8.8|110141|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110141-110173 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 110141-110173 0 1.0
CP029339_8 8.9|110202|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110202-110234 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 81578-81610 0 1.0
CP029339_8 8.9|110202|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110202-110234 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 110202-110234 0 1.0
CP029339_8 8.10|110263|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110263-110295 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 110263-110295 0 1.0
CP029339_8 8.11|110324|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110324-110356 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 110324-110356 0 1.0
CP029339_8 8.12|110385|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110385-110417 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 110385-110417 0 1.0
CP029339_8 8.13|110446|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110446-110478 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 110446-110478 0 1.0
CP029339_8 8.14|110507|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110507-110539 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 110507-110539 0 1.0
CP029339_8 8.15|110568|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110568-110600 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 110568-110600 0 1.0
CP029339_8 8.16|110629|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110629-110661 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 110629-110661 0 1.0
CP029339_8 8.17|110690|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110690-110722 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 110690-110722 0 1.0
CP029339_8 8.18|110751|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110751-110783 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 110751-110783 0 1.0
CP029339_8 8.19|110812|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110812-110844 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 110812-110844 0 1.0
CP029339_8 8.20|110873|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110873-110905 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 110873-110905 0 1.0
CP029339_8 8.21|110934|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110934-110966 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 110934-110966 0 1.0
CP029339_8 8.22|110995|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110995-111027 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 110995-111027 0 1.0
CP029339_8 8.23|111056|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 111056-111088 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 111056-111088 0 1.0
CP029339_8 8.24|111117|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 111117-111149 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 111117-111149 0 1.0
CP029339_8 8.25|111178|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 111178-111210 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 111178-111210 0 1.0
CP029339_8 8.26|111239|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 111239-111271 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 111239-111271 0 1.0
CP029339_8 8.27|111300|38|CP029339|PILER-CR 111300-111337 38 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 111300-111337 0 1.0
CP029339_8 8.28|111366|33|CP029339|PILER-CR 111366-111398 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 111360-111392 0 1.0
CP029339_8 8.29|111300|32|CP029339|CRISPRCasFinder,CRT 111300-111331 32 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 111300-111331 0 1.0
CP029339_8 8.30|111360|33|CP029339|CRISPRCasFinder,CRT 111360-111392 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 111360-111392 0 1.0
CP029339_1 1.5|84074|33|CP029339|CRISPRCasFinder,CRT 84074-84106 33 NC_010311 Streptomyces sp. HK1 plasmid pSHK1, complete sequence 108681-108713 1 0.97
CP029339_1 1.5|84074|33|CP029339|CRISPRCasFinder,CRT 84074-84106 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 55264-55296 1 0.97
CP029339_1 1.5|84074|33|CP029339|CRISPRCasFinder,CRT 84074-84106 33 ASHF01000034 Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence 146890-146922 1 0.97
CP029339_1 1.9|84318|33|CP029339|CRISPRCasFinder,CRT 84318-84350 33 MK392363 Streptomyces phage Bowden, complete genome 20938-20970 1 0.97
CP029339_1 1.9|84318|33|CP029339|CRISPRCasFinder,CRT 84318-84350 33 MK460245 Streptomyces phage BartholomewSD, complete genome 21006-21038 1 0.97
CP029339_1 1.9|84318|33|CP029339|CRISPRCasFinder,CRT 84318-84350 33 MN234208 Streptomyces phage Alvy, complete genome 21006-21038 1 0.97
CP029339_1 1.24|85227|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 85227-85259 33 ASHF01000034 Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence 51016-51048 1 0.97
CP029339_1 1.27|84013|37|CP029339|PILER-CR 84013-84049 37 NC_010311 Streptomyces sp. HK1 plasmid pSHK1, complete sequence 92974-93010 1 0.973
CP029339_4 4.1|88874|33|CP029339|CRISPRCasFinder,CRT 88874-88906 33 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 102399-102431 1 0.97
CP029339_4 4.12|89545|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 89545-89577 33 NC_013449 Streptomyces sp. W9 plasmid pCQ3, complete sequence 78098-78130 1 0.97
CP029339_4 4.15|89728|33|CP029339|CRISPRCasFinder,CRT 89728-89760 33 NC_013449 Streptomyces sp. W9 plasmid pCQ3, complete sequence 53665-53697 1 0.97
CP029339_5 5.1|90308|33|CP029339|CRISPRCasFinder 90308-90340 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 69880-69912 1 0.97
CP029339_6 6.1|93224|57|CP029339|CRISPRCasFinder,CRT 93224-93280 57 NC_010311 Streptomyces sp. HK1 plasmid pSHK1, complete sequence 75013-75069 1 0.982
CP029339_6 6.1|93224|57|CP029339|CRISPRCasFinder,CRT 93224-93280 57 NC_010311 Streptomyces sp. HK1 plasmid pSHK1, complete sequence 88666-88722 1 0.982
CP029339_7 7.1|97970|28|CP029339|CRT 97970-97997 28 ASHF01000034 Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence 125797-125824 1 0.964
CP029339_7 7.2|98026|33|CP029339|CRT 98026-98058 33 NC_010311 Streptomyces sp. HK1 plasmid pSHK1, complete sequence 84579-84611 1 0.97
CP029339_7 7.2|98026|33|CP029339|CRT 98026-98058 33 ASHF01000034 Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence 125736-125768 1 0.97
CP029339_7 7.5|98209|33|CP029339|CRT,CRISPRCasFinder 98209-98241 33 ASHF01000034 Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence 173421-173453 1 0.97
CP029339_8 8.6|110019|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110019-110051 33 GQ919031 Streptomyces phage ZL12, complete genome 51765-51797 1 0.97
CP029339_8 8.10|110263|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110263-110295 33 NC_019307 Streptomyces sp. W75 plasmid pCQ4, complete sequence 52661-52693 1 0.97
CP029339_1 1.9|84318|33|CP029339|CRISPRCasFinder,CRT 84318-84350 33 MH669016 Streptomyces phage TrvxScott, complete genome 20919-20951 2 0.939
CP029339_1 1.9|84318|33|CP029339|CRISPRCasFinder,CRT 84318-84350 33 MK392365 Streptomyces phage TinaBelcher, complete genome 20889-20921 2 0.939
CP029339_1 1.9|84318|33|CP029339|CRISPRCasFinder,CRT 84318-84350 33 MH651190 Streptomyces phage Thestral, complete genome 20941-20973 2 0.939
CP029339_1 1.9|84318|33|CP029339|CRISPRCasFinder,CRT 84318-84350 33 MK392366 Streptomyces phage Janus, complete genome 21042-21074 2 0.939
CP029339_1 1.14|84617|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 84617-84649 33 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 67893-67925 2 0.939
CP029339_4 4.12|89545|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 89545-89577 33 NC_019307 Streptomyces sp. W75 plasmid pCQ4, complete sequence 1309-1341 2 0.939
CP029339_4 4.13|89606|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 89606-89638 33 NC_019307 Streptomyces sp. W75 plasmid pCQ4, complete sequence 76126-76158 2 0.939
CP029339_6 6.2|93309|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 93309-93341 33 NC_019307 Streptomyces sp. W75 plasmid pCQ4, complete sequence 36017-36049 2 0.939
CP029339_8 8.6|110019|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110019-110051 33 NC_013449 Streptomyces sp. W9 plasmid pCQ3, complete sequence 31590-31622 2 0.939
CP029339_8 8.10|110263|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110263-110295 33 NC_013449 Streptomyces sp. W9 plasmid pCQ3, complete sequence 47948-47980 2 0.939
CP029339_1 1.9|84318|33|CP029339|CRISPRCasFinder,CRT 84318-84350 33 NC_018836 Streptomyces phage phiHau3, complete genome 20583-20615 3 0.909
CP029339_1 1.9|84318|33|CP029339|CRISPRCasFinder,CRT 84318-84350 33 MT310862 Streptomyces phage Itza, complete genome 21095-21127 3 0.909
CP029339_1 1.9|84318|33|CP029339|CRISPRCasFinder,CRT 84318-84350 33 MF766044 Streptomyces phage Amethyst, complete genome 20834-20866 3 0.909
CP029339_1 1.9|84318|33|CP029339|CRISPRCasFinder,CRT 84318-84350 33 MN234192 Streptomyces phage Animus, complete genome 21042-21074 3 0.909
CP029339_1 1.9|84318|33|CP029339|CRISPRCasFinder,CRT 84318-84350 33 MN062705 Streptomyces phage Celia, complete genome 21181-21213 3 0.909
CP029339_1 1.9|84318|33|CP029339|CRISPRCasFinder,CRT 84318-84350 33 MN234189 Streptomyces phage Urza, complete genome 21116-21148 3 0.909
CP029339_1 1.9|84318|33|CP029339|CRISPRCasFinder,CRT 84318-84350 33 MH669004 Streptomyces phage Hank144, complete genome 21147-21179 3 0.909
CP029339_1 1.9|84318|33|CP029339|CRISPRCasFinder,CRT 84318-84350 33 NC_041856 Streptomyces phage phiCAM, complete genome 23911-23943 3 0.909
CP029339_1 1.9|84318|33|CP029339|CRISPRCasFinder,CRT 84318-84350 33 MF766047 Streptomyces phage SqueakyClean, complete genome 20968-21000 3 0.909
CP029339_1 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR 84562-84588 27 NZ_CP009804 Streptomyces sp. FR-008 plasmid pSSFR2, complete sequence 3627-3653 3 0.889
CP029339_1 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR 84562-84588 27 NZ_CP029341 Streptomyces sp. SM17 plasmid pSM17C, complete sequence 18503-18529 3 0.889
CP029339_1 1.20|84983|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 84983-85015 33 NZ_CP009804 Streptomyces sp. FR-008 plasmid pSSFR2, complete sequence 6359-6391 3 0.909
CP029339_4 4.15|89728|33|CP029339|CRISPRCasFinder,CRT 89728-89760 33 NC_019307 Streptomyces sp. W75 plasmid pCQ4, complete sequence 58664-58696 3 0.909
CP029339_8 8.24|111117|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 111117-111149 33 NZ_CP022546 Streptomyces sp. 11-1-2 plasmid unnamed1, complete sequence 30617-30649 3 0.909
CP029339_8 8.24|111117|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 111117-111149 33 NC_006911 Streptomyces sp. F11 plasmid pFP11, complete sequence 24824-24856 3 0.909
CP029339_8 8.24|111117|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 111117-111149 33 NZ_CP020702 Streptomyces tsukubensis strain NRRL 18488 plasmid pSTS2, complete sequence 27894-27926 3 0.909
CP029339_1 1.5|84074|33|CP029339|CRISPRCasFinder,CRT 84074-84106 33 LN997844 Streptomyces reticuli genome assembly TUE45, plasmid : III 54730-54762 4 0.879
CP029339_1 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR 84562-84588 27 NZ_CP024423 Paracoccus yeei strain TT13 plasmid pTT13-1, complete sequence 140146-140172 4 0.852
CP029339_1 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR 84562-84588 27 NZ_CP011665 Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence 307134-307160 4 0.852
CP029339_1 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR 84562-84588 27 NZ_CP033582 Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence 372493-372519 4 0.852
CP029339_1 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR 84562-84588 27 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1516270-1516296 4 0.852
CP029339_6 6.2|93309|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 93309-93341 33 MT889368 Gordonia phage Sam12, complete genome 62724-62756 4 0.879
CP029339_6 6.2|93309|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 93309-93341 33 MK433265 Gordonia phage Exiguo, complete genome 62724-62756 4 0.879
CP029339_6 6.2|93309|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 93309-93341 33 MG770211 Gordonia phage Flakey, complete genome 64199-64231 4 0.879
CP029339_6 6.2|93309|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 93309-93341 33 NC_031229 Gordonia phage Hotorobo, complete genome 64176-64208 4 0.879
CP029339_7 7.10|98514|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98514-98546 33 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 81184-81216 4 0.879
CP029339_8 8.1|109714|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 109714-109746 33 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 131170-131202 4 0.879
CP029339_8 8.1|109714|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 109714-109746 33 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 594686-594718 4 0.879
CP029339_8 8.1|109714|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 109714-109746 33 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 59974-60006 4 0.879
CP029339_1 1.5|84074|33|CP029339|CRISPRCasFinder,CRT 84074-84106 33 NC_004934 Streptomyces violaceoruber strain SANK95570 plasmid pSV2, complete sequence 56607-56639 5 0.848
CP029339_1 1.5|84074|33|CP029339|CRISPRCasFinder,CRT 84074-84106 33 NZ_CP026654 Streptomyces dengpaensis strain XZHG99 plasmid unnamed2, complete sequence 54320-54352 5 0.848
CP029339_1 1.9|84318|33|CP029339|CRISPRCasFinder,CRT 84318-84350 33 MH248947 Streptomyces phage Yosif, complete genome 22137-22169 5 0.848
CP029339_1 1.9|84318|33|CP029339|CRISPRCasFinder,CRT 84318-84350 33 MK524524 Streptomyces phage Caelum, complete genome 20911-20943 5 0.848
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 117769-117801 5 0.848
CP029339_1 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR 84562-84588 27 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 618345-618371 5 0.815
CP029339_1 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR 84562-84588 27 NZ_CP023549 Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence 377442-377468 5 0.815
CP029339_1 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR 84562-84588 27 NZ_CP022541 Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence 127206-127232 5 0.815
CP029339_1 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR 84562-84588 27 NZ_CP029986 Sphingomonas sp. FARSPH plasmid p01, complete sequence 63108-63134 5 0.815
CP029339_1 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR 84562-84588 27 NC_008826 Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence 399781-399807 5 0.815
CP029339_1 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR 84562-84588 27 NC_008826 Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence 431851-431877 5 0.815
CP029339_1 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR 84562-84588 27 NZ_CP026518 Deinococcus sp. NW-56 plasmid unnamed2, complete sequence 267245-267271 5 0.815
CP029339_1 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR 84562-84588 27 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 1234536-1234562 5 0.815
CP029339_1 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR 84562-84588 27 MK416018 Klebsiella phage ST147-VIM1phi7.1, complete genome 5492-5518 5 0.815
CP029339_1 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR 84562-84588 27 KX752698 Mycobacterium phage Tonenili, complete genome 16643-16669 5 0.815
CP029339_1 1.28|84074|37|CP029339|PILER-CR 84074-84110 37 NC_010311 Streptomyces sp. HK1 plasmid pSHK1, complete sequence 108677-108713 5 0.865
CP029339_1 1.28|84074|37|CP029339|PILER-CR 84074-84110 37 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 55264-55300 5 0.865
CP029339_1 1.28|84074|37|CP029339|PILER-CR 84074-84110 37 ASHF01000034 Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence 146886-146922 5 0.865
CP029339_1 1.32|84318|37|CP029339|PILER-CR 84318-84354 37 MK392363 Streptomyces phage Bowden, complete genome 20938-20974 5 0.865
CP029339_1 1.32|84318|37|CP029339|PILER-CR 84318-84354 37 MK460245 Streptomyces phage BartholomewSD, complete genome 21006-21042 5 0.865
CP029339_1 1.32|84318|37|CP029339|PILER-CR 84318-84354 37 MN234208 Streptomyces phage Alvy, complete genome 21006-21042 5 0.865
CP029339_2 2.3|86815|33|CP029339|CRT,CRISPRCasFinder 86815-86847 33 NZ_CP011665 Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence 520851-520883 5 0.848
CP029339_6 6.2|93309|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 93309-93341 33 MK433261 Gordonia phage Msay19, complete genome 65068-65100 5 0.848
CP029339_6 6.2|93309|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 93309-93341 33 MG757152 Gordonia phage Adgers, complete genome 63384-63416 5 0.848
CP029339_6 6.2|93309|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 93309-93341 33 MG757155 Gordonia phage Boneham, complete genome 64752-64784 5 0.848
CP029339_6 6.2|93309|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 93309-93341 33 NC_048820 Gordonia phage Jellybones, complete genome 64467-64499 5 0.848
CP029339_6 6.2|93309|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 93309-93341 33 MK433263 Gordonia phage FelixAlejandro, complete genome 65273-65305 5 0.848
CP029339_6 6.2|93309|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 93309-93341 33 MK359302 Gordonia phage Sombrero, complete genome 63349-63381 5 0.848
CP029339_6 6.2|93309|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 93309-93341 33 NC_047892 Gordonia phage BirksAndSocks, complete genome 64827-64859 5 0.848
CP029339_6 6.2|93309|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 93309-93341 33 MK433267 Gordonia phage Butterball, complete genome 64757-64789 5 0.848
CP029339_7 7.1|97970|28|CP029339|CRT 97970-97997 28 NC_010311 Streptomyces sp. HK1 plasmid pSHK1, complete sequence 63263-63290 5 0.821
CP029339_7 7.1|97970|28|CP029339|CRT 97970-97997 28 NZ_CP009803 Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence 91675-91702 5 0.821
CP029339_7 7.1|97970|28|CP029339|CRT 97970-97997 28 ASHF01000034 Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence 113692-113719 5 0.821
CP029339_7 7.1|97970|28|CP029339|CRT 97970-97997 28 NZ_CP041653 Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence 5056-5083 5 0.821
CP029339_7 7.1|97970|28|CP029339|CRT 97970-97997 28 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 84115-84142 5 0.821
CP029339_7 7.1|97970|28|CP029339|CRT 97970-97997 28 NZ_CP043960 Streptomyces tendae strain 139 plasmid unnamed1, complete sequence 14763-14790 5 0.821
CP029339_7 7.1|97970|28|CP029339|CRT 97970-97997 28 MN204493 Streptomyces phage Zuko, complete genome 63051-63078 5 0.821
CP029339_7 7.4|98147|34|CP029339|CRT,CRISPRCasFinder 98147-98180 34 NZ_CP029341 Streptomyces sp. SM17 plasmid pSM17C, complete sequence 3571-3604 5 0.853
CP029339_7 7.23|99307|33|CP029339|CRT,CRISPRCasFinder 99307-99339 33 NZ_LR134458 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 16, complete sequence 19075-19107 5 0.848
CP029339_1 1.4|84013|33|CP029339|CRISPRCasFinder,CRT 84013-84045 33 NZ_CP053565 Pseudonocardia sp. Gen01 plasmid unnamed1, complete sequence 57818-57850 6 0.818
CP029339_1 1.5|84074|33|CP029339|CRISPRCasFinder,CRT 84074-84106 33 CP054922 Streptomyces sp. NA03103 plasmid unnamed2, complete sequence 82011-82043 6 0.818
CP029339_1 1.5|84074|33|CP029339|CRISPRCasFinder,CRT 84074-84106 33 NZ_CP010408 Streptomyces vietnamensis strain GIMV4.0001 plasmid pSVL1, complete sequence 215802-215834 6 0.818
CP029339_1 1.5|84074|33|CP029339|CRISPRCasFinder,CRT 84074-84106 33 NZ_CP016084 Streptomyces sp. SAT1 plasmid unnamed4, complete sequence 39286-39318 6 0.818
CP029339_1 1.9|84318|33|CP029339|CRISPRCasFinder,CRT 84318-84350 33 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 448671-448703 6 0.818
CP029339_1 1.9|84318|33|CP029339|CRISPRCasFinder,CRT 84318-84350 33 MT701598 Streptomyces phage Sitrop, complete genome 19455-19487 6 0.818
CP029339_1 1.9|84318|33|CP029339|CRISPRCasFinder,CRT 84318-84350 33 JQ807246 Environmental Halophage eHP-27, partial genome 4249-4281 6 0.818
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1288239-1288271 6 0.818
CP029339_1 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR 84562-84588 27 NZ_CP019603 Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence 79726-79752 6 0.778
CP029339_1 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR 84562-84588 27 NZ_CP043499 Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence 1012534-1012560 6 0.778
CP029339_1 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR 84562-84588 27 NZ_CP053709 Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed1, complete sequence 328682-328708 6 0.778
CP029339_1 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR 84562-84588 27 NZ_CP014797 Salipiger profundus strain JLT2016 plasmid pTPRO1, complete sequence 216649-216675 6 0.778
CP029339_1 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR 84562-84588 27 NZ_CP045548 Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence 59799-59825 6 0.778
CP029339_1 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR 84562-84588 27 MT210154 Xanthomonas phage PPDBI, complete genome 36860-36886 6 0.778
CP029339_1 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR 84562-84588 27 MN582093 Podoviridae sp. ctviO18, complete genome 23296-23322 6 0.778
CP029339_1 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR 84562-84588 27 MT119766 Xanthomonas phage PBR31, complete genome 36860-36886 6 0.778
CP029339_1 1.32|84318|37|CP029339|PILER-CR 84318-84354 37 MH669016 Streptomyces phage TrvxScott, complete genome 20919-20955 6 0.838
CP029339_1 1.32|84318|37|CP029339|PILER-CR 84318-84354 37 MK392365 Streptomyces phage TinaBelcher, complete genome 20889-20925 6 0.838
CP029339_1 1.32|84318|37|CP029339|PILER-CR 84318-84354 37 MH651190 Streptomyces phage Thestral, complete genome 20941-20977 6 0.838
CP029339_1 1.32|84318|37|CP029339|PILER-CR 84318-84354 37 MK392366 Streptomyces phage Janus, complete genome 21042-21078 6 0.838
CP029339_2 2.4|86876|33|CP029339|CRT,CRISPRCasFinder 86876-86908 33 NZ_CP021083 Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence 270089-270121 6 0.818
CP029339_3 3.4|87577|33|CP029339|CRISPRCasFinder 87577-87609 33 NZ_LT703506 Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 2 90198-90230 6 0.818
CP029339_6 6.2|93309|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 93309-93341 33 NZ_CP015882 Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence 58608-58640 6 0.818
CP029339_7 7.1|97970|28|CP029339|CRT 97970-97997 28 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5309685-5309712 6 0.786
CP029339_7 7.1|97970|28|CP029339|CRT 97970-97997 28 NZ_CP011665 Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence 11450-11477 6 0.786
CP029339_7 7.1|97970|28|CP029339|CRT 97970-97997 28 NZ_CP014169 Sphingomonas panacis strain DCY99 plasmid unnamed, complete sequence 92017-92044 6 0.786
CP029339_7 7.1|97970|28|CP029339|CRT 97970-97997 28 NC_015727 Cupriavidus necator N-1 plasmid pBB1, complete sequence 1457668-1457695 6 0.786
CP029339_7 7.1|97970|28|CP029339|CRT 97970-97997 28 NZ_CP020698 Sulfitobacter sp. D7 plasmid p4SUD7, complete sequence 73716-73743 6 0.786
CP029339_7 7.1|97970|28|CP029339|CRT 97970-97997 28 NZ_HG938354 Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence 298904-298931 6 0.786
CP029339_7 7.1|97970|28|CP029339|CRT 97970-97997 28 NZ_CP020447 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed7, complete sequence 56213-56240 6 0.786
CP029339_7 7.1|97970|28|CP029339|CRT 97970-97997 28 NZ_CP025547 Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence 141806-141833 6 0.786
CP029339_7 7.1|97970|28|CP029339|CRT 97970-97997 28 MH371110 Mycobacterium phage Magnar, complete genome 47713-47740 6 0.786
CP029339_7 7.1|97970|28|CP029339|CRT 97970-97997 28 MK061415 Mycobacterium phage Rhynn, complete genome 48697-48724 6 0.786
CP029339_7 7.1|97970|28|CP029339|CRT 97970-97997 28 KP027205 Mycobacterium phage Alvin, complete genome 47382-47409 6 0.786
CP029339_7 7.3|98087|32|CP029339|CRT,CRISPRCasFinder 98087-98118 32 AF447491 Bacteriophage phiE125, complete genome 16243-16274 6 0.812
CP029339_7 7.3|98087|32|CP029339|CRT,CRISPRCasFinder 98087-98118 32 NC_003309 Burkholderia phage phiE125, complete genome 16243-16274 6 0.812
CP029339_7 7.4|98147|34|CP029339|CRT,CRISPRCasFinder 98147-98180 34 NZ_CP009804 Streptomyces sp. FR-008 plasmid pSSFR2, complete sequence 18847-18880 6 0.824
CP029339_7 7.15|98819|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98819-98851 33 NZ_CP011523 Streptomyces sp. CFMR 7 strain CFMR-7 plasmid unnamed, complete sequence 35025-35057 6 0.818
CP029339_7 7.17|98941|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98941-98973 33 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 99236-99268 6 0.818
CP029339_7 7.23|99307|33|CP029339|CRT,CRISPRCasFinder 99307-99339 33 NZ_LR134459 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence 237110-237142 6 0.818
CP029339_8 8.1|109714|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 109714-109746 33 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 706808-706840 6 0.818
CP029339_8 8.13|110446|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110446-110478 33 NZ_LR134458 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 16, complete sequence 12038-12070 6 0.818
CP029339_1 1.1|83832|31|CP029339|CRISPRCasFinder,CRT 83832-83862 31 NZ_CP019203 Salmonella enterica subsp. enterica serovar Infantis strain CFSAN003307 plasmid pCFSAN003307, complete sequence 125170-125200 7 0.774
CP029339_1 1.1|83832|31|CP029339|CRISPRCasFinder,CRT 83832-83862 31 NZ_LN868945 Salmonella enterica subsp. enterica serovar Senftenberg strain NCTC10384 plasmid 3, complete sequence 91628-91658 7 0.774
CP029339_1 1.4|84013|33|CP029339|CRISPRCasFinder,CRT 84013-84045 33 CP040467 Streptomyces albidoflavus strain UYFA156 plasmid unnamed, complete sequence 53192-53224 7 0.788
CP029339_1 1.4|84013|33|CP029339|CRISPRCasFinder,CRT 84013-84045 33 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1380344-1380376 7 0.788
CP029339_1 1.4|84013|33|CP029339|CRISPRCasFinder,CRT 84013-84045 33 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 432723-432755 7 0.788
CP029339_1 1.5|84074|33|CP029339|CRISPRCasFinder,CRT 84074-84106 33 NC_003903 Streptomyces coelicolor A3(2) plasmid SCP1, complete sequence 90263-90295 7 0.788
CP029339_1 1.9|84318|33|CP029339|CRISPRCasFinder,CRT 84318-84350 33 NZ_CP032053 Streptomyces clavuligerus strain F1D-5 plasmid pSCL2, complete sequence 2939-2971 7 0.788
CP029339_1 1.9|84318|33|CP029339|CRISPRCasFinder,CRT 84318-84350 33 NC_008697 Nocardioides sp. JS614 plasmid pNOCA01, complete sequence 248755-248787 7 0.788
CP029339_1 1.9|84318|33|CP029339|CRISPRCasFinder,CRT 84318-84350 33 NZ_CP045549 Streptomyces sp. SYP-A7193 plasmid unnamed2, complete sequence 103687-103719 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 NC_016972 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG2, complete sequence 33312-33344 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 NZ_LR134452 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence 67118-67150 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 KM389460 UNVERIFIED: Pseudomonas phage F_MX560sp/Pa1651 clone contig00001 genomic sequence 25719-25751 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 KM389326 UNVERIFIED: Pseudomonas phage F_KK2074sp/Pa1651 clone contig00001 genomic sequence 26273-26305 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 KM389461 UNVERIFIED: Pseudomonas phage F_TK432sp/Pa1651 clone ctg7180000000005 genomic sequence 25150-25182 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 KM389462 UNVERIFIED: Pseudomonas phage JBD23 clone contig00001 genomic sequence 24989-25021 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 KM389464 UNVERIFIED: Pseudomonas phage JBDs5 clone contig00001 genomic sequence 24467-24499 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 LN907801 unidentified phage genome assembly 2P1, chromosome : 2P1 12071-12103 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 AY394005 Bacteriophage D3112, complete genome 12656-12688 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 LT999987 Pseudomonas phage vB_PaeS_PAO1_HW12 genome assembly, complete genome: monopartite 12222-12254 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 NC_009818 Pseudomonas phage MP22, complete genome 11658-11690 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 JN811560 Pseudomonas phage JBD26, complete genome 12782-12814 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 KM389337 UNVERIFIED: Pseudomonas phage JBD58a clone contig00002 genomic sequence 10465-10497 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 MK511036 Pseudomonas phage BR327, partial genome 12656-12688 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 MH643777 Pseudomonas phage YMC12/01/R960, complete genome 12254-12286 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 MK511031 Pseudomonas phage BR52, partial genome 5858-5890 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 MK511034 Pseudomonas phage BR243, partial genome 12498-12530 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 MK511033 Pseudomonas phage BR205, partial genome 12563-12595 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 NC_027298 Pseudomonas phage LPB1, complate genome 12028-12060 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 JQ762257 Pseudomonas phage MP42, complete genome 12574-12606 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 MK511017 Pseudomonas phage CF23, partial genome 12514-12546 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 JX434033 Pseudomonas phage JBD88a, complete genome 11647-11679 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 KM389242 UNVERIFIED: Pseudomonas phage F_TK1932sp/Pa1651 clone contig00001 genomic sequence 12210-12242 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 KM389278 UNVERIFIED: Pseudomonas phage Phi05_1400 B clone contig00006 genomic sequence 4139-4171 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 MK144667 Pseudomonas phage Spike, complete genome 12563-12595 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 KM389260 UNVERIFIED: Pseudomonas phage F_ET2439sp/Pa1651 clone ctg7180000000618 genomic sequence 2396-2428 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 MH643778 Pseudomonas phage YMC12/01/R24, complete genome 12184-12216 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 MK511018 Pseudomonas phage CF28, partial genome 12688-12720 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 KU199707 Pseudomonas phage JBD16C, partial genome 11624-11656 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 JQ067085 Pseudomonas phage PaMx73, complete genome 11496-11528 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 KT968832 Pseudomonas phage YMC11/11/R1836, complete genome 12283-12315 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 MK511026 Pseudomonas phage CF121, partial genome 12466-12498 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 NC_041851 Pseudomonas phage F_HA0480sp/Pa1651, complete genome 12568-12600 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 KJ477077 Pseudomonas phage JD024, complete genome 11643-11675 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 LT608331 Pseudomonas phage vB_PaeS_PcyII-40_PfII40a isolate PfII40A_reads genome assembly, chromosome: PFII40A 12179-12211 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 NC_026601 Pseudomonas phage vB_PaeS_PAO1_Ab30, complete genome 12661-12693 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 JX434030 Pseudomonas phage JBD5, complete genome 12565-12597 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 NC_030918 Pseudomonas phage JBD93, complete genome 12185-12217 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 NC_005178 Pseudomonas phage D3112, complete genome 12656-12688 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 EU272037 Pseudomonas phage MP38, complete genome 12789-12821 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 KM389459 UNVERIFIED: Pseudomonas phage F_ET309sp/Pa1651 clone contig00001 genomic sequence 12222-12254 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 NC_023700 Pseudomonas phage PA1/KOR/2010, complete genome 9534-9566 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 JX434032 Pseudomonas phage JBD30, complete genome 12613-12645 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 MK511022 Pseudomonas phage CF74, partial genome 15127-15159 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 KM233689 Pseudomonas phage H70, complete genome 12582-12614 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 KU199708 Pseudomonas phage JBD69, complete genome 12596-12628 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 DQ631426 Pseudomonas phage DMS3, complete genome 12169-12201 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 MK511030 Pseudomonas phage CF213, partial genome 12464-12496 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 NC_024782 Pseudomonas phage MP48, complete genome 12147-12179 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 MK511025 Pseudomonas phage CF118, partial genome 12493-12525 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 JX434031 Pseudomonas phage JBD24, complete genome 12506-12538 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 DQ873690 Phage MP22, complete genome 11658-11690 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 MK511023 Pseudomonas phage CF77, partial genome 12464-12496 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 MK511029 Pseudomonas phage CF183, partial genome 13248-13280 7 0.788
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 EU272036 Pseudomonas phage MP29, complete genome 12147-12179 7 0.788
CP029339_1 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR 84562-84588 27 NC_015377 Burkholderia gladioli BSR3 plasmid bgla_2p, complete sequence 87599-87625 7 0.741
CP029339_1 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR 84562-84588 27 NZ_CP014600 Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence 131095-131121 7 0.741
CP029339_1 1.17|84800|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 84800-84832 33 NZ_CP017942 Phyllobacterium zundukense strain Tri-48 plasmid unnamed3, complete sequence 387685-387717 7 0.788
CP029339_1 1.24|85227|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 85227-85259 33 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 946947-946979 7 0.788
CP029339_1 1.32|84318|37|CP029339|PILER-CR 84318-84354 37 NC_018836 Streptomyces phage phiHau3, complete genome 20583-20619 7 0.811
CP029339_1 1.32|84318|37|CP029339|PILER-CR 84318-84354 37 MT310862 Streptomyces phage Itza, complete genome 21095-21131 7 0.811
CP029339_1 1.32|84318|37|CP029339|PILER-CR 84318-84354 37 MF766044 Streptomyces phage Amethyst, complete genome 20834-20870 7 0.811
CP029339_1 1.32|84318|37|CP029339|PILER-CR 84318-84354 37 MN234192 Streptomyces phage Animus, complete genome 21042-21078 7 0.811
CP029339_1 1.32|84318|37|CP029339|PILER-CR 84318-84354 37 MN062705 Streptomyces phage Celia, complete genome 21181-21217 7 0.811
CP029339_1 1.32|84318|37|CP029339|PILER-CR 84318-84354 37 MN234189 Streptomyces phage Urza, complete genome 21116-21152 7 0.811
CP029339_1 1.32|84318|37|CP029339|PILER-CR 84318-84354 37 MH669004 Streptomyces phage Hank144, complete genome 21147-21183 7 0.811
CP029339_1 1.32|84318|37|CP029339|PILER-CR 84318-84354 37 NC_041856 Streptomyces phage phiCAM, complete genome 23911-23947 7 0.811
CP029339_1 1.32|84318|37|CP029339|PILER-CR 84318-84354 37 MF766047 Streptomyces phage SqueakyClean, complete genome 20968-21004 7 0.811
CP029339_1 1.32|84318|37|CP029339|PILER-CR 84318-84354 37 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 448671-448707 7 0.811
CP029339_2 2.2|86754|33|CP029339|CRT,CRISPRCasFinder 86754-86786 33 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 294347-294379 7 0.788
CP029339_2 2.2|86754|33|CP029339|CRT,CRISPRCasFinder 86754-86786 33 NZ_CP020399 Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence 280164-280196 7 0.788
CP029339_2 2.2|86754|33|CP029339|CRT,CRISPRCasFinder 86754-86786 33 CP040467 Streptomyces albidoflavus strain UYFA156 plasmid unnamed, complete sequence 277025-277057 7 0.788
CP029339_2 2.4|86876|33|CP029339|CRT,CRISPRCasFinder 86876-86908 33 NZ_CP028567 Aeromonas hydrophila subsp. hydrophila strain WCHAH045096 plasmid pMCR5_045096, complete sequence 169126-169158 7 0.788
CP029339_2 2.4|86876|33|CP029339|CRT,CRISPRCasFinder 86876-86908 33 NC_015727 Cupriavidus necator N-1 plasmid pBB1, complete sequence 1165354-1165386 7 0.788
CP029339_3 3.5|87638|33|CP029339|CRISPRCasFinder 87638-87670 33 DQ372923 Bacteriophage mu1/6, complete genome 18966-18998 7 0.788
CP029339_3 3.5|87638|33|CP029339|CRISPRCasFinder 87638-87670 33 NC_007967 Streptomyces phage mu1/6, complete genome 18966-18998 7 0.788
CP029339_4 4.11|89484|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 89484-89516 33 MT723933 Streptomyces phage Keanu, complete genome 51825-51857 7 0.788
CP029339_4 4.15|89728|33|CP029339|CRISPRCasFinder,CRT 89728-89760 33 NZ_CP047900 Pseudarthrobacter sp. YJ56 plasmid unnamed2, complete sequence 50180-50212 7 0.788
CP029339_4 4.21|89789|32|CP029339|PILER-CR 89789-89820 32 NZ_CP032156 Mycobacterium sp. ELW1 plasmid pELW1-1, complete sequence 81310-81341 7 0.781
CP029339_5 5.1|90308|33|CP029339|CRISPRCasFinder 90308-90340 33 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 745718-745750 7 0.788
CP029339_6 6.5|93493|32|CP029339|CRISPRCasFinder,CRT,PILER-CR 93493-93524 32 NZ_CP023738 Methylosinus trichosporium OB3b plasmid pOB3b1, complete sequence 260374-260405 7 0.781
CP029339_7 7.1|97970|28|CP029339|CRT 97970-97997 28 CP054927 Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence 160173-160200 7 0.75
CP029339_7 7.8|98392|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98392-98424 33 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5712058-5712090 7 0.788
CP029339_7 7.14|98758|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98758-98790 33 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 747752-747784 7 0.788
CP029339_7 7.14|98758|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98758-98790 33 NZ_CP006369 Aureimonas sp. AU20 plasmid pAU20b, complete sequence 371006-371038 7 0.788
CP029339_7 7.16|98880|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98880-98912 33 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 468298-468330 7 0.788
CP029339_7 7.17|98941|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98941-98973 33 MN304818 Phage 71_18, complete genome 5726-5758 7 0.788
CP029339_7 7.22|99246|33|CP029339|CRT,CRISPRCasFinder 99246-99278 33 NZ_CP016822 Rhodococcus sp. p52 plasmid pDF03, complete sequence 33973-34005 7 0.788
CP029339_7 7.23|99307|33|CP029339|CRT,CRISPRCasFinder 99307-99339 33 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 792073-792105 7 0.788
CP029339_8 8.1|109714|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 109714-109746 33 NZ_CP014361 Methylomonas sp. DH-1 plasmid, complete sequence 178460-178492 7 0.788
CP029339_8 8.1|109714|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 109714-109746 33 NZ_CP023670 Methylomonas koyamae strain LM6 plasmid pLM6, complete sequence 151421-151453 7 0.788
CP029339_8 8.1|109714|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 109714-109746 33 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1335982-1336014 7 0.788
CP029339_8 8.5|109958|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 109958-109990 33 NZ_CP054618 Azospirillum oryzae strain KACC 14407 plasmid unnamed4, complete sequence 286396-286428 7 0.788
CP029339_8 8.5|109958|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 109958-109990 33 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 626880-626912 7 0.788
CP029339_8 8.5|109958|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 109958-109990 33 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 692641-692673 7 0.788
CP029339_8 8.5|109958|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 109958-109990 33 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 625995-626027 7 0.788
CP029339_8 8.5|109958|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 109958-109990 33 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 626868-626900 7 0.788
CP029339_8 8.5|109958|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 109958-109990 33 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 626886-626918 7 0.788
CP029339_8 8.5|109958|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 109958-109990 33 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 626865-626897 7 0.788
CP029339_8 8.12|110385|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110385-110417 33 NZ_CP035512 Haematobacter massiliensis strain OT1 plasmid pOT1-2, complete sequence 112083-112115 7 0.788
CP029339_8 8.13|110446|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110446-110478 33 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 624404-624436 7 0.788
CP029339_8 8.13|110446|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110446-110478 33 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 610100-610132 7 0.788
CP029339_8 8.14|110507|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110507-110539 33 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 577136-577168 7 0.788
CP029339_8 8.17|110690|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110690-110722 33 MN234195 Mycobacterium phage Xula, complete genome 12185-12217 7 0.788
CP029339_8 8.17|110690|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110690-110722 33 MN234236 Mycobacterium phage QueenHazel, complete genome 12556-12588 7 0.788
CP029339_8 8.24|111117|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 111117-111149 33 NZ_CP022424 Vitreoscilla filiformis strain ATCC 15551 plasmid pVF1, complete sequence 57693-57725 7 0.788
CP029339_8 8.28|111366|33|CP029339|PILER-CR 111366-111398 33 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 727121-727153 7 0.788
CP029339_8 8.30|111360|33|CP029339|CRISPRCasFinder,CRT 111360-111392 33 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 727121-727153 7 0.788
CP029339_1 1.2|83891|33|CP029339|CRISPRCasFinder,CRT 83891-83923 33 NZ_CP013436 Burkholderia latens strain AU17928 isolate AU17928 plasmid pAU17928, complete sequence 4575-4607 8 0.758
CP029339_1 1.2|83891|33|CP029339|CRISPRCasFinder,CRT 83891-83923 33 NZ_CP013436 Burkholderia latens strain AU17928 isolate AU17928 plasmid pAU17928, complete sequence 43882-43914 8 0.758
CP029339_1 1.8|84257|33|CP029339|CRISPRCasFinder,CRT 84257-84289 33 MH029512 Siphoviridae environmental samples clone NHS-Seq1, complete sequence 33125-33157 8 0.758
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 NZ_CP019182 Salmonella enterica subsp. enterica serovar Inverness str. ATCC 10720 plasmid pATCC10720, complete sequence 73547-73579 8 0.758
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 CP053403 Salmonella enterica strain 2010K-2057 plasmid unnamed1, complete sequence 78337-78369 8 0.758
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 NZ_CP012575 Clavibacter michiganensis subsp. capsici strain PF008 plasmid pCM2, complete sequence 16399-16431 8 0.758
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 CP048046 Clavibacter michiganensis subsp. capsici strain 1207 plasmid pCM2_1207, complete sequence 15955-15987 8 0.758
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 NZ_CP048050 Clavibacter michiganensis subsp. capsici strain 1101 plasmid pCM2_1101, complete sequence 102852-102884 8 0.758
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 NZ_CP029833 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence 350831-350863 8 0.758
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 NZ_CP048048 Clavibacter michiganensis subsp. capsici strain 1106 plasmid pCM2_1106, complete sequence 985-1017 8 0.758
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 NZ_CP054622 Azospirillum oryzae strain KACC 14407 plasmid unnamed7, complete sequence 258357-258389 8 0.758
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 NZ_CP039651 Azospirillum sp. TSA2s plasmid p1 301099-301131 8 0.758
CP029339_1 1.12|84501|33|CP029339|CRISPRCasFinder,CRT 84501-84533 33 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 989338-989370 8 0.758
CP029339_1 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR 84562-84588 27 MT118301 Pseudomonas phage Epa33, complete genome 5592-5618 8 0.704
CP029339_1 1.16|84739|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 84739-84771 33 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 286940-286972 8 0.758
CP029339_1 1.22|85105|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 85105-85137 33 NZ_CP042824 Rhizobium sp. WL3 plasmid unnamed1, complete sequence 53271-53303 8 0.758
CP029339_1 1.27|84013|37|CP029339|PILER-CR 84013-84049 37 NC_015170 Deinococcus proteolyticus MRP plasmid pDEIPR03, complete sequence 71267-71303 8 0.784
CP029339_1 1.28|84074|37|CP029339|PILER-CR 84074-84110 37 LN997844 Streptomyces reticuli genome assembly TUE45, plasmid : III 54730-54766 8 0.784
CP029339_1 1.32|84318|37|CP029339|PILER-CR 84318-84354 37 MH248947 Streptomyces phage Yosif, complete genome 22137-22173 8 0.784
CP029339_1 1.32|84318|37|CP029339|PILER-CR 84318-84354 37 MK524524 Streptomyces phage Caelum, complete genome 20911-20947 8 0.784
CP029339_2 2.4|86876|33|CP029339|CRT,CRISPRCasFinder 86876-86908 33 NZ_CP013855 Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence 228608-228640 8 0.758
CP029339_2 2.4|86876|33|CP029339|CRT,CRISPRCasFinder 86876-86908 33 NZ_CP027299 Streptomyces sp. SGAir0924 plasmid unnamed_5 272568-272600 8 0.758
CP029339_2 2.4|86876|33|CP029339|CRT,CRISPRCasFinder 86876-86908 33 NZ_CP026306 Streptomyces lunaelactis strain MM109 plasmid pSLUN2, complete sequence 1525-1557 8 0.758
CP029339_4 4.12|89545|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 89545-89577 33 NZ_CP006993 Methylobacterium sp. AMS5 plasmid pAMS5a, complete sequence 13748-13780 8 0.758
CP029339_4 4.13|89606|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 89606-89638 33 NZ_CP015372 Pandoraea pnomenusa strain MCB032 plasmid unnamed 1, complete sequence 30909-30941 8 0.758
CP029339_4 4.13|89606|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 89606-89638 33 NZ_CP015372 Pandoraea pnomenusa strain MCB032 plasmid unnamed 1, complete sequence 47240-47272 8 0.758
CP029339_4 4.13|89606|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 89606-89638 33 NZ_CP015372 Pandoraea pnomenusa strain MCB032 plasmid unnamed 1, complete sequence 57791-57823 8 0.758
CP029339_4 4.21|89789|32|CP029339|PILER-CR 89789-89820 32 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 974143-974174 8 0.75
CP029339_4 4.21|89789|32|CP029339|PILER-CR 89789-89820 32 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1790857-1790888 8 0.75
CP029339_4 4.21|89789|32|CP029339|PILER-CR 89789-89820 32 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 143204-143235 8 0.75
CP029339_4 4.24|89972|32|CP029339|PILER-CR 89972-90003 32 NZ_CP007449 Yersinia enterocolitica LC20 plasmid plasmid1_80K, complete sequence 41634-41665 8 0.75
CP029339_4 4.24|89972|32|CP029339|PILER-CR 89972-90003 32 NZ_CP048398 Streptomyces sp. S4.7 plasmid pSSPS4.7a, complete sequence 4214-4245 8 0.75
CP029339_6 6.2|93309|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 93309-93341 33 NZ_CP030264 Ensifer adhaerens strain Corn53 plasmid AB, complete sequence 874899-874931 8 0.758
CP029339_6 6.3|93370|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 93370-93402 33 MN176220 Bacillus phage 019DV002, complete genome 6451-6483 8 0.758
CP029339_6 6.3|93370|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 93370-93402 33 MN176230 Bacillus phage 056SW001B, complete genome 6415-6447 8 0.758
CP029339_6 6.3|93370|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 93370-93402 33 MN176232 Bacillus phage 280BB001, complete genome 6608-6640 8 0.758
CP029339_6 6.3|93370|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 93370-93402 33 MN176221 Bacillus phage 019DV004, complete genome 6451-6483 8 0.758
CP029339_6 6.3|93370|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 93370-93402 33 MN176231 Bacillus phage 276BB001, complete genome 6608-6640 8 0.758
CP029339_6 6.5|93493|32|CP029339|CRISPRCasFinder,CRT,PILER-CR 93493-93524 32 NZ_HG938354 Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence 1423195-1423226 8 0.75
CP029339_6 6.6|93553|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 93553-93585 33 CP042595 Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence 330679-330711 8 0.758
CP029339_7 7.1|97970|28|CP029339|CRT 97970-97997 28 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 582357-582384 8 0.714
CP029339_7 7.3|98087|32|CP029339|CRT,CRISPRCasFinder 98087-98118 32 NZ_CP024424 Paracoccus yeei strain TT13 plasmid pTT13-2, complete sequence 196008-196039 8 0.75
CP029339_7 7.3|98087|32|CP029339|CRT,CRISPRCasFinder 98087-98118 32 NZ_CP020440 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed2, complete sequence 78046-78077 8 0.75
CP029339_7 7.3|98087|32|CP029339|CRT,CRISPRCasFinder 98087-98118 32 NZ_CP044082 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed4, complete sequence 244633-244664 8 0.75
CP029339_7 7.3|98087|32|CP029339|CRT,CRISPRCasFinder 98087-98118 32 NZ_CP031080 Paracoccus yeei strain CCUG 32053 plasmid pYEE2, complete sequence 136260-136291 8 0.75
CP029339_7 7.8|98392|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98392-98424 33 NZ_CP041744 Paraburkholderia megapolitana strain LMG 23650 plasmid unnamed1, complete sequence 99831-99863 8 0.758
CP029339_7 7.10|98514|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98514-98546 33 NC_006462 Thermus thermophilus HB8 plasmid pTT27, complete sequence 80478-80510 8 0.758
CP029339_7 7.10|98514|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98514-98546 33 NC_005838 Thermus thermophilus HB27 plasmid pTT27, complete sequence 41471-41503 8 0.758
CP029339_7 7.10|98514|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98514-98546 33 NZ_AP019802 Thermus thermophilus strain HC11 plasmid pHC11, complete sequence 203452-203484 8 0.758
CP029339_7 7.11|98575|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98575-98607 33 NZ_CP033323 Azospirillum brasilense strain Cd plasmid p5, complete sequence 249511-249543 8 0.758
CP029339_7 7.11|98575|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98575-98607 33 NZ_CP012919 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p5, complete sequence 24968-25000 8 0.758
CP029339_7 7.11|98575|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98575-98607 33 NZ_CP032344 Azospirillum brasilense strain MTCC4038 plasmid p5, complete sequence 9786-9818 8 0.758
CP029339_7 7.11|98575|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98575-98607 33 NZ_CP032344 Azospirillum brasilense strain MTCC4038 plasmid p5, complete sequence 158470-158502 8 0.758
CP029339_7 7.11|98575|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98575-98607 33 NZ_CP033317 Azospirillum brasilense strain Sp 7 plasmid p5, complete sequence 82045-82077 8 0.758
CP029339_7 7.14|98758|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98758-98790 33 NZ_AP014580 Burkholderia sp. RPE67 plasmid p2, complete sequence 156955-156987 8 0.758
CP029339_7 7.14|98758|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98758-98790 33 NZ_CP024986 Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence 22069-22101 8 0.758
CP029339_7 7.14|98758|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98758-98790 33 NZ_CP021651 Acidovorax sp. T1 plasmid p3-T1, complete sequence 29475-29507 8 0.758
CP029339_7 7.14|98758|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98758-98790 33 NZ_CP054616 Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence 277757-277789 8 0.758
CP029339_7 7.14|98758|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98758-98790 33 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 971821-971853 8 0.758
CP029339_7 7.14|98758|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98758-98790 33 NC_024970 Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence 218976-219008 8 0.758
CP029339_7 7.14|98758|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98758-98790 33 NZ_KJ396772 Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence 218976-219008 8 0.758
CP029339_7 7.14|98758|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98758-98790 33 NC_016623 Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence 167528-167560 8 0.758
CP029339_7 7.15|98819|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98819-98851 33 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 538200-538232 8 0.758
CP029339_7 7.15|98819|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98819-98851 33 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1048319-1048351 8 0.758
CP029339_7 7.15|98819|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98819-98851 33 NZ_CP022567 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK03, complete sequence 23509-23541 8 0.758
CP029339_7 7.17|98941|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98941-98973 33 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5114115-5114147 8 0.758
CP029339_7 7.22|99246|33|CP029339|CRT,CRISPRCasFinder 99246-99278 33 NC_014918 Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence 133364-133396 8 0.758
CP029339_7 7.22|99246|33|CP029339|CRT,CRISPRCasFinder 99246-99278 33 NZ_CP021071 Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence 386302-386334 8 0.758
CP029339_7 7.22|99246|33|CP029339|CRT,CRISPRCasFinder 99246-99278 33 NZ_CP015065 Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence 389702-389734 8 0.758
CP029339_7 7.22|99246|33|CP029339|CRT,CRISPRCasFinder 99246-99278 33 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 502622-502654 8 0.758
CP029339_8 8.1|109714|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 109714-109746 33 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 1086350-1086382 8 0.758
CP029339_8 8.3|109836|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 109836-109868 33 NZ_LR134457 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 15, complete sequence 19409-19441 8 0.758
CP029339_8 8.4|109897|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 109897-109929 33 NZ_CP014675 Kozakia baliensis strain DSM 14400 plasmid pKB14400_1, complete sequence 4318-4350 8 0.758
CP029339_8 8.5|109958|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 109958-109990 33 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 731695-731727 8 0.758
CP029339_8 8.5|109958|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 109958-109990 33 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 731759-731791 8 0.758
CP029339_8 8.5|109958|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 109958-109990 33 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 731759-731791 8 0.758
CP029339_8 8.5|109958|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 109958-109990 33 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 731745-731777 8 0.758
CP029339_8 8.6|110019|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110019-110051 33 KY053532 Siphovirus 29632, complete genome 15857-15889 8 0.758
CP029339_8 8.7|110080|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110080-110112 33 NC_012528 Deinococcus deserti VCD115 plasmid 3, complete sequence 30875-30907 8 0.758
CP029339_8 8.13|110446|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110446-110478 33 MG941013 Actinomyces phage xhp1, complete genome 6323-6355 8 0.758
CP029339_8 8.13|110446|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110446-110478 33 NC_006462 Thermus thermophilus HB8 plasmid pTT27, complete sequence 58258-58290 8 0.758
CP029339_8 8.13|110446|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110446-110478 33 NC_017273 Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence 321456-321488 8 0.758
CP029339_8 8.13|110446|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110446-110478 33 NC_005838 Thermus thermophilus HB27 plasmid pTT27, complete sequence 20325-20357 8 0.758
CP029339_8 8.13|110446|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110446-110478 33 NZ_CP014142 Thermus parvatiensis strain RL plasmid pTP143, complete sequence 91367-91399 8 0.758
CP029339_8 8.13|110446|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110446-110478 33 NC_017588 Thermus thermophilus JL-18 plasmid pTTJL1801, complete sequence 177517-177549 8 0.758
CP029339_8 8.13|110446|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110446-110478 33 NZ_LR027520 Thermus thermophilus isolate TTHNAR1 plasmid 4, complete sequence 263804-263836 8 0.758
CP029339_8 8.13|110446|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110446-110478 33 JN698995 Mycobacterium phage Dori, complete genome 5481-5513 8 0.758
CP029339_8 8.17|110690|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110690-110722 33 AP021851 Deinococcus grandis ATCC 43672 plasmid: pDEGR-2 DNA, complete genome 250135-250167 8 0.758
CP029339_8 8.17|110690|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110690-110722 33 NZ_CP033584 Streptomyces sp. ADI95-16 plasmid pADI95-16c, complete sequence 3921-3953 8 0.758
CP029339_8 8.21|110934|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110934-110966 33 NZ_CP019938 Ketogulonicigenium robustum strain SPU_B003 plasmid unnamed1, complete sequence 15496-15528 8 0.758
CP029339_8 8.21|110934|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110934-110966 33 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 1139613-1139645 8 0.758
CP029339_8 8.21|110934|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110934-110966 33 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 992760-992792 8 0.758
CP029339_8 8.21|110934|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110934-110966 33 MN694777 Marine virus AFVG_250M80, complete genome 4529-4561 8 0.758
CP029339_1 1.2|83891|33|CP029339|CRISPRCasFinder,CRT 83891-83923 33 NZ_CP035505 Kocuria indica strain CE7 plasmid pCE7, complete sequence 19981-20013 9 0.727
CP029339_1 1.4|84013|33|CP029339|CRISPRCasFinder,CRT 84013-84045 33 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1163919-1163951 9 0.727
CP029339_1 1.4|84013|33|CP029339|CRISPRCasFinder,CRT 84013-84045 33 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 649151-649183 9 0.727
CP029339_1 1.4|84013|33|CP029339|CRISPRCasFinder,CRT 84013-84045 33 MK977714 Corynebacterium phage Bran, complete genome 41733-41765 9 0.727
CP029339_1 1.4|84013|33|CP029339|CRISPRCasFinder,CRT 84013-84045 33 MK977706 Corynebacterium phage Dina, complete genome 41630-41662 9 0.727
CP029339_1 1.4|84013|33|CP029339|CRISPRCasFinder,CRT 84013-84045 33 MH926061 Corynebacterium phage Troy, complete genome 41858-41890 9 0.727
CP029339_1 1.4|84013|33|CP029339|CRISPRCasFinder,CRT 84013-84045 33 NC_048069 Corynebacterium phage SamW, complete genome 41858-41890 9 0.727
CP029339_1 1.4|84013|33|CP029339|CRISPRCasFinder,CRT 84013-84045 33 NZ_CP010857 Marinovum algicola DG 898 plasmid pMaD2, complete sequence 20096-20128 9 0.727
CP029339_1 1.4|84013|33|CP029339|CRISPRCasFinder,CRT 84013-84045 33 CP042595 Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence 113735-113767 9 0.727
CP029339_1 1.7|84196|33|CP029339|CRISPRCasFinder,CRT 84196-84228 33 NZ_LR134451 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence 102049-102081 9 0.727
CP029339_1 1.11|84440|33|CP029339|CRISPRCasFinder,CRT 84440-84472 33 NZ_CP035001 Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence 626599-626631 9 0.727
CP029339_1 1.17|84800|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 84800-84832 33 NZ_CP010862 Marinovum algicola DG 898 plasmid pMaD7 1248-1280 9 0.727
CP029339_1 1.18|84861|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 84861-84893 33 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 167581-167613 9 0.727
CP029339_1 1.25|85288|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 85288-85320 33 NZ_CP029830 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence 548371-548403 9 0.727
CP029339_1 1.27|84013|37|CP029339|PILER-CR 84013-84049 37 CP040467 Streptomyces albidoflavus strain UYFA156 plasmid unnamed, complete sequence 53192-53228 9 0.757
CP029339_1 1.27|84013|37|CP029339|PILER-CR 84013-84049 37 NZ_CP053565 Pseudonocardia sp. Gen01 plasmid unnamed1, complete sequence 57818-57854 9 0.757
CP029339_1 1.28|84074|37|CP029339|PILER-CR 84074-84110 37 NC_004934 Streptomyces violaceoruber strain SANK95570 plasmid pSV2, complete sequence 56607-56643 9 0.757
CP029339_1 1.28|84074|37|CP029339|PILER-CR 84074-84110 37 NZ_CP026654 Streptomyces dengpaensis strain XZHG99 plasmid unnamed2, complete sequence 54320-54356 9 0.757
CP029339_2 2.2|86754|33|CP029339|CRT,CRISPRCasFinder 86754-86786 33 NZ_CP013855 Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence 133945-133977 9 0.727
CP029339_2 2.2|86754|33|CP029339|CRT,CRISPRCasFinder 86754-86786 33 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 662720-662752 9 0.727
CP029339_2 2.2|86754|33|CP029339|CRT,CRISPRCasFinder 86754-86786 33 NZ_CP046574 Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence 390117-390149 9 0.727
CP029339_2 2.3|86815|33|CP029339|CRT,CRISPRCasFinder 86815-86847 33 NZ_CP032326 Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence 277985-278017 9 0.727
CP029339_3 3.5|87638|33|CP029339|CRISPRCasFinder 87638-87670 33 NZ_CP032324 Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence 202706-202738 9 0.727
CP029339_3 3.5|87638|33|CP029339|CRISPRCasFinder 87638-87670 33 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 621830-621862 9 0.727
CP029339_3 3.5|87638|33|CP029339|CRISPRCasFinder 87638-87670 33 NZ_CP007797 Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence 354097-354129 9 0.727
CP029339_3 3.5|87638|33|CP029339|CRISPRCasFinder 87638-87670 33 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 191543-191575 9 0.727
CP029339_3 3.5|87638|33|CP029339|CRISPRCasFinder 87638-87670 33 NZ_CP032348 Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence 388652-388684 9 0.727
CP029339_3 3.5|87638|33|CP029339|CRISPRCasFinder 87638-87670 33 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 536656-536688 9 0.727
CP029339_4 4.7|89240|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 89240-89272 33 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 807588-807620 9 0.727
CP029339_4 4.8|89301|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 89301-89333 33 NZ_CP011520 Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-3, complete sequence 49783-49815 9 0.727
CP029339_4 4.16|89789|33|CP029339|CRISPRCasFinder,CRT 89789-89821 33 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 974142-974174 9 0.727
CP029339_4 4.16|89789|33|CP029339|CRISPRCasFinder,CRT 89789-89821 33 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1790856-1790888 9 0.727
CP029339_4 4.19|89972|33|CP029339|CRISPRCasFinder,CRT 89972-90004 33 NZ_CP007449 Yersinia enterocolitica LC20 plasmid plasmid1_80K, complete sequence 41633-41665 9 0.727
CP029339_4 4.21|89789|32|CP029339|PILER-CR 89789-89820 32 NC_019387 Thermus oshimai JL-2 plasmid pTHEOS01, complete sequence 271315-271346 9 0.719
CP029339_4 4.23|89911|32|CP029339|PILER-CR 89911-89942 32 NC_015162 Deinococcus proteolyticus MRP plasmid pDEIPR02, complete sequence 147057-147088 9 0.719
CP029339_5 5.1|90308|33|CP029339|CRISPRCasFinder 90308-90340 33 NZ_AP022578 Mycolicibacterium aubagnense strain JCM 15296 plasmid pJCM15296, complete sequence 197498-197530 9 0.727
CP029339_6 6.4|93431|34|CP029339|CRISPRCasFinder,CRT,PILER-CR 93431-93464 34 NC_021347 Rhodococcus phage E3, complete genome 105038-105071 9 0.735
CP029339_6 6.5|93493|32|CP029339|CRISPRCasFinder,CRT,PILER-CR 93493-93524 32 NZ_CP029211 Aquabacterium olei strain NBRC 110486 plasmid pTB101, complete sequence 182051-182082 9 0.719
CP029339_7 7.3|98087|32|CP029339|CRT,CRISPRCasFinder 98087-98118 32 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 51705-51736 9 0.719
CP029339_7 7.3|98087|32|CP029339|CRT,CRISPRCasFinder 98087-98118 32 NC_011143 Phenylobacterium zucineum HLK1 plasmid, complete sequence 758-789 9 0.719
CP029339_7 7.3|98087|32|CP029339|CRT,CRISPRCasFinder 98087-98118 32 NZ_HG938354 Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence 458049-458080 9 0.719
CP029339_7 7.3|98087|32|CP029339|CRT,CRISPRCasFinder 98087-98118 32 NZ_AP014706 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence 225215-225246 9 0.719
CP029339_7 7.8|98392|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98392-98424 33 NC_020894 Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence 69464-69496 9 0.727
CP029339_7 7.8|98392|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98392-98424 33 NC_017791 Deinococcus gobiensis I-0 plasmid P2, complete sequence 247451-247483 9 0.727
CP029339_7 7.8|98392|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98392-98424 33 NC_017766 Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence 69465-69497 9 0.727
CP029339_7 7.8|98392|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98392-98424 33 NZ_CP035709 Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt12, complete sequence 20791-20823 9 0.727
CP029339_7 7.11|98575|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98575-98607 33 NZ_CP017077 Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence 233068-233100 9 0.727
CP029339_7 7.11|98575|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98575-98607 33 NZ_CP017077 Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence 777309-777341 9 0.727
CP029339_7 7.11|98575|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98575-98607 33 NZ_CP012399 Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence 746376-746408 9 0.727
CP029339_7 7.11|98575|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98575-98607 33 NZ_CP024314 Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence 16141-16173 9 0.727
CP029339_7 7.14|98758|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98758-98790 33 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 223348-223380 9 0.727
CP029339_7 7.14|98758|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98758-98790 33 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 391228-391260 9 0.727
CP029339_7 7.14|98758|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98758-98790 33 NC_008741 Desulfovibrio vulgaris DP4 plasmid pDVUL01, complete sequence 64213-64245 9 0.727
CP029339_7 7.14|98758|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98758-98790 33 NC_006569 Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence 224191-224223 9 0.727
CP029339_7 7.14|98758|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98758-98790 33 NC_017311 Desulfovibrio vulgaris RCH1 plasmid pDEVAL01, complete sequence 138733-138765 9 0.727
CP029339_7 7.14|98758|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98758-98790 33 NC_005863 Desulfovibrio vulgaris str. Hildenborough plasmid pDV, complete sequence 144176-144208 9 0.727
CP029339_7 7.19|99063|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 99063-99095 33 MK977714 Corynebacterium phage Bran, complete genome 29964-29996 9 0.727
CP029339_7 7.21|99185|33|CP029339|CRT,CRISPRCasFinder 99185-99217 33 NZ_CP025431 Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence 97024-97056 9 0.727
CP029339_7 7.23|99307|33|CP029339|CRT,CRISPRCasFinder 99307-99339 33 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1543447-1543479 9 0.727
CP029339_7 7.23|99307|33|CP029339|CRT,CRISPRCasFinder 99307-99339 33 CP021185 Sphingomonas wittichii DC-6 plasmid pDC04, complete sequence 59356-59388 9 0.727
CP029339_7 7.23|99307|33|CP029339|CRT,CRISPRCasFinder 99307-99339 33 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 8941-8973 9 0.727
CP029339_7 7.23|99307|33|CP029339|CRT,CRISPRCasFinder 99307-99339 33 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 1925569-1925601 9 0.727
CP029339_7 7.23|99307|33|CP029339|CRT,CRISPRCasFinder 99307-99339 33 NZ_LN831789 Streptomyces leeuwenhoekii strain type strain (C34 = DSM 42122 = NRRL B-24963) plasmid pSLE2 42666-42698 9 0.727
CP029339_7 7.23|99307|33|CP029339|CRT,CRISPRCasFinder 99307-99339 33 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1124023-1124055 9 0.727
CP029339_7 7.23|99307|33|CP029339|CRT,CRISPRCasFinder 99307-99339 33 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 146-178 9 0.727
CP029339_7 7.23|99307|33|CP029339|CRT,CRISPRCasFinder 99307-99339 33 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 1830839-1830871 9 0.727
CP029339_7 7.23|99307|33|CP029339|CRT,CRISPRCasFinder 99307-99339 33 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 470064-470096 9 0.727
CP029339_7 7.23|99307|33|CP029339|CRT,CRISPRCasFinder 99307-99339 33 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 1662298-1662330 9 0.727
CP029339_8 8.3|109836|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 109836-109868 33 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 42267-42299 9 0.727
CP029339_8 8.9|110202|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110202-110234 33 NZ_CP029360 Azospirillum sp. CFH 70021 plasmid unnamed5 33814-33846 9 0.727
CP029339_8 8.13|110446|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110446-110478 33 NZ_CP040760 Paracoccus sp. 2251 plasmid unnamed6, complete sequence 131979-132011 9 0.727
CP029339_8 8.13|110446|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110446-110478 33 NZ_CP015322 Mesorhizobium amorphae CCNWGS0123 plasmid pM0123d, complete sequence 814503-814535 9 0.727
CP029339_8 8.19|110812|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110812-110844 33 NC_017273 Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence 116469-116501 9 0.727
CP029339_8 8.19|110812|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110812-110844 33 NZ_CP014142 Thermus parvatiensis strain RL plasmid pTP143, complete sequence 55703-55735 9 0.727
CP029339_8 8.19|110812|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110812-110844 33 NC_005838 Thermus thermophilus HB27 plasmid pTT27, complete sequence 204538-204570 9 0.727
CP029339_8 8.19|110812|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110812-110844 33 NC_017588 Thermus thermophilus JL-18 plasmid pTTJL1801, complete sequence 96862-96894 9 0.727
CP029339_8 8.19|110812|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110812-110844 33 NZ_LR027520 Thermus thermophilus isolate TTHNAR1 plasmid 4, complete sequence 309819-309851 9 0.727
CP029339_8 8.21|110934|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110934-110966 33 NZ_LT853886 Xanthomonas fragariae strain PD5205 plasmid pPD5205-30, complete sequence 11295-11327 9 0.727
CP029339_8 8.21|110934|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110934-110966 33 NZ_CP016831 Xanthomonas fragariae isolate Fap21 plasmid pFap21-1, complete sequence 28606-28638 9 0.727
CP029339_8 8.21|110934|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110934-110966 33 NZ_CP016834 Xanthomonas fragariae isolate Fap29 plasmid pFap29-1, complete sequence 24228-24260 9 0.727
CP029339_8 8.21|110934|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110934-110966 33 NZ_LT853883 Xanthomonas fragariae strain PD885 plasmid pPD885-29, complete sequence 10058-10090 9 0.727
CP029339_8 8.22|110995|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110995-111027 33 MK494117 Mycobacterium phage Miramae, complete genome 5130-5162 9 0.727
CP029339_8 8.22|110995|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110995-111027 33 MK494129 Mycobacterium phage AvatarAhPeg, complete genome 5130-5162 9 0.727
CP029339_8 8.29|111300|32|CP029339|CRISPRCasFinder,CRT 111300-111331 32 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 336901-336932 9 0.719
CP029339_8 8.29|111300|32|CP029339|CRISPRCasFinder,CRT 111300-111331 32 JX042579 Mycobacterium virus MacnCheese, complete genome 13117-13148 9 0.719
CP029339_8 8.29|111300|32|CP029339|CRISPRCasFinder,CRT 111300-111331 32 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 601422-601453 9 0.719
CP029339_1 1.1|83832|31|CP029339|CRISPRCasFinder,CRT 83832-83862 31 NZ_CP029831 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence 514319-514349 10 0.677
CP029339_1 1.5|84074|33|CP029339|CRISPRCasFinder,CRT 84074-84106 33 NZ_CP029777 Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed3, complete sequence 114311-114343 10 0.697
CP029339_1 1.17|84800|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 84800-84832 33 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 229345-229377 10 0.697
CP029339_1 1.17|84800|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 84800-84832 33 MH834620 Arthrobacter phage Melons, complete genome 24293-24325 10 0.697
CP029339_1 1.17|84800|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 84800-84832 33 MH834606 Arthrobacter phage Coral, complete genome 23666-23698 10 0.697
CP029339_1 1.17|84800|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 84800-84832 33 MH834618 Arthrobacter phage Lunar, complete genome 24477-24509 10 0.697
CP029339_1 1.17|84800|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 84800-84832 33 MN234214 Arthrobacter phage Amelia, complete genome 23817-23849 10 0.697
CP029339_1 1.17|84800|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 84800-84832 33 MH834624 Arthrobacter phage Polka, complete genome 23667-23699 10 0.697
CP029339_1 1.17|84800|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 84800-84832 33 MH834608 Arthrobacter phage Cote, complete genome 24143-24175 10 0.697
CP029339_1 1.17|84800|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 84800-84832 33 MH834616 Arthrobacter phage Kepler, complete genome 24559-24591 10 0.697
CP029339_1 1.17|84800|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 84800-84832 33 MH834609 Arthrobacter phage Daob, complete genome 24151-24183 10 0.697
CP029339_1 1.23|85166|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 85166-85198 33 NZ_CP023976 Streptomyces alboflavus strain MDJK44 plasmid pMDJK44.1, complete sequence 225309-225341 10 0.697
CP029339_1 1.28|84074|37|CP029339|PILER-CR 84074-84110 37 CP054922 Streptomyces sp. NA03103 plasmid unnamed2, complete sequence 82007-82043 10 0.73
CP029339_1 1.28|84074|37|CP029339|PILER-CR 84074-84110 37 NZ_CP010408 Streptomyces vietnamensis strain GIMV4.0001 plasmid pSVL1, complete sequence 215798-215834 10 0.73
CP029339_1 1.32|84318|37|CP029339|PILER-CR 84318-84354 37 MT701598 Streptomyces phage Sitrop, complete genome 19455-19491 10 0.73
CP029339_4 4.4|89057|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 89057-89089 33 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 7822-7854 10 0.697
CP029339_4 4.4|89057|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 89057-89089 33 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 834673-834705 10 0.697
CP029339_4 4.4|89057|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 89057-89089 33 NZ_CP041223 Porphyrobacter sp. YT40 plasmid pYT40, complete sequence 16988-17020 10 0.697
CP029339_4 4.21|89789|32|CP029339|PILER-CR 89789-89820 32 NZ_AP019795 Thermus thermophilus strain AA2-29 plasmid pAA229, complete sequence 90826-90857 10 0.688
CP029339_4 4.21|89789|32|CP029339|PILER-CR 89789-89820 32 NZ_AP019793 Thermus thermophilus strain AA2-20 plasmid pAA220, complete sequence 116012-116043 10 0.688
CP029339_4 4.21|89789|32|CP029339|PILER-CR 89789-89820 32 NC_022063 Mycobacterium phage Phelemich, complete genome 56410-56441 10 0.688
CP029339_4 4.21|89789|32|CP029339|PILER-CR 89789-89820 32 KF024727 Mycobacterium phage Reprobate, complete genome 56415-56446 10 0.688
CP029339_6 6.4|93431|34|CP029339|CRISPRCasFinder,CRT,PILER-CR 93431-93464 34 NZ_CP023150 Mycobacterium intracellulare strain FLAC0181 plasmid pFLAC0181, complete sequence 12150-12183 10 0.706
CP029339_6 6.4|93431|34|CP029339|CRISPRCasFinder,CRT,PILER-CR 93431-93464 34 NZ_CP040254 Mycobacterium avium subsp. hominissuis strain 101115 plasmid pFLAC0181_CHOP101, complete sequence 24516-24549 10 0.706
CP029339_6 6.4|93431|34|CP029339|CRISPRCasFinder,CRT,PILER-CR 93431-93464 34 NZ_CP040248 Mycobacterium avium subsp. hominissuis strain 101174 plasmid pFLAC0181_CHOP101, complete sequence 2159-2192 10 0.706
CP029339_6 6.4|93431|34|CP029339|CRISPRCasFinder,CRT,PILER-CR 93431-93464 34 NZ_CP040246 Mycobacterium avium subsp. hominissuis strain 101034 plasmid pFLAC0181_CHOP1, complete sequence 15899-15932 10 0.706
CP029339_7 7.3|98087|32|CP029339|CRT,CRISPRCasFinder 98087-98118 32 NZ_CP029831 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence 266208-266239 10 0.688
CP029339_7 7.3|98087|32|CP029339|CRT,CRISPRCasFinder 98087-98118 32 MH976515 Gordonia phage Octobien14, complete genome 41624-41655 10 0.688
CP029339_7 7.7|98331|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98331-98363 33 NZ_LR536451 Methylocella tundrae isolate MTUNDRAET4 annotated genome plasmid 2 94561-94593 10 0.697
CP029339_7 7.8|98392|33|CP029339|CRT,CRISPRCasFinder,PILER-CR 98392-98424 33 NZ_LR134466 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 24, complete sequence 30417-30449 10 0.697
CP029339_7 7.23|99307|33|CP029339|CRT,CRISPRCasFinder 99307-99339 33 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 2549379-2549411 10 0.697
CP029339_7 7.23|99307|33|CP029339|CRT,CRISPRCasFinder 99307-99339 33 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 1077924-1077956 10 0.697
CP029339_8 8.3|109836|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 109836-109868 33 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 212335-212367 10 0.697
CP029339_8 8.5|109958|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 109958-109990 33 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 477115-477147 10 0.697
CP029339_8 8.13|110446|33|CP029339|PILER-CR,CRISPRCasFinder,CRT 110446-110478 33 KX557288 Rhodococcus phage ChewyVIII, complete genome 10952-10984 10 0.697
CP029339_8 8.29|111300|32|CP029339|CRISPRCasFinder,CRT 111300-111331 32 NZ_CP025013 Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence 766092-766123 10 0.688
CP029339_1 1.4|84013|33|CP029339|CRISPRCasFinder,CRT 84013-84045 33 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 346534-346566 11 0.667
CP029339_1 1.8|84257|33|CP029339|CRISPRCasFinder,CRT 84257-84289 33 NZ_CP016082 Streptomyces sp. SAT1 plasmid unnamed2, complete sequence 59422-59454 11 0.667
CP029339_1 1.8|84257|33|CP029339|CRISPRCasFinder,CRT 84257-84289 33 MH316566 Gordonia phage Nedarya, complete genome 7746-7778 11 0.667
CP029339_1 1.19|84922|33|CP029339|CRISPRCasFinder,CRT,PILER-CR 84922-84954 33 NZ_CP013379 Burkholderia pseudomultivorans strain SUB-INT23-BP2 plasmid pINT23, complete sequence 3469-3501 11 0.667
CP029339_1 1.27|84013|37|CP029339|PILER-CR 84013-84049 37 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 432719-432755 11 0.703
CP029339_1 1.27|84013|37|CP029339|PILER-CR 84013-84049 37 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1380344-1380380 11 0.703
CP029339_1 1.28|84074|37|CP029339|PILER-CR 84074-84110 37 NC_003903 Streptomyces coelicolor A3(2) plasmid SCP1, complete sequence 90259-90295 11 0.703
CP029339_2 2.2|86754|33|CP029339|CRT,CRISPRCasFinder 86754-86786 33 NC_047751 Ralstonia phage phiITL-1, complete genome 19265-19297 11 0.667
CP029339_7 7.3|98087|32|CP029339|CRT,CRISPRCasFinder 98087-98118 32 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 745988-746019 11 0.656
CP029339_4 4.20|89728|277|CP029339|PILER-CR 89728-90004 277 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 89728-90004 217 0.217

1. spacer 1.1|83832|31|CP029339|CRISPRCasFinder,CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

ggcagcgccgggcgtagcgggctgcgtcgtg	CRISPR spacer
ggcagcgccgggcgtagcgggctgcgtcgtg	Protospacer
*******************************

2. spacer 1.2|83891|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

gggtccgaccgcggcgacgccacgacgacggca	CRISPR spacer
gggtccgaccgcggcgacgccacgacgacggca	Protospacer
*********************************

3. spacer 1.2|83891|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

gggtccgaccgcggcgacgccacgacgacggca	CRISPR spacer
gggtccgaccgcggcgacgccacgacgacggca	Protospacer
*********************************

4. spacer 1.2|83891|33|CP029339|CRISPRCasFinder,CRT matches to NC_010311 (Streptomyces sp. HK1 plasmid pSHK1, complete sequence) position: , mismatch: 0, identity: 1.0

gggtccgaccgcggcgacgccacgacgacggca	CRISPR spacer
gggtccgaccgcggcgacgccacgacgacggca	Protospacer
*********************************

5. spacer 1.3|83952|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gtgacgcgccagtggttcaggctctccggcatc	CRISPR spacer
gtgacgcgccagtggttcaggctctccggcatc	Protospacer
*********************************

6. spacer 1.3|83952|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

gtgacgcgccagtggttcaggctctccggcatc	CRISPR spacer
gtgacgcgccagtggttcaggctctccggcatc	Protospacer
*********************************

7. spacer 1.4|84013|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

accgaggaccccgacggcaccgtgctggtctcc	CRISPR spacer
accgaggaccccgacggcaccgtgctggtctcc	Protospacer
*********************************

8. spacer 1.4|84013|33|CP029339|CRISPRCasFinder,CRT matches to NC_010311 (Streptomyces sp. HK1 plasmid pSHK1, complete sequence) position: , mismatch: 0, identity: 1.0

accgaggaccccgacggcaccgtgctggtctcc	CRISPR spacer
accgaggaccccgacggcaccgtgctggtctcc	Protospacer
*********************************

9. spacer 1.4|84013|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

accgaggaccccgacggcaccgtgctggtctcc	CRISPR spacer
accgaggaccccgacggcaccgtgctggtctcc	Protospacer
*********************************

10. spacer 1.5|84074|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

gcgctgcgtcacggccgtcaggctccggcggag	CRISPR spacer
gcgctgcgtcacggccgtcaggctccggcggag	Protospacer
*********************************

11. spacer 1.5|84074|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gcgctgcgtcacggccgtcaggctccggcggag	CRISPR spacer
gcgctgcgtcacggccgtcaggctccggcggag	Protospacer
*********************************

12. spacer 1.6|84135|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cggctgcgggtggagatcaagtccgccgaccgg	CRISPR spacer
cggctgcgggtggagatcaagtccgccgaccgg	Protospacer
*********************************

13. spacer 1.6|84135|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

cggctgcgggtggagatcaagtccgccgaccgg	CRISPR spacer
cggctgcgggtggagatcaagtccgccgaccgg	Protospacer
*********************************

14. spacer 1.7|84196|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

ccgcacttgccgcagaccaggacgccgttctcg	CRISPR spacer
ccgcacttgccgcagaccaggacgccgttctcg	Protospacer
*********************************

15. spacer 1.7|84196|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

ccgcacttgccgcagaccaggacgccgttctcg	CRISPR spacer
ccgcacttgccgcagaccaggacgccgttctcg	Protospacer
*********************************

16. spacer 1.8|84257|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

ctgacgttcaggccgtgggcggtctcagcgatc	CRISPR spacer
ctgacgttcaggccgtgggcggtctcagcgatc	Protospacer
*********************************

17. spacer 1.8|84257|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

ctgacgttcaggccgtgggcggtctcagcgatc	CRISPR spacer
ctgacgttcaggccgtgggcggtctcagcgatc	Protospacer
*********************************

18. spacer 1.9|84318|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

cggtacgcggtgtgggtcgagggcgacggcacc	CRISPR spacer
cggtacgcggtgtgggtcgagggcgacggcacc	Protospacer
*********************************

19. spacer 1.9|84318|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cggtacgcggtgtgggtcgagggcgacggcacc	CRISPR spacer
cggtacgcggtgtgggtcgagggcgacggcacc	Protospacer
*********************************

20. spacer 1.10|84379|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

agcctgtggcctggccacgcaccgccaccacac	CRISPR spacer
agcctgtggcctggccacgcaccgccaccacac	Protospacer
*********************************

21. spacer 1.10|84379|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

agcctgtggcctggccacgcaccgccaccacac	CRISPR spacer
agcctgtggcctggccacgcaccgccaccacac	Protospacer
*********************************

22. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

cgccagagcgccggccgccgtgccagagccgta	CRISPR spacer
cgccagagcgccggccgccgtgccagagccgta	Protospacer
*********************************

23. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgccagagcgccggccgccgtgccagagccgta	CRISPR spacer
cgccagagcgccggccgccgtgccagagccgta	Protospacer
*********************************

24. spacer 1.12|84501|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

ccaccaccgtcacggaaggggaagcctgatgac	CRISPR spacer
ccaccaccgtcacggaaggggaagcctgatgac	Protospacer
*********************************

25. spacer 1.12|84501|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

ccaccaccgtcacggaaggggaagcctgatgac	CRISPR spacer
ccaccaccgtcacggaaggggaagcctgatgac	Protospacer
*********************************

26. spacer 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

tccggggccgcgccatcgccaccgccc	CRISPR spacer
tccggggccgcgccatcgccaccgccc	Protospacer
***************************

27. spacer 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tccggggccgcgccatcgccaccgccc	CRISPR spacer
tccggggccgcgccatcgccaccgccc	Protospacer
***************************

28. spacer 1.14|84617|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

ccgtcctcctggggcggcatgcgtcgcgagcac	CRISPR spacer
ccgtcctcctggggcggcatgcgtcgcgagcac	Protospacer
*********************************

29. spacer 1.14|84617|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

ccgtcctcctggggcggcatgcgtcgcgagcac	CRISPR spacer
ccgtcctcctggggcggcatgcgtcgcgagcac	Protospacer
*********************************

30. spacer 1.15|84678|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gtccaggtcgccggggcgtagtgccggtagacc	CRISPR spacer
gtccaggtcgccggggcgtagtgccggtagacc	Protospacer
*********************************

31. spacer 1.15|84678|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

gtccaggtcgccggggcgtagtgccggtagacc	CRISPR spacer
gtccaggtcgccggggcgtagtgccggtagacc	Protospacer
*********************************

32. spacer 1.15|84678|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

gtccaggtcgccggggcgtagtgccggtagacc	CRISPR spacer
gtccaggtcgccggggcgtagtgccggtagacc	Protospacer
*********************************

33. spacer 1.16|84739|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaggtctgcgcggacggtggccgtcctgctgcg	CRISPR spacer
gaggtctgcgcggacggtggccgtcctgctgcg	Protospacer
*********************************

34. spacer 1.16|84739|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

gaggtctgcgcggacggtggccgtcctgctgcg	CRISPR spacer
gaggtctgcgcggacggtggccgtcctgctgcg	Protospacer
*********************************

35. spacer 1.17|84800|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to ASHF01000034 (Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence) position: , mismatch: 0, identity: 1.0

tagagatcgcccgccggcgcgggccggtcgagc	CRISPR spacer
tagagatcgcccgccggcgcgggccggtcgagc	Protospacer
*********************************

36. spacer 1.17|84800|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

tagagatcgcccgccggcgcgggccggtcgagc	CRISPR spacer
tagagatcgcccgccggcgcgggccggtcgagc	Protospacer
*********************************

37. spacer 1.17|84800|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tagagatcgcccgccggcgcgggccggtcgagc	CRISPR spacer
tagagatcgcccgccggcgcgggccggtcgagc	Protospacer
*********************************

38. spacer 1.18|84861|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

ctctgggacgcccacgcgcacctcgtggagtgc	CRISPR spacer
ctctgggacgcccacgcgcacctcgtggagtgc	Protospacer
*********************************

39. spacer 1.19|84922|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

tgttgatcaacggcgaaaaggcccgccccctgc	CRISPR spacer
tgttgatcaacggcgaaaaggcccgccccctgc	Protospacer
*********************************

40. spacer 1.20|84983|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

tatccgtactgctcgtaaatgtaggcgtcggcg	CRISPR spacer
tatccgtactgctcgtaaatgtaggcgtcggcg	Protospacer
*********************************

41. spacer 1.20|84983|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tatccgtactgctcgtaaatgtaggcgtcggcg	CRISPR spacer
tatccgtactgctcgtaaatgtaggcgtcggcg	Protospacer
*********************************

42. spacer 1.21|85044|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gggcgtgcagtcgctctgtcaggccgcgcgagg	CRISPR spacer
gggcgtgcagtcgctctgtcaggccgcgcgagg	Protospacer
*********************************

43. spacer 1.21|85044|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

gggcgtgcagtcgctctgtcaggccgcgcgagg	CRISPR spacer
gggcgtgcagtcgctctgtcaggccgcgcgagg	Protospacer
*********************************

44. spacer 1.22|85105|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

ttgacattccccgacggtagcgaggtcaccgag	CRISPR spacer
ttgacattccccgacggtagcgaggtcaccgag	Protospacer
*********************************

45. spacer 1.22|85105|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

ttgacattccccgacggtagcgaggtcaccgag	CRISPR spacer
ttgacattccccgacggtagcgaggtcaccgag	Protospacer
*********************************

46. spacer 1.23|85166|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

gccgcggtactcggagaccgctcccggagcccg	CRISPR spacer
gccgcggtactcggagaccgctcccggagcccg	Protospacer
*********************************

47. spacer 1.23|85166|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gccgcggtactcggagaccgctcccggagcccg	CRISPR spacer
gccgcggtactcggagaccgctcccggagcccg	Protospacer
*********************************

48. spacer 1.24|85227|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

agcggcaggtccacagtgtcggccacgcgcacc	CRISPR spacer
agcggcaggtccacagtgtcggccacgcgcacc	Protospacer
*********************************

49. spacer 1.25|85288|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

gggtgatcaggggcccggtccggccgtaggaag	CRISPR spacer
gggtgatcaggggcccggtccggccgtaggaag	Protospacer
*********************************

50. spacer 1.26|83952|37|CP029339|PILER-CR matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gtgacgcgccagtggttcaggctctccggcatcggaa	CRISPR spacer
gtgacgcgccagtggttcaggctctccggcatcggaa	Protospacer
*************************************

51. spacer 1.26|83952|37|CP029339|PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

gtgacgcgccagtggttcaggctctccggcatcggaa	CRISPR spacer
gtgacgcgccagtggttcaggctctccggcatcggaa	Protospacer
*************************************

52. spacer 1.27|84013|37|CP029339|PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

accgaggaccccgacggcaccgtgctggtctccggaa	CRISPR spacer
accgaggaccccgacggcaccgtgctggtctccggaa	Protospacer
*************************************

53. spacer 1.27|84013|37|CP029339|PILER-CR matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

accgaggaccccgacggcaccgtgctggtctccggaa	CRISPR spacer
accgaggaccccgacggcaccgtgctggtctccggaa	Protospacer
*************************************

54. spacer 1.28|84074|37|CP029339|PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

gcgctgcgtcacggccgtcaggctccggcggagggaa	CRISPR spacer
gcgctgcgtcacggccgtcaggctccggcggagggaa	Protospacer
*************************************

55. spacer 1.28|84074|37|CP029339|PILER-CR matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gcgctgcgtcacggccgtcaggctccggcggagggaa	CRISPR spacer
gcgctgcgtcacggccgtcaggctccggcggagggaa	Protospacer
*************************************

56. spacer 1.29|84135|37|CP029339|PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

cggctgcgggtggagatcaagtccgccgaccggggag	CRISPR spacer
cggctgcgggtggagatcaagtccgccgaccggggag	Protospacer
*************************************

57. spacer 1.29|84135|37|CP029339|PILER-CR matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cggctgcgggtggagatcaagtccgccgaccggggag	CRISPR spacer
cggctgcgggtggagatcaagtccgccgaccggggag	Protospacer
*************************************

58. spacer 1.30|84196|37|CP029339|PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

ccgcacttgccgcagaccaggacgccgttctcggaag	CRISPR spacer
ccgcacttgccgcagaccaggacgccgttctcggaag	Protospacer
*************************************

59. spacer 1.30|84196|37|CP029339|PILER-CR matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

ccgcacttgccgcagaccaggacgccgttctcggaag	CRISPR spacer
ccgcacttgccgcagaccaggacgccgttctcggaag	Protospacer
*************************************

60. spacer 1.31|84257|37|CP029339|PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

ctgacgttcaggccgtgggcggtctcagcgatcgaag	CRISPR spacer
ctgacgttcaggccgtgggcggtctcagcgatcgaag	Protospacer
*************************************

61. spacer 1.31|84257|37|CP029339|PILER-CR matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

ctgacgttcaggccgtgggcggtctcagcgatcgaag	CRISPR spacer
ctgacgttcaggccgtgggcggtctcagcgatcgaag	Protospacer
*************************************

62. spacer 1.32|84318|37|CP029339|PILER-CR matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cggtacgcggtgtgggtcgagggcgacggcaccggag	CRISPR spacer
cggtacgcggtgtgggtcgagggcgacggcaccggag	Protospacer
*************************************

63. spacer 1.32|84318|37|CP029339|PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

cggtacgcggtgtgggtcgagggcgacggcaccggag	CRISPR spacer
cggtacgcggtgtgggtcgagggcgacggcaccggag	Protospacer
*************************************

64. spacer 2.1|86693|33|CP029339|CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

agcagcgaagggctcgcgagcggacacggctga	CRISPR spacer
agcagcgaagggctcgcgagcggacacggctga	Protospacer
*********************************

65. spacer 2.1|86693|33|CP029339|CRT matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

agcagcgaagggctcgcgagcggacacggctga	CRISPR spacer
agcagcgaagggctcgcgagcggacacggctga	Protospacer
*********************************

66. spacer 2.2|86754|33|CP029339|CRT,CRISPRCasFinder matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

gccgacatcgagggcgtcgacggcgtccgcctc	CRISPR spacer
gccgacatcgagggcgtcgacggcgtccgcctc	Protospacer
*********************************

67. spacer 2.2|86754|33|CP029339|CRT,CRISPRCasFinder matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gccgacatcgagggcgtcgacggcgtccgcctc	CRISPR spacer
gccgacatcgagggcgtcgacggcgtccgcctc	Protospacer
*********************************

68. spacer 2.3|86815|33|CP029339|CRT,CRISPRCasFinder matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

gaccgcgacgtcaagaagcgctgggccgaagat	CRISPR spacer
gaccgcgacgtcaagaagcgctgggccgaagat	Protospacer
*********************************

69. spacer 2.3|86815|33|CP029339|CRT,CRISPRCasFinder matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gaccgcgacgtcaagaagcgctgggccgaagat	CRISPR spacer
gaccgcgacgtcaagaagcgctgggccgaagat	Protospacer
*********************************

70. spacer 2.4|86876|33|CP029339|CRT,CRISPRCasFinder matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

accggccacgcgcccagctcggtgacgccgtac	CRISPR spacer
accggccacgcgcccagctcggtgacgccgtac	Protospacer
*********************************

71. spacer 2.4|86876|33|CP029339|CRT,CRISPRCasFinder matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

accggccacgcgcccagctcggtgacgccgtac	CRISPR spacer
accggccacgcgcccagctcggtgacgccgtac	Protospacer
*********************************

72. spacer 3.1|87516|41|CP029339|CRT matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

accgactgggagttcaccgagaacgactactggggaacatt	CRISPR spacer
accgactgggagttcaccgagaacgactactggggaacatt	Protospacer
*****************************************

73. spacer 3.1|87516|41|CP029339|CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

accgactgggagttcaccgagaacgactactggggaacatt	CRISPR spacer
accgactgggagttcaccgagaacgactactggggaacatt	Protospacer
*****************************************

74. spacer 3.1|87516|41|CP029339|CRT matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

accgactgggagttcaccgagaacgactactggggaacatt	CRISPR spacer
accgactgggagttcaccgagaacgactactggggaacatt	Protospacer
*****************************************

75. spacer 3.2|87577|41|CP029339|CRT matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgtcactacgacccgaccggtgcccggtacggcggagcatc	CRISPR spacer
cgtcactacgacccgaccggtgcccggtacggcggagcatc	Protospacer
*****************************************

76. spacer 3.2|87577|41|CP029339|CRT matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtcactacgacccgaccggtgcccggtacggcggagcatc	CRISPR spacer
cgtcactacgacccgaccggtgcccggtacggcggagcatc	Protospacer
*****************************************

77. spacer 3.2|87577|41|CP029339|CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

cgtcactacgacccgaccggtgcccggtacggcggagcatc	CRISPR spacer
cgtcactacgacccgaccggtgcccggtacggcggagcatc	Protospacer
*****************************************

78. spacer 3.3|87638|41|CP029339|CRT matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gatttcgagatcctcagcgtggaggagctgaacggagcatc	CRISPR spacer
gatttcgagatcctcagcgtggaggagctgaacggagcatc	Protospacer
*****************************************

79. spacer 3.3|87638|41|CP029339|CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

gatttcgagatcctcagcgtggaggagctgaacggagcatc	CRISPR spacer
gatttcgagatcctcagcgtggaggagctgaacggagcatc	Protospacer
*****************************************

80. spacer 3.4|87577|33|CP029339|CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtcactacgacccgaccggtgcccggtacggc	CRISPR spacer
cgtcactacgacccgaccggtgcccggtacggc	Protospacer
*********************************

81. spacer 3.4|87577|33|CP029339|CRISPRCasFinder matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

cgtcactacgacccgaccggtgcccggtacggc	CRISPR spacer
cgtcactacgacccgaccggtgcccggtacggc	Protospacer
*********************************

82. spacer 3.4|87577|33|CP029339|CRISPRCasFinder matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgtcactacgacccgaccggtgcccggtacggc	CRISPR spacer
cgtcactacgacccgaccggtgcccggtacggc	Protospacer
*********************************

83. spacer 3.5|87638|33|CP029339|CRISPRCasFinder matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

gatttcgagatcctcagcgtggaggagctgaac	CRISPR spacer
gatttcgagatcctcagcgtggaggagctgaac	Protospacer
*********************************

84. spacer 3.5|87638|33|CP029339|CRISPRCasFinder matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gatttcgagatcctcagcgtggaggagctgaac	CRISPR spacer
gatttcgagatcctcagcgtggaggagctgaac	Protospacer
*********************************

85. spacer 4.1|88874|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacgccggatcgaccatctccccgaccttc	CRISPR spacer
agcaacgccggatcgaccatctccccgaccttc	Protospacer
*********************************

86. spacer 4.1|88874|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

agcaacgccggatcgaccatctccccgaccttc	CRISPR spacer
agcaacgccggatcgaccatctccccgaccttc	Protospacer
*********************************

87. spacer 4.2|88935|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgggccccggccgcatcctggggagtgtcgtgc	CRISPR spacer
cgggccccggccgcatcctggggagtgtcgtgc	Protospacer
*********************************

88. spacer 4.2|88935|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

cgggccccggccgcatcctggggagtgtcgtgc	CRISPR spacer
cgggccccggccgcatcctggggagtgtcgtgc	Protospacer
*********************************

89. spacer 4.3|88996|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

gggtccaggtgcgccgcgacgtacggcgtggcg	CRISPR spacer
gggtccaggtgcgccgcgacgtacggcgtggcg	Protospacer
*********************************

90. spacer 4.4|89057|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

ctcggcggccctgcggcgtcgttctgcggcggc	CRISPR spacer
ctcggcggccctgcggcgtcgttctgcggcggc	Protospacer
*********************************

91. spacer 4.5|89118|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

cctacgacgacgcatcggaactgcccggtcggg	CRISPR spacer
cctacgacgacgcatcggaactgcccggtcggg	Protospacer
*********************************

92. spacer 4.6|89179|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

cccttccaactcccaagggggagcaggggctca	CRISPR spacer
cccttccaactcccaagggggagcaggggctca	Protospacer
*********************************

93. spacer 4.7|89240|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

gtccgcccgcaccggcagatgactgggggtggg	CRISPR spacer
gtccgcccgcaccggcagatgactgggggtggg	Protospacer
*********************************

94. spacer 4.8|89301|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

cggttcttcgccacggtccgatcgtcgcgcccc	CRISPR spacer
cggttcttcgccacggtccgatcgtcgcgcccc	Protospacer
*********************************

95. spacer 4.9|89362|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

gatcttaggcccccgcgataacgggtctgtttg	CRISPR spacer
gatcttaggcccccgcgataacgggtctgtttg	Protospacer
*********************************

96. spacer 4.10|89423|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

atgatcgtgtggcatctgatgcagggggagagg	CRISPR spacer
atgatcgtgtggcatctgatgcagggggagagg	Protospacer
*********************************

97. spacer 4.11|89484|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

ggcagcgaggccaccgacgaggagtacggccag	CRISPR spacer
ggcagcgaggccaccgacgaggagtacggccag	Protospacer
*********************************

98. spacer 4.12|89545|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

gcggtgggtgagccattgccggtataggtcgag	CRISPR spacer
gcggtgggtgagccattgccggtataggtcgag	Protospacer
*********************************

99. spacer 4.13|89606|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

gctcgggaacgtcgggctgtgcattacgtgggc	CRISPR spacer
gctcgggaacgtcgggctgtgcattacgtgggc	Protospacer
*********************************

100. spacer 4.14|89667|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgccggtacgtgcttgttgccgagcacgccaag	CRISPR spacer
cgccggtacgtgcttgttgccgagcacgccaag	Protospacer
*********************************

101. spacer 4.14|89667|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NC_019307 (Streptomyces sp. W75 plasmid pCQ4, complete sequence) position: , mismatch: 0, identity: 1.0

cgccggtacgtgcttgttgccgagcacgccaag	CRISPR spacer
cgccggtacgtgcttgttgccgagcacgccaag	Protospacer
*********************************

102. spacer 4.14|89667|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

cgccggtacgtgcttgttgccgagcacgccaag	CRISPR spacer
cgccggtacgtgcttgttgccgagcacgccaag	Protospacer
*********************************

103. spacer 4.15|89728|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

acgcgcctggtgtcgccggcggcgggggagccg	CRISPR spacer
acgcgcctggtgtcgccggcggcgggggagccg	Protospacer
*********************************

104. spacer 4.16|89789|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

cactccaccccgatcaccgtggtgggctgggcg	CRISPR spacer
cactccaccccgatcaccgtggtgggctgggcg	Protospacer
*********************************

105. spacer 4.17|89850|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

acgccgtactgcgtctcaccccactgctgcggg	CRISPR spacer
acgccgtactgcgtctcaccccactgctgcggg	Protospacer
*********************************

106. spacer 4.17|89850|33|CP029339|CRISPRCasFinder,CRT matches to NC_019307 (Streptomyces sp. W75 plasmid pCQ4, complete sequence) position: , mismatch: 0, identity: 1.0

acgccgtactgcgtctcaccccactgctgcggg	CRISPR spacer
acgccgtactgcgtctcaccccactgctgcggg	Protospacer
*********************************

107. spacer 4.18|89911|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

catcgggagtgcgttcgtgctggtcaaggtggg	CRISPR spacer
catcgggagtgcgttcgtgctggtcaaggtggg	Protospacer
*********************************

108. spacer 4.19|89972|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

gttgggaatgcctaggtgtgtgatctgtgcggg	CRISPR spacer
gttgggaatgcctaggtgtgtgatctgtgcggg	Protospacer
*********************************

109. spacer 4.21|89789|32|CP029339|PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

cactccaccccgatcaccgtggtgggctgggc	CRISPR spacer
cactccaccccgatcaccgtggtgggctgggc	Protospacer
********************************

110. spacer 4.22|89850|32|CP029339|PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

acgccgtactgcgtctcaccccactgctgcgg	CRISPR spacer
acgccgtactgcgtctcaccccactgctgcgg	Protospacer
********************************

111. spacer 4.22|89850|32|CP029339|PILER-CR matches to NC_019307 (Streptomyces sp. W75 plasmid pCQ4, complete sequence) position: , mismatch: 0, identity: 1.0

acgccgtactgcgtctcaccccactgctgcgg	CRISPR spacer
acgccgtactgcgtctcaccccactgctgcgg	Protospacer
********************************

112. spacer 4.23|89911|32|CP029339|PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

catcgggagtgcgttcgtgctggtcaaggtgg	CRISPR spacer
catcgggagtgcgttcgtgctggtcaaggtgg	Protospacer
********************************

113. spacer 4.24|89972|32|CP029339|PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

gttgggaatgcctaggtgtgtgatctgtgcgg	CRISPR spacer
gttgggaatgcctaggtgtgtgatctgtgcgg	Protospacer
********************************

114. spacer 5.1|90308|33|CP029339|CRISPRCasFinder matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

atggcgtcgaggcggatggagatggtgccgccc	CRISPR spacer
atggcgtcgaggcggatggagatggtgccgccc	Protospacer
*********************************

115. spacer 5.2|90369|33|CP029339|CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

agcccatcaaagacgagactcatgagggggtca	CRISPR spacer
agcccatcaaagacgagactcatgagggggtca	Protospacer
*********************************

116. spacer 5.2|90369|33|CP029339|CRISPRCasFinder matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

agcccatcaaagacgagactcatgagggggtca	CRISPR spacer
agcccatcaaagacgagactcatgagggggtca	Protospacer
*********************************

117. spacer 6.1|93224|57|CP029339|CRISPRCasFinder,CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

ccctgggagatcaggttccggcacctgcggctggccttcttcgccgcccgccgctgg	CRISPR spacer
ccctgggagatcaggttccggcacctgcggctggccttcttcgccgcccgccgctgg	Protospacer
*********************************************************

118. spacer 6.2|93309|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

ctgatggtgatgttcatgcccgagccgtgcagg	CRISPR spacer
ctgatggtgatgttcatgcccgagccgtgcagg	Protospacer
*********************************

119. spacer 6.3|93370|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

cggccactacaactgccgagctggctgcgctgg	CRISPR spacer
cggccactacaactgccgagctggctgcgctgg	Protospacer
*********************************

120. spacer 6.4|93431|34|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

gatgcccccggcgacgacgtagcagtacccgggc	CRISPR spacer
gatgcccccggcgacgacgtagcagtacccgggc	Protospacer
**********************************

121. spacer 6.4|93431|34|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029340 (Streptomyces sp. SM17 plasmid pSM17B, complete sequence) position: , mismatch: 0, identity: 1.0

gatgcccccggcgacgacgtagcagtacccgggc	CRISPR spacer
gatgcccccggcgacgacgtagcagtacccgggc	Protospacer
**********************************

122. spacer 6.4|93431|34|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029340 (Streptomyces sp. SM17 plasmid pSM17B, complete sequence) position: , mismatch: 0, identity: 1.0

gatgcccccggcgacgacgtagcagtacccgggc	CRISPR spacer
gatgcccccggcgacgacgtagcagtacccgggc	Protospacer
**********************************

123. spacer 6.4|93431|34|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NC_013667 (Streptomyces sp. Y27 plasmid pWTY27, complete sequence) position: , mismatch: 0, identity: 1.0

gatgcccccggcgacgacgtagcagtacccgggc	CRISPR spacer
gatgcccccggcgacgacgtagcagtacccgggc	Protospacer
**********************************

124. spacer 6.5|93493|32|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

cggggctgtacgaggtcgatctcggggcggag	CRISPR spacer
cggggctgtacgaggtcgatctcggggcggag	Protospacer
********************************

125. spacer 6.5|93493|32|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NC_013449 (Streptomyces sp. W9 plasmid pCQ3, complete sequence) position: , mismatch: 0, identity: 1.0

cggggctgtacgaggtcgatctcggggcggag	CRISPR spacer
cggggctgtacgaggtcgatctcggggcggag	Protospacer
********************************

126. spacer 6.6|93553|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtcctacgtctgggccctcggcggccgcgtc	CRISPR spacer
ctgtcctacgtctgggccctcggcggccgcgtc	Protospacer
*********************************

127. spacer 7.1|97970|28|CP029339|CRT matches to NC_010311 (Streptomyces sp. HK1 plasmid pSHK1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtcgtcgtcctcgggcacggcatcaac	CRISPR spacer
cgtcgtcgtcctcgggcacggcatcaac	Protospacer
****************************

128. spacer 7.1|97970|28|CP029339|CRT matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtcgtcgtcctcgggcacggcatcaac	CRISPR spacer
cgtcgtcgtcctcgggcacggcatcaac	Protospacer
****************************

129. spacer 7.1|97970|28|CP029339|CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

cgtcgtcgtcctcgggcacggcatcaac	CRISPR spacer
cgtcgtcgtcctcgggcacggcatcaac	Protospacer
****************************

130. spacer 7.2|98026|33|CP029339|CRT matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtcgtggcccgcgagcctcgccgcaggtagc	CRISPR spacer
acgtcgtggcccgcgagcctcgccgcaggtagc	Protospacer
*********************************

131. spacer 7.2|98026|33|CP029339|CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

acgtcgtggcccgcgagcctcgccgcaggtagc	CRISPR spacer
acgtcgtggcccgcgagcctcgccgcaggtagc	Protospacer
*********************************

132. spacer 7.3|98087|32|CP029339|CRT,CRISPRCasFinder matches to NC_010311 (Streptomyces sp. HK1 plasmid pSHK1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcacgctgagcgcggcgtcccgctcggacag	CRISPR spacer
ttcacgctgagcgcggcgtcccgctcggacag	Protospacer
********************************

133. spacer 7.3|98087|32|CP029339|CRT,CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

ttcacgctgagcgcggcgtcccgctcggacag	CRISPR spacer
ttcacgctgagcgcggcgtcccgctcggacag	Protospacer
********************************

134. spacer 7.3|98087|32|CP029339|CRT,CRISPRCasFinder matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

ttcacgctgagcgcggcgtcccgctcggacag	CRISPR spacer
ttcacgctgagcgcggcgtcccgctcggacag	Protospacer
********************************

135. spacer 7.4|98147|34|CP029339|CRT,CRISPRCasFinder matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

tgggcccgcccacatccccctcgccaccaccgtc	CRISPR spacer
tgggcccgcccacatccccctcgccaccaccgtc	Protospacer
**********************************

136. spacer 7.5|98209|33|CP029339|CRT,CRISPRCasFinder matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

cggcccgtgcagccggagttggggtcgcggggc	CRISPR spacer
cggcccgtgcagccggagttggggtcgcggggc	Protospacer
*********************************

137. spacer 7.6|98270|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

gacgtagcgtcgcggctccggaggatcttcgac	CRISPR spacer
gacgtagcgtcgcggctccggaggatcttcgac	Protospacer
*********************************

138. spacer 7.7|98331|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

aggtcatgccgccacttgggcatggggccagcg	CRISPR spacer
aggtcatgccgccacttgggcatggggccagcg	Protospacer
*********************************

139. spacer 7.8|98392|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

ttctggaagaccggcccgaccgccgagaacccc	CRISPR spacer
ttctggaagaccggcccgaccgccgagaacccc	Protospacer
*********************************

140. spacer 7.9|98453|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

tcgaccacgcgaccctcagtgtccacgcagctc	CRISPR spacer
tcgaccacgcgaccctcagtgtccacgcagctc	Protospacer
*********************************

141. spacer 7.10|98514|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

gaagtggtggaggggtgccctcggggcggccgg	CRISPR spacer
gaagtggtggaggggtgccctcggggcggccgg	Protospacer
*********************************

142. spacer 7.11|98575|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

acgggcgtcgccgtcgagtggctgaaggtgaag	CRISPR spacer
acgggcgtcgccgtcgagtggctgaaggtgaag	Protospacer
*********************************

143. spacer 7.12|98636|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcgcgccgtctacgaactgctcgcacagcgc	CRISPR spacer
gtgcgcgccgtctacgaactgctcgcacagcgc	Protospacer
*********************************

144. spacer 7.13|98697|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

catcaaccgggaaggtctatcggggcctacttc	CRISPR spacer
catcaaccgggaaggtctatcggggcctacttc	Protospacer
*********************************

145. spacer 7.14|98758|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

agcccatcagacgccgtgcgcggcgccatcgcc	CRISPR spacer
agcccatcagacgccgtgcgcggcgccatcgcc	Protospacer
*********************************

146. spacer 7.15|98819|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

ttgacgagcccggtcgtcttcggcagcagcgcg	CRISPR spacer
ttgacgagcccggtcgtcttcggcagcagcgcg	Protospacer
*********************************

147. spacer 7.16|98880|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

ggcgacggcaaggacccgtggacggacgcccag	CRISPR spacer
ggcgacggcaaggacccgtggacggacgcccag	Protospacer
*********************************

148. spacer 7.17|98941|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

gtcgcctcaccgaggacgtgcccgaccacctga	CRISPR spacer
gtcgcctcaccgaggacgtgcccgaccacctga	Protospacer
*********************************

149. spacer 7.18|99002|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

agctcggtgagcttctgattggcggcctcgggg	CRISPR spacer
agctcggtgagcttctgattggcggcctcgggg	Protospacer
*********************************

150. spacer 7.19|99063|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

tactacctctcccccaacaagaccgccgaggac	CRISPR spacer
tactacctctcccccaacaagaccgccgaggac	Protospacer
*********************************

151. spacer 7.20|99124|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

gtcgaacaggtctaccccggctacctggaggag	CRISPR spacer
gtcgaacaggtctaccccggctacctggaggag	Protospacer
*********************************

152. spacer 7.21|99185|33|CP029339|CRT,CRISPRCasFinder matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

aatatgagaattcctgccgcgcgcccgaggggg	CRISPR spacer
aatatgagaattcctgccgcgcgcccgaggggg	Protospacer
*********************************

153. spacer 7.22|99246|33|CP029339|CRT,CRISPRCasFinder matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

cgaggacgtgcccgaccacctgatcccgagcgt	CRISPR spacer
cgaggacgtgcccgaccacctgatcccgagcgt	Protospacer
*********************************

154. spacer 7.23|99307|33|CP029339|CRT,CRISPRCasFinder matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

tcgacgtgggcggcgccgccgtggtcggcgaac	CRISPR spacer
tcgacgtgggcggcgccgccgtggtcggcgaac	Protospacer
*********************************

155. spacer 8.1|109714|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

ccgcgcaggcatcggcgacctgatccagaccag	CRISPR spacer
ccgcgcaggcatcggcgacctgatccagaccag	Protospacer
*********************************

156. spacer 8.2|109775|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

gggcccttcacacaggtcagggcctgccacacg	CRISPR spacer
gggcccttcacacaggtcagggcctgccacacg	Protospacer
*********************************

157. spacer 8.3|109836|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

ggcgacgcggccccggtcgttccggcgcgcacc	CRISPR spacer
ggcgacgcggccccggtcgttccggcgcgcacc	Protospacer
*********************************

158. spacer 8.4|109897|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

gatccggccgagcagcccccgcttcttcggtgc	CRISPR spacer
gatccggccgagcagcccccgcttcttcggtgc	Protospacer
*********************************

159. spacer 8.5|109958|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

ggtcccggctcccccgacaggccggcccttcac	CRISPR spacer
ggtcccggctcccccgacaggccggcccttcac	Protospacer
*********************************

160. spacer 8.6|110019|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

gccgccctctccgagcaggagaagcgcgagaag	CRISPR spacer
gccgccctctccgagcaggagaagcgcgagaag	Protospacer
*********************************

161. spacer 8.6|110019|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NC_019307 (Streptomyces sp. W75 plasmid pCQ4, complete sequence) position: , mismatch: 0, identity: 1.0

gccgccctctccgagcaggagaagcgcgagaag	CRISPR spacer
gccgccctctccgagcaggagaagcgcgagaag	Protospacer
*********************************

162. spacer 8.7|110080|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

cgcgtcctggtggtccgtgatgagctggggggt	CRISPR spacer
cgcgtcctggtggtccgtgatgagctggggggt	Protospacer
*********************************

163. spacer 8.8|110141|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

ccgctaccggtccgcctggcagtccgcccgctt	CRISPR spacer
ccgctaccggtccgcctggcagtccgcccgctt	Protospacer
*********************************

164. spacer 8.9|110202|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 0, identity: 1.0

gctgcccaccagtcacgacggcgccgttgacct	CRISPR spacer
gctgcccaccagtcacgacggcgccgttgacct	Protospacer
*********************************

165. spacer 8.9|110202|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

gctgcccaccagtcacgacggcgccgttgacct	CRISPR spacer
gctgcccaccagtcacgacggcgccgttgacct	Protospacer
*********************************

166. spacer 8.10|110263|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

ccacgcctcccccgccgtcacctcagacgcctc	CRISPR spacer
ccacgcctcccccgccgtcacctcagacgcctc	Protospacer
*********************************

167. spacer 8.11|110324|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

ttccttggatgcgcggaaaagagcaccgccgag	CRISPR spacer
ttccttggatgcgcggaaaagagcaccgccgag	Protospacer
*********************************

168. spacer 8.12|110385|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

cttcgtgctgtcgtggatgacgccgaggttgac	CRISPR spacer
cttcgtgctgtcgtggatgacgccgaggttgac	Protospacer
*********************************

169. spacer 8.13|110446|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

gcgcctgggcctggtcgaggacgcggaggccgg	CRISPR spacer
gcgcctgggcctggtcgaggacgcggaggccgg	Protospacer
*********************************

170. spacer 8.14|110507|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

gtcgctggcccaccgggtgaaccaactggccca	CRISPR spacer
gtcgctggcccaccgggtgaaccaactggccca	Protospacer
*********************************

171. spacer 8.15|110568|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

cacacagtcagcagtctctgtcacgtgtcctcc	CRISPR spacer
cacacagtcagcagtctctgtcacgtgtcctcc	Protospacer
*********************************

172. spacer 8.16|110629|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

cccacttcacggcgtcggacacccactccttga	CRISPR spacer
cccacttcacggcgtcggacacccactccttga	Protospacer
*********************************

173. spacer 8.17|110690|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

gggcgggcccgccaccatcccgaccctcgacgc	CRISPR spacer
gggcgggcccgccaccatcccgaccctcgacgc	Protospacer
*********************************

174. spacer 8.18|110751|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

gatgtactgtccctcgcccttctcctggaagta	CRISPR spacer
gatgtactgtccctcgcccttctcctggaagta	Protospacer
*********************************

175. spacer 8.19|110812|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

gccgatgccgccgccaggtcacccccgcagatc	CRISPR spacer
gccgatgccgccgccaggtcacccccgcagatc	Protospacer
*********************************

176. spacer 8.20|110873|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

tccgggccgagatgcccgaggggtcggccgacg	CRISPR spacer
tccgggccgagatgcccgaggggtcggccgacg	Protospacer
*********************************

177. spacer 8.21|110934|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

gtcggggcggcgcgcgtcggccgcgtacaccac	CRISPR spacer
gtcggggcggcgcgcgtcggccgcgtacaccac	Protospacer
*********************************

178. spacer 8.22|110995|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

ccagacgacagagagccccccggcctccagcag	CRISPR spacer
ccagacgacagagagccccccggcctccagcag	Protospacer
*********************************

179. spacer 8.23|111056|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

ccgccccaggctccgcgccgtacggccgaccgg	CRISPR spacer
ccgccccaggctccgcgccgtacggccgaccgg	Protospacer
*********************************

180. spacer 8.24|111117|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

ggcgggggagcgccacgccgggccgatgtggtg	CRISPR spacer
ggcgggggagcgccacgccgggccgatgtggtg	Protospacer
*********************************

181. spacer 8.25|111178|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

tggcgcttgcggtcgagaacggccccttcggcg	CRISPR spacer
tggcgcttgcggtcgagaacggccccttcggcg	Protospacer
*********************************

182. spacer 8.26|111239|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

gatccgcacctacaaggccgcgccggtctacga	CRISPR spacer
gatccgcacctacaaggccgcgccggtctacga	Protospacer
*********************************

183. spacer 8.27|111300|38|CP029339|PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

gcgttgtagaaaatgccgtccatgtcgatgtccgtcgg	CRISPR spacer
gcgttgtagaaaatgccgtccatgtcgatgtccgtcgg	Protospacer
**************************************

184. spacer 8.28|111366|33|CP029339|PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

gcgcgccacgcaggaccacttggcgcacctgtt	CRISPR spacer
gcgcgccacgcaggaccacttggcgcacctgtt	Protospacer
*********************************

185. spacer 8.29|111300|32|CP029339|CRISPRCasFinder,CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

gcgttgtagaaaatgccgtccatgtcgatgtc	CRISPR spacer
gcgttgtagaaaatgccgtccatgtcgatgtc	Protospacer
********************************

186. spacer 8.30|111360|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 0, identity: 1.0

gcgcgccacgcaggaccacttggcgcacctgtt	CRISPR spacer
gcgcgccacgcaggaccacttggcgcacctgtt	Protospacer
*********************************

187. spacer 1.5|84074|33|CP029339|CRISPRCasFinder,CRT matches to NC_010311 (Streptomyces sp. HK1 plasmid pSHK1, complete sequence) position: , mismatch: 1, identity: 0.97

gcgctgcgtcacggccgtcaggctccggcggag	CRISPR spacer
gcgctgcgtcacggccgtcaggctccgggggag	Protospacer
**************************** ****

188. spacer 1.5|84074|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 1, identity: 0.97

gcgctgcgtcacggccgtcaggctccggcggag	CRISPR spacer
gcgctgcgtcacggccgtcaggctccgggggag	Protospacer
**************************** ****

189. spacer 1.5|84074|33|CP029339|CRISPRCasFinder,CRT matches to ASHF01000034 (Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence) position: , mismatch: 1, identity: 0.97

gcgctgcgtcacggccgtcaggctccggcggag	CRISPR spacer
gcgctgcgtcacggccgtcaggctccgggggag	Protospacer
**************************** ****

190. spacer 1.9|84318|33|CP029339|CRISPRCasFinder,CRT matches to MK392363 (Streptomyces phage Bowden, complete genome) position: , mismatch: 1, identity: 0.97

cggtacgcggtgtgggtcgagggcgacggcacc	CRISPR spacer
tggtacgcggtgtgggtcgagggcgacggcacc	Protospacer
.********************************

191. spacer 1.9|84318|33|CP029339|CRISPRCasFinder,CRT matches to MK460245 (Streptomyces phage BartholomewSD, complete genome) position: , mismatch: 1, identity: 0.97

cggtacgcggtgtgggtcgagggcgacggcacc	CRISPR spacer
tggtacgcggtgtgggtcgagggcgacggcacc	Protospacer
.********************************

192. spacer 1.9|84318|33|CP029339|CRISPRCasFinder,CRT matches to MN234208 (Streptomyces phage Alvy, complete genome) position: , mismatch: 1, identity: 0.97

cggtacgcggtgtgggtcgagggcgacggcacc	CRISPR spacer
tggtacgcggtgtgggtcgagggcgacggcacc	Protospacer
.********************************

193. spacer 1.24|85227|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to ASHF01000034 (Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence) position: , mismatch: 1, identity: 0.97

agcggcaggtccacagtgtcggccacgcgcacc	CRISPR spacer
agcggcaggtccacggtgtcggccacgcgcacc	Protospacer
**************.******************

194. spacer 1.27|84013|37|CP029339|PILER-CR matches to NC_010311 (Streptomyces sp. HK1 plasmid pSHK1, complete sequence) position: , mismatch: 1, identity: 0.973

accgaggaccccgacggcaccgtgctggtctccggaa	CRISPR spacer
accgaggaccccgacggcaccgtgctggtctccggag	Protospacer
************************************.

195. spacer 4.1|88874|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.97

agcaacgccggatcgaccatctccccgaccttc	CRISPR spacer
agcaacgccggatcgaccgtctccccgaccttc	Protospacer
******************.**************

196. spacer 4.12|89545|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NC_013449 (Streptomyces sp. W9 plasmid pCQ3, complete sequence) position: , mismatch: 1, identity: 0.97

gcggtgggtgagccattgccggtataggtcgag	CRISPR spacer
gcggtgggtgagccattgccggtagaggtcgag	Protospacer
************************ ********

197. spacer 4.15|89728|33|CP029339|CRISPRCasFinder,CRT matches to NC_013449 (Streptomyces sp. W9 plasmid pCQ3, complete sequence) position: , mismatch: 1, identity: 0.97

acgcgcctggtgtcgccggcggcgggggagccg	CRISPR spacer
acgcgcctggtatcgccggcggcgggggagccg	Protospacer
***********.*********************

198. spacer 5.1|90308|33|CP029339|CRISPRCasFinder matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 1, identity: 0.97

atggcgtcgaggcggatggagatggtgccgccc	CRISPR spacer
atggcgtcgaggcggatgaagatggtgccgccc	Protospacer
******************.**************

199. spacer 6.1|93224|57|CP029339|CRISPRCasFinder,CRT matches to NC_010311 (Streptomyces sp. HK1 plasmid pSHK1, complete sequence) position: , mismatch: 1, identity: 0.982

ccctgggagatcaggttccggcacctgcggctggccttcttcgccgcccgccgctgg	CRISPR spacer
ccctgggagatcaagttccggcacctgcggctggccttcttcgccgcccgccgctgg	Protospacer
*************.*******************************************

200. spacer 6.1|93224|57|CP029339|CRISPRCasFinder,CRT matches to NC_010311 (Streptomyces sp. HK1 plasmid pSHK1, complete sequence) position: , mismatch: 1, identity: 0.982

ccctgggagatcaggttccggcacctgcggctggccttcttcgccgcccgccgctgg	CRISPR spacer
ccctgggagatcaagttccggcacctgcggctggccttcttcgccgcccgccgctgg	Protospacer
*************.*******************************************

201. spacer 7.1|97970|28|CP029339|CRT matches to ASHF01000034 (Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence) position: , mismatch: 1, identity: 0.964

cgtcgtcgtcctcgggcacggcatcaac	CRISPR spacer
catcgtcgtcctcgggcacggcatcaac	Protospacer
*.**************************

202. spacer 7.2|98026|33|CP029339|CRT matches to NC_010311 (Streptomyces sp. HK1 plasmid pSHK1, complete sequence) position: , mismatch: 1, identity: 0.97

acgtcgtggcccgcgagcctcgccgcaggtagc	CRISPR spacer
acgtcgtggcccgcgagcctcgccgcaggtggc	Protospacer
******************************.**

203. spacer 7.2|98026|33|CP029339|CRT matches to ASHF01000034 (Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence) position: , mismatch: 1, identity: 0.97

acgtcgtggcccgcgagcctcgccgcaggtagc	CRISPR spacer
acgtcgtggcccgcgagccccgccgcaggtagc	Protospacer
*******************.*************

204. spacer 7.5|98209|33|CP029339|CRT,CRISPRCasFinder matches to ASHF01000034 (Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence) position: , mismatch: 1, identity: 0.97

cggcccgtgcagccggagttggggtcgcggggc	CRISPR spacer
cggcccgtgcagccggagtcggggtcgcggggc	Protospacer
*******************.*************

205. spacer 8.6|110019|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to GQ919031 (Streptomyces phage ZL12, complete genome) position: , mismatch: 1, identity: 0.97

gccgccctctccgagcaggagaagcgcgagaag	CRISPR spacer
gccgccctctccgagcaggagaggcgcgagaag	Protospacer
**********************.**********

206. spacer 8.10|110263|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NC_019307 (Streptomyces sp. W75 plasmid pCQ4, complete sequence) position: , mismatch: 1, identity: 0.97

ccacgcctcccccgccgtcacctcagacgcctc	CRISPR spacer
ccacgcctcccccaccgtcacctcagacgcctc	Protospacer
*************.*******************

207. spacer 1.9|84318|33|CP029339|CRISPRCasFinder,CRT matches to MH669016 (Streptomyces phage TrvxScott, complete genome) position: , mismatch: 2, identity: 0.939

cggtacgcggtgtgggtcgagggcgacggcacc	CRISPR spacer
tggtacgcggtgtgggtcgagggggacggcacc	Protospacer
.********************** *********

208. spacer 1.9|84318|33|CP029339|CRISPRCasFinder,CRT matches to MK392365 (Streptomyces phage TinaBelcher, complete genome) position: , mismatch: 2, identity: 0.939

cggtacgcggtgtgggtcgagggcgacggcacc	CRISPR spacer
tggtacgcggtgtgggtcgagggggacggcacc	Protospacer
.********************** *********

209. spacer 1.9|84318|33|CP029339|CRISPRCasFinder,CRT matches to MH651190 (Streptomyces phage Thestral, complete genome) position: , mismatch: 2, identity: 0.939

cggtacgcggtgtgggtcgagggcgacggcacc	CRISPR spacer
tggtacgcggtgtgggtcgagggggacggcacc	Protospacer
.********************** *********

210. spacer 1.9|84318|33|CP029339|CRISPRCasFinder,CRT matches to MK392366 (Streptomyces phage Janus, complete genome) position: , mismatch: 2, identity: 0.939

cggtacgcggtgtgggtcgagggcgacggcacc	CRISPR spacer
tggtacgcggtgtgggtcgagggtgacggcacc	Protospacer
.**********************.*********

211. spacer 1.14|84617|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 2, identity: 0.939

ccgtcctcctggggcggcatgcgtcgcgagcac	CRISPR spacer
ccgtcctcttggggcggcatgcgccgcgagcac	Protospacer
********.**************.*********

212. spacer 4.12|89545|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NC_019307 (Streptomyces sp. W75 plasmid pCQ4, complete sequence) position: , mismatch: 2, identity: 0.939

gcggtgggtgagccattgccggtataggtcgag	CRISPR spacer
gcggtgggtgagtcattgccggtacaggtcgag	Protospacer
************.***********.********

213. spacer 4.13|89606|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NC_019307 (Streptomyces sp. W75 plasmid pCQ4, complete sequence) position: , mismatch: 2, identity: 0.939

gctcgggaacgtcgggctgtgcattacgtgggc	CRISPR spacer
gctcgggaacgtcgggctgtgcattacgcgggt	Protospacer
****************************.***.

214. spacer 6.2|93309|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NC_019307 (Streptomyces sp. W75 plasmid pCQ4, complete sequence) position: , mismatch: 2, identity: 0.939

ctgatggtgatgttcatgcccgagccgtgcagg	CRISPR spacer
gtgatggtggtgttcatgcccgagccgtgcagg	Protospacer
 ********.***********************

215. spacer 8.6|110019|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NC_013449 (Streptomyces sp. W9 plasmid pCQ3, complete sequence) position: , mismatch: 2, identity: 0.939

gccgccctctccgagcaggagaagcgcgagaag	CRISPR spacer
gccgccctctctgagcaggagaagcgcgaaaag	Protospacer
***********.*****************.***

216. spacer 8.10|110263|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NC_013449 (Streptomyces sp. W9 plasmid pCQ3, complete sequence) position: , mismatch: 2, identity: 0.939

ccacgcctcccccgccgtcacctcagacgcctc	CRISPR spacer
ccacgcctcccccaccgtcacctcagacgcttc	Protospacer
*************.****************.**

217. spacer 1.9|84318|33|CP029339|CRISPRCasFinder,CRT matches to NC_018836 (Streptomyces phage phiHau3, complete genome) position: , mismatch: 3, identity: 0.909

cggtacgcggtgtgggtcgagggcgacggcacc	CRISPR spacer
tggtacgcggtgtgggtcgagggcgacgggacg	Protospacer
.**************************** ** 

218. spacer 1.9|84318|33|CP029339|CRISPRCasFinder,CRT matches to MT310862 (Streptomyces phage Itza, complete genome) position: , mismatch: 3, identity: 0.909

cggtacgcggtgtgggtcgagggcgacggcacc	CRISPR spacer
tggtacgcggtgtgggtcgaggggaacggcacc	Protospacer
.********************** .********

219. spacer 1.9|84318|33|CP029339|CRISPRCasFinder,CRT matches to MF766044 (Streptomyces phage Amethyst, complete genome) position: , mismatch: 3, identity: 0.909

cggtacgcggtgtgggtcgagggcgacggcacc	CRISPR spacer
tggtacgcggtgtgggtcgagggctccggcacc	Protospacer
.***********************  *******

220. spacer 1.9|84318|33|CP029339|CRISPRCasFinder,CRT matches to MN234192 (Streptomyces phage Animus, complete genome) position: , mismatch: 3, identity: 0.909

cggtacgcggtgtgggtcgagggcgacggcacc	CRISPR spacer
tggtacgcagtgtgggtcgagggtgacggcacc	Protospacer
.*******.**************.*********

221. spacer 1.9|84318|33|CP029339|CRISPRCasFinder,CRT matches to MN062705 (Streptomyces phage Celia, complete genome) position: , mismatch: 3, identity: 0.909

cggtacgcggtgtgggtcgagggcgacggcacc	CRISPR spacer
tggtacgcggtgtgggtcgaggggaacggcacc	Protospacer
.********************** .********

222. spacer 1.9|84318|33|CP029339|CRISPRCasFinder,CRT matches to MN234189 (Streptomyces phage Urza, complete genome) position: , mismatch: 3, identity: 0.909

cggtacgcggtgtgggtcgagggcgacggcacc	CRISPR spacer
tggtacgcggtgtgggtcgaggggaacggcacc	Protospacer
.********************** .********

223. spacer 1.9|84318|33|CP029339|CRISPRCasFinder,CRT matches to MH669004 (Streptomyces phage Hank144, complete genome) position: , mismatch: 3, identity: 0.909

cggtacgcggtgtgggtcgagggcgacggcacc	CRISPR spacer
tggtacgcggtctgggtcgagggtgacggcacc	Protospacer
.********** ***********.*********

224. spacer 1.9|84318|33|CP029339|CRISPRCasFinder,CRT matches to NC_041856 (Streptomyces phage phiCAM, complete genome) position: , mismatch: 3, identity: 0.909

cggtacgcggtgtgggtcgagggcgacggcacc	CRISPR spacer
tggtacgcggtgtgggtcgaggctgacggcacc	Protospacer
.********************* .*********

225. spacer 1.9|84318|33|CP029339|CRISPRCasFinder,CRT matches to MF766047 (Streptomyces phage SqueakyClean, complete genome) position: , mismatch: 3, identity: 0.909

cggtacgcggtgtgggtcgagggcgacggcacc	CRISPR spacer
tggtacgcagtgtgggtcgagggtgacggcacc	Protospacer
.*******.**************.*********

226. spacer 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009804 (Streptomyces sp. FR-008 plasmid pSSFR2, complete sequence) position: , mismatch: 3, identity: 0.889

tccggggccgcgccatcgccaccgccc	CRISPR spacer
tccggggccgcgtcatcgccatcgcca	Protospacer
************.********.**** 

227. spacer 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029341 (Streptomyces sp. SM17 plasmid pSM17C, complete sequence) position: , mismatch: 3, identity: 0.889

tccggggccgcgccatcgccaccgccc	CRISPR spacer
tccggggccgcgtcatcgccatcgcca	Protospacer
************.********.**** 

228. spacer 1.20|84983|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009804 (Streptomyces sp. FR-008 plasmid pSSFR2, complete sequence) position: , mismatch: 3, identity: 0.909

tatccgtactgctcgtaaatgtaggcgtcggcg	CRISPR spacer
tatccgtactgctcataaatgtaggcgtcggaa	Protospacer
**************.**************** .

229. spacer 4.15|89728|33|CP029339|CRISPRCasFinder,CRT matches to NC_019307 (Streptomyces sp. W75 plasmid pCQ4, complete sequence) position: , mismatch: 3, identity: 0.909

acgcgcctggtgtcgccggcggcgggggagccg	CRISPR spacer
accaggctggtgtcgccggcggcgggggagccg	Protospacer
**  * ***************************

230. spacer 8.24|111117|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022546 (Streptomyces sp. 11-1-2 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.909

ggcgggggagcgccacgccgggccgatgtggtg	CRISPR spacer
agcgggggagcgccgcgccgggccgatgtggtc	Protospacer
.*************.***************** 

231. spacer 8.24|111117|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NC_006911 (Streptomyces sp. F11 plasmid pFP11, complete sequence) position: , mismatch: 3, identity: 0.909

ggcgggggagcgccacgccgggccgatgtggtg	CRISPR spacer
gccgggggagcgccgcgccgggccgatgtggtc	Protospacer
* ************.***************** 

232. spacer 8.24|111117|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020702 (Streptomyces tsukubensis strain NRRL 18488 plasmid pSTS2, complete sequence) position: , mismatch: 3, identity: 0.909

ggcgggggagcgccacgccgggccgatgtggtg	CRISPR spacer
gccgggggagcgccgcgccgggccgatgtggtc	Protospacer
* ************.***************** 

233. spacer 1.5|84074|33|CP029339|CRISPRCasFinder,CRT matches to LN997844 (Streptomyces reticuli genome assembly TUE45, plasmid : III) position: , mismatch: 4, identity: 0.879

gcgctg-cgtcacggccgtcaggctccggcggag	CRISPR spacer
-cgcagtcgtcgcggccgtcaggctccgggggag	Protospacer
 *** * ****.***************** ****

234. spacer 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024423 (Paracoccus yeei strain TT13 plasmid pTT13-1, complete sequence) position: , mismatch: 4, identity: 0.852

tccggggccgcgccatcgccaccgccc	CRISPR spacer
acctgtgccgcgccatcgccaccgcca	Protospacer
 ** * ******************** 

235. spacer 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011665 (Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence) position: , mismatch: 4, identity: 0.852

tccggggccgcgccatcgccaccgccc	CRISPR spacer
agcggggccgcgccctcgccgccgccc	Protospacer
  ************ *****.******

236. spacer 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 4, identity: 0.852

tccggggccgcgccatcgccaccgccc	CRISPR spacer
agcggggccgcgccctcgccgccgccc	Protospacer
  ************ *****.******

237. spacer 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852

tccggggccgcgccatcgccaccgccc	CRISPR spacer
tccggggccgcgccaccggcaccgaca	Protospacer
***************.** ***** * 

238. spacer 6.2|93309|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to MT889368 (Gordonia phage Sam12, complete genome) position: , mismatch: 4, identity: 0.879

ctgatggtgatgttcatgcccgagccgtgcagg-	CRISPR spacer
ctgatgggaatgttcatgcccgagccg-gtaggc	Protospacer
******* .****************** *.*** 

239. spacer 6.2|93309|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to MK433265 (Gordonia phage Exiguo, complete genome) position: , mismatch: 4, identity: 0.879

ctgatggtgatgttcatgcccgagccgtgcagg-	CRISPR spacer
ctgatgggaatgttcatgcccgagccg-gtaggc	Protospacer
******* .****************** *.*** 

240. spacer 6.2|93309|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to MG770211 (Gordonia phage Flakey, complete genome) position: , mismatch: 4, identity: 0.879

ctgatggtgatgttcatgcccgagccgtgcagg-	CRISPR spacer
ctgatgggaatgttcatgcccgagccg-gtaggc	Protospacer
******* .****************** *.*** 

241. spacer 6.2|93309|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NC_031229 (Gordonia phage Hotorobo, complete genome) position: , mismatch: 4, identity: 0.879

ctgatggtgatgttcatgcccgagccgtgcagg-	CRISPR spacer
ctgatgggaatgttcatgcccgagccg-gtaggc	Protospacer
******* .****************** *.*** 

242. spacer 7.10|98514|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.879

gaagtggtggaggggtgccctcggggcggccgg	CRISPR spacer
tccgtggtggaggggcgccctcggggcggccgg	Protospacer
   ************.*****************

243. spacer 8.1|109714|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 4, identity: 0.879

ccgcgca-ggcatcggcgacctgatccagaccag	CRISPR spacer
-cgcggacggcaagggcgacctgatccagaccag	Protospacer
 **** * ****  ********************

244. spacer 8.1|109714|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 4, identity: 0.879

ccgcgca-ggcatcggcgacctgatccagaccag	CRISPR spacer
-cgcggacggcaagggcgacctgatccagaccag	Protospacer
 **** * ****  ********************

245. spacer 8.1|109714|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 4, identity: 0.879

ccgcgca-ggcatcggcgacctgatccagaccag	CRISPR spacer
-cgcggacggcaagggcgacctgatccagaccag	Protospacer
 **** * ****  ********************

246. spacer 1.5|84074|33|CP029339|CRISPRCasFinder,CRT matches to NC_004934 (Streptomyces violaceoruber strain SANK95570 plasmid pSV2, complete sequence) position: , mismatch: 5, identity: 0.848

gcgctg-cgtcacggccgtcaggctccggcggag	CRISPR spacer
-cacagtcgtcgcggccgtcaggctccggaggag	Protospacer
 *.* * ****.***************** ****

247. spacer 1.5|84074|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP026654 (Streptomyces dengpaensis strain XZHG99 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.848

gcgctg-cgtcacggccgtcaggctccggcggag	CRISPR spacer
-cacagtcgtcgcggccgtcaggctccggaggag	Protospacer
 *.* * ****.***************** ****

248. spacer 1.9|84318|33|CP029339|CRISPRCasFinder,CRT matches to MH248947 (Streptomyces phage Yosif, complete genome) position: , mismatch: 5, identity: 0.848

cggtacgcggtgtgggtcgagggcgacggcacc	CRISPR spacer
tactacgcggtgtgggtccagggtgacggcacc	Protospacer
.. *************** ****.*********

249. spacer 1.9|84318|33|CP029339|CRISPRCasFinder,CRT matches to MK524524 (Streptomyces phage Caelum, complete genome) position: , mismatch: 5, identity: 0.848

cggtacgcggtgtgggtcgagggcgacggcacc	CRISPR spacer
tactacgcggtgtgggtcgagggcgatggaacc	Protospacer
.. ***********************.** ***

250. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 5, identity: 0.848

cgccagagcgccggccgccgtgccagagccgta--	CRISPR spacer
cgccacagcgccggccgccgcgcc--cgccgtatc	Protospacer
***** **************.***   ******  

251. spacer 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 5, identity: 0.815

tccggggccgcgccatcgccaccgccc	CRISPR spacer
tggtcgaccgcgccatcgccaccgccc	Protospacer
*    *.********************

252. spacer 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

tccggggccgcgccatcgccaccgccc	CRISPR spacer
gcgcgggcggcgccatcgccaccgccg	Protospacer
 *  **** ***************** 

253. spacer 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022541 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence) position: , mismatch: 5, identity: 0.815

tccggggccgcgccatcgccaccgccc	CRISPR spacer
ggctgggccgcgccattgcaaccgccc	Protospacer
  * ************.** *******

254. spacer 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029986 (Sphingomonas sp. FARSPH plasmid p01, complete sequence) position: , mismatch: 5, identity: 0.815

tccggggccgcgccatcgccaccgccc	CRISPR spacer
gcaggagccgcgccatcgccagcgccg	Protospacer
 * **.*************** **** 

255. spacer 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NC_008826 (Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence) position: , mismatch: 5, identity: 0.815

tccggggccgcgccatcgccaccgccc	CRISPR spacer
accggggccgcgacatcgccacgcccg	Protospacer
 *********** *********  ** 

256. spacer 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NC_008826 (Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence) position: , mismatch: 5, identity: 0.815

tccggggccgcgccatcgccaccgccc	CRISPR spacer
accggggccgcgacatcgccacgcccg	Protospacer
 *********** *********  ** 

257. spacer 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026518 (Deinococcus sp. NW-56 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815

tccggggccgcgccatcgccaccgccc	CRISPR spacer
tcctggcccgcgccatcgccacccgcg	Protospacer
*** ** ****************  * 

258. spacer 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.815

--tccggggccgcgccatcgccaccgccc	CRISPR spacer
ggtcc--aaccgcgccatcgccaccgccg	Protospacer
  ***  ..******************* 

259. spacer 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to MK416018 (Klebsiella phage ST147-VIM1phi7.1, complete genome) position: , mismatch: 5, identity: 0.815

tccggggccgcgccatcgccaccgccc	CRISPR spacer
accggggccgcgccagcgccagcgagc	Protospacer
 ************** ***** **  *

260. spacer 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to KX752698 (Mycobacterium phage Tonenili, complete genome) position: , mismatch: 5, identity: 0.815

tccggggccgcgccatcgccaccgccc	CRISPR spacer
tccggggccgcaccatcgcctcctaca	Protospacer
***********.******** **  * 

261. spacer 1.28|84074|37|CP029339|PILER-CR matches to NC_010311 (Streptomyces sp. HK1 plasmid pSHK1, complete sequence) position: , mismatch: 5, identity: 0.865

gcgctgcgtcacggccgtcaggctccggcggagggaa	CRISPR spacer
gcgctgcgtcacggccgtcaggctccgggggagtttg	Protospacer
**************************** ****   .

262. spacer 1.28|84074|37|CP029339|PILER-CR matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 5, identity: 0.865

gcgctgcgtcacggccgtcaggctccggcggagggaa	CRISPR spacer
gcgctgcgtcacggccgtcaggctccgggggagtttg	Protospacer
**************************** ****   .

263. spacer 1.28|84074|37|CP029339|PILER-CR matches to ASHF01000034 (Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence) position: , mismatch: 5, identity: 0.865

gcgctgcgtcacggccgtcaggctccggcggagggaa	CRISPR spacer
gcgctgcgtcacggccgtcaggctccgggggagtttg	Protospacer
**************************** ****   .

264. spacer 1.32|84318|37|CP029339|PILER-CR matches to MK392363 (Streptomyces phage Bowden, complete genome) position: , mismatch: 5, identity: 0.865

cggtacgcggtgtgggtcgagggcgacggcaccggag	CRISPR spacer
tggtacgcggtgtgggtcgagggcgacggcaccttct	Protospacer
.********************************    

265. spacer 1.32|84318|37|CP029339|PILER-CR matches to MK460245 (Streptomyces phage BartholomewSD, complete genome) position: , mismatch: 5, identity: 0.865

cggtacgcggtgtgggtcgagggcgacggcaccggag	CRISPR spacer
tggtacgcggtgtgggtcgagggcgacggcaccttct	Protospacer
.********************************    

266. spacer 1.32|84318|37|CP029339|PILER-CR matches to MN234208 (Streptomyces phage Alvy, complete genome) position: , mismatch: 5, identity: 0.865

cggtacgcggtgtgggtcgagggcgacggcaccggag	CRISPR spacer
tggtacgcggtgtgggtcgagggcgacggcaccttct	Protospacer
.********************************    

267. spacer 2.3|86815|33|CP029339|CRT,CRISPRCasFinder matches to NZ_CP011665 (Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence) position: , mismatch: 5, identity: 0.848

gaccgcgacgtcaagaagcgctgg--gccgaagat	CRISPR spacer
gaccgcgaggtcaagaagcggtggcagccgcag--	Protospacer
******** *********** ***  **** **  

268. spacer 6.2|93309|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to MK433261 (Gordonia phage Msay19, complete genome) position: , mismatch: 5, identity: 0.848

ctgatggtgatgttcatgcccgagccgtgcagg-	CRISPR spacer
ctgatgggaatgttcatgcccgagccg-gtgggt	Protospacer
******* .****************** *..** 

269. spacer 6.2|93309|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to MG757152 (Gordonia phage Adgers, complete genome) position: , mismatch: 5, identity: 0.848

ctgatggtgatgttcatgcccgagccgtgcagg-	CRISPR spacer
ctgatgggaatgttcatgcccgagccg-gtgggt	Protospacer
******* .****************** *..** 

270. spacer 6.2|93309|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to MG757155 (Gordonia phage Boneham, complete genome) position: , mismatch: 5, identity: 0.848

ctgatggtgatgttcatgcccgagccgtgcagg-	CRISPR spacer
ctgatgggaatgttcatgcccgagcc-tgtgggc	Protospacer
******* .***************** **..** 

271. spacer 6.2|93309|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NC_048820 (Gordonia phage Jellybones, complete genome) position: , mismatch: 5, identity: 0.848

ctgatggtgatgttcatgcccgagccgtgcagg-	CRISPR spacer
ctgatgggaatgttcatgcccgagcc-tgtgggc	Protospacer
******* .***************** **..** 

272. spacer 6.2|93309|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to MK433263 (Gordonia phage FelixAlejandro, complete genome) position: , mismatch: 5, identity: 0.848

ctgatggtgatgttcatgcccgagccgtgcagg-	CRISPR spacer
ctgatgggaatgttcatgcccgagcc-tgtgggc	Protospacer
******* .***************** **..** 

273. spacer 6.2|93309|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to MK359302 (Gordonia phage Sombrero, complete genome) position: , mismatch: 5, identity: 0.848

ctgatggtgatgttcatgcccgagccgtgcagg-	CRISPR spacer
ctgatgggaatgttcatgcccgagcc-tgtgggc	Protospacer
******* .***************** **..** 

274. spacer 6.2|93309|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NC_047892 (Gordonia phage BirksAndSocks, complete genome) position: , mismatch: 5, identity: 0.848

ctgatggtgatgttcatgcccgagccgtgcagg-	CRISPR spacer
ctgatgggaatgttcatgcccgagcc-tgtgggc	Protospacer
******* .***************** **..** 

275. spacer 6.2|93309|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to MK433267 (Gordonia phage Butterball, complete genome) position: , mismatch: 5, identity: 0.848

ctgatggtgatgttcatgcccgagccgtgcagg-	CRISPR spacer
ctgatgggaatgttcatgcccgagcc-tgtgggc	Protospacer
******* .***************** **..** 

276. spacer 7.1|97970|28|CP029339|CRT matches to NC_010311 (Streptomyces sp. HK1 plasmid pSHK1, complete sequence) position: , mismatch: 5, identity: 0.821

cgtcgtcgtcctcgggcacggcatcaac	CRISPR spacer
cgtcgtcctcctcgggcccggcacccgc	Protospacer
******* ********* *****.* .*

277. spacer 7.1|97970|28|CP029339|CRT matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 5, identity: 0.821

cgtcgtcgtcctcgggcacggcatcaac	CRISPR spacer
cgtcgtcctcctcgggcccggcacccgc	Protospacer
******* ********* *****.* .*

278. spacer 7.1|97970|28|CP029339|CRT matches to ASHF01000034 (Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence) position: , mismatch: 5, identity: 0.821

cgtcgtcgtcctcgggcacggcatcaac	CRISPR spacer
cgtcgtcctcctcgggcccggcacccgc	Protospacer
******* ********* *****.* .*

279. spacer 7.1|97970|28|CP029339|CRT matches to NZ_CP041653 (Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence) position: , mismatch: 5, identity: 0.821

cgtcgtcgtcctcgggcacggcatcaac	CRISPR spacer
cgccgacgtcctcgggcacggcatgacg	Protospacer
**.** ****************** *  

280. spacer 7.1|97970|28|CP029339|CRT matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

cgtcgtcgtcctcgggcacggcatcaac	CRISPR spacer
cgtcgtcctcctcgggcccggcacccgc	Protospacer
******* ********* *****.* .*

281. spacer 7.1|97970|28|CP029339|CRT matches to NZ_CP043960 (Streptomyces tendae strain 139 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

cgtcgtcgtcctcgggcacggcatcaac	CRISPR spacer
cgtcgtcgtcctcggtcacggagtcggc	Protospacer
*************** ***** .**..*

282. spacer 7.1|97970|28|CP029339|CRT matches to MN204493 (Streptomyces phage Zuko, complete genome) position: , mismatch: 5, identity: 0.821

cgtcgtcgtcctcgggcacggcatcaac	CRISPR spacer
cgtcgtcgtcctcggggacggtgtcgtc	Protospacer
**************** ****..**. *

283. spacer 7.4|98147|34|CP029339|CRT,CRISPRCasFinder matches to NZ_CP029341 (Streptomyces sp. SM17 plasmid pSM17C, complete sequence) position: , mismatch: 5, identity: 0.853

tgggcccgcccacatccccctcgccaccaccgtc	CRISPR spacer
ctgggccgcccacatccccctcgccaccacctgc	Protospacer
. ** **************************  *

284. spacer 7.23|99307|33|CP029339|CRT,CRISPRCasFinder matches to NZ_LR134458 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 16, complete sequence) position: , mismatch: 5, identity: 0.848

tcgacgtgggcggcgccgccgtggtcggcgaac	CRISPR spacer
tagccgcgggcggcgcggccgtggtcggcgagc	Protospacer
* * **.********* **************.*

285. spacer 1.4|84013|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP053565 (Pseudonocardia sp. Gen01 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.818

accgaggaccccgacggcaccgtgctggtctcc	CRISPR spacer
gccgagcaccccggcggcaccgtgctgggcgtc	Protospacer
.***** ******.************** * .*

286. spacer 1.5|84074|33|CP029339|CRISPRCasFinder,CRT matches to CP054922 (Streptomyces sp. NA03103 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.818

gcgctgcgtcacggccgtcaggctccggcggag	CRISPR spacer
gcaagtcgtcgcggccgtcaggctccgggggag	Protospacer
**.   ****.***************** ****

287. spacer 1.5|84074|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP010408 (Streptomyces vietnamensis strain GIMV4.0001 plasmid pSVL1, complete sequence) position: , mismatch: 6, identity: 0.818

gcgctg-cgtcacggccgtcaggctccggcggag	CRISPR spacer
-cacagttgtcgcggccgtcaggctccggaggag	Protospacer
 *.* * .***.***************** ****

288. spacer 1.5|84074|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP016084 (Streptomyces sp. SAT1 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.818

gcgctgcg-tcacggccgtcaggctccggcggag	CRISPR spacer
-cacagtgatcgcggccgtcaggctccgggggag	Protospacer
 *.* *.* **.***************** ****

289. spacer 1.9|84318|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 6, identity: 0.818

cggtacgcggtgtgggtcgagggcgacggcacc	CRISPR spacer
ccttacgcgttgtgggtcgaggtcgacggcaag	Protospacer
*  ****** ************ ********  

290. spacer 1.9|84318|33|CP029339|CRISPRCasFinder,CRT matches to MT701598 (Streptomyces phage Sitrop, complete genome) position: , mismatch: 6, identity: 0.818

cggtacgcggtgtgggtcgagggcgacggcacc	CRISPR spacer
tggtacgcggtgtgggtcgacggcaaccacaac	Protospacer
.******************* ***.** .** *

291. spacer 1.9|84318|33|CP029339|CRISPRCasFinder,CRT matches to JQ807246 (Environmental Halophage eHP-27, partial genome) position: , mismatch: 6, identity: 0.818

-cggtacgcggtgtgggtcgagggcgacggcacc	CRISPR spacer
tctgt-ctcggtgtcgggcgagggcgacggcaac	Protospacer
 * ** * ****** ** ************** *

292. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818

cgccagagcgccggccgccgtgccagagccgta	CRISPR spacer
cgccagcgcgccgtccgccgtgccagaggaggt	Protospacer
****** ****** **************  *  

293. spacer 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019603 (Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence) position: , mismatch: 6, identity: 0.778

tccggggccgcgccatcgccaccgccc	CRISPR spacer
gaggttgccgcgccatcgccgccgccc	Protospacer
   *  **************.******

294. spacer 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

tccggggccgcgccatcgccaccgccc	CRISPR spacer
tccggggccgcgacatcgccatgatct	Protospacer
************ ********. ..*.

295. spacer 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053709 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778

tccggggccgcgccatcgccaccgccc	CRISPR spacer
ccgtcagccgcgccagcgccaccgccc	Protospacer
.*   .********* ***********

296. spacer 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014797 (Salipiger profundus strain JLT2016 plasmid pTPRO1, complete sequence) position: , mismatch: 6, identity: 0.778

tccggggccgcgccatcgccaccgccc	CRISPR spacer
ctcggtgccgcgccatcgccaccccgg	Protospacer
..*** ***************** *  

297. spacer 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045548 (Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778

tccggggccgcgccatcgccaccgccc	CRISPR spacer
gtctcggccgcgccttcgccaccgccg	Protospacer
 .*  ********* *********** 

298. spacer 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to MT210154 (Xanthomonas phage PPDBI, complete genome) position: , mismatch: 6, identity: 0.778

tccggggccgcgccatcgccaccgccc	CRISPR spacer
gcgtatgccgggccatcgccaccgccc	Protospacer
 *  . **** ****************

299. spacer 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to MN582093 (Podoviridae sp. ctviO18, complete genome) position: , mismatch: 6, identity: 0.778

tccggggccgcgccatcgccaccgccc	CRISPR spacer
gtagcggccgcgccatctccaccgcct	Protospacer
 . * ************ ********.

300. spacer 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to MT119766 (Xanthomonas phage PBR31, complete genome) position: , mismatch: 6, identity: 0.778

tccggggccgcgccatcgccaccgccc	CRISPR spacer
gcgtatgccgggccatcgccaccgccc	Protospacer
 *  . **** ****************

301. spacer 1.32|84318|37|CP029339|PILER-CR matches to MH669016 (Streptomyces phage TrvxScott, complete genome) position: , mismatch: 6, identity: 0.838

cggtacgcggtgtgggtcgagggcgacggcaccggag	CRISPR spacer
tggtacgcggtgtgggtcgagggggacggcaccttct	Protospacer
.********************** *********    

302. spacer 1.32|84318|37|CP029339|PILER-CR matches to MK392365 (Streptomyces phage TinaBelcher, complete genome) position: , mismatch: 6, identity: 0.838

cggtacgcggtgtgggtcgagggcgacggcaccggag	CRISPR spacer
tggtacgcggtgtgggtcgagggggacggcaccttct	Protospacer
.********************** *********    

303. spacer 1.32|84318|37|CP029339|PILER-CR matches to MH651190 (Streptomyces phage Thestral, complete genome) position: , mismatch: 6, identity: 0.838

cggtacgcggtgtgggtcgagggcgacggcaccggag	CRISPR spacer
tggtacgcggtgtgggtcgagggggacggcaccttct	Protospacer
.********************** *********    

304. spacer 1.32|84318|37|CP029339|PILER-CR matches to MK392366 (Streptomyces phage Janus, complete genome) position: , mismatch: 6, identity: 0.838

cggtacgcggtgtgggtcgagggcgacggcaccggag	CRISPR spacer
tggtacgcggtgtgggtcgagggtgacggcaccttct	Protospacer
.**********************.*********    

305. spacer 2.4|86876|33|CP029339|CRT,CRISPRCasFinder matches to NZ_CP021083 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence) position: , mismatch: 6, identity: 0.818

accggccacgcgcccagctcggtgacgccgtac-	CRISPR spacer
gccggccacccgcccagctcgctgac-cagcacc	Protospacer
.******** *********** **** * *.** 

306. spacer 3.4|87577|33|CP029339|CRISPRCasFinder matches to NZ_LT703506 (Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 2) position: , mismatch: 6, identity: 0.818

-cgtcactacgacccgaccggtgcccggtacggc	CRISPR spacer
acgat-ctacgaccccaccggtgcctggtacggg	Protospacer
 ** . ********* *********.******* 

307. spacer 6.2|93309|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015882 (Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence) position: , mismatch: 6, identity: 0.818

ctgatggtgatgttcatgcccgagcc-gtgcagg	CRISPR spacer
gtcatggtgatgttcatgcgcgaaccggtgcgg-	Protospacer
 * **************** ***.** ****.* 

308. spacer 7.1|97970|28|CP029339|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.786

cgtcgtcgtcctcgggcacggcatcaac	CRISPR spacer
cgtcgtcgtgctcgggcacggttccggc	Protospacer
********* ***********. .*..*

309. spacer 7.1|97970|28|CP029339|CRT matches to NZ_CP011665 (Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence) position: , mismatch: 6, identity: 0.786

cgtcgtcgtcctcgggcacggcatcaac	CRISPR spacer
cgtcgacgtcctcgggcacggcgagata	Protospacer
***** ****************.  *  

310. spacer 7.1|97970|28|CP029339|CRT matches to NZ_CP014169 (Sphingomonas panacis strain DCY99 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

cgtcgtcgtcctcgggcacggcatcaac	CRISPR spacer
cttcgtcgtcctcggtcacggcataggg	Protospacer
* ************* ******** .. 

311. spacer 7.1|97970|28|CP029339|CRT matches to NC_015727 (Cupriavidus necator N-1 plasmid pBB1, complete sequence) position: , mismatch: 6, identity: 0.786

cgtcgtcgtcctcgggcacggcatcaac	CRISPR spacer
cgtcgtcgtgatcgggcacggcaaattc	Protospacer
*********  ************    *

312. spacer 7.1|97970|28|CP029339|CRT matches to NZ_CP020698 (Sulfitobacter sp. D7 plasmid p4SUD7, complete sequence) position: , mismatch: 6, identity: 0.786

cgtcgtcgtcctcgggcacggcatcaac	CRISPR spacer
ccaggtcgtccttgggcgcggcatcaaa	Protospacer
*   ********.****.********* 

313. spacer 7.1|97970|28|CP029339|CRT matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 6, identity: 0.786

cgtcgtcgtcctcgggcacggcatcaac	CRISPR spacer
cgtcgtcttcctcgggctcggcacctgg	Protospacer
******* ********* *****.* . 

314. spacer 7.1|97970|28|CP029339|CRT matches to NZ_CP020447 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed7, complete sequence) position: , mismatch: 6, identity: 0.786

cgtcgtcgtcctcgggcacggcatcaac	CRISPR spacer
catcgtcgtcctcggtcacggcaacgct	Protospacer
*.************* ******* *. .

315. spacer 7.1|97970|28|CP029339|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

cgtcgtcgtcctcgggcacggcatcaac	CRISPR spacer
tgtcgtcgtgctcgtgcacggcatgggc	Protospacer
.******** **** ********* ..*

316. spacer 7.1|97970|28|CP029339|CRT matches to MH371110 (Mycobacterium phage Magnar, complete genome) position: , mismatch: 6, identity: 0.786

cgtcgtcgtcctcgggcacggcatcaac	CRISPR spacer
acacatcatcctcgggcacggcatccac	Protospacer
   *.**.***************** **

317. spacer 7.1|97970|28|CP029339|CRT matches to MK061415 (Mycobacterium phage Rhynn, complete genome) position: , mismatch: 6, identity: 0.786

cgtcgtcgtcctcgggcacggcatcaac	CRISPR spacer
acacatcatcctcgggcacggcatccac	Protospacer
   *.**.***************** **

318. spacer 7.1|97970|28|CP029339|CRT matches to KP027205 (Mycobacterium phage Alvin, complete genome) position: , mismatch: 6, identity: 0.786

cgtcgtcgtcctcgggcacggcatcaac	CRISPR spacer
acacatcatcctcgggcacggcatccac	Protospacer
   *.**.***************** **

319. spacer 7.3|98087|32|CP029339|CRT,CRISPRCasFinder matches to AF447491 (Bacteriophage phiE125, complete genome) position: , mismatch: 6, identity: 0.812

ttcacgctgagcgcggcgtcccgct--cggacag	CRISPR spacer
atctcgctgagcgcggcgtctcgctacccgac--	Protospacer
 ** ****************.****  * ***  

320. spacer 7.3|98087|32|CP029339|CRT,CRISPRCasFinder matches to NC_003309 (Burkholderia phage phiE125, complete genome) position: , mismatch: 6, identity: 0.812

ttcacgctgagcgcggcgtcccgct--cggacag	CRISPR spacer
atctcgctgagcgcggcgtctcgctacccgac--	Protospacer
 ** ****************.****  * ***  

321. spacer 7.4|98147|34|CP029339|CRT,CRISPRCasFinder matches to NZ_CP009804 (Streptomyces sp. FR-008 plasmid pSSFR2, complete sequence) position: , mismatch: 6, identity: 0.824

tgggcccgcccacatccccctcgccaccaccgtc	CRISPR spacer
ctgggccgcccatatccccctcgccaccacctgc	Protospacer
. ** *******.******************  *

322. spacer 7.15|98819|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP011523 (Streptomyces sp. CFMR 7 strain CFMR-7 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818

-ttgacgagcccggtcgtcttcggcagcagcgcg	CRISPR spacer
ggcggcga-cccggtcggcttcggcagcagcccg	Protospacer
  .*.*** ******** ************* **

323. spacer 7.17|98941|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 6, identity: 0.818

gtcgcctcaccgaggacgtgcccgaccacctga	CRISPR spacer
cggggccgaccgaggacgtgcccgaccacctga	Protospacer
   * *. *************************

324. spacer 7.23|99307|33|CP029339|CRT,CRISPRCasFinder matches to NZ_LR134459 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence) position: , mismatch: 6, identity: 0.818

tcgacgtgggcggcgccgccgtggtcggcgaac-	CRISPR spacer
acgacgagggcgccgccgccgtggtcga-gaccg	Protospacer
 ***** ***** **************. ** * 

325. spacer 8.1|109714|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 6, identity: 0.818

ccgcgcaggcatcggcgacctgatccagaccag--	CRISPR spacer
gcgcgccggcatcgacgacctgatcc--atcagga	Protospacer
 ***** *******.***********  *.***  

326. spacer 8.13|110446|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134458 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 16, complete sequence) position: , mismatch: 6, identity: 0.818

---gcgcctgggcctggtcgaggacgcggaggccgg	CRISPR spacer
gatgggcc---gcctcgtcgaggacgcgcaggccgg	Protospacer
   * ***   **** ************ *******

327. spacer 1.1|83832|31|CP029339|CRISPRCasFinder,CRT matches to NZ_CP019203 (Salmonella enterica subsp. enterica serovar Infantis strain CFSAN003307 plasmid pCFSAN003307, complete sequence) position: , mismatch: 7, identity: 0.774

ggcagcgccgggcgtagcgggctgcgtcgtg	CRISPR spacer
agaactgacgggcgtagcaggctgcgacgtg	Protospacer
.* * .* **********.******* ****

328. spacer 1.1|83832|31|CP029339|CRISPRCasFinder,CRT matches to NZ_LN868945 (Salmonella enterica subsp. enterica serovar Senftenberg strain NCTC10384 plasmid 3, complete sequence) position: , mismatch: 7, identity: 0.774

ggcagcgccgggcgtagcgggctgcgtcgtg	CRISPR spacer
agaactgacgggcgtagcaggctgcgacgtg	Protospacer
.* * .* **********.******* ****

329. spacer 1.4|84013|33|CP029339|CRISPRCasFinder,CRT matches to CP040467 (Streptomyces albidoflavus strain UYFA156 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

accgaggaccccgacggcaccgtgctggtctcc	CRISPR spacer
ccgctcgaccccgacggcaccgtcctggtcacc	Protospacer
 *    ***************** ****** **

330. spacer 1.4|84013|33|CP029339|CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 7, identity: 0.788

accgaggaccccgacggcaccgtgctggtctcc	CRISPR spacer
cgccgggaccccgacggcaccgggctgggcttc	Protospacer
  * .***************** ***** **.*

331. spacer 1.4|84013|33|CP029339|CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 7, identity: 0.788

accgaggaccccgacggcaccgtgctggtctcc	CRISPR spacer
cgccgggaccccgacggcaccgggctgggcttc	Protospacer
  * .***************** ***** **.*

332. spacer 1.5|84074|33|CP029339|CRISPRCasFinder,CRT matches to NC_003903 (Streptomyces coelicolor A3(2) plasmid SCP1, complete sequence) position: , mismatch: 7, identity: 0.788

gcgctgcgtcacggccgtcaggctccggcggag	CRISPR spacer
acaagtcgtcgcggccgtcaggctccgggggag	Protospacer
.*.   ****.***************** ****

333. spacer 1.9|84318|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP032053 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL2, complete sequence) position: , mismatch: 7, identity: 0.788

cggtacgcggtgtgggtcgagggcgacggcacc	CRISPR spacer
caggacgcggtgtggggcgagggcgacgagatg	Protospacer
*.* ************ ***********. *. 

334. spacer 1.9|84318|33|CP029339|CRISPRCasFinder,CRT matches to NC_008697 (Nocardioides sp. JS614 plasmid pNOCA01, complete sequence) position: , mismatch: 7, identity: 0.788

cggtacgcggtgtgggtcgagggcgacggcacc	CRISPR spacer
cagatcgcggtgtgggtcgagggcgagggacct	Protospacer
*.*  ********************* **  *.

335. spacer 1.9|84318|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP045549 (Streptomyces sp. SYP-A7193 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.788

-cggtacgcggtgtgggtcgagggcgacggcacc	CRISPR spacer
gtggtg-gcggtgtcggtcgagggcgccggccgc	Protospacer
 .***. ******* *********** ****  *

336. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to NC_016972 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG2, complete sequence) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta	CRISPR spacer
cccgtcgccgccggccgccgtgcctgagccgta	Protospacer
* *   . **************** ********

337. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 7, identity: 0.788

-cgccagagcgccggccgccgtgccagagccgta	CRISPR spacer
acgac-cagcgccggccgccgggccagggccgcc	Protospacer
 ** *  ************** *****.****. 

338. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to KM389460 (UNVERIFIED: Pseudomonas phage F_MX560sp/Pa1651 clone contig00001 genomic sequence) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

339. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to KM389326 (UNVERIFIED: Pseudomonas phage F_KK2074sp/Pa1651 clone contig00001 genomic sequence) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

340. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to KM389461 (UNVERIFIED: Pseudomonas phage F_TK432sp/Pa1651 clone ctg7180000000005 genomic sequence) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

341. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to KM389462 (UNVERIFIED: Pseudomonas phage JBD23 clone contig00001 genomic sequence) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

342. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to KM389464 (UNVERIFIED: Pseudomonas phage JBDs5 clone contig00001 genomic sequence) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

343. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to LN907801 (unidentified phage genome assembly 2P1, chromosome : 2P1) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

344. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to AY394005 (Bacteriophage D3112, complete genome) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

345. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to LT999987 (Pseudomonas phage vB_PaeS_PAO1_HW12 genome assembly, complete genome: monopartite) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

346. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to NC_009818 (Pseudomonas phage MP22, complete genome) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

347. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to JN811560 (Pseudomonas phage JBD26, complete genome) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

348. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to KM389337 (UNVERIFIED: Pseudomonas phage JBD58a clone contig00002 genomic sequence) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

349. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to MK511036 (Pseudomonas phage BR327, partial genome) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

350. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to MH643777 (Pseudomonas phage YMC12/01/R960, complete genome) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

351. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to MK511031 (Pseudomonas phage BR52, partial genome) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

352. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to MK511034 (Pseudomonas phage BR243, partial genome) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

353. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to MK511033 (Pseudomonas phage BR205, partial genome) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

354. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to NC_027298 (Pseudomonas phage LPB1, complate genome) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

355. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to JQ762257 (Pseudomonas phage MP42, complete genome) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

356. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to MK511017 (Pseudomonas phage CF23, partial genome) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

357. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to JX434033 (Pseudomonas phage JBD88a, complete genome) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

358. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to KM389242 (UNVERIFIED: Pseudomonas phage F_TK1932sp/Pa1651 clone contig00001 genomic sequence) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

359. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to KM389278 (UNVERIFIED: Pseudomonas phage Phi05_1400 B clone contig00006 genomic sequence) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

360. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to MK144667 (Pseudomonas phage Spike, complete genome) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

361. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to KM389260 (UNVERIFIED: Pseudomonas phage F_ET2439sp/Pa1651 clone ctg7180000000618 genomic sequence) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

362. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to MH643778 (Pseudomonas phage YMC12/01/R24, complete genome) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

363. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to MK511018 (Pseudomonas phage CF28, partial genome) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

364. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to KU199707 (Pseudomonas phage JBD16C, partial genome) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

365. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to JQ067085 (Pseudomonas phage PaMx73, complete genome) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

366. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to KT968832 (Pseudomonas phage YMC11/11/R1836, complete genome) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

367. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to MK511026 (Pseudomonas phage CF121, partial genome) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

368. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to NC_041851 (Pseudomonas phage F_HA0480sp/Pa1651, complete genome) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

369. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to KJ477077 (Pseudomonas phage JD024, complete genome) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

370. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to LT608331 (Pseudomonas phage vB_PaeS_PcyII-40_PfII40a isolate PfII40A_reads genome assembly, chromosome: PFII40A) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

371. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to NC_026601 (Pseudomonas phage vB_PaeS_PAO1_Ab30, complete genome) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

372. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to JX434030 (Pseudomonas phage JBD5, complete genome) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

373. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to NC_030918 (Pseudomonas phage JBD93, complete genome) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

374. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to NC_005178 (Pseudomonas phage D3112, complete genome) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

375. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to EU272037 (Pseudomonas phage MP38, complete genome) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

376. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to KM389459 (UNVERIFIED: Pseudomonas phage F_ET309sp/Pa1651 clone contig00001 genomic sequence) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

377. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to NC_023700 (Pseudomonas phage PA1/KOR/2010, complete genome) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

378. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to JX434032 (Pseudomonas phage JBD30, complete genome) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

379. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to MK511022 (Pseudomonas phage CF74, partial genome) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

380. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to KM233689 (Pseudomonas phage H70, complete genome) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

381. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to KU199708 (Pseudomonas phage JBD69, complete genome) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

382. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to DQ631426 (Pseudomonas phage DMS3, complete genome) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

383. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to MK511030 (Pseudomonas phage CF213, partial genome) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

384. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to NC_024782 (Pseudomonas phage MP48, complete genome) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

385. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to MK511025 (Pseudomonas phage CF118, partial genome) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

386. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to JX434031 (Pseudomonas phage JBD24, complete genome) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

387. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to DQ873690 (Phage MP22, complete genome) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

388. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to MK511023 (Pseudomonas phage CF77, partial genome) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

389. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to MK511029 (Pseudomonas phage CF183, partial genome) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

390. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to EU272036 (Pseudomonas phage MP29, complete genome) position: , mismatch: 7, identity: 0.788

cgccagagcgccggccgccgtgccagagccgta------	CRISPR spacer
cgccagcgcgccggccgcc------gagccgtacagcac	Protospacer
****** ************      ********      

391. spacer 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NC_015377 (Burkholderia gladioli BSR3 plasmid bgla_2p, complete sequence) position: , mismatch: 7, identity: 0.741

tccggggccgcgccatcgccaccgccc	CRISPR spacer
gccggggccgcgccatcgccttgaatc	Protospacer
 ******************* . . .*

392. spacer 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.741

tccggggccgcgccatcgccaccgccc	CRISPR spacer
agaccggccgcgccatcgccgccgccg	Protospacer
     ***************.***** 

393. spacer 1.17|84800|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017942 (Phyllobacterium zundukense strain Tri-48 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.788

tagagatcgcccgccggcgcgggccggtcgagc	CRISPR spacer
tgcggatcgcccgccggctcggggcggtcgacg	Protospacer
*. .************** **** *******  

394. spacer 1.24|85227|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 7, identity: 0.788

agcggcaggtccacagtgtcggccacgcgcacc	CRISPR spacer
cgcggcaggaccacagggtcggccacagggatc	Protospacer
 ******** ****** *********. * *.*

395. spacer 1.32|84318|37|CP029339|PILER-CR matches to NC_018836 (Streptomyces phage phiHau3, complete genome) position: , mismatch: 7, identity: 0.811

cggtacgcggtgtgggtcgagggcgacggcaccggag	CRISPR spacer
tggtacgcggtgtgggtcgagggcgacgggacgttct	Protospacer
.**************************** **     

396. spacer 1.32|84318|37|CP029339|PILER-CR matches to MT310862 (Streptomyces phage Itza, complete genome) position: , mismatch: 7, identity: 0.811

cggtacgcggtgtgggtcgagggcgacggcaccggag	CRISPR spacer
tggtacgcggtgtgggtcgaggggaacggcaccttct	Protospacer
.********************** .********    

397. spacer 1.32|84318|37|CP029339|PILER-CR matches to MF766044 (Streptomyces phage Amethyst, complete genome) position: , mismatch: 7, identity: 0.811

cggtacgcggtgtgggtcgagggcgacggcaccggag	CRISPR spacer
tggtacgcggtgtgggtcgagggctccggcaccttct	Protospacer
.***********************  *******    

398. spacer 1.32|84318|37|CP029339|PILER-CR matches to MN234192 (Streptomyces phage Animus, complete genome) position: , mismatch: 7, identity: 0.811

cggtacgcggtgtgggtcgagggcgacggcaccggag	CRISPR spacer
tggtacgcagtgtgggtcgagggtgacggcaccttct	Protospacer
.*******.**************.*********    

399. spacer 1.32|84318|37|CP029339|PILER-CR matches to MN062705 (Streptomyces phage Celia, complete genome) position: , mismatch: 7, identity: 0.811

cggtacgcggtgtgggtcgagggcgacggcaccggag	CRISPR spacer
tggtacgcggtgtgggtcgaggggaacggcaccttct	Protospacer
.********************** .********    

400. spacer 1.32|84318|37|CP029339|PILER-CR matches to MN234189 (Streptomyces phage Urza, complete genome) position: , mismatch: 7, identity: 0.811

cggtacgcggtgtgggtcgagggcgacggcaccggag	CRISPR spacer
tggtacgcggtgtgggtcgaggggaacggcaccttct	Protospacer
.********************** .********    

401. spacer 1.32|84318|37|CP029339|PILER-CR matches to MH669004 (Streptomyces phage Hank144, complete genome) position: , mismatch: 7, identity: 0.811

cggtacgcggtgtgggtcgagggcgacggcaccggag	CRISPR spacer
tggtacgcggtctgggtcgagggtgacggcaccttct	Protospacer
.********** ***********.*********    

402. spacer 1.32|84318|37|CP029339|PILER-CR matches to NC_041856 (Streptomyces phage phiCAM, complete genome) position: , mismatch: 7, identity: 0.811

cggtacgcggtgtgggtcgagggcgacggcaccggag	CRISPR spacer
tggtacgcggtgtgggtcgaggctgacggcaccttct	Protospacer
.********************* .*********    

403. spacer 1.32|84318|37|CP029339|PILER-CR matches to MF766047 (Streptomyces phage SqueakyClean, complete genome) position: , mismatch: 7, identity: 0.811

cggtacgcggtgtgggtcgagggcgacggcaccggag	CRISPR spacer
tggtacgcagtgtgggtcgagggtgacggcaccttct	Protospacer
.*******.**************.*********    

404. spacer 1.32|84318|37|CP029339|PILER-CR matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 7, identity: 0.811

cggtacgcggtgtgggtcgagggcgacggcaccggag	CRISPR spacer
ccttacgcgttgtgggtcgaggtcgacggcaagggcg	Protospacer
*  ****** ************ ********  ** *

405. spacer 2.2|86754|33|CP029339|CRT,CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 7, identity: 0.788

gccgacatcgagggcgtcgacggcgtccgcctc	CRISPR spacer
gttgccatcgagggcgccgacgccgtccgcgcc	Protospacer
*..* ***********.***** ******* .*

406. spacer 2.2|86754|33|CP029339|CRT,CRISPRCasFinder matches to NZ_CP020399 (Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

gccgacatcgagggcgtcgacggcgtccgcctc	CRISPR spacer
acctgcatcgacggcgtcgacggcgtgcgcttt	Protospacer
.** .****** ************** ***.*.

407. spacer 2.2|86754|33|CP029339|CRT,CRISPRCasFinder matches to CP040467 (Streptomyces albidoflavus strain UYFA156 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

gccgacatcgagggcgtcgacggcgtccgcctc	CRISPR spacer
gccgacatcgagggcttcgacgccgggttcttc	Protospacer
*************** ****** **  . *.**

408. spacer 2.4|86876|33|CP029339|CRT,CRISPRCasFinder matches to NZ_CP028567 (Aeromonas hydrophila subsp. hydrophila strain WCHAH045096 plasmid pMCR5_045096, complete sequence) position: , mismatch: 7, identity: 0.788

accggccacgcgcccagctcggtgacgccgtac	CRISPR spacer
accggccactcgcccagcacggtgaaactccac	Protospacer
********* ******** ****** .*. .**

409. spacer 2.4|86876|33|CP029339|CRT,CRISPRCasFinder matches to NC_015727 (Cupriavidus necator N-1 plasmid pBB1, complete sequence) position: , mismatch: 7, identity: 0.788

accggcc-acgcgcccagctcggtgacgccgtac	CRISPR spacer
-tcgaccgacgcggccagctcggcgacgccgtct	Protospacer
 .**.** ***** *********.******** .

410. spacer 3.5|87638|33|CP029339|CRISPRCasFinder matches to DQ372923 (Bacteriophage mu1/6, complete genome) position: , mismatch: 7, identity: 0.788

gatttcgagatcctcagcgtggaggagctgaac	CRISPR spacer
gagctggagaccctcagcgcggaggagctggag	Protospacer
** .* ****.********.**********.* 

411. spacer 3.5|87638|33|CP029339|CRISPRCasFinder matches to NC_007967 (Streptomyces phage mu1/6, complete genome) position: , mismatch: 7, identity: 0.788

gatttcgagatcctcagcgtggaggagctgaac	CRISPR spacer
gagctggagaccctcagcgcggaggagctggag	Protospacer
** .* ****.********.**********.* 

412. spacer 4.11|89484|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to MT723933 (Streptomyces phage Keanu, complete genome) position: , mismatch: 7, identity: 0.788

ggcagcgaggccaccgacgaggagtacggccag	CRISPR spacer
ggccgcgaggtcaccgacgaggaggccaccgag	Protospacer
*** ******.*************  *. * **

413. spacer 4.15|89728|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP047900 (Pseudarthrobacter sp. YJ56 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.788

acgcgcctggtgtcgccggcggcgggggagccg	CRISPR spacer
atggtcctggtgtcgccggctgcaggggatacg	Protospacer
*.*  *************** **.*****  **

414. spacer 4.21|89789|32|CP029339|PILER-CR matches to NZ_CP032156 (Mycobacterium sp. ELW1 plasmid pELW1-1, complete sequence) position: , mismatch: 7, identity: 0.781

cactccaccccgatcaccgtggtgg-gctgggc	CRISPR spacer
agcttcaccgcgatcaccgtggtggtgttcgg-	Protospacer
 .**.**** *************** *.* ** 

415. spacer 5.1|90308|33|CP029339|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

atggcgtcgaggcggatggagatggtgccgccc	CRISPR spacer
gtgctgacgaggccaatggagatggtgccgcca	Protospacer
.** .* ****** .***************** 

416. spacer 6.5|93493|32|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023738 (Methylosinus trichosporium OB3b plasmid pOB3b1, complete sequence) position: , mismatch: 7, identity: 0.781

cggggctgtacgaggtcgatctcggggcggag	CRISPR spacer
gacggattgacgaggtcgatctcggggcgcag	Protospacer
 . ** *  ******************** **

417. spacer 7.1|97970|28|CP029339|CRT matches to CP054927 (Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75

cgtcgtcgtcctcgggcacggcatcaac	CRISPR spacer
cgtcgacgtcctcgggcacggcgaggta	Protospacer
***** ****************.  .  

418. spacer 7.8|98392|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.788

ttctggaagaccggcccgaccgccgagaacccc	CRISPR spacer
tacccgatgaccggcctgaccgccgagaagcac	Protospacer
* *. ** ********.************ * *

419. spacer 7.14|98758|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 7, identity: 0.788

agcccat-cagacgccgtgcgcggcgccatcgcc	CRISPR spacer
-gccgacatggacgccctgcgcggcgcgatcgcc	Protospacer
 *** *. ..****** ********** ******

420. spacer 7.14|98758|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP006369 (Aureimonas sp. AU20 plasmid pAU20b, complete sequence) position: , mismatch: 7, identity: 0.788

agcccatc--agacgccgtgcgcggcgccatcgcc	CRISPR spacer
--tccaaccgggacgccgtgcgcgccggcatcgcc	Protospacer
  .*** *  .************* ** *******

421. spacer 7.16|98880|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 7, identity: 0.788

ggcgacggcaaggacccgtggacg--gacgcccag	CRISPR spacer
cgcgacggcatcgacccgtggacggtgacgatc--	Protospacer
 *********  ************  **** .*  

422. spacer 7.17|98941|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to MN304818 (Phage 71_18, complete genome) position: , mismatch: 7, identity: 0.788

gtcgcctcaccgaggacgtgcccgaccacctga---	CRISPR spacer
gcggcatcaccgtggacgtgcccg---acctgaccg	Protospacer
*. ** ****** ***********   ******   

423. spacer 7.22|99246|33|CP029339|CRT,CRISPRCasFinder matches to NZ_CP016822 (Rhodococcus sp. p52 plasmid pDF03, complete sequence) position: , mismatch: 7, identity: 0.788

cgaggacgtgcccgaccacctgatcccgagcgt	CRISPR spacer
cgtgttcgtgcccgaccacctgctcacgagcca	Protospacer
** *  **************** ** *****  

424. spacer 7.23|99307|33|CP029339|CRT,CRISPRCasFinder matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 7, identity: 0.788

tcgacgtgggcggcgccgccgtgg---tcggcgaac	CRISPR spacer
tcgccgtggtcggcgccgccgtggcgctcgcca---	Protospacer
*** ***** **************   *** *.   

425. spacer 8.1|109714|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014361 (Methylomonas sp. DH-1 plasmid, complete sequence) position: , mismatch: 7, identity: 0.788

ccgcgcaggcatcggcgacctgatccagaccag	CRISPR spacer
ctacgacggcttcggcgacctgatccagaccca	Protospacer
*..**  *** ******************** .

426. spacer 8.1|109714|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023670 (Methylomonas koyamae strain LM6 plasmid pLM6, complete sequence) position: , mismatch: 7, identity: 0.788

ccgcgcaggcatcggcgacctgatccagaccag	CRISPR spacer
ctacgacggcttcggcgacctgatccagaccca	Protospacer
*..**  *** ******************** .

427. spacer 8.1|109714|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

ccgcgcaggcatcggcgacctgatccagaccag	CRISPR spacer
gcgcgaaggcatcggtgacctgatccgggaccg	Protospacer
 **** *********.**********.*. * *

428. spacer 8.5|109958|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054618 (Azospirillum oryzae strain KACC 14407 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.788

ggtcccggctcccccgacaggccggcccttcac	CRISPR spacer
gtcgccggcgcccccgacgggccggcccttgcc	Protospacer
* . ***** ********.***********  *

429. spacer 8.5|109958|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

--ggtcccggctcccccgacaggccggcccttcac	CRISPR spacer
ccggt--cgcctcccccgccaggccggccctgaat	Protospacer
  ***  ** ******** ************  *.

430. spacer 8.5|109958|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

--ggtcccggctcccccgacaggccggcccttcac	CRISPR spacer
ccggt--cgcctcccccgccaggccggccctgaat	Protospacer
  ***  ** ******** ************  *.

431. spacer 8.5|109958|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 7, identity: 0.788

--ggtcccggctcccccgacaggccggcccttcac	CRISPR spacer
ccggt--cgcctcccccgccaggccggccctgaat	Protospacer
  ***  ** ******** ************  *.

432. spacer 8.5|109958|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

--ggtcccggctcccccgacaggccggcccttcac	CRISPR spacer
ccggt--cgcctcccccgccaggccggccctgaat	Protospacer
  ***  ** ******** ************  *.

433. spacer 8.5|109958|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

--ggtcccggctcccccgacaggccggcccttcac	CRISPR spacer
ccggt--cgcctcccccgccaggccggccctgaat	Protospacer
  ***  ** ******** ************  *.

434. spacer 8.5|109958|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

--ggtcccggctcccccgacaggccggcccttcac	CRISPR spacer
ccggt--cgcctcccccgccaggccggccctgaat	Protospacer
  ***  ** ******** ************  *.

435. spacer 8.12|110385|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP035512 (Haematobacter massiliensis strain OT1 plasmid pOT1-2, complete sequence) position: , mismatch: 7, identity: 0.788

cttcgtgctgtcgtggatgacgccgaggttgac	CRISPR spacer
cagcgtgctgtcgtgcatgacgacgaggacgcc	Protospacer
*  ************ ****** ***** .* *

436. spacer 8.13|110446|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 7, identity: 0.788

gcgcctgggcctggtcgaggacgcggaggccgg	CRISPR spacer
gcgcctgggcctgttcgaggaggcgggcttcgc	Protospacer
************* ******* ****.  .** 

437. spacer 8.13|110446|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 7, identity: 0.788

gcgcctgggcctggtcgaggacgcggaggccgg	CRISPR spacer
gcgcccggccctggtcgaggacgccggcgcggt	Protospacer
*****.** *************** *. ** * 

438. spacer 8.14|110507|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 7, identity: 0.788

gtcgctggcccaccgggtgaaccaactggccca	CRISPR spacer
gtcgctggccgaccgggtgatccagatcgtcga	Protospacer
********** ********* ***. * *.* *

439. spacer 8.17|110690|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to MN234195 (Mycobacterium phage Xula, complete genome) position: , mismatch: 7, identity: 0.788

gggcgggcccgccaccatcccgaccctcgacgc	CRISPR spacer
gggcgggcccgccaccagcccgaccgcggcggt	Protospacer
***************** ******* . *  *.

440. spacer 8.17|110690|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to MN234236 (Mycobacterium phage QueenHazel, complete genome) position: , mismatch: 7, identity: 0.788

gggcgggcccgccaccatcccgaccctcgacgc	CRISPR spacer
gggcgggcccgccaccagcccgaccgcggcggt	Protospacer
***************** ******* . *  *.

441. spacer 8.24|111117|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022424 (Vitreoscilla filiformis strain ATCC 15551 plasmid pVF1, complete sequence) position: , mismatch: 7, identity: 0.788

ggcgggggagcgccacgccgggccgatgtggtg	CRISPR spacer
gctgggggtgagccacgccgggccgatccgctg	Protospacer
* .***** * **************** .* **

442. spacer 8.28|111366|33|CP029339|PILER-CR matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 7, identity: 0.788

gcgcgccacgcaggaccacttggc--gcacctgtt	CRISPR spacer
ccgcgcccagcaggaccacttggcgggcgcccg--	Protospacer
 ******  ***************  **.**.*  

443. spacer 8.30|111360|33|CP029339|CRISPRCasFinder,CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 7, identity: 0.788

gcgcgccacgcaggaccacttggc--gcacctgtt	CRISPR spacer
ccgcgcccagcaggaccacttggcgggcgcccg--	Protospacer
 ******  ***************  **.**.*  

444. spacer 1.2|83891|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP013436 (Burkholderia latens strain AU17928 isolate AU17928 plasmid pAU17928, complete sequence) position: , mismatch: 8, identity: 0.758

gggtccgaccgcggcgacgccacgacgacggca	CRISPR spacer
tcgaccatccacggcgacggcacgacgacggcg	Protospacer
  * **. **.******** ************.

445. spacer 1.2|83891|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP013436 (Burkholderia latens strain AU17928 isolate AU17928 plasmid pAU17928, complete sequence) position: , mismatch: 8, identity: 0.758

gggtccgaccgcggcgacgccacgacgacggca	CRISPR spacer
tcgaccatccacggcgacggcacgacgacggcg	Protospacer
  * **. **.******** ************.

446. spacer 1.8|84257|33|CP029339|CRISPRCasFinder,CRT matches to MH029512 (Siphoviridae environmental samples clone NHS-Seq1, complete sequence) position: , mismatch: 8, identity: 0.758

ctgacgttcaggccgtgggcggtctcagcgatc	CRISPR spacer
ctgacgttaaggccgtaggcggtcctagacgtg	Protospacer
******** *******.*******..**  .* 

447. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP019182 (Salmonella enterica subsp. enterica serovar Inverness str. ATCC 10720 plasmid pATCC10720, complete sequence) position: , mismatch: 8, identity: 0.758

cgccagagcgccggccgccgtgccagagccgta	CRISPR spacer
gttcaccacgccgcccgccgcgccagagccgta	Protospacer
  .**  .***** ******.************

448. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to CP053403 (Salmonella enterica strain 2010K-2057 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758

cgccagagcgccggccgccgtgccagagccgta	CRISPR spacer
gttcaccacgccgcccgccgcgccagagccgta	Protospacer
  .**  .***** ******.************

449. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP012575 (Clavibacter michiganensis subsp. capsici strain PF008 plasmid pCM2, complete sequence) position: , mismatch: 8, identity: 0.758

cgccagagcgccggccgccgtgccagagccgta	CRISPR spacer
accctccgcgccggccgccgtgccggcgccgga	Protospacer
  **   *****************.* **** *

450. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to CP048046 (Clavibacter michiganensis subsp. capsici strain 1207 plasmid pCM2_1207, complete sequence) position: , mismatch: 8, identity: 0.758

cgccagagcgccggccgccgtgccagagccgta	CRISPR spacer
accctccgcgccggccgccgtgccggcgccgga	Protospacer
  **   *****************.* **** *

451. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP048050 (Clavibacter michiganensis subsp. capsici strain 1101 plasmid pCM2_1101, complete sequence) position: , mismatch: 8, identity: 0.758

cgccagagcgccggccgccgtgccagagccgta	CRISPR spacer
accctccgcgccggccgccgtgccggcgccgga	Protospacer
  **   *****************.* **** *

452. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP029833 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.758

cgccagagcgccggccgccgtgccagagccgta	CRISPR spacer
cgccacagcgccggccgccgcgcccggcgcatc	Protospacer
***** **************.*** *.  *.* 

453. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP048048 (Clavibacter michiganensis subsp. capsici strain 1106 plasmid pCM2_1106, complete sequence) position: , mismatch: 8, identity: 0.758

cgccagagcgccggccgccgtgccagagccgta	CRISPR spacer
accctccgcgccggccgccgtgccggcgccgga	Protospacer
  **   *****************.* **** *

454. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP054622 (Azospirillum oryzae strain KACC 14407 plasmid unnamed7, complete sequence) position: , mismatch: 8, identity: 0.758

cgccagagcgccggccgccgtgccagagccgta	CRISPR spacer
cgcaagatcgccggccgccgtgcccagagcgaa	Protospacer
*** *** **************** ... ** *

455. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP039651 (Azospirillum sp. TSA2s plasmid p1) position: , mismatch: 8, identity: 0.758

cgccagagcgccggccgccgtgccagagccgta	CRISPR spacer
cgcaagatcgccggccgccgtgcccagagcgaa	Protospacer
*** *** **************** ... ** *

456. spacer 1.12|84501|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 8, identity: 0.758

ccaccaccgtcacggaaggggaagcctgatgac	CRISPR spacer
tcaccaccgtgacggatggggaagccggtttga	Protospacer
.********* ***** ********* * * . 

457. spacer 1.13|84562|27|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to MT118301 (Pseudomonas phage Epa33, complete genome) position: , mismatch: 8, identity: 0.704

tccggggccgcgccatcgccaccgccc	CRISPR spacer
agaaccaccgcgccatcgccaccgcct	Protospacer
   .  .*******************.

458. spacer 1.16|84739|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.758

gaggtctgcgcggacggtggccgtcctgctgcg	CRISPR spacer
ggccgcggcggggacggtggccgtgctgctgcc	Protospacer
*.   * *** ************* ******* 

459. spacer 1.22|85105|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP042824 (Rhizobium sp. WL3 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758

ttgacattccccgacggtagcgaggtcaccgag	CRISPR spacer
tttacatttcccgacggtagcgaggactatggt	Protospacer
** *****.**************** *  .*. 

460. spacer 1.27|84013|37|CP029339|PILER-CR matches to NC_015170 (Deinococcus proteolyticus MRP plasmid pDEIPR03, complete sequence) position: , mismatch: 8, identity: 0.784

accgaggaccccgacggcaccgtgctggtctccggaa	CRISPR spacer
acccaccgccccgacggcaccgtgctggtcaacggcc	Protospacer
*** *  .**********************  ***  

461. spacer 1.28|84074|37|CP029339|PILER-CR matches to LN997844 (Streptomyces reticuli genome assembly TUE45, plasmid : III) position: , mismatch: 8, identity: 0.784

gcgctg-cgtcacggccgtcaggctccggcggagggaa	CRISPR spacer
-cgcagtcgtcgcggccgtcaggctccgggggagtttg	Protospacer
 *** * ****.***************** ****   .

462. spacer 1.32|84318|37|CP029339|PILER-CR matches to MH248947 (Streptomyces phage Yosif, complete genome) position: , mismatch: 8, identity: 0.784

cggtacgcggtgtgggtcgagggcgacggcaccggag	CRISPR spacer
tactacgcggtgtgggtccagggtgacggcaccttcg	Protospacer
.. *************** ****.*********   *

463. spacer 1.32|84318|37|CP029339|PILER-CR matches to MK524524 (Streptomyces phage Caelum, complete genome) position: , mismatch: 8, identity: 0.784

cggtacgcggtgtgggtcgagggcgacggcaccggag	CRISPR spacer
tactacgcggtgtgggtcgagggcgatggaaccttcg	Protospacer
.. ***********************.** ***   *

464. spacer 2.4|86876|33|CP029339|CRT,CRISPRCasFinder matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 8, identity: 0.758

accggccacgcgcccagctcggtgacgccgtac	CRISPR spacer
cgcgccgtcgcgaccaggtcggtgacgccgtag	Protospacer
  ** *  **** **** ************** 

465. spacer 2.4|86876|33|CP029339|CRT,CRISPRCasFinder matches to NZ_CP027299 (Streptomyces sp. SGAir0924 plasmid unnamed_5) position: , mismatch: 8, identity: 0.758

--accggccacgcgcccagctcggtgacgccgtac	CRISPR spacer
acgtcggt--ggcgcccagctcggtggctccgtac	Protospacer
  ..***.   ***************.* ******

466. spacer 2.4|86876|33|CP029339|CRT,CRISPRCasFinder matches to NZ_CP026306 (Streptomyces lunaelactis strain MM109 plasmid pSLUN2, complete sequence) position: , mismatch: 8, identity: 0.758

-----accggccacgcgcccagctcggtgacgccgtac	CRISPR spacer
atgccgccg-----gcggacagctcggtgacgccgtac	Protospacer
     .***     ***  *******************

467. spacer 4.12|89545|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP006993 (Methylobacterium sp. AMS5 plasmid pAMS5a, complete sequence) position: , mismatch: 8, identity: 0.758

gcggtgggtgagccattgccggtataggtcgag	CRISPR spacer
aggctcgcggagccgttgccggtatagatcgag	Protospacer
. * * *  *****.************.*****

468. spacer 4.13|89606|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015372 (Pandoraea pnomenusa strain MCB032 plasmid unnamed 1, complete sequence) position: , mismatch: 8, identity: 0.758

gctcgggaacgtcgggctgtgcattacgtgggc	CRISPR spacer
aaacgggaacgtcgggccgtgcatgacgtcacc	Protospacer
.  **************.****** **** . *

469. spacer 4.13|89606|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015372 (Pandoraea pnomenusa strain MCB032 plasmid unnamed 1, complete sequence) position: , mismatch: 8, identity: 0.758

gctcgggaacgtcgggctgtgcattacgtgggc	CRISPR spacer
aaacgggaacgtcgggccgtgcatgacgtcacc	Protospacer
.  **************.****** **** . *

470. spacer 4.13|89606|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015372 (Pandoraea pnomenusa strain MCB032 plasmid unnamed 1, complete sequence) position: , mismatch: 8, identity: 0.758

gctcgggaacgtcgggctgtgcattacgtgggc	CRISPR spacer
aaacgggaacgtcgggccgtgcatgacgtcacc	Protospacer
.  **************.****** **** . *

471. spacer 4.21|89789|32|CP029339|PILER-CR matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75

cactccaccccgatcaccgtggtgggctgggc	CRISPR spacer
cactccaccccgatcaccgcgatgtccggctt	Protospacer
*******************.*.**  * *  .

472. spacer 4.21|89789|32|CP029339|PILER-CR matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 8, identity: 0.75

cactccaccccgatcaccgtggtgggctgggc	CRISPR spacer
cactccaccccgatcaccgcgatgtccggctt	Protospacer
*******************.*.**  * *  .

473. spacer 4.21|89789|32|CP029339|PILER-CR matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 8, identity: 0.75

cactccaccccgatcaccgtggtgggctgggc	CRISPR spacer
gtctccaccccgatcaccgacgtggtgcggac	Protospacer
  *****************  ****  .**.*

474. spacer 4.24|89972|32|CP029339|PILER-CR matches to NZ_CP007449 (Yersinia enterocolitica LC20 plasmid plasmid1_80K, complete sequence) position: , mismatch: 8, identity: 0.75

gttgggaatgcctaggtgtgtgatctgtgcgg	CRISPR spacer
tggtggtgtgcctaggtctgtggtctgtgcgg	Protospacer
    ** .********* ****.*********

475. spacer 4.24|89972|32|CP029339|PILER-CR matches to NZ_CP048398 (Streptomyces sp. S4.7 plasmid pSSPS4.7a, complete sequence) position: , mismatch: 8, identity: 0.75

gttgggaatgcctaggtgtgtgatctgtgcgg	CRISPR spacer
ttcaggaatgcctaggtgtgcggtctgaggtg	Protospacer
 *..****************.*.**** *  *

476. spacer 6.2|93309|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 8, identity: 0.758

ctgatggtgatgttcatgcccgagccgtgcagg	CRISPR spacer
gtcatggtgatgttcatgcgcgaaccggagcgg	Protospacer
 * **************** ***.*** .  **

477. spacer 6.3|93370|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to MN176220 (Bacillus phage 019DV002, complete genome) position: , mismatch: 8, identity: 0.758

cggccactacaactgccgagctggctgcgctgg-	CRISPR spacer
aaaccactacaattgccgagctagctg-gctacc	Protospacer
 ..*********.*********.**** ***.  

478. spacer 6.3|93370|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to MN176230 (Bacillus phage 056SW001B, complete genome) position: , mismatch: 8, identity: 0.758

cggccactacaactgccgagctggctgcgctgg-	CRISPR spacer
aaaccactacaattgccgagctagctg-gctacc	Protospacer
 ..*********.*********.**** ***.  

479. spacer 6.3|93370|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to MN176232 (Bacillus phage 280BB001, complete genome) position: , mismatch: 8, identity: 0.758

cggccactacaactgccgagctggctgcgctgg-	CRISPR spacer
aaaccactacaattgccgagctagctg-gctacc	Protospacer
 ..*********.*********.**** ***.  

480. spacer 6.3|93370|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to MN176221 (Bacillus phage 019DV004, complete genome) position: , mismatch: 8, identity: 0.758

cggccactacaactgccgagctggctgcgctgg-	CRISPR spacer
aaaccactacaattgccgagctagctg-gctacc	Protospacer
 ..*********.*********.**** ***.  

481. spacer 6.3|93370|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to MN176231 (Bacillus phage 276BB001, complete genome) position: , mismatch: 8, identity: 0.758

cggccactacaactgccgagctggctgcgctgg-	CRISPR spacer
aaaccactacaattgccgagctagctg-gctacc	Protospacer
 ..*********.*********.**** ***.  

482. spacer 6.5|93493|32|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 8, identity: 0.75

cggggctgtacgaggtcgatctcggggcggag	CRISPR spacer
aggggctgtacgaggtcgacgtcgtcctgaag	Protospacer
 ******************. ***   .*.**

483. spacer 6.6|93553|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 8, identity: 0.758

ctgtcctacgtctgggccctcggcggccgcgtc	CRISPR spacer
ctgtcctacgcctgggcactcggccggacggcc	Protospacer
**********.****** ****** *    *.*

484. spacer 7.1|97970|28|CP029339|CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.714

cgtcgtcgtcctcgggcacggcatcaac	CRISPR spacer
gaagttcgtcctcgggcacggcatcctg	Protospacer
 .   ********************   

485. spacer 7.3|98087|32|CP029339|CRT,CRISPRCasFinder matches to NZ_CP024424 (Paracoccus yeei strain TT13 plasmid pTT13-2, complete sequence) position: , mismatch: 8, identity: 0.75

-ttcacgctgagcgcggcgtcccgctcggacag	CRISPR spacer
aggcgcacc-agcgcggcgtcgcgcgcggacag	Protospacer
   *.*.*. *********** *** *******

486. spacer 7.3|98087|32|CP029339|CRT,CRISPRCasFinder matches to NZ_CP020440 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

-ttcacgctgagcgcggcgtcccgctcggacag	CRISPR spacer
aggcgcacc-agcgcggcgtcgcgcgcggacag	Protospacer
   *.*.*. *********** *** *******

487. spacer 7.3|98087|32|CP029339|CRT,CRISPRCasFinder matches to NZ_CP044082 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75

-ttcacgctgagcgcggcgtcccgctcggacag	CRISPR spacer
aggcgcacc-agcgcggcgtcgcgcgcggacag	Protospacer
   *.*.*. *********** *** *******

488. spacer 7.3|98087|32|CP029339|CRT,CRISPRCasFinder matches to NZ_CP031080 (Paracoccus yeei strain CCUG 32053 plasmid pYEE2, complete sequence) position: , mismatch: 8, identity: 0.75

-ttcacgctgagcgcggcgtcccgctcggacag	CRISPR spacer
aggcgcacc-agcgcggcgtcgcgcgcggacag	Protospacer
   *.*.*. *********** *** *******

489. spacer 7.8|98392|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP041744 (Paraburkholderia megapolitana strain LMG 23650 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758

ttctggaagaccggcccgaccgccgagaacccc	CRISPR spacer
ttctggaagactggcccgaccacctcccacgca	Protospacer
***********.*********.**    ** * 

490. spacer 7.10|98514|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NC_006462 (Thermus thermophilus HB8 plasmid pTT27, complete sequence) position: , mismatch: 8, identity: 0.758

gaagtggtggaggggtgccctcggggcggccgg	CRISPR spacer
ctcctcggggaggggtgccctgggtgcggccgg	Protospacer
    * * ************* ** ********

491. spacer 7.10|98514|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NC_005838 (Thermus thermophilus HB27 plasmid pTT27, complete sequence) position: , mismatch: 8, identity: 0.758

gaagtggtggaggggtgccctcggggcggccgg	CRISPR spacer
ctcctcggggaggggtgccctgggtgcggccgg	Protospacer
    * * ************* ** ********

492. spacer 7.10|98514|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NZ_AP019802 (Thermus thermophilus strain HC11 plasmid pHC11, complete sequence) position: , mismatch: 8, identity: 0.758

gaagtggtggaggggtgccctcggggcggccgg	CRISPR spacer
ctcctcggggaggggtgccctgggtgcggccgg	Protospacer
    * * ************* ** ********

493. spacer 7.11|98575|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP033323 (Azospirillum brasilense strain Cd plasmid p5, complete sequence) position: , mismatch: 8, identity: 0.758

acgggcgtcgccgtcgagtggctgaaggtgaag	CRISPR spacer
ccgggcgtggccgtcgagtgggtgatcgccaac	Protospacer
 ******* ************ ***  *. ** 

494. spacer 7.11|98575|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP012919 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p5, complete sequence) position: , mismatch: 8, identity: 0.758

acgggcgtcgccgtcgagtggctgaaggtgaag	CRISPR spacer
ccgggcgtggccgtcgagtgggtgatcgccaac	Protospacer
 ******* ************ ***  *. ** 

495. spacer 7.11|98575|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP032344 (Azospirillum brasilense strain MTCC4038 plasmid p5, complete sequence) position: , mismatch: 8, identity: 0.758

acgggcgtcgccgtcgagtggctgaaggtgaag	CRISPR spacer
ccgggcgtggccgtcgagtgggtgatcgccaac	Protospacer
 ******* ************ ***  *. ** 

496. spacer 7.11|98575|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP032344 (Azospirillum brasilense strain MTCC4038 plasmid p5, complete sequence) position: , mismatch: 8, identity: 0.758

acgggcgtcgccgtcgagtggctgaaggtgaag	CRISPR spacer
ccgggcgtggccgtcgagtgggtgatcgccaac	Protospacer
 ******* ************ ***  *. ** 

497. spacer 7.11|98575|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP033317 (Azospirillum brasilense strain Sp 7 plasmid p5, complete sequence) position: , mismatch: 8, identity: 0.758

acgggcgtcgccgtcgagtggctgaaggtgaag	CRISPR spacer
ccgggcgtggccgtcgagtgggtgatcgccaac	Protospacer
 ******* ************ ***  *. ** 

498. spacer 7.14|98758|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NZ_AP014580 (Burkholderia sp. RPE67 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.758

agcccatcagacgccgtgcgcggcgccatcgcc	CRISPR spacer
gccgggtccgacgccgtgcgcgacgccatcgct	Protospacer
. *  .** *************.*********.

499. spacer 7.14|98758|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP024986 (Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence) position: , mismatch: 8, identity: 0.758

agcccatcagacgccgtgcgcggcgccatcgcc	CRISPR spacer
gaccgtccggacgccgtccgccgcgccatcgcc	Protospacer
..**  .*.******** *** ***********

500. spacer 7.14|98758|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP021651 (Acidovorax sp. T1 plasmid p3-T1, complete sequence) position: , mismatch: 8, identity: 0.758

agcccatcagacgccgtgcgcggcgccatcgcc	CRISPR spacer
gacctgttcgacgccgtgcgggccgccatcgcc	Protospacer
..**..*. *********** * **********

501. spacer 7.14|98758|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.758

-----agcccatcagacgccgtgcgcggcgccatcgcc	CRISPR spacer
ctggacgcc-----gacgccctgcgcgacgccatcgcc	Protospacer
      ***     ****** ******.**********

502. spacer 7.14|98758|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758

agccca--tcagacgccgtgcgcggcgccatcgcc	CRISPR spacer
--cccgacctggacgccgtgcgcggcatcatcgcc	Protospacer
  ***.  ...***************..*******

503. spacer 7.14|98758|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NC_024970 (Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 8, identity: 0.758

agcccatcagacgccgtgcgcggcgccatcgcc	CRISPR spacer
gaccgtccggacgccgtccgccgcgccatcgcc	Protospacer
..**  .*.******** *** ***********

504. spacer 7.14|98758|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NZ_KJ396772 (Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 8, identity: 0.758

agcccatcagacgccgtgcgcggcgccatcgcc	CRISPR spacer
gaccgtccggacgccgtccgccgcgccatcgcc	Protospacer
..**  .*.******** *** ***********

505. spacer 7.14|98758|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 8, identity: 0.758

-----agcccatcagacgccgtgcgcggcgccatcgcc	CRISPR spacer
ctggacgcc-----gacgccctgcgcgccgccatcgcc	Protospacer
      ***     ****** ****** **********

506. spacer 7.15|98819|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.758

ttgacgagcccggtcgtcttcggcagcagcgcg	CRISPR spacer
ctcttcggcccgatcgtctgcggcagcagcgcg	Protospacer
.*  . .*****.****** *************

507. spacer 7.15|98819|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

ttgacgagcccggtcgtcttcggcagcagcgcg	CRISPR spacer
ctcttcggcccgatcgtctgcggcagcagcgcg	Protospacer
.*  . .*****.****** *************

508. spacer 7.15|98819|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP022567 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK03, complete sequence) position: , mismatch: 8, identity: 0.758

ttgacgagcccggtcgtcttcggcagcagcgcg	CRISPR spacer
tggacgagaccgatcgtcttcggcagtttcatg	Protospacer
* ****** ***.*************.  *..*

509. spacer 7.17|98941|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.758

gtcgcctcaccgaggacgtgcccgac--cacctga	CRISPR spacer
aacgcctcgccgaggaggtgcccgacgtgaccc--	Protospacer
. ******.******* *********   ***.  

510. spacer 7.22|99246|33|CP029339|CRT,CRISPRCasFinder matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 8, identity: 0.758

cgaggacgtgcccgaccacctgatcccgagcgt	CRISPR spacer
ccagggcctgcccgaccacctgatccatgttgt	Protospacer
* ***.* ******************  . .**

511. spacer 7.22|99246|33|CP029339|CRT,CRISPRCasFinder matches to NZ_CP021071 (Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence) position: , mismatch: 8, identity: 0.758

cgaggacgtgcccgaccacctgatcccgagcgt	CRISPR spacer
ccagggcctgcccgaccacctgatccatgttgt	Protospacer
* ***.* ******************  . .**

512. spacer 7.22|99246|33|CP029339|CRT,CRISPRCasFinder matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 8, identity: 0.758

cgaggacgtgcccgaccacctgatcccgagcgt	CRISPR spacer
ccagggcctgcccgaccacctgatccatgttgt	Protospacer
* ***.* ******************  . .**

513. spacer 7.22|99246|33|CP029339|CRT,CRISPRCasFinder matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 8, identity: 0.758

cgaggacgtgcccgaccacctgatcccgagcgt	CRISPR spacer
ccagggcctgcccgaccacctgatccatgttgt	Protospacer
* ***.* ******************  . .**

514. spacer 8.1|109714|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 8, identity: 0.758

ccgcgcaggcatcggcgacctgatccagaccag--	CRISPR spacer
cctcgcaggcatcggcgaccggatt--gatcgtct	Protospacer
** ***************** ***.  **.*.   

515. spacer 8.3|109836|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134457 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 15, complete sequence) position: , mismatch: 8, identity: 0.758

ggcgacgcggccccggtcgttccggcgcgcacc	CRISPR spacer
gcgcacgcggccccggtcgtccccgcgcgagcg	Protospacer
*   ****************.** ***** .* 

516. spacer 8.4|109897|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014675 (Kozakia baliensis strain DSM 14400 plasmid pKB14400_1, complete sequence) position: , mismatch: 8, identity: 0.758

gatccggccgagcagcccccgcttcttcggtgc	CRISPR spacer
gatccggccgggcagccccagcttgatggccgg	Protospacer
**********.******** ****  * * .* 

517. spacer 8.5|109958|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

--ggtcccggctcccccgacaggccggcccttcac	CRISPR spacer
ccggt--cgcctcccccgccaggccggccctgagt	Protospacer
  ***  ** ******** ************  ..

518. spacer 8.5|109958|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

--ggtcccggctcccccgacaggccggcccttcac	CRISPR spacer
ccggt--cgcctcccccgccaggccggccctgagt	Protospacer
  ***  ** ******** ************  ..

519. spacer 8.5|109958|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

--ggtcccggctcccccgacaggccggcccttcac	CRISPR spacer
ccggt--cgcctcccccgccaggccggccctgagt	Protospacer
  ***  ** ******** ************  ..

520. spacer 8.5|109958|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

--ggtcccggctcccccgacaggccggcccttcac	CRISPR spacer
ccggt--cgcctcccccgccaggccggccctgagt	Protospacer
  ***  ** ******** ************  ..

521. spacer 8.6|110019|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to KY053532 (Siphovirus 29632, complete genome) position: , mismatch: 8, identity: 0.758

gccgccctctccgagcaggagaagcgcgagaag	CRISPR spacer
gccgctatctccgagcaggagaagcagctcgag	Protospacer
*****. ******************.    .**

522. spacer 8.7|110080|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NC_012528 (Deinococcus deserti VCD115 plasmid 3, complete sequence) position: , mismatch: 8, identity: 0.758

cgcgtcctggtggtccgtgatgagctggggggt	CRISPR spacer
gaagtggtagtggtccgtgatgagctgtgtggt	Protospacer
 . **  *.****************** * ***

523. spacer 8.13|110446|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to MG941013 (Actinomyces phage xhp1, complete genome) position: , mismatch: 8, identity: 0.758

gcgcctgggcctggtcgaggacgcggaggccgg	CRISPR spacer
cggtatcggcctggtcgaggacgcggaagcctt	Protospacer
  *. * ********************.***  

524. spacer 8.13|110446|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NC_006462 (Thermus thermophilus HB8 plasmid pTT27, complete sequence) position: , mismatch: 8, identity: 0.758

gcgcctgggcctggtcgaggacgcggaggccgg	CRISPR spacer
cctccggggcctggccgaggacgcggagcatgt	Protospacer
 * ** ********.*************  .* 

525. spacer 8.13|110446|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NC_017273 (Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence) position: , mismatch: 8, identity: 0.758

gcgcctgggcctggtcgaggacgcggaggccgg	CRISPR spacer
cctccggggcctggccgaggacgcggagcatgt	Protospacer
 * ** ********.*************  .* 

526. spacer 8.13|110446|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NC_005838 (Thermus thermophilus HB27 plasmid pTT27, complete sequence) position: , mismatch: 8, identity: 0.758

gcgcctgggcctggtcgaggacgcggaggccgg	CRISPR spacer
cctccggggcctggccgaggacgcggagcatgt	Protospacer
 * ** ********.*************  .* 

527. spacer 8.13|110446|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014142 (Thermus parvatiensis strain RL plasmid pTP143, complete sequence) position: , mismatch: 8, identity: 0.758

gcgcctgggcctggtcgaggacgcggaggccgg	CRISPR spacer
cctccggggcctggccgaggacgcggagcatgt	Protospacer
 * ** ********.*************  .* 

528. spacer 8.13|110446|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NC_017588 (Thermus thermophilus JL-18 plasmid pTTJL1801, complete sequence) position: , mismatch: 8, identity: 0.758

gcgcctgggcctggtcgaggacgcggaggccgg	CRISPR spacer
cctccggggcctggccgaggacgcggagcatgt	Protospacer
 * ** ********.*************  .* 

529. spacer 8.13|110446|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR027520 (Thermus thermophilus isolate TTHNAR1 plasmid 4, complete sequence) position: , mismatch: 8, identity: 0.758

gcgcctgggcctggtcgaggacgcggaggccgg	CRISPR spacer
cctccggggcctggccgaggacgcggagcatgt	Protospacer
 * ** ********.*************  .* 

530. spacer 8.13|110446|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to JN698995 (Mycobacterium phage Dori, complete genome) position: , mismatch: 8, identity: 0.758

gcgcctgggcctggtcgaggacgcggaggccgg	CRISPR spacer
gttcatgggcccggtcgcggacgcggaggtggc	Protospacer
*. * ******.***** ***********. * 

531. spacer 8.17|110690|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to AP021851 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-2 DNA, complete genome) position: , mismatch: 8, identity: 0.758

gggcgggcccgccaccatcccgaccctcgacgc	CRISPR spacer
actcaagtacgccaccctcccgaccctcgacgc	Protospacer
.  *..*. ******* ****************

532. spacer 8.17|110690|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033584 (Streptomyces sp. ADI95-16 plasmid pADI95-16c, complete sequence) position: , mismatch: 8, identity: 0.758

gggcgggcccgccaccatcccgaccctcgacgc	CRISPR spacer
cggcgcgcccgccaccatccccaccaccaagga	Protospacer
 **** *************** *** .*.* * 

533. spacer 8.21|110934|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019938 (Ketogulonicigenium robustum strain SPU_B003 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758

gtcggggcggcgcgcgtcggccgcgtacaccac-	CRISPR spacer
ctcgcggcggcgcgcgtcggcctcg-gcgtcgca	Protospacer
 *** ***************** ** .*..*.* 

534. spacer 8.21|110934|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.758

gtcggggcggcgcgcgtcggccgcgtacaccac	CRISPR spacer
gtcggggtggcgcgggtcggccgccaggacggc	Protospacer
*******.****** *********  . ** .*

535. spacer 8.21|110934|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 8, identity: 0.758

gtcggggcggcgcgcgtcggccgcgtacaccac	CRISPR spacer
gtcggggtggcgcgggtcggccgccaggacggc	Protospacer
*******.****** *********  . ** .*

536. spacer 8.21|110934|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to MN694777 (Marine virus AFVG_250M80, complete genome) position: , mismatch: 8, identity: 0.758

gtcggggcggcgcgcgtcggccgcgtacaccac	CRISPR spacer
atcggcgcggcgcgtgtcggccgcgacggccag	Protospacer
.**** ********.**********   .*** 

537. spacer 1.2|83891|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP035505 (Kocuria indica strain CE7 plasmid pCE7, complete sequence) position: , mismatch: 9, identity: 0.727

gggtccgaccgcggcgacgccacgacgacggca	CRISPR spacer
gccgccgaccgcggcgacaccacgaccaccctc	Protospacer
*   **************.******* **  . 

538. spacer 1.4|84013|33|CP029339|CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 9, identity: 0.727

accgaggaccccgacggcaccgtgctggtctcc	CRISPR spacer
gaggaggacgcggacggcaccgtgctgcgtccc	Protospacer
.  ****** * ***************  ..**

539. spacer 1.4|84013|33|CP029339|CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 9, identity: 0.727

accgaggaccccgacggcaccgtgctggtctcc	CRISPR spacer
gaggaggacgcggacggcaccgtgctgcgtccc	Protospacer
.  ****** * ***************  ..**

540. spacer 1.4|84013|33|CP029339|CRISPRCasFinder,CRT matches to MK977714 (Corynebacterium phage Bran, complete genome) position: , mismatch: 9, identity: 0.727

accgaggaccccgacggcaccgtgctggtctcc	CRISPR spacer
gccgcggaccccgacggcaccttgcaccgctgt	Protospacer
.*** **************** ***    ** .

541. spacer 1.4|84013|33|CP029339|CRISPRCasFinder,CRT matches to MK977706 (Corynebacterium phage Dina, complete genome) position: , mismatch: 9, identity: 0.727

accgaggaccccgacggcaccgtgctggtctcc	CRISPR spacer
gccgcggaccccgacggcaccttgcaccgctgt	Protospacer
.*** **************** ***    ** .

542. spacer 1.4|84013|33|CP029339|CRISPRCasFinder,CRT matches to MH926061 (Corynebacterium phage Troy, complete genome) position: , mismatch: 9, identity: 0.727

accgaggaccccgacggcaccgtgctggtctcc	CRISPR spacer
gccgcggaccccgacggcaccttgcaccgctgt	Protospacer
.*** **************** ***    ** .

543. spacer 1.4|84013|33|CP029339|CRISPRCasFinder,CRT matches to NC_048069 (Corynebacterium phage SamW, complete genome) position: , mismatch: 9, identity: 0.727

accgaggaccccgacggcaccgtgctggtctcc	CRISPR spacer
gccgcggaccccgacggcaccttgcaccgctgt	Protospacer
.*** **************** ***    ** .

544. spacer 1.4|84013|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP010857 (Marinovum algicola DG 898 plasmid pMaD2, complete sequence) position: , mismatch: 9, identity: 0.727

accgaggaccccgacggcaccgtgctggtctcc	CRISPR spacer
tgccgcgaccccgagggcaccgggctggtcgcg	Protospacer
  * . ******** ******* ******* * 

545. spacer 1.4|84013|33|CP029339|CRISPRCasFinder,CRT matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 9, identity: 0.727

accgaggaccccgacggcaccgtgctggtctcc	CRISPR spacer
ggcacgggccccgacggcaccgtcctggtgatc	Protospacer
. *. **.*************** *****  .*

546. spacer 1.7|84196|33|CP029339|CRISPRCasFinder,CRT matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 9, identity: 0.727

ccgcacttgccgcagaccaggacgccgttctcg	CRISPR spacer
gtccacttgccgccgacgaggacgccgatgccc	Protospacer
 . ********** *** ********* * .* 

547. spacer 1.11|84440|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 9, identity: 0.727

cgccagagcgccggccgccgtgccagagccgta	CRISPR spacer
cgccagcgcgccgggcgccgtgccttcgatgac	Protospacer
****** ******* *********   * .*  

548. spacer 1.17|84800|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010862 (Marinovum algicola DG 898 plasmid pMaD7) position: , mismatch: 9, identity: 0.727

tagagatcgcccgccggcgcgggccggtcgagc	CRISPR spacer
gccaccgcgcccggcggctcgggccggtcgagt	Protospacer
   *   ****** **** *************.

549. spacer 1.18|84861|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.727

ctctgggacgcccacgcgcacctcgtggagtgc-	CRISPR spacer
cggcggggcgcccacgcgcacctcg-aggctgta	Protospacer
*  .***.***************** .*. **. 

550. spacer 1.25|85288|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727

gggtgatcaggggcccggtccggccgtaggaag	CRISPR spacer
tgctgaacaggcgcccggtccggccgtcgtcct	Protospacer
 * *** **** *************** *    

551. spacer 1.27|84013|37|CP029339|PILER-CR matches to CP040467 (Streptomyces albidoflavus strain UYFA156 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.757

accgaggaccccgacggcaccgtgctggtctccggaa	CRISPR spacer
ccgctcgaccccgacggcaccgtcctggtcaccggcg	Protospacer
 *    ***************** ****** **** .

552. spacer 1.27|84013|37|CP029339|PILER-CR matches to NZ_CP053565 (Pseudonocardia sp. Gen01 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.757

accgaggaccccgacggcaccgtgctggtctccggaa	CRISPR spacer
gccgagcaccccggcggcaccgtgctgggcgtcgcgg	Protospacer
.***** ******.************** * .** ..

553. spacer 1.28|84074|37|CP029339|PILER-CR matches to NC_004934 (Streptomyces violaceoruber strain SANK95570 plasmid pSV2, complete sequence) position: , mismatch: 9, identity: 0.757

gcgctg-cgtcacggccgtcaggctccggcggagggaa	CRISPR spacer
-cacagtcgtcgcggccgtcaggctccggaggagttcg	Protospacer
 *.* * ****.***************** ****   .

554. spacer 1.28|84074|37|CP029339|PILER-CR matches to NZ_CP026654 (Streptomyces dengpaensis strain XZHG99 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.757

gcgctg-cgtcacggccgtcaggctccggcggagggaa	CRISPR spacer
-cacagtcgtcgcggccgtcaggctccggaggagttcg	Protospacer
 *.* * ****.***************** ****   .

555. spacer 2.2|86754|33|CP029339|CRT,CRISPRCasFinder matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 9, identity: 0.727

gccgacatcgagggcgtcgacggcgtccgcctc	CRISPR spacer
cccgacgtcgagggcgtcgacgtcggtccggtg	Protospacer
 *****.*************** ** .*   * 

556. spacer 2.2|86754|33|CP029339|CRT,CRISPRCasFinder matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 9, identity: 0.727

gccgacatcgagggcgtcgacggcgtccgcctc	CRISPR spacer
cggggcggcgagggcgtcgacggcggccacctg	Protospacer
   *.*. ***************** **.*** 

557. spacer 2.2|86754|33|CP029339|CRT,CRISPRCasFinder matches to NZ_CP046574 (Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence) position: , mismatch: 9, identity: 0.727

gccgacatcgagggcgtcgacggcgtccgcctc	CRISPR spacer
gccgacctcgagggcgtcggcggcaatcaggcc	Protospacer
****** ************.****. .*.  .*

558. spacer 2.3|86815|33|CP029339|CRT,CRISPRCasFinder matches to NZ_CP032326 (Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence) position: , mismatch: 9, identity: 0.727

gaccgcgacgtcaagaagcgctgggccgaagat	CRISPR spacer
gaccgctacgtcaagaagcgcgggctctactcg	Protospacer
****** ************** ** .* *    

559. spacer 3.5|87638|33|CP029339|CRISPRCasFinder matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.727

gatttcgagatcctcagcgtggaggagctgaac	CRISPR spacer
ctgatcgagatcgtcagcctggaggagccgcgc	Protospacer
    ******** ***** *********.* .*

560. spacer 3.5|87638|33|CP029339|CRISPRCasFinder matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 9, identity: 0.727

gatttcgagatcctcagcgtggaggagctgaac	CRISPR spacer
atgatcgagatcgtcagcctggaggagccgcgc	Protospacer
.   ******** ***** *********.* .*

561. spacer 3.5|87638|33|CP029339|CRISPRCasFinder matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 9, identity: 0.727

gatttcgagatcctcagcgtggaggagctgaac	CRISPR spacer
ctgatcgagatcgtcagcctggaggagccgcgc	Protospacer
    ******** ***** *********.* .*

562. spacer 3.5|87638|33|CP029339|CRISPRCasFinder matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 9, identity: 0.727

gatttcgagatcctcagcgtggaggagctgaac	CRISPR spacer
ctgatcgagatcgtcagcctggaggagccgcgc	Protospacer
    ******** ***** *********.* .*

563. spacer 3.5|87638|33|CP029339|CRISPRCasFinder matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 9, identity: 0.727

gatttcgagatcctcagcgtggaggagctgaac	CRISPR spacer
ctgatcgagatcgtcagcctggaggagccgcgc	Protospacer
    ******** ***** *********.* .*

564. spacer 3.5|87638|33|CP029339|CRISPRCasFinder matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 9, identity: 0.727

gatttcgagatcctcagcgtggaggagctgaac	CRISPR spacer
ctgatcgagatcgtcagcctggaggagccgcgc	Protospacer
    ******** ***** *********.* .*

565. spacer 4.7|89240|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 9, identity: 0.727

gtccgcccgcaccggcagatgactgggggtggg	CRISPR spacer
aaccgcccgcaccgccagatgacgggccgccag	Protospacer
. ************ ******** **  *. .*

566. spacer 4.8|89301|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011520 (Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-3, complete sequence) position: , mismatch: 9, identity: 0.727

cggttcttcgccacggtccgatcgtcgcgcccc	CRISPR spacer
aacgtcgccgacacggtccaatcgtcgcgcccg	Protospacer
 .  ** .** ********.************ 

567. spacer 4.16|89789|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.727

cactccaccccgatcaccgtggtgggctgggcg	CRISPR spacer
cactccaccccgatcaccgcgatgtccggcttc	Protospacer
*******************.*.**  * *  . 

568. spacer 4.16|89789|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 9, identity: 0.727

cactccaccccgatcaccgtggtgggctgggcg	CRISPR spacer
cactccaccccgatcaccgcgatgtccggcttc	Protospacer
*******************.*.**  * *  . 

569. spacer 4.19|89972|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP007449 (Yersinia enterocolitica LC20 plasmid plasmid1_80K, complete sequence) position: , mismatch: 9, identity: 0.727

gttgggaatgcctaggtgtgtgatctgtgcggg	CRISPR spacer
tggtggtgtgcctaggtctgtggtctgtgcgga	Protospacer
    ** .********* ****.*********.

570. spacer 4.21|89789|32|CP029339|PILER-CR matches to NC_019387 (Thermus oshimai JL-2 plasmid pTHEOS01, complete sequence) position: , mismatch: 9, identity: 0.719

cactccaccccgatcaccgtggtgggctgggc	CRISPR spacer
agctccaccccgatccccgtggtggccacctt	Protospacer
 .************* ********* *    .

571. spacer 4.23|89911|32|CP029339|PILER-CR matches to NC_015162 (Deinococcus proteolyticus MRP plasmid pDEIPR02, complete sequence) position: , mismatch: 9, identity: 0.719

catcgggagtgcgttcgtgctggtcaaggtgg	CRISPR spacer
cacccggagtgcgttcgtgctggcgggcgagt	Protospacer
**.* ******************. .. * * 

572. spacer 5.1|90308|33|CP029339|CRISPRCasFinder matches to NZ_AP022578 (Mycolicibacterium aubagnense strain JCM 15296 plasmid pJCM15296, complete sequence) position: , mismatch: 9, identity: 0.727

atggcgtcgaggcggatggagatggtgccgccc	CRISPR spacer
tagtcagcgaggcgggtggcgatggtgccgctg	Protospacer
  * *. ********.*** ***********. 

573. spacer 6.4|93431|34|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NC_021347 (Rhodococcus phage E3, complete genome) position: , mismatch: 9, identity: 0.735

gatgcccccggcgacgacgtagcagtacccgggc	CRISPR spacer
ggtgtagtcggcgacgacgttgaagtacccggcg	Protospacer
*.**.  .************ * *********  

574. spacer 6.5|93493|32|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029211 (Aquabacterium olei strain NBRC 110486 plasmid pTB101, complete sequence) position: , mismatch: 9, identity: 0.719

cggggctgtacgaggtcgatctcggggcggag	CRISPR spacer
cggggctgtacgaggccgagctcagctacctg	Protospacer
***************.*** ***.*      *

575. spacer 7.3|98087|32|CP029339|CRT,CRISPRCasFinder matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 9, identity: 0.719

ttcacgctgagcgcggcgtcccgctcggacag	CRISPR spacer
agacggctgagagcggcgtcccgctcggcggg	Protospacer
     ****** ****************  .*

576. spacer 7.3|98087|32|CP029339|CRT,CRISPRCasFinder matches to NC_011143 (Phenylobacterium zucineum HLK1 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719

ttcacgctgagcgcggcgtcccgctcggacag	CRISPR spacer
ctcccgccgagcgcggcgtcccgctgaatgac	Protospacer
.** ***.***************** ..  * 

577. spacer 7.3|98087|32|CP029339|CRT,CRISPRCasFinder matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 9, identity: 0.719

ttcacgctgagcgcggcgtcccgctcggacag	CRISPR spacer
tccgcgctgagcgcggcgtctcggtcgccttc	Protospacer
*.*.****************.** ***  .  

578. spacer 7.3|98087|32|CP029339|CRT,CRISPRCasFinder matches to NZ_AP014706 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence) position: , mismatch: 9, identity: 0.719

ttcacgctgagcgcggcgtcccgctcggacag	CRISPR spacer
gcctcctcgagcgcggcgtcgcgctcggccaa	Protospacer
 .* * ..************ ******* **.

579. spacer 7.8|98392|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 9, identity: 0.727

ttctggaagaccggcccgaccgccgagaacccc	CRISPR spacer
cacacgccgacctgcccgaccgccgagagcccg	Protospacer
. *  *  **** ***************.*** 

580. spacer 7.8|98392|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NC_017791 (Deinococcus gobiensis I-0 plasmid P2, complete sequence) position: , mismatch: 9, identity: 0.727

ttctggaagaccggcccgaccgccgagaacccc	CRISPR spacer
tcggaccataccggcctgaccgccgagaacgcc	Protospacer
*.  .  * *******.************* **

581. spacer 7.8|98392|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 9, identity: 0.727

ttctggaagaccggcccgaccgccgagaacccc	CRISPR spacer
cacacgccgacctgcccgaccgccgagagcccg	Protospacer
. *  *  **** ***************.*** 

582. spacer 7.8|98392|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP035709 (Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt12, complete sequence) position: , mismatch: 9, identity: 0.727

ttctggaagaccggcccgaccgccgagaacccc	CRISPR spacer
ggcagccagaccgacccgcccgccgagaaccgg	Protospacer
  * *  ******.**** ************  

583. spacer 7.11|98575|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 9, identity: 0.727

acgggcgtcgccgtcgagtggctgaaggtgaag	CRISPR spacer
ccgggcgttgccgtcgagaggctgaagccccca	Protospacer
 *******.********* ******** .   .

584. spacer 7.11|98575|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 9, identity: 0.727

acgggcgtcgccgtcgagtggctgaaggtgaag	CRISPR spacer
ccgggcgttgccgtcgagaggctgaagccccca	Protospacer
 *******.********* ******** .   .

585. spacer 7.11|98575|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 9, identity: 0.727

acgggcgtcgccgtcgagtggctgaaggtgaag	CRISPR spacer
ctcggcatcgccgtcgagcggctgaagcaggtg	Protospacer
 . ***.***********.********  *. *

586. spacer 7.11|98575|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 9, identity: 0.727

acgggcgtcgccgtcgagtggctgaaggtgaag	CRISPR spacer
ctggacggcgccgtcgagtggctgaactcgccg	Protospacer
 .**.** ******************  .*  *

587. spacer 7.14|98758|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.727

agcccatcagacgccgtgcgcggcgccatcgcc	CRISPR spacer
gctccggacgacgccgtgcgcggcgcgctcgcc	Protospacer
. .**.   *****************  *****

588. spacer 7.14|98758|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 9, identity: 0.727

agcccatcagacgccgtgcgcggcgccatcgcc	CRISPR spacer
ttcaattcggacgccgcgcgcggcgccatcttc	Protospacer
  *   **.*******.************* .*

589. spacer 7.14|98758|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NC_008741 (Desulfovibrio vulgaris DP4 plasmid pDVUL01, complete sequence) position: , mismatch: 9, identity: 0.727

agcccatcagacgccgtgcgcggcgccatcgcc	CRISPR spacer
ggcgtgcgcgaggcggtgcgcggcgccatcgcc	Protospacer
.** ...  ** ** ******************

590. spacer 7.14|98758|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NC_006569 (Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.727

agcccatcagacgccgtgcgcggcgccatcgcc	CRISPR spacer
gttactgccgaggccgcgcgcggcgccatcgcc	Protospacer
. . *  * ** ****.****************

591. spacer 7.14|98758|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NC_017311 (Desulfovibrio vulgaris RCH1 plasmid pDEVAL01, complete sequence) position: , mismatch: 9, identity: 0.727

agcccatcagacgccgtgcgcggcgccatcgcc	CRISPR spacer
ggcgtgcgcgaggcggtgcgcggcgccatcgcc	Protospacer
.** ...  ** ** ******************

592. spacer 7.14|98758|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NC_005863 (Desulfovibrio vulgaris str. Hildenborough plasmid pDV, complete sequence) position: , mismatch: 9, identity: 0.727

agcccatcagacgccgtgcgcggcgccatcgcc	CRISPR spacer
ggcgtgcgcgaggcggtgcgcggcgccatcgcc	Protospacer
.** ...  ** ** ******************

593. spacer 7.19|99063|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to MK977714 (Corynebacterium phage Bran, complete genome) position: , mismatch: 9, identity: 0.727

tactacctctcccccaacaagaccgccgaggac	CRISPR spacer
cgccgcatcacccccaagaagaccgccgaggcg	Protospacer
..*..* ** ******* *************  

594. spacer 7.21|99185|33|CP029339|CRT,CRISPRCasFinder matches to NZ_CP025431 (Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence) position: , mismatch: 9, identity: 0.727

aatatgagaa-ttcctgccgcgcgcccgaggggg	CRISPR spacer
-gcacgaagacttccagccgcgcgcccgaggtgt	Protospacer
 ..*.**..* **** *************** * 

595. spacer 7.23|99307|33|CP029339|CRT,CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 9, identity: 0.727

tcgacgtgggcggcgccgccgtggtcggcgaac	CRISPR spacer
gggacatgggcggcgccgcggtggtcatcggca	Protospacer
  ***.************* ******. **.  

596. spacer 7.23|99307|33|CP029339|CRT,CRISPRCasFinder matches to CP021185 (Sphingomonas wittichii DC-6 plasmid pDC04, complete sequence) position: , mismatch: 9, identity: 0.727

tcgacgtgggcggcgccgccgtggtcggcgaac	CRISPR spacer
ccgacttgggcggcgcggccgtggtcatgcgcc	Protospacer
.**** ********** *********.   . *

597. spacer 7.23|99307|33|CP029339|CRT,CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.727

tcgacgtgggcggcgccgccgtggtcggcgaac	CRISPR spacer
gggacatgggcggcgccgcggtggtcatcggca	Protospacer
  ***.************* ******. **.  

598. spacer 7.23|99307|33|CP029339|CRT,CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.727

tcgacgtgggcggcgccgccgtggtcggcgaac	CRISPR spacer
gggacatgggcggcgccgcggtggtcatcggca	Protospacer
  ***.************* ******. **.  

599. spacer 7.23|99307|33|CP029339|CRT,CRISPRCasFinder matches to NZ_LN831789 (Streptomyces leeuwenhoekii strain type strain (C34 = DSM 42122 = NRRL B-24963) plasmid pSLE2) position: , mismatch: 9, identity: 0.727

tcgacgtgggcggcgccgccgtggtcggcgaac	CRISPR spacer
aggacgtcggcgacgccgccgtggtcctcggtg	Protospacer
  ***** ****.*************  **.  

600. spacer 7.23|99307|33|CP029339|CRT,CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 9, identity: 0.727

tcgacgtgggcggcgccgccgtggtcggcgaac	CRISPR spacer
gggacatgggcggcgccgcggtggtcatcggca	Protospacer
  ***.************* ******. **.  

601. spacer 7.23|99307|33|CP029339|CRT,CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.727

tcgacgtgggcggcgccgccgtggtcggcgaac	CRISPR spacer
gggacatgggcggcgccgcggtggtcatcggca	Protospacer
  ***.************* ******. **.  

602. spacer 7.23|99307|33|CP029339|CRT,CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.727

tcgacgtgggcggcgccgccgtggtcggcgaac	CRISPR spacer
gggacatgggcggcgccgcggtggtcatcggca	Protospacer
  ***.************* ******. **.  

603. spacer 7.23|99307|33|CP029339|CRT,CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 9, identity: 0.727

tcgacgtgggcggcgccgccgtggtcggcgaac	CRISPR spacer
gggacatgggcggcgccgcggtggtcatcggca	Protospacer
  ***.************* ******. **.  

604. spacer 7.23|99307|33|CP029339|CRT,CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.727

tcgacgtgggcggcgccgccgtggtcggcgaac	CRISPR spacer
gggacatgggcggcgccgcggtggtcatcggca	Protospacer
  ***.************* ******. **.  

605. spacer 8.3|109836|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.727

ggcgacgcggccccggtcgttccggcgcgcacc	CRISPR spacer
ggcggcgcggcctcggtcgttccgttcatgaca	Protospacer
****.*******.*********** .    ** 

606. spacer 8.9|110202|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029360 (Azospirillum sp. CFH 70021 plasmid unnamed5) position: , mismatch: 9, identity: 0.727

gctgcccaccagtcacgacggcgccgttgacct	CRISPR spacer
agagctggcccgtcacgacggcggcgttgaccg	Protospacer
.  **. .** ************ ******** 

607. spacer 8.13|110446|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040760 (Paracoccus sp. 2251 plasmid unnamed6, complete sequence) position: , mismatch: 9, identity: 0.727

gcgcctgggcctggtcgaggacgcggaggccgg	CRISPR spacer
ttcgtttggccttgtcgaggatgcggaggccga	Protospacer
 .  .* ***** ********.**********.

608. spacer 8.13|110446|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015322 (Mesorhizobium amorphae CCNWGS0123 plasmid pM0123d, complete sequence) position: , mismatch: 9, identity: 0.727

gcgcctgggcctggtcgaggacgcggaggccgg	CRISPR spacer
ccatatgggcctggtcgaagacgcagaggaagc	Protospacer
 *.. *************.*****.****  * 

609. spacer 8.19|110812|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NC_017273 (Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence) position: , mismatch: 9, identity: 0.727

gccgatgccgccgccaggtcacccccgcagatc	CRISPR spacer
accgctgccgccgccaggtaaccccatcacggg	Protospacer
.*** ************** *****  ** .  

610. spacer 8.19|110812|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014142 (Thermus parvatiensis strain RL plasmid pTP143, complete sequence) position: , mismatch: 9, identity: 0.727

gccgatgccgccgccaggtcacccccgcagatc	CRISPR spacer
accgttgccgccgccaggtaaccccatcacggg	Protospacer
.*** ************** *****  ** .  

611. spacer 8.19|110812|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NC_005838 (Thermus thermophilus HB27 plasmid pTT27, complete sequence) position: , mismatch: 9, identity: 0.727

gccgatgccgccgccaggtcacccccgcagatc	CRISPR spacer
accgctgccgccgccaggtaaccccatcacggg	Protospacer
.*** ************** *****  ** .  

612. spacer 8.19|110812|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NC_017588 (Thermus thermophilus JL-18 plasmid pTTJL1801, complete sequence) position: , mismatch: 9, identity: 0.727

gccgatgccgccgccaggtcacccccgcagatc	CRISPR spacer
accgctgccgccgccaggtaaccccatcacggg	Protospacer
.*** ************** *****  ** .  

613. spacer 8.19|110812|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR027520 (Thermus thermophilus isolate TTHNAR1 plasmid 4, complete sequence) position: , mismatch: 9, identity: 0.727

gccgatgccgccgccaggtcacccccgcagatc	CRISPR spacer
accgctgccgccgccaggtaaccccatcacggg	Protospacer
.*** ************** *****  ** .  

614. spacer 8.21|110934|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT853886 (Xanthomonas fragariae strain PD5205 plasmid pPD5205-30, complete sequence) position: , mismatch: 9, identity: 0.727

gtcggggcggcgcgcgtcggccgcgtacaccac	CRISPR spacer
ggaaacggcgcgcgcgtcttccgcgtacaccac	Protospacer
*  .. *  *********  *************

615. spacer 8.21|110934|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016831 (Xanthomonas fragariae isolate Fap21 plasmid pFap21-1, complete sequence) position: , mismatch: 9, identity: 0.727

gtcggggcggcgcgcgtcggccgcgtacaccac	CRISPR spacer
ggaaacggcgcgcgcgtcttccgcgtacaccac	Protospacer
*  .. *  *********  *************

616. spacer 8.21|110934|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016834 (Xanthomonas fragariae isolate Fap29 plasmid pFap29-1, complete sequence) position: , mismatch: 9, identity: 0.727

gtcggggcggcgcgcgtcggccgcgtacaccac	CRISPR spacer
ggaaacggcgcgcgcgtcttccgcgtacaccac	Protospacer
*  .. *  *********  *************

617. spacer 8.21|110934|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT853883 (Xanthomonas fragariae strain PD885 plasmid pPD885-29, complete sequence) position: , mismatch: 9, identity: 0.727

gtcggggcggcgcgcgtcggccgcgtacaccac	CRISPR spacer
ggaaacggcgcgcgcgtcttccgcgtacaccac	Protospacer
*  .. *  *********  *************

618. spacer 8.22|110995|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to MK494117 (Mycobacterium phage Miramae, complete genome) position: , mismatch: 9, identity: 0.727

ccagacgacagagagccccccggcctccagcag	CRISPR spacer
ccagacggcagtgagccccccggcaacgtctgg	Protospacer
*******.*** ************  *   ..*

619. spacer 8.22|110995|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to MK494129 (Mycobacterium phage AvatarAhPeg, complete genome) position: , mismatch: 9, identity: 0.727

ccagacgacagagagccccccggcctccagcag	CRISPR spacer
ccagacggcagtgagccccccggcaacgtctgg	Protospacer
*******.*** ************  *   ..*

620. spacer 8.29|111300|32|CP029339|CRISPRCasFinder,CRT matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 9, identity: 0.719

gcgttgtagaaaatgccgtccatgtcgatgtc	CRISPR spacer
tttcggcggagaatgccgttcatgtcgatgtc	Protospacer
 . . *..**.********.************

621. spacer 8.29|111300|32|CP029339|CRISPRCasFinder,CRT matches to JX042579 (Mycobacterium virus MacnCheese, complete genome) position: , mismatch: 9, identity: 0.719

gcgttgtagaaaatgccgtccatgtcgatgtc	CRISPR spacer
accttgttgaaaatgccgcccatgtcggccag	Protospacer
.* **** **********.********..   

622. spacer 8.29|111300|32|CP029339|CRISPRCasFinder,CRT matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 9, identity: 0.719

gcgttgtagaaaatgccgtccatgtcgatgtc	CRISPR spacer
tcgcacccgaaaacgccgttcatgtcgatgta	Protospacer
 **.  . *****.*****.*********** 

623. spacer 1.1|83832|31|CP029339|CRISPRCasFinder,CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 10, identity: 0.677

ggcagcgccgggcgtagcgggctgcgtcgtg	CRISPR spacer
tccagcgcccggcgttgcgggctgctgtaga	Protospacer
  ******* ***** *********  .. .

624. spacer 1.5|84074|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP029777 (Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.697

gcgctgcgtcacggccgtcaggctccggcggag	CRISPR spacer
gtcggaggtgacggccgtcaggccccggcgggt	Protospacer
*.   . ** *************.*******. 

625. spacer 1.17|84800|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 10, identity: 0.697

tagagatcgcccgccggcgcgggccggtcgagc	CRISPR spacer
acgccgtcgcccgcatgcgcgggccggtcggca	Protospacer
  *  .********  **************.  

626. spacer 1.17|84800|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to MH834620 (Arthrobacter phage Melons, complete genome) position: , mismatch: 10, identity: 0.697

tagaga-----tcgcccgccggcgcgggccggtcgagc	CRISPR spacer
-----atttcctcgccggccggcgcggtccggtcgttg	Protospacer
     *     ***** ********** *******   

627. spacer 1.17|84800|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to MH834606 (Arthrobacter phage Coral, complete genome) position: , mismatch: 10, identity: 0.697

tagaga-----tcgcccgccggcgcgggccggtcgagc	CRISPR spacer
-----atttcctcgccggccggcgcggtccggtcgttg	Protospacer
     *     ***** ********** *******   

628. spacer 1.17|84800|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to MH834618 (Arthrobacter phage Lunar, complete genome) position: , mismatch: 10, identity: 0.697

tagaga-----tcgcccgccggcgcgggccggtcgagc	CRISPR spacer
-----atttcctcgccggccggcgcggtccggtcgttg	Protospacer
     *     ***** ********** *******   

629. spacer 1.17|84800|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to MN234214 (Arthrobacter phage Amelia, complete genome) position: , mismatch: 10, identity: 0.697

tagaga-----tcgcccgccggcgcgggccggtcgagc	CRISPR spacer
-----atttcctcgccggccggcgcggtccggtcgttg	Protospacer
     *     ***** ********** *******   

630. spacer 1.17|84800|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to MH834624 (Arthrobacter phage Polka, complete genome) position: , mismatch: 10, identity: 0.697

tagaga-----tcgcccgccggcgcgggccggtcgagc	CRISPR spacer
-----atttcctcgccggccggcgcggtccggtcgttg	Protospacer
     *     ***** ********** *******   

631. spacer 1.17|84800|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to MH834608 (Arthrobacter phage Cote, complete genome) position: , mismatch: 10, identity: 0.697

tagaga-----tcgcccgccggcgcgggccggtcgagc	CRISPR spacer
-----atttcctcgccggccggcgcggtccggtcgttg	Protospacer
     *     ***** ********** *******   

632. spacer 1.17|84800|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to MH834616 (Arthrobacter phage Kepler, complete genome) position: , mismatch: 10, identity: 0.697

tagaga-----tcgcccgccggcgcgggccggtcgagc	CRISPR spacer
-----atttcctcgccggccggcgcggtccggtcgttg	Protospacer
     *     ***** ********** *******   

633. spacer 1.17|84800|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to MH834609 (Arthrobacter phage Daob, complete genome) position: , mismatch: 10, identity: 0.697

tagaga-----tcgcccgccggcgcgggccggtcgagc	CRISPR spacer
-----atttcctcgccggccggcgcggtccggtcgttg	Protospacer
     *     ***** ********** *******   

634. spacer 1.23|85166|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023976 (Streptomyces alboflavus strain MDJK44 plasmid pMDJK44.1, complete sequence) position: , mismatch: 10, identity: 0.697

gccgcggtactcggagaccgctcccggagcccg	CRISPR spacer
cggccggtacgcggagaccgcgcccggagtgaa	Protospacer
    ****** ********** *******.  .

635. spacer 1.28|84074|37|CP029339|PILER-CR matches to CP054922 (Streptomyces sp. NA03103 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.73

gcgctgcgtcacggccgtcaggctccggcggagggaa	CRISPR spacer
gcaagtcgtcgcggccgtcaggctccgggggagttcg	Protospacer
**.   ****.***************** ****   .

636. spacer 1.28|84074|37|CP029339|PILER-CR matches to NZ_CP010408 (Streptomyces vietnamensis strain GIMV4.0001 plasmid pSVL1, complete sequence) position: , mismatch: 10, identity: 0.73

gcgctg-cgtcacggccgtcaggctccggcggagggaa	CRISPR spacer
-cacagttgtcgcggccgtcaggctccggaggagttcg	Protospacer
 *.* * .***.***************** ****   .

637. spacer 1.32|84318|37|CP029339|PILER-CR matches to MT701598 (Streptomyces phage Sitrop, complete genome) position: , mismatch: 10, identity: 0.73

cggtacgcggtgtgggtcgagggcgacggcaccggag	CRISPR spacer
tggtacgcggtgtgggtcgacggcaaccacaacttct	Protospacer
.******************* ***.** .** *    

638. spacer 4.4|89057|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 10, identity: 0.697

ctcggcggccctgcggcgtcgttctgcggcggc	CRISPR spacer
aggggcggcccttccgcgtcgttctgctggact	Protospacer
   ********* * ************ * . .

639. spacer 4.4|89057|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 10, identity: 0.697

ctcggcggccctgcggcgtcgttctgcggcggc	CRISPR spacer
aggggcggcccttccgcgtcgttctgctggact	Protospacer
   ********* * ************ * . .

640. spacer 4.4|89057|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP041223 (Porphyrobacter sp. YT40 plasmid pYT40, complete sequence) position: , mismatch: 10, identity: 0.697

ctcggcggccctgcggcgtcgttctgcggcggc	CRISPR spacer
aatcgcggccctgcggcgtcgatatgcgcagtt	Protospacer
  . ***************** * ****  * .

641. spacer 4.21|89789|32|CP029339|PILER-CR matches to NZ_AP019795 (Thermus thermophilus strain AA2-29 plasmid pAA229, complete sequence) position: , mismatch: 10, identity: 0.688

cactccaccccgatcaccgtggtgggctgggc	CRISPR spacer
agctccacccctatccccgtggtggccacctt	Protospacer
 .********* *** ********* *    .

642. spacer 4.21|89789|32|CP029339|PILER-CR matches to NZ_AP019793 (Thermus thermophilus strain AA2-20 plasmid pAA220, complete sequence) position: , mismatch: 10, identity: 0.688

cactccaccccgatcaccgtggtgggctgggc	CRISPR spacer
agctccacccctatccccgtggtggccacctt	Protospacer
 .********* *** ********* *    .

643. spacer 4.21|89789|32|CP029339|PILER-CR matches to NC_022063 (Mycobacterium phage Phelemich, complete genome) position: , mismatch: 10, identity: 0.688

cactccaccccgatcaccgtggtgggctgggc	CRISPR spacer
tacaccaccccgaccaccgtggtgcagaccac	Protospacer
.** *********.********** .    .*

644. spacer 4.21|89789|32|CP029339|PILER-CR matches to KF024727 (Mycobacterium phage Reprobate, complete genome) position: , mismatch: 10, identity: 0.688

cactccaccccgatcaccgtggtgggctgggc	CRISPR spacer
tacaccaccccgaccaccgtggtgcagaccac	Protospacer
.** *********.********** .    .*

645. spacer 6.4|93431|34|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023150 (Mycobacterium intracellulare strain FLAC0181 plasmid pFLAC0181, complete sequence) position: , mismatch: 10, identity: 0.706

gatgcccccggcgacgacgtagcagtacccgggc	CRISPR spacer
gtgtgccccggcgtcgatgtagcagtacccttcg	Protospacer
*    ******** ***.************    

646. spacer 6.4|93431|34|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040254 (Mycobacterium avium subsp. hominissuis strain 101115 plasmid pFLAC0181_CHOP101, complete sequence) position: , mismatch: 10, identity: 0.706

gatgcccccggcgacgacgtagcagtacccgggc	CRISPR spacer
gtgtgccccggcgtcgatgtagcagtacccttcg	Protospacer
*    ******** ***.************    

647. spacer 6.4|93431|34|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040248 (Mycobacterium avium subsp. hominissuis strain 101174 plasmid pFLAC0181_CHOP101, complete sequence) position: , mismatch: 10, identity: 0.706

gatgcccccggcgacgacgtagcagtacccgggc	CRISPR spacer
gtgtgccccggcgtcgatgtagcagtacccttcg	Protospacer
*    ******** ***.************    

648. spacer 6.4|93431|34|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040246 (Mycobacterium avium subsp. hominissuis strain 101034 plasmid pFLAC0181_CHOP1, complete sequence) position: , mismatch: 10, identity: 0.706

gatgcccccggcgacgacgtagcagtacccgggc	CRISPR spacer
gtgtgccccggcgtcgatgtagcagtacccttcg	Protospacer
*    ******** ***.************    

649. spacer 7.3|98087|32|CP029339|CRT,CRISPRCasFinder matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 10, identity: 0.688

ttcacgctgagcgcggcgtcccgctcggacag	CRISPR spacer
aggcggctgagggcggcgtctcgctcggcggg	Protospacer
     ****** ********.*******  .*

650. spacer 7.3|98087|32|CP029339|CRT,CRISPRCasFinder matches to MH976515 (Gordonia phage Octobien14, complete genome) position: , mismatch: 10, identity: 0.688

ttcacgctgagcgcggcgtcccgctcggacag	CRISPR spacer
cgttggctgagggccgcgtcccgctcggggac	Protospacer
. .  ****** ** *************. * 

651. spacer 7.7|98331|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NZ_LR536451 (Methylocella tundrae isolate MTUNDRAET4 annotated genome plasmid 2) position: , mismatch: 10, identity: 0.697

aggtcatgccgccacttgggcatggggccagcg	CRISPR spacer
cgccagcagcgccgctttggcatggggccagcg	Protospacer
 * . ... ****.*** ***************

652. spacer 7.8|98392|33|CP029339|CRT,CRISPRCasFinder,PILER-CR matches to NZ_LR134466 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 24, complete sequence) position: , mismatch: 10, identity: 0.697

ttctggaagaccggcccgaccgccgagaacccc	CRISPR spacer
accgtcgagaccagcccgaccgccaagaacctg	Protospacer
 .*   .*****.***********.******. 

653. spacer 7.23|99307|33|CP029339|CRT,CRISPRCasFinder matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.697

tcgacgtgggcggcgccgccgtggtcggcgaac	CRISPR spacer
tactgctgggcggcgccgccctgttcggcgcga	Protospacer
*     ************** ** ****** . 

654. spacer 7.23|99307|33|CP029339|CRT,CRISPRCasFinder matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 10, identity: 0.697

tcgacgtgggcggcgccgccgtggtcggcgaac	CRISPR spacer
tactgctgggcggcgccgccctgttcggcgcga	Protospacer
*     ************** ** ****** . 

655. spacer 8.3|109836|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 10, identity: 0.697

ggcgacgcggccccggtcgttccggcgcgcacc	CRISPR spacer
ccgaacgcgacccccgtcgttccggcgcaggtc	Protospacer
   .*****.**** *************. ..*

656. spacer 8.5|109958|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.697

ggtcccggctcccccgacaggccggcccttcac	CRISPR spacer
ctggccggctcccccggcagggcggcccggcgg	Protospacer
    ************.**** ******  *. 

657. spacer 8.13|110446|33|CP029339|PILER-CR,CRISPRCasFinder,CRT matches to KX557288 (Rhodococcus phage ChewyVIII, complete genome) position: , mismatch: 10, identity: 0.697

gcgcctgggcctggtcgaggacgcggaggccgg	CRISPR spacer
ggagctcggcctggtcgaggacgtggagaagtt	Protospacer
* . ** ****************.****.    

658. spacer 8.29|111300|32|CP029339|CRISPRCasFinder,CRT matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 10, identity: 0.688

gcgttgtagaaaatgccgtccatgtcgatgtc	CRISPR spacer
ccgttgtggaaaatgccgttcatgaaatcatt	Protospacer
 ******.***********.****  . ..*.

659. spacer 1.4|84013|33|CP029339|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 11, identity: 0.667

accgaggaccccgacggcaccgtgctggtctcc	CRISPR spacer
ctcgaggtctccgacggcaccgtgctaccactg	Protospacer
 .***** *.****************. . .. 

660. spacer 1.8|84257|33|CP029339|CRISPRCasFinder,CRT matches to NZ_CP016082 (Streptomyces sp. SAT1 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.667

ctgacgttcaggccgtgggcggtctcagcgatc	CRISPR spacer
tccccgttcaggacgtgggcggtcacagtccgg	Protospacer
..  ******** *********** ***.    

661. spacer 1.8|84257|33|CP029339|CRISPRCasFinder,CRT matches to MH316566 (Gordonia phage Nedarya, complete genome) position: , mismatch: 11, identity: 0.667

ctgacgttcaggccgtgggcggtctcagcgatc	CRISPR spacer
ttgacgttcaggccgtagtcggtcttgagcgca	Protospacer
.***************.* ******...  .. 

662. spacer 1.19|84922|33|CP029339|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013379 (Burkholderia pseudomultivorans strain SUB-INT23-BP2 plasmid pINT23, complete sequence) position: , mismatch: 11, identity: 0.667

tgttgatcaacggcgaaaaggcccgccccctgc	CRISPR spacer
ctcgccccaacgtcaaaaaggcccgccccctcg	Protospacer
. .   .***** *.****************  

663. spacer 1.27|84013|37|CP029339|PILER-CR matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 11, identity: 0.703

accgaggaccccgacggcaccgtgctggtctccggaa	CRISPR spacer
cgccgggaccccgacggcaccgggctgggcttcttcg	Protospacer
  * .***************** ***** **.*   .

664. spacer 1.27|84013|37|CP029339|PILER-CR matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 11, identity: 0.703

accgaggaccccgacggcaccgtgctggtctccggaa	CRISPR spacer
cgccgggaccccgacggcaccgggctgggcttcttcg	Protospacer
  * .***************** ***** **.*   .

665. spacer 1.28|84074|37|CP029339|PILER-CR matches to NC_003903 (Streptomyces coelicolor A3(2) plasmid SCP1, complete sequence) position: , mismatch: 11, identity: 0.703

gcgctgcgtcacggccgtcaggctccggcggagggaa	CRISPR spacer
acaagtcgtcgcggccgtcaggctccgggggagttcg	Protospacer
.*.   ****.***************** ****   .

666. spacer 2.2|86754|33|CP029339|CRT,CRISPRCasFinder matches to NC_047751 (Ralstonia phage phiITL-1, complete genome) position: , mismatch: 11, identity: 0.667

gccgacatcgagggcgtcgacggcgtccgcctc	CRISPR spacer
cgggacatcgagggcgccgagggcgtcaagtca	Protospacer
   *************.*** ****** . .. 

667. spacer 7.3|98087|32|CP029339|CRT,CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.656

ttcacgctgagcgcggcgtcccgctcggacag	CRISPR spacer
gcttcgcggagcgcggcgtcgcgctcgactcc	Protospacer
 .. *** ************ ******. .  

668. spacer 4.20|89728|277|CP029339|PILER-CR matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 217, identity: 0.217

acgcgcctggtgtcgccggcggcgggggagccgggagcatccccgcgcgtgcggggccga	CRISPR spacer
acgcgcctggtgtcgccggcggcgggggagccgggagcatccccgcgcgtgcggggccga	Protospacer
************************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP029338
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029338_1 750680-750875 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029338_2 783383-783487 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029338_3 790588-790678 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029338_4 1395672-1395759 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029338_5 1455671-1455815 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029338_6 1611385-1611481 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029338_7 1757108-1757268 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029338_8 1971497-1971583 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029338_9 2022904-2023115 TypeII NA
3 spacers
Cas9_archaeal

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029338_10 2448224-2448437 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029338_11 2474379-2474464 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029338_12 2563647-2563823 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029338_13 2601254-2601352 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029338_14 2696315-2696402 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029338_15 2719306-2719407 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029338_17 2987902-2988003 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029338_18 3094875-3095073 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029338_20 3396735-3396837 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029338_21 3573069-3573562 Orphan NA
6 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029338_23 3663770-3663915 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029338_24 3927681-3927880 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029338_25 3928986-3929252 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029338_26 3996018-3996103 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029338_27 4120556-4120642 TypeV-U4 NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029338_28 4124745-4124852 TypeV-U4 NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029338_29 4197952-4198040 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029338_31 4719872-4719960 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029338_32 5069821-5069905 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029338_35 5240991-5241092 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029338_36 5639909-5640010 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029338_37 5808869-5809068 Orphan NA
3 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP029338_16 16.3|2851439|18|CP029338|CRT 2851439-2851456 18 CP029338.1 6495071-6495088 1 0.944
CP029338_25 25.2|3929064|41|CP029338|CRT 3929064-3929104 41 CP029338.1 3927641-3927681 1 0.976
CP029338_27 27.1|4120579|41|CP029338|CRISPRCasFinder 4120579-4120619 41 CP029338.1 3015345-3015385 1 0.976
CP029338_27 27.1|4120579|41|CP029338|CRISPRCasFinder 4120579-4120619 41 CP029338.1 3058007-3058047 1 0.976
CP029338_12 12.2|2563764|29|CP029338|PILER-CR 2563764-2563792 29 CP029338.1 1288475-1288503 2 0.931
CP029338_12 12.4|2563759|38|CP029338|CRISPRCasFinder 2563759-2563796 38 CP029338.1 1288466-1288503 2 0.947
CP029338_27 27.1|4120579|41|CP029338|CRISPRCasFinder 4120579-4120619 41 CP029338.1 3015579-3015619 2 0.951

1. spacer 16.3|2851439|18|CP029338|CRT matches to position: 6495071-6495088, mismatch: 1, identity: 0.944

tcggtcggcttcggggtg	CRISPR spacer
tcggtcggcttcgggttg	Protospacer
*************** **

2. spacer 25.2|3929064|41|CP029338|CRT matches to position: 3927641-3927681, mismatch: 1, identity: 0.976

gttctgggccggcaccgttgagccggtgctcagccgatctc	CRISPR spacer
gttctggaccggcaccgttgagccggtgctcagccgatctc	Protospacer
*******.*********************************

3. spacer 27.1|4120579|41|CP029338|CRISPRCasFinder matches to position: 3015345-3015385, mismatch: 1, identity: 0.976

gttggttgccgggctccgtctcgaccgtgccggtcaccgat	CRISPR spacer
gttggttgccgggctccgtcccgaccgtgccggtcaccgat	Protospacer
********************.********************

4. spacer 27.1|4120579|41|CP029338|CRISPRCasFinder matches to position: 3058007-3058047, mismatch: 1, identity: 0.976

gttggttgccgggctccgtctcgaccgtgccggtcaccgat	CRISPR spacer
gtgggttgccgggctccgtctcgaccgtgccggtcaccgat	Protospacer
** **************************************

5. spacer 12.2|2563764|29|CP029338|PILER-CR matches to position: 1288475-1288503, mismatch: 2, identity: 0.931

tcggtgaccggcacggtcagacgtgtccg	CRISPR spacer
tcggtgacccgcacggtcagaggtgtccg	Protospacer
********* *********** *******

6. spacer 12.4|2563759|38|CP029338|CRISPRCasFinder matches to position: 1288466-1288503, mismatch: 2, identity: 0.947

tcggtgaccggcacggtcagacgtgtccgcaccaaaac	CRISPR spacer
tcggtgacccgcacggtcagaggtgtccgcaccaaaac	Protospacer
********* *********** ****************

7. spacer 27.1|4120579|41|CP029338|CRISPRCasFinder matches to position: 3015579-3015619, mismatch: 2, identity: 0.951

gttggttgccgggctccgtctcgaccgtgccggtcaccgat	CRISPR spacer
gttgtttgcggggctccgtctcgaccgtgccggtcaccgat	Protospacer
**** **** *******************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP029338_34 34.2|5116972|21|CP029338|CRISPRCasFinder 5116972-5116992 21 NZ_CP027023 Streptomyces sp. WAC00288 plasmid p1, complete sequence 29911-29931 1 0.952
CP029338_1 1.2|750752|25|CP029338|CRISPRCasFinder 750752-750776 25 NZ_AP014706 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence 21640-21664 3 0.88
CP029338_10 10.3|2448377|30|CP029338|CRISPRCasFinder 2448377-2448406 30 NZ_CP023976 Streptomyces alboflavus strain MDJK44 plasmid pMDJK44.1, complete sequence 217864-217893 3 0.9
CP029338_16 16.2|2851394|24|CP029338|CRT 2851394-2851417 24 NZ_CP045361 Roseivivax sp. THAF40 plasmid pTHAF40_a, complete sequence 72479-72502 3 0.875
CP029338_16 16.2|2851394|24|CP029338|CRT 2851394-2851417 24 NZ_CP045319 Roseivivax sp. THAF197b plasmid pTHAF197b_a, complete sequence 190579-190602 3 0.875
CP029338_16 16.4|2851478|24|CP029338|CRT 2851478-2851501 24 NZ_CP050092 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence 182285-182308 3 0.875
CP029338_16 16.4|2851478|24|CP029338|CRT 2851478-2851501 24 NZ_CP053984 Achromobacter pestifer strain FDAARGOS_790 plasmid unnamed, complete sequence 28115-28138 3 0.875
CP029338_16 16.4|2851478|24|CP029338|CRT 2851478-2851501 24 NZ_LR594667 Variovorax sp. SRS16 plasmid 2 296839-296862 3 0.875
CP029338_16 16.4|2851478|24|CP029338|CRT 2851478-2851501 24 NC_010935 Comamonas testosteroni CNB-1 plasmid pCNB, complete sequence 34993-35016 3 0.875
CP029338_16 16.4|2851478|24|CP029338|CRT 2851478-2851501 24 NC_016968 Comamonas testosteroni plasmid pTB30, complete sequence 17514-17537 3 0.875
CP029338_16 16.4|2851478|24|CP029338|CRT 2851478-2851501 24 NC_016968 Comamonas testosteroni plasmid pTB30, complete sequence 36381-36404 3 0.875
CP029338_16 16.4|2851478|24|CP029338|CRT 2851478-2851501 24 NC_016978 Comamonas testosteroni plasmid pI2, complete sequence 17513-17536 3 0.875
CP029338_16 16.4|2851478|24|CP029338|CRT 2851478-2851501 24 NZ_LR594672 Variovorax sp. PBL-E5 plasmid 2 296837-296860 3 0.875
CP029338_16 16.4|2851478|24|CP029338|CRT 2851478-2851501 24 NC_019263 Delftia acidovorans plasmid pLME1, complete sequence 17515-17538 3 0.875
CP029338_16 16.4|2851478|24|CP029338|CRT 2851478-2851501 24 NC_019264 Delftia acidovorans plasmid pNB8c, complete sequence 17515-17538 3 0.875
CP029338_16 16.4|2851478|24|CP029338|CRT 2851478-2851501 24 NC_019283 Delftia acidovorans plasmid pC1-1, complete sequence 17515-17538 3 0.875
CP029338_16 16.4|2851478|24|CP029338|CRT 2851478-2851501 24 NZ_LR594660 Variovorax sp. PBL-H6 plasmid 2 538707-538730 3 0.875
CP029338_16 16.4|2851478|24|CP029338|CRT 2851478-2851501 24 NZ_CP025613 Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence 68387-68410 3 0.875
CP029338_16 16.4|2851478|24|CP029338|CRT 2851478-2851501 24 NZ_CP010408 Streptomyces vietnamensis strain GIMV4.0001 plasmid pSVL1, complete sequence 49167-49190 3 0.875
CP029338_1 1.2|750752|25|CP029338|CRISPRCasFinder 750752-750776 25 NZ_CP049158 Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence 1339647-1339671 4 0.84
CP029338_1 1.2|750752|25|CP029338|CRISPRCasFinder 750752-750776 25 NZ_CP049318 Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence 1344315-1344339 4 0.84
CP029338_1 1.2|750752|25|CP029338|CRISPRCasFinder 750752-750776 25 NZ_AP022333 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence 260113-260137 4 0.84
CP029338_1 1.2|750752|25|CP029338|CRISPRCasFinder 750752-750776 25 NZ_CP022565 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence 761511-761535 4 0.84
CP029338_1 1.2|750752|25|CP029338|CRISPRCasFinder 750752-750776 25 NZ_CP036516 Lichenihabitans psoromatis strain PAMC 29148 plasmid p_unnamed1, complete sequence 74034-74058 4 0.84
CP029338_33 33.5|5116600|33|CP029338|CRISPRCasFinder 5116600-5116632 33 NZ_JX627580 Methylobacterium oryzae CBMB20 plasmid pMOC1, complete sequence 63924-63956 4 0.879
CP029338_10 10.2|2448316|30|CP029338|CRISPRCasFinder 2448316-2448345 30 NZ_CP007257 Rhodococcus erythropolis R138 plasmid pLRE138, complete sequence 237945-237974 5 0.833
CP029338_10 10.2|2448316|30|CP029338|CRISPRCasFinder 2448316-2448345 30 NZ_CP045736 Aeromicrobium sp. MF47 plasmid p001, complete sequence 28688-28717 5 0.833
CP029338_10 10.2|2448316|30|CP029338|CRISPRCasFinder 2448316-2448345 30 NC_014549 Glutamicibacter arilaitensis Re117 plasmid pRE117-1, complete sequence 34721-34750 5 0.833
CP029338_10 10.2|2448316|30|CP029338|CRISPRCasFinder 2448316-2448345 30 NC_008537 Arthrobacter sp. FB24 plasmid 1, complete sequence 125352-125381 5 0.833
CP029338_10 10.2|2448316|30|CP029338|CRISPRCasFinder 2448316-2448345 30 NC_009235 Burkholderia phage phi644-2 chromosome, complete genome 31493-31522 5 0.833
CP029338_10 10.2|2448316|30|CP029338|CRISPRCasFinder 2448316-2448345 30 CP000625 Burkholderia phage phi644-2, complete genome 31493-31522 5 0.833
CP029338_10 10.2|2448316|30|CP029338|CRISPRCasFinder 2448316-2448345 30 AF447491 Bacteriophage phiE125, complete genome 37188-37217 5 0.833
CP029338_10 10.2|2448316|30|CP029338|CRISPRCasFinder 2448316-2448345 30 NC_003309 Burkholderia phage phiE125, complete genome 37188-37217 5 0.833
CP029338_12 12.2|2563764|29|CP029338|PILER-CR 2563764-2563792 29 NZ_CP016293 Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence 231439-231467 5 0.828
CP029338_23 23.2|3663855|37|CP029338|CRISPRCasFinder 3663855-3663891 37 ASHF01000034 Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence 173873-173909 5 0.865
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 NZ_CP029828 Burkholderia sp. JP2-270 plasmid p2, complete sequence 416208-416233 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 MK494116 Mycobacterium phage Dulcie, complete genome 40514-40539 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 MN234212 Mycobacterium phage Paphu, complete genome 40515-40540 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 MH001458 Mycobacterium phage Smeagol, complete genome 41955-41980 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 MH000607 Mycobacterium phage RiverMonster, complete genome 59037-59062 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 MN585973 Mycobacterium phage StAnnes, complete genome 44801-44826 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 MK757445 Mycobacterium phage Lilizi, complete genome 58648-58673 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 MH576953 Mycobacterium phage Hopey, complete genome 59420-59445 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 MF919506 Mycobacterium phage FireRed, complete genome 59296-59321 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 MH230878 Mycobacterium phage Oogway, complete genome 40869-40894 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 MH020235 Mycobacterium phage Batiatus, complete genome 45713-45738 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 MK359320 Mycobacterium phage Cookies, complete genome 58316-58341 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 AY129331 Mycobacterium virus Cjw1, complete genome 60070-60095 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 MG962370 Mycobacterium phage Kykar, complete genome 40369-40394 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 MN586043 Mycobacterium phage Buck, complete genome 59746-59771 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 MK061415 Mycobacterium phage Rhynn, complete genome 39680-39705 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 MH576975 Mycobacterium phage Target, complete genome 39223-39248 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 MN586000 Mycobacterium phage Sagefire, complete genome 41800-41825 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 KY549152 Mycobacterium phage Maxxinista, complete genome 58749-58774 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 NC_029059 Mycobacterium phage Edtherson, complete genome 40625-40650 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 MK359331 Mycobacterium phage Rajelicia, complete genome 41770-41795 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 MH744414 Mycobacterium phage Arcanine, complete genome 41236-41261 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 NC_004688 Mycobacterium phage Omega, complete genome 80421-80446 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 MF919524 Mycobacterium phage MISSy, complete genome 58764-58789 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 EU816588 Mycobacterium phage Porky, complete genome 57849-57874 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 MT952854 Mycobacterium phage Miniwave, complete genome 58259-58284 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 MK524506 Mycobacterium phage Zeuska, complete genome 41082-41107 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 KP027203 Mycobacterium phage Treddle, complete genome 41504-41529 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 NC_021297 Mycobacterium phage PattyP, complete genome 41173-41198 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 KC748969 Mycobacterium phage Phaux, complete genome 59865-59890 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 MH669002 Mycobacterium phage Emmina, complete genome 57841-57866 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 AY129338 Mycobacterium virus Omega, complete genome 80421-80446 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 KC661277 Mycobacterium phage Phrux, complete genome 58141-58166 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 MK524499 Mycobacterium phage Tripl3t, complete genome 42433-42458 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 JF937096 Mycobacterium phage Henry, complete genome 58463-58488 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 KX522649 Mycobacterium phage Bircsak, complete genome 41782-41807 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 MH020247 Mycobacterium phage MPhalcon, complete genome 58757-58782 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 JN391441 Mycobacterium phage Elph10, complete genome 58100-58125 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 NC_041844 Mycobacterium phage Optimus, complete genome 77513-77538 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 KM597531 Mycobacterium phage Abrogate, complete genome 41648-41673 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 MN617845 Mycobacterium phage BaconJack, complete genome 42986-43011 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 NC_022969 Mycobacterium phage PhatBacter, complete genome 59296-59321 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 MN586019 Mycobacterium phage Stark, complete genome 58920-58945 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 KX522943 Mycobacterium phage Gompeii16, complete genome 41783-41808 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 NC_041850 Mycobacterium phage Eureka, complete genome 59128-59153 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 NC_028906 Mycobacterium phage Toto, complete genome 59158-59183 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 KY319168 Mycobacterium phage CrystalP, complete genome 59158-59183 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 KU998244 Gordonia phage Smoothie, complete genome 26680-26705 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 MG812486 Mycobacterium phage Acme, complete genome 40212-40237 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 NC_031067 Mycobacterium phage Makemake, complete genome 41183-41208 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 MH727557 Mycobacterium phage Paperbeatsrock, complete genome 58937-58962 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 KF279417 Mycobacterium phage Quink, complete genome 59516-59541 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 MH576971 Mycobacterium phage Arlo, complete genome 39619-39644 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 JN382248 Mycobacterium phage Lilac, complete genome 58582-58607 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 MF919520 Gordonia phage Lozinak, complete genome 26680-26705 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 KJ409696 Mycobacterium phage Lamina13, complete genome 41157-41182 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 MN586017 Mycobacterium phage OrionPax, complete genome 58354-58379 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 NC_023695 Mycobacterium phage Violet, complete genome 41862-41887 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 KT020852 Mycobacterium phage NoSleep, complete genome 58282-58307 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 NC_022976 Mycobacterium phage Nala, complete genome 59266-59291 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 MK967379 Mycobacterium phage HokkenD, complete genome 79995-80020 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 NC_028784 Mycobacterium phage Tasp14, complete genome 41781-41806 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 JF937093 Mycobacterium virus DLane, complete genome 45267-45292 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 KT259047 Mycobacterium phage Rufus, complete genome 40406-40431 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 MN586034 Mycobacterium phage Hoonter, complete genome 58914-58939 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 NC_022085 Mycobacterium phage Goku, complete genome 58857-58882 5 0.808
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 NC_004681 Mycobacterium phage Cjw1, complete genome 60070-60095 5 0.808
CP029338_10 10.1|2448255|30|CP029338|CRISPRCasFinder 2448255-2448284 30 NZ_CP024896 Amycolatopsis sp. AA4 plasmid unnamed2, complete sequence 42498-42527 6 0.8
CP029338_10 10.2|2448316|30|CP029338|CRISPRCasFinder 2448316-2448345 30 NZ_CP046475 Janibacter melonis strain M714 plasmid unnamed, complete sequence 13740-13769 6 0.8
CP029338_10 10.2|2448316|30|CP029338|CRISPRCasFinder 2448316-2448345 30 NZ_CP029051 Miniimonas sp. S16 plasmid pS16-2, complete sequence 26810-26839 6 0.8
CP029338_10 10.2|2448316|30|CP029338|CRISPRCasFinder 2448316-2448345 30 NC_021229 Arthrobacter nicotinovorans pAO1 megaplasmid sequence, strain ATCC 49919 126720-126749 6 0.8
CP029338_10 10.2|2448316|30|CP029338|CRISPRCasFinder 2448316-2448345 30 NZ_CP016284 Cryobacterium arcticum strain PAMC 27867 plasmid pP27867_2, complete sequence 12620-12649 6 0.8
CP029338_10 10.2|2448316|30|CP029338|CRISPRCasFinder 2448316-2448345 30 NZ_CP021994 Cryobacterium sp. LW097 plasmid unnamed1 51749-51778 6 0.8
CP029338_10 10.2|2448316|30|CP029338|CRISPRCasFinder 2448316-2448345 30 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 765005-765034 6 0.8
CP029338_12 12.2|2563764|29|CP029338|PILER-CR 2563764-2563792 29 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 415703-415731 6 0.793
CP029338_12 12.2|2563764|29|CP029338|PILER-CR 2563764-2563792 29 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 719054-719082 6 0.793
CP029338_33 33.3|5116459|33|CP029338|CRISPRCasFinder 5116459-5116491 33 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 1041654-1041686 6 0.818
CP029338_33 33.3|5116459|33|CP029338|CRISPRCasFinder 5116459-5116491 33 NZ_CP019938 Ketogulonicigenium robustum strain SPU_B003 plasmid unnamed1, complete sequence 162734-162766 6 0.818
CP029338_33 33.6|5116666|33|CP029338|CRISPRCasFinder 5116666-5116698 33 NZ_CP018784 Curtobacterium pusillum strain AA3 plasmid pCPAA3, complete sequence 272561-272593 6 0.818
CP029338_37 37.3|5809017|26|CP029338|CRISPRCasFinder 5809017-5809042 26 NC_013859 Azospirillum sp. B510 plasmid pAB510e, complete sequence 235516-235541 6 0.769
CP029338_9 9.2|2022994|32|CP029338|CRISPRCasFinder 2022994-2023025 32 NZ_CP015007 Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence 6298-6329 7 0.781
CP029338_9 9.2|2022994|32|CP029338|CRISPRCasFinder 2022994-2023025 32 NZ_CP020447 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed7, complete sequence 58914-58945 7 0.781
CP029338_9 9.2|2022994|32|CP029338|CRISPRCasFinder 2022994-2023025 32 NZ_CP026528 Sinorhizobium meliloti strain AK21 plasmid pSmeAK21a, complete sequence 7487-7518 7 0.781
CP029338_9 9.2|2022994|32|CP029338|CRISPRCasFinder 2022994-2023025 32 NZ_CP044078 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence 95226-95257 7 0.781
CP029338_9 9.2|2022994|32|CP029338|CRISPRCasFinder 2022994-2023025 32 NZ_CP031081 Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence 92780-92811 7 0.781
CP029338_9 9.2|2022994|32|CP029338|CRISPRCasFinder 2022994-2023025 32 NC_011273 Mycobacterium phage Myrna, complete genome 144177-144208 7 0.781
CP029338_10 10.1|2448255|30|CP029338|CRISPRCasFinder 2448255-2448284 30 MN062717 Microbacterium phage Sharkboy, complete genome 34814-34843 7 0.767
CP029338_10 10.1|2448255|30|CP029338|CRISPRCasFinder 2448255-2448284 30 NC_042099 Microbacterium phage Dismas, complete genome 34724-34753 7 0.767
CP029338_10 10.1|2448255|30|CP029338|CRISPRCasFinder 2448255-2448284 30 NZ_CP007797 Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence 116984-117013 7 0.767
CP029338_10 10.1|2448255|30|CP029338|CRISPRCasFinder 2448255-2448284 30 NC_004808 Streptomyces rochei plasmid pSLA2-L DNA, complete sequence 199341-199370 7 0.767
CP029338_10 10.2|2448316|30|CP029338|CRISPRCasFinder 2448316-2448345 30 NZ_CP033038 Agrobacterium fabrum strain 12D13 plasmid pAt12D13c, complete sequence 32846-32875 7 0.767
CP029338_10 10.2|2448316|30|CP029338|CRISPRCasFinder 2448316-2448345 30 NZ_CP015237 Rhodococcus fascians D188 plasmid unnamed2, complete sequence 140989-141018 7 0.767
CP029338_10 10.2|2448316|30|CP029338|CRISPRCasFinder 2448316-2448345 30 CP054924 Verrucosispora sp. NA02020 plasmid unnamed, complete sequence 24057-24086 7 0.767
CP029338_10 10.2|2448316|30|CP029338|CRISPRCasFinder 2448316-2448345 30 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 1042181-1042210 7 0.767
CP029338_10 10.2|2448316|30|CP029338|CRISPRCasFinder 2448316-2448345 30 NC_015409 Verrucosispora maris AB-18-032 plasmid pVMKU, complete sequence 52140-52169 7 0.767
CP029338_10 10.2|2448316|30|CP029338|CRISPRCasFinder 2448316-2448345 30 NC_034248 Rhizobium phage RHEph10, complete genome 50842-50871 7 0.767
CP029338_10 10.3|2448377|30|CP029338|CRISPRCasFinder 2448377-2448406 30 NZ_AP018921 Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence 74756-74785 7 0.767
CP029338_24 24.1|3927704|29|CP029338|CRISPRCasFinder 3927704-3927732 29 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 1327396-1327424 7 0.759
CP029338_24 24.1|3927704|29|CP029338|CRISPRCasFinder 3927704-3927732 29 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 151947-151975 7 0.759
CP029338_24 24.1|3927704|29|CP029338|CRISPRCasFinder 3927704-3927732 29 NZ_CP042809 Acetobacter oryzoeni strain B6 plasmid unnamed1, complete sequence 158065-158093 7 0.759
CP029338_24 24.1|3927704|29|CP029338|CRISPRCasFinder 3927704-3927732 29 MH045568 Microbacterium phage Kieran, complete genome 12875-12903 7 0.759
CP029338_24 24.1|3927704|29|CP029338|CRISPRCasFinder 3927704-3927732 29 MN062717 Microbacterium phage Sharkboy, complete genome 12871-12899 7 0.759
CP029338_24 24.1|3927704|29|CP029338|CRISPRCasFinder 3927704-3927732 29 MT310853 Microbacterium phage AvGardian, complete genome 12858-12886 7 0.759
CP029338_24 24.1|3927704|29|CP029338|CRISPRCasFinder 3927704-3927732 29 NC_042099 Microbacterium phage Dismas, complete genome 12872-12900 7 0.759
CP029338_30 30.1|4522686|54|CP029338|CRISPRCasFinder 4522686-4522739 54 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 233324-233377 7 0.87
CP029338_33 33.3|5116459|33|CP029338|CRISPRCasFinder 5116459-5116491 33 CP054924 Verrucosispora sp. NA02020 plasmid unnamed, complete sequence 67068-67100 7 0.788
CP029338_33 33.5|5116600|33|CP029338|CRISPRCasFinder 5116600-5116632 33 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 568224-568256 7 0.788
CP029338_33 33.5|5116600|33|CP029338|CRISPRCasFinder 5116600-5116632 33 NZ_CP040761 Paracoccus sp. 2251 plasmid unnamed5, complete sequence 60415-60447 7 0.788
CP029338_33 33.5|5116600|33|CP029338|CRISPRCasFinder 5116600-5116632 33 NZ_LR134463 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 21, complete sequence 68312-68344 7 0.788
CP029338_37 37.2|5808959|32|CP029338|CRISPRCasFinder 5808959-5808990 32 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 593981-594012 7 0.781
CP029338_37 37.2|5808959|32|CP029338|CRISPRCasFinder 5808959-5808990 32 NZ_CP029832 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence 12759-12790 7 0.781
CP029338_9 9.2|2022994|32|CP029338|CRISPRCasFinder 2022994-2023025 32 NZ_CP041652 Streptomyces sp. RLB1-9 plasmid pRLB1-9.2, complete sequence 70669-70700 8 0.75
CP029338_9 9.2|2022994|32|CP029338|CRISPRCasFinder 2022994-2023025 32 NZ_CP015006 Aminobacter aminovorans strain KCTC 2477 plasmid pAA01, complete sequence 5067-5098 8 0.75
CP029338_9 9.2|2022994|32|CP029338|CRISPRCasFinder 2022994-2023025 32 NZ_CP054613 Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence 1283111-1283142 8 0.75
CP029338_9 9.2|2022994|32|CP029338|CRISPRCasFinder 2022994-2023025 32 NZ_CP042915 Rhodococcus qingshengii strain RL1 plasmid unnamed2 62090-62121 8 0.75
CP029338_10 10.1|2448255|30|CP029338|CRISPRCasFinder 2448255-2448284 30 NZ_CP015446 Streptomyces sp. S8 plasmid unnamed, complete sequence 69345-69374 8 0.733
CP029338_10 10.2|2448316|30|CP029338|CRISPRCasFinder 2448316-2448345 30 NZ_CP013299 Arthrobacter sp. YC-RL1 plasmid unnamed 2, complete sequence 43900-43929 8 0.733
CP029338_10 10.2|2448316|30|CP029338|CRISPRCasFinder 2448316-2448345 30 NZ_CP016082 Streptomyces sp. SAT1 plasmid unnamed2, complete sequence 193921-193950 8 0.733
CP029338_10 10.2|2448316|30|CP029338|CRISPRCasFinder 2448316-2448345 30 NZ_CP017301 Rhodococcus sp. YL-1 plasmid pYLC2, complete sequence 10338-10367 8 0.733
CP029338_10 10.2|2448316|30|CP029338|CRISPRCasFinder 2448316-2448345 30 NZ_CP050127 Rhodococcus erythropolis strain KB1 plasmid plas4, complete sequence 12455-12484 8 0.733
CP029338_10 10.2|2448316|30|CP029338|CRISPRCasFinder 2448316-2448345 30 NZ_CP020556 Streptomyces sp. Sge12 plasmid pSGE, complete sequence 103587-103616 8 0.733
CP029338_10 10.2|2448316|30|CP029338|CRISPRCasFinder 2448316-2448345 30 NZ_CP011869 Pseudonocardia sp. HH130629-09 plasmid pLS1-1, complete sequence 241575-241604 8 0.733
CP029338_10 10.2|2448316|30|CP029338|CRISPRCasFinder 2448316-2448345 30 NC_005284 Burkholderia phage phi1026b, complete genome 37058-37087 8 0.733
CP029338_10 10.2|2448316|30|CP029338|CRISPRCasFinder 2448316-2448345 30 AY453853 Bacteriophage phi1026b, complete genome 37058-37087 8 0.733
CP029338_24 24.1|3927704|29|CP029338|CRISPRCasFinder 3927704-3927732 29 NC_010335 Caulobacter sp. K31 plasmid pCAUL01, complete sequence 136750-136778 8 0.724
CP029338_25 25.1|3929008|34|CP029338|CRT 3929008-3929041 34 MN062714 Microbacterium Phage DirtyBubble, complete genome 13153-13186 8 0.765
CP029338_25 25.1|3929008|34|CP029338|CRT 3929008-3929041 34 MT024860 Microbacterium phage Stromboli, complete genome 13193-13226 8 0.765
CP029338_33 33.5|5116600|33|CP029338|CRISPRCasFinder 5116600-5116632 33 NZ_CP016593 Ketogulonicigenium vulgare strain SKV plasmid pKvSKV1, complete sequence 266669-266701 8 0.758
CP029338_33 33.5|5116600|33|CP029338|CRISPRCasFinder 5116600-5116632 33 NC_017386 Ketogulonicigenium vulgare WSH-001 plasmid 1, complete sequence 201899-201931 8 0.758
CP029338_33 33.5|5116600|33|CP029338|CRISPRCasFinder 5116600-5116632 33 NC_014621 Ketogulonicigenium vulgare Y25 plasmid pYP1, complete sequence 168947-168979 8 0.758
CP029338_33 33.5|5116600|33|CP029338|CRISPRCasFinder 5116600-5116632 33 NZ_CP012909 Ketogulonicigenium vulgare strain Hbe602 plasmid 1, complete sequence 266708-266740 8 0.758
CP029338_33 33.5|5116600|33|CP029338|CRISPRCasFinder 5116600-5116632 33 NZ_CP016620 Microvirga ossetica strain V5/3m plasmid unnamed4, complete sequence 92779-92811 8 0.758
CP029338_37 37.2|5808959|32|CP029338|CRISPRCasFinder 5808959-5808990 32 NZ_CP054841 Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence 50278-50309 8 0.75
CP029338_37 37.2|5808959|32|CP029338|CRISPRCasFinder 5808959-5808990 32 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 605703-605734 8 0.75
CP029338_37 37.2|5808959|32|CP029338|CRISPRCasFinder 5808959-5808990 32 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 266321-266352 8 0.75
CP029338_9 9.2|2022994|32|CP029338|CRISPRCasFinder 2022994-2023025 32 NZ_CP014649 Klebsiella pneumoniae strain KPNIH36 plasmid pKPN-fff, complete sequence 52863-52894 9 0.719
CP029338_9 9.2|2022994|32|CP029338|CRISPRCasFinder 2022994-2023025 32 NC_021654 Klebsiella pneumoniae plasmid pKN-LS6, complete sequence 188508-188539 9 0.719
CP029338_9 9.2|2022994|32|CP029338|CRISPRCasFinder 2022994-2023025 32 NZ_CP007729 Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKPN-498, complete sequence 153082-153113 9 0.719
CP029338_9 9.2|2022994|32|CP029338|CRISPRCasFinder 2022994-2023025 32 NZ_CP037929 Klebsiella pneumoniae subsp. pneumoniae strain KP-8788 plasmid pKPN-IT-8788, complete sequence 256811-256842 9 0.719
CP029338_9 9.2|2022994|32|CP029338|CRISPRCasFinder 2022994-2023025 32 MN922301 Klebsiella pneumoniae strain KP-14159 plasmid pKPN-IT-14159, complete sequence 256811-256842 9 0.719
CP029338_9 9.2|2022994|32|CP029338|CRISPRCasFinder 2022994-2023025 32 MK422448 Klebsiella phage ST512-KPC3phi13.3, complete genome 28855-28886 9 0.719
CP029338_9 9.2|2022994|32|CP029338|CRISPRCasFinder 2022994-2023025 32 NZ_CP013072 Sphingobium indicum B90A plasmid pSRL2, complete sequence 83478-83509 9 0.719
CP029338_9 9.2|2022994|32|CP029338|CRISPRCasFinder 2022994-2023025 32 NZ_KF418775 Burkholderia pseudomallei strain MSHR1950 plasmid pBPSE01, complete sequence 68871-68902 9 0.719
CP029338_9 9.2|2022994|32|CP029338|CRISPRCasFinder 2022994-2023025 32 NZ_CP005190 Sphingobium sp. MI1205 plasmid pMI1, complete sequence 80305-80336 9 0.719
CP029338_9 9.2|2022994|32|CP029338|CRISPRCasFinder 2022994-2023025 32 CP006880 Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence 2462685-2462716 9 0.719
CP029338_9 9.2|2022994|32|CP029338|CRISPRCasFinder 2022994-2023025 32 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1332023-1332054 9 0.719
CP029338_9 9.3|2023055|32|CP029338|CRISPRCasFinder 2023055-2023086 32 NC_013859 Azospirillum sp. B510 plasmid pAB510e, complete sequence 162913-162944 9 0.719
CP029338_9 9.3|2023055|32|CP029338|CRISPRCasFinder 2023055-2023086 32 NZ_CP054620 Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence 322235-322266 9 0.719
CP029338_10 10.2|2448316|30|CP029338|CRISPRCasFinder 2448316-2448345 30 NC_023283 Streptomyces sp. FR1 plasmid pFRL3, complete sequence 125653-125682 9 0.7
CP029338_10 10.2|2448316|30|CP029338|CRISPRCasFinder 2448316-2448345 30 NC_023284 Streptomyces sp. F2 plasmid pFRL4, complete sequence 162281-162310 9 0.7
CP029338_10 10.2|2448316|30|CP029338|CRISPRCasFinder 2448316-2448345 30 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 1968988-1969017 9 0.7
CP029338_23 23.2|3663855|37|CP029338|CRISPRCasFinder 3663855-3663891 37 ASHF01000034 Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence 174719-174755 9 0.757
CP029338_25 25.1|3929008|34|CP029338|CRT 3929008-3929041 34 MT310853 Microbacterium phage AvGardian, complete genome 12854-12887 9 0.735
CP029338_33 33.5|5116600|33|CP029338|CRISPRCasFinder 5116600-5116632 33 NC_017588 Thermus thermophilus JL-18 plasmid pTTJL1801, complete sequence 123488-123520 9 0.727
CP029338_33 33.5|5116600|33|CP029338|CRISPRCasFinder 5116600-5116632 33 NZ_LR027520 Thermus thermophilus isolate TTHNAR1 plasmid 4, complete sequence 276375-276407 9 0.727
CP029338_33 33.6|5116666|33|CP029338|CRISPRCasFinder 5116666-5116698 33 NZ_LR134455 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 13, complete sequence 20735-20767 9 0.727
CP029338_37 37.2|5808959|32|CP029338|CRISPRCasFinder 5808959-5808990 32 NZ_CP018096 Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence 377811-377842 9 0.719
CP029338_37 37.2|5808959|32|CP029338|CRISPRCasFinder 5808959-5808990 32 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 51179-51210 9 0.719
CP029338_37 37.2|5808959|32|CP029338|CRISPRCasFinder 5808959-5808990 32 NZ_CP006369 Aureimonas sp. AU20 plasmid pAU20b, complete sequence 104933-104964 9 0.719
CP029338_37 37.2|5808959|32|CP029338|CRISPRCasFinder 5808959-5808990 32 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 1101481-1101512 9 0.719
CP029338_37 37.2|5808959|32|CP029338|CRISPRCasFinder 5808959-5808990 32 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 50835-50866 9 0.719
CP029338_9 9.2|2022994|32|CP029338|CRISPRCasFinder 2022994-2023025 32 NZ_CP017426 Arthrobacter sp. ZXY-2 plasmid pZXY25, complete sequence 26222-26253 10 0.688
CP029338_25 25.1|3929008|34|CP029338|CRT 3929008-3929041 34 MH045568 Microbacterium phage Kieran, complete genome 12871-12904 10 0.706
CP029338_25 25.1|3929008|34|CP029338|CRT 3929008-3929041 34 MN062717 Microbacterium phage Sharkboy, complete genome 12867-12900 10 0.706
CP029338_25 25.1|3929008|34|CP029338|CRT 3929008-3929041 34 NC_042099 Microbacterium phage Dismas, complete genome 12868-12901 10 0.706
CP029338_33 33.5|5116600|33|CP029338|CRISPRCasFinder 5116600-5116632 33 NC_006462 Thermus thermophilus HB8 plasmid pTT27, complete sequence 10659-10691 10 0.697
CP029338_33 33.5|5116600|33|CP029338|CRISPRCasFinder 5116600-5116632 33 NZ_AP019802 Thermus thermophilus strain HC11 plasmid pHC11, complete sequence 17522-17554 10 0.697
CP029338_33 33.5|5116600|33|CP029338|CRISPRCasFinder 5116600-5116632 33 MN234201 Mycobacterium phage Guanica15, complete genome 44459-44491 10 0.697
CP029338_37 37.2|5808959|32|CP029338|CRISPRCasFinder 5808959-5808990 32 NZ_CP032697 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525a, complete sequence 41524-41555 10 0.688
CP029338_37 37.2|5808959|32|CP029338|CRISPRCasFinder 5808959-5808990 32 NZ_CP032697 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525a, complete sequence 44791-44822 10 0.688
CP029338_37 37.2|5808959|32|CP029338|CRISPRCasFinder 5808959-5808990 32 NZ_CP032697 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525a, complete sequence 48000-48031 10 0.688
CP029338_37 37.2|5808959|32|CP029338|CRISPRCasFinder 5808959-5808990 32 NZ_CP024313 Rhizobium sp. NXC24 plasmid pRspNXC24b, complete sequence 357415-357446 10 0.688
CP029338_37 37.2|5808959|32|CP029338|CRISPRCasFinder 5808959-5808990 32 NZ_CP024313 Rhizobium sp. NXC24 plasmid pRspNXC24b, complete sequence 360688-360719 10 0.688
CP029338_33 33.4|5116525|42|CP029338|CRISPRCasFinder 5116525-5116566 42 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 249601-249642 11 0.738
CP029338_33 33.5|5116600|33|CP029338|CRISPRCasFinder 5116600-5116632 33 NZ_CP054616 Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence 327811-327843 11 0.667
CP029338_37 37.2|5808959|32|CP029338|CRISPRCasFinder 5808959-5808990 32 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 151944-151975 11 0.656

1. spacer 34.2|5116972|21|CP029338|CRISPRCasFinder matches to NZ_CP027023 (Streptomyces sp. WAC00288 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952

ggcccgctcccgctccgcgtg	CRISPR spacer
ggcccgctcccgctccgcctg	Protospacer
****************** **

2. spacer 1.2|750752|25|CP029338|CRISPRCasFinder matches to NZ_AP014706 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence) position: , mismatch: 3, identity: 0.88

acggcccgtccggcatgaggacgat	CRISPR spacer
ccggcccgttcgtcatgaggacgat	Protospacer
 ********.** ************

3. spacer 10.3|2448377|30|CP029338|CRISPRCasFinder matches to NZ_CP023976 (Streptomyces alboflavus strain MDJK44 plasmid pMDJK44.1, complete sequence) position: , mismatch: 3, identity: 0.9

gaggccactccggtcgtcacgaacatcatc	CRISPR spacer
gaggccaccccggtcgtcaccaacatcatt	Protospacer
********.*********** ********.

4. spacer 16.2|2851394|24|CP029338|CRT matches to NZ_CP045361 (Roseivivax sp. THAF40 plasmid pTHAF40_a, complete sequence) position: , mismatch: 3, identity: 0.875

tccgtggggcccggatcggtgggg	CRISPR spacer
tccgtgaggcccggatcggtgtcg	Protospacer
******.**************  *

5. spacer 16.2|2851394|24|CP029338|CRT matches to NZ_CP045319 (Roseivivax sp. THAF197b plasmid pTHAF197b_a, complete sequence) position: , mismatch: 3, identity: 0.875

tccgtggggcccggatcggtgggg	CRISPR spacer
tccgtgaggcccggatcggtgtcg	Protospacer
******.**************  *

6. spacer 16.4|2851478|24|CP029338|CRT matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 3, identity: 0.875

ccgccggggcccggctgggtggtg	CRISPR spacer
ccgccgaggcccggctgggtggcc	Protospacer
******.***************. 

7. spacer 16.4|2851478|24|CP029338|CRT matches to NZ_CP053984 (Achromobacter pestifer strain FDAARGOS_790 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

ccgccggggcccggctgggtggtg	CRISPR spacer
ccaccgaggcccggctgggtggtt	Protospacer
**.***.**************** 

8. spacer 16.4|2851478|24|CP029338|CRT matches to NZ_LR594667 (Variovorax sp. SRS16 plasmid 2) position: , mismatch: 3, identity: 0.875

ccgccggggcccggctgggtggtg	CRISPR spacer
ccaccgaggcccggctgggtggtt	Protospacer
**.***.**************** 

9. spacer 16.4|2851478|24|CP029338|CRT matches to NC_010935 (Comamonas testosteroni CNB-1 plasmid pCNB, complete sequence) position: , mismatch: 3, identity: 0.875

ccgccggggcccggctgggtggtg	CRISPR spacer
ccaccgaggcccggctgggtggtt	Protospacer
**.***.**************** 

10. spacer 16.4|2851478|24|CP029338|CRT matches to NC_016968 (Comamonas testosteroni plasmid pTB30, complete sequence) position: , mismatch: 3, identity: 0.875

ccgccggggcccggctgggtggtg	CRISPR spacer
ccaccgaggcccggctgggtggtt	Protospacer
**.***.**************** 

11. spacer 16.4|2851478|24|CP029338|CRT matches to NC_016968 (Comamonas testosteroni plasmid pTB30, complete sequence) position: , mismatch: 3, identity: 0.875

ccgccggggcccggctgggtggtg	CRISPR spacer
ccaccgaggcccggctgggtggtt	Protospacer
**.***.**************** 

12. spacer 16.4|2851478|24|CP029338|CRT matches to NC_016978 (Comamonas testosteroni plasmid pI2, complete sequence) position: , mismatch: 3, identity: 0.875

ccgccggggcccggctgggtggtg	CRISPR spacer
ccaccgaggcccggctgggtggtt	Protospacer
**.***.**************** 

13. spacer 16.4|2851478|24|CP029338|CRT matches to NZ_LR594672 (Variovorax sp. PBL-E5 plasmid 2) position: , mismatch: 3, identity: 0.875

ccgccggggcccggctgggtggtg	CRISPR spacer
ccaccgaggcccggctgggtggtt	Protospacer
**.***.**************** 

14. spacer 16.4|2851478|24|CP029338|CRT matches to NC_019263 (Delftia acidovorans plasmid pLME1, complete sequence) position: , mismatch: 3, identity: 0.875

ccgccggggcccggctgggtggtg	CRISPR spacer
ccaccgaggcccggctgggtggtt	Protospacer
**.***.**************** 

15. spacer 16.4|2851478|24|CP029338|CRT matches to NC_019264 (Delftia acidovorans plasmid pNB8c, complete sequence) position: , mismatch: 3, identity: 0.875

ccgccggggcccggctgggtggtg	CRISPR spacer
ccaccgaggcccggctgggtggtt	Protospacer
**.***.**************** 

16. spacer 16.4|2851478|24|CP029338|CRT matches to NC_019283 (Delftia acidovorans plasmid pC1-1, complete sequence) position: , mismatch: 3, identity: 0.875

ccgccggggcccggctgggtggtg	CRISPR spacer
ccaccgaggcccggctgggtggtt	Protospacer
**.***.**************** 

17. spacer 16.4|2851478|24|CP029338|CRT matches to NZ_LR594660 (Variovorax sp. PBL-H6 plasmid 2) position: , mismatch: 3, identity: 0.875

ccgccggggcccggctgggtggtg	CRISPR spacer
ccaccgaggcccggctgggtggtt	Protospacer
**.***.**************** 

18. spacer 16.4|2851478|24|CP029338|CRT matches to NZ_CP025613 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ccgccggggcccggctgggtggtg	CRISPR spacer
acgccgtggcccggctggggggtg	Protospacer
 ***** ************ ****

19. spacer 16.4|2851478|24|CP029338|CRT matches to NZ_CP010408 (Streptomyces vietnamensis strain GIMV4.0001 plasmid pSVL1, complete sequence) position: , mismatch: 3, identity: 0.875

ccgccggggcccggctgggtggtg	CRISPR spacer
acgccggggcccgggtaggtggtg	Protospacer
 ************* *.*******

20. spacer 1.2|750752|25|CP029338|CRISPRCasFinder matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 4, identity: 0.84

acggcccgtccggcatgaggacgat	CRISPR spacer
ccggtccgtccggcatggggacgaa	Protospacer
 ***.************.****** 

21. spacer 1.2|750752|25|CP029338|CRISPRCasFinder matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 4, identity: 0.84

acggcccgtccggcatgaggacgat	CRISPR spacer
ccggtccgtccggcatggggacgaa	Protospacer
 ***.************.****** 

22. spacer 1.2|750752|25|CP029338|CRISPRCasFinder matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 4, identity: 0.84

acggcccgtccggcatgaggacgat	CRISPR spacer
agagcccgtccggcttgaggacgac	Protospacer
* .*********** *********.

23. spacer 1.2|750752|25|CP029338|CRISPRCasFinder matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 4, identity: 0.84

acggcccgtccggcatgaggacgat	CRISPR spacer
ccggcgcgcccggcatgaggacgac	Protospacer
 **** **.***************.

24. spacer 1.2|750752|25|CP029338|CRISPRCasFinder matches to NZ_CP036516 (Lichenihabitans psoromatis strain PAMC 29148 plasmid p_unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

acggcccgtccggcatgaggacgat	CRISPR spacer
tcgtcccggccggcatgaggacgac	Protospacer
 ** **** ***************.

25. spacer 33.5|5116600|33|CP029338|CRISPRCasFinder matches to NZ_JX627580 (Methylobacterium oryzae CBMB20 plasmid pMOC1, complete sequence) position: , mismatch: 4, identity: 0.879

cgcctcggtcaccgtccgctcggcctcggcccg--	CRISPR spacer
cgcctcggtctccgtccgctcggc--cggcgcgac	Protospacer
********** *************  **** **  

26. spacer 10.2|2448316|30|CP029338|CRISPRCasFinder matches to NZ_CP007257 (Rhodococcus erythropolis R138 plasmid pLRE138, complete sequence) position: , mismatch: 5, identity: 0.833

tacctcgtcctcgacgagctgtggcgcgtc	CRISPR spacer
tacctcgtcctcgacgagccgtggccggcg	Protospacer
*******************.*****  *. 

27. spacer 10.2|2448316|30|CP029338|CRISPRCasFinder matches to NZ_CP045736 (Aeromicrobium sp. MF47 plasmid p001, complete sequence) position: , mismatch: 5, identity: 0.833

tacctcgtcctcgacgagctgtggcgcgtc	CRISPR spacer
ttcgtcgtcctggacgagctgtggcgcgcg	Protospacer
* * ******* ****************. 

28. spacer 10.2|2448316|30|CP029338|CRISPRCasFinder matches to NC_014549 (Glutamicibacter arilaitensis Re117 plasmid pRE117-1, complete sequence) position: , mismatch: 5, identity: 0.833

tacctcgtcctcgacgagctgtggcgcgtc	CRISPR spacer
ttcgtcatcctcgacgagctgtggcgtgcc	Protospacer
* * **.*******************.*.*

29. spacer 10.2|2448316|30|CP029338|CRISPRCasFinder matches to NC_008537 (Arthrobacter sp. FB24 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.833

tacctcgtcctcgacgagctgtggcgcgtc	CRISPR spacer
ttcgtcgtcctggacgagctgtggcgggcc	Protospacer
* * ******* ************** *.*

30. spacer 10.2|2448316|30|CP029338|CRISPRCasFinder matches to NC_009235 (Burkholderia phage phi644-2 chromosome, complete genome) position: , mismatch: 5, identity: 0.833

tacctcgtcctcgacg---agctgtggcgcgtc	CRISPR spacer
tacctcgtcctcgacgcgctgctgtagcgc---	Protospacer
****************    *****.****   

31. spacer 10.2|2448316|30|CP029338|CRISPRCasFinder matches to CP000625 (Burkholderia phage phi644-2, complete genome) position: , mismatch: 5, identity: 0.833

tacctcgtcctcgacg---agctgtggcgcgtc	CRISPR spacer
tacctcgtcctcgacgcgctgctgtagcgc---	Protospacer
****************    *****.****   

32. spacer 10.2|2448316|30|CP029338|CRISPRCasFinder matches to AF447491 (Bacteriophage phiE125, complete genome) position: , mismatch: 5, identity: 0.833

tacctcgtcctcgacg---agctgtggcgcgtc	CRISPR spacer
tacctcgtcctcgacgcgctgctgtagcgc---	Protospacer
****************    *****.****   

33. spacer 10.2|2448316|30|CP029338|CRISPRCasFinder matches to NC_003309 (Burkholderia phage phiE125, complete genome) position: , mismatch: 5, identity: 0.833

tacctcgtcctcgacg---agctgtggcgcgtc	CRISPR spacer
tacctcgtcctcgacgcgctgctgtagcgc---	Protospacer
****************    *****.****   

34. spacer 12.2|2563764|29|CP029338|PILER-CR matches to NZ_CP016293 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence) position: , mismatch: 5, identity: 0.828

tcggtgaccggcacggtcagacgtgtccg	CRISPR spacer
tcggtgaccggcagtgtcagacgtgtatt	Protospacer
*************  *********** . 

35. spacer 23.2|3663855|37|CP029338|CRISPRCasFinder matches to ASHF01000034 (Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence) position: , mismatch: 5, identity: 0.865

gacttcaccgtcttcaacccccgccgccgagccggaa	CRISPR spacer
gacttcaccgtcttcaacccccgccgccgcgccttcc	Protospacer
***************************** ***    

36. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to NZ_CP029828 (Burkholderia sp. JP2-270 plasmid p2, complete sequence) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
atccaggtgccggccgggctcgagcc	Protospacer
* .*****************.***  

37. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to MK494116 (Mycobacterium phage Dulcie, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

38. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to MN234212 (Mycobacterium phage Paphu, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

39. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to MH001458 (Mycobacterium phage Smeagol, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

40. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to MH000607 (Mycobacterium phage RiverMonster, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

41. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to MN585973 (Mycobacterium phage StAnnes, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

42. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to MK757445 (Mycobacterium phage Lilizi, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

43. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to MH576953 (Mycobacterium phage Hopey, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

44. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to MF919506 (Mycobacterium phage FireRed, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

45. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to MH230878 (Mycobacterium phage Oogway, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

46. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to MH020235 (Mycobacterium phage Batiatus, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

47. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to MK359320 (Mycobacterium phage Cookies, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

48. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to AY129331 (Mycobacterium virus Cjw1, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

49. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to MG962370 (Mycobacterium phage Kykar, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

50. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to MN586043 (Mycobacterium phage Buck, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

51. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to MK061415 (Mycobacterium phage Rhynn, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

52. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to MH576975 (Mycobacterium phage Target, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

53. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to MN586000 (Mycobacterium phage Sagefire, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

54. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to KY549152 (Mycobacterium phage Maxxinista, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

55. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to NC_029059 (Mycobacterium phage Edtherson, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

56. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to MK359331 (Mycobacterium phage Rajelicia, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

57. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to MH744414 (Mycobacterium phage Arcanine, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

58. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to NC_004688 (Mycobacterium phage Omega, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

59. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to MF919524 (Mycobacterium phage MISSy, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

60. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to EU816588 (Mycobacterium phage Porky, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

61. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to MT952854 (Mycobacterium phage Miniwave, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

62. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to MK524506 (Mycobacterium phage Zeuska, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

63. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to KP027203 (Mycobacterium phage Treddle, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

64. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to NC_021297 (Mycobacterium phage PattyP, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

65. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to KC748969 (Mycobacterium phage Phaux, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

66. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to MH669002 (Mycobacterium phage Emmina, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

67. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to AY129338 (Mycobacterium virus Omega, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

68. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to KC661277 (Mycobacterium phage Phrux, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

69. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to MK524499 (Mycobacterium phage Tripl3t, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

70. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to JF937096 (Mycobacterium phage Henry, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

71. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to KX522649 (Mycobacterium phage Bircsak, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

72. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to MH020247 (Mycobacterium phage MPhalcon, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

73. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to JN391441 (Mycobacterium phage Elph10, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

74. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to NC_041844 (Mycobacterium phage Optimus, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

75. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to KM597531 (Mycobacterium phage Abrogate, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

76. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to MN617845 (Mycobacterium phage BaconJack, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

77. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to NC_022969 (Mycobacterium phage PhatBacter, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

78. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to MN586019 (Mycobacterium phage Stark, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

79. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to KX522943 (Mycobacterium phage Gompeii16, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

80. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to NC_041850 (Mycobacterium phage Eureka, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

81. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to NC_028906 (Mycobacterium phage Toto, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

82. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to KY319168 (Mycobacterium phage CrystalP, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

83. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to KU998244 (Gordonia phage Smoothie, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gttcaggggccggccggacttgaggt	Protospacer
. ***** *********.******* 

84. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to MG812486 (Mycobacterium phage Acme, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

85. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to NC_031067 (Mycobacterium phage Makemake, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

86. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to MH727557 (Mycobacterium phage Paperbeatsrock, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

87. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to KF279417 (Mycobacterium phage Quink, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

88. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to MH576971 (Mycobacterium phage Arlo, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

89. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to JN382248 (Mycobacterium phage Lilac, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgccccccgggcttgagga	Protospacer
.. ********  *************

90. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to MF919520 (Gordonia phage Lozinak, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gttcaggggccggccggacttgaggt	Protospacer
. ***** *********.******* 

91. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to KJ409696 (Mycobacterium phage Lamina13, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

92. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to MN586017 (Mycobacterium phage OrionPax, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

93. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to NC_023695 (Mycobacterium phage Violet, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

94. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to KT020852 (Mycobacterium phage NoSleep, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

95. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to NC_022976 (Mycobacterium phage Nala, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

96. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to MK967379 (Mycobacterium phage HokkenD, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

97. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to NC_028784 (Mycobacterium phage Tasp14, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

98. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to JF937093 (Mycobacterium virus DLane, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

99. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to KT259047 (Mycobacterium phage Rufus, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

100. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to MN586034 (Mycobacterium phage Hoonter, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

101. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to NC_022085 (Mycobacterium phage Goku, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

102. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to NC_004681 (Mycobacterium phage Cjw1, complete genome) position: , mismatch: 5, identity: 0.808

agtcaggtgccggccgggcttgagga	CRISPR spacer
gagcaggtgcccaccgggcttgagga	Protospacer
.. ******** .*************

103. spacer 10.1|2448255|30|CP029338|CRISPRCasFinder matches to NZ_CP024896 (Amycolatopsis sp. AA4 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.8

-ctcccgcaccggcgggtgtggctggtcggc	CRISPR spacer
gcggccacg-cgccgggtgtggctggtcggc	Protospacer
 *  **.*. ** ******************

104. spacer 10.2|2448316|30|CP029338|CRISPRCasFinder matches to NZ_CP046475 (Janibacter melonis strain M714 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

tacctcgtcctcgacgagctgtggcgcgtc	CRISPR spacer
gtgctcgtcatggacgagctgtggcgcgtg	Protospacer
   ****** * ***************** 

105. spacer 10.2|2448316|30|CP029338|CRISPRCasFinder matches to NZ_CP029051 (Miniimonas sp. S16 plasmid pS16-2, complete sequence) position: , mismatch: 6, identity: 0.8

tacctcgtcctcgacgagctgtggcgcgtc	CRISPR spacer
ttcgtgatcctcgacgagctgtggcgcgcg	Protospacer
* * * .*********************. 

106. spacer 10.2|2448316|30|CP029338|CRISPRCasFinder matches to NC_021229 (Arthrobacter nicotinovorans pAO1 megaplasmid sequence, strain ATCC 49919) position: , mismatch: 6, identity: 0.8

tacctcgtcctcgacgagctgtggcgcgtc	CRISPR spacer
ttcgtcgtcctggacgagctgtggcgtgct	Protospacer
* * ******* **************.*..

107. spacer 10.2|2448316|30|CP029338|CRISPRCasFinder matches to NZ_CP016284 (Cryobacterium arcticum strain PAMC 27867 plasmid pP27867_2, complete sequence) position: , mismatch: 6, identity: 0.8

tacctcgtcctcgacgagctgtggcgcgtc	CRISPR spacer
ctcgtcgtcctcgacgagctctggcgagcc	Protospacer
. * **************** ***** *.*

108. spacer 10.2|2448316|30|CP029338|CRISPRCasFinder matches to NZ_CP021994 (Cryobacterium sp. LW097 plasmid unnamed1) position: , mismatch: 6, identity: 0.8

tacctcgtcctcgacgagctgtggcgcgtc	CRISPR spacer
ttcgtcatcctcgacgagctgtggcgggcg	Protospacer
* * **.******************* *. 

109. spacer 10.2|2448316|30|CP029338|CRISPRCasFinder matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.8

tacctcgtcctcgacgagctgtggcgcgtc	CRISPR spacer
gacctcgtccccggcgagctgtggatcggc	Protospacer
 *********.**.**********  ** *

110. spacer 12.2|2563764|29|CP029338|PILER-CR matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 6, identity: 0.793

tcggtgaccggcacggtcagacgtgtccg	CRISPR spacer
tcggtgaccagcacggtcaggcgcgggcc	Protospacer
*********.**********.**.*  * 

111. spacer 12.2|2563764|29|CP029338|PILER-CR matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.793

tcggtgaccggcacggtcagacgtgtccg	CRISPR spacer
tcggtgaccagcacggtcaggcgcgggcc	Protospacer
*********.**********.**.*  * 

112. spacer 33.3|5116459|33|CP029338|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 6, identity: 0.818

tgcctgcgaggtcagttcctcggccgcggccag	CRISPR spacer
tccctgcgagcgcagttcctcggccgcgtcgat	Protospacer
* ********  **************** * * 

113. spacer 33.3|5116459|33|CP029338|CRISPRCasFinder matches to NZ_CP019938 (Ketogulonicigenium robustum strain SPU_B003 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.818

--tgcctgcgaggtcagttcctcggccgcggccag	CRISPR spacer
ggtgacggc--ggccagttcctcggcctcggccag	Protospacer
  ** * **  **.************* *******

114. spacer 33.6|5116666|33|CP029338|CRISPRCasFinder matches to NZ_CP018784 (Curtobacterium pusillum strain AA3 plasmid pCPAA3, complete sequence) position: , mismatch: 6, identity: 0.818

ggaacg-cgcccccagcgactcggcctccgtggc	CRISPR spacer
-caacgccgcctcgagcgactcggcctccgtcac	Protospacer
  **** ****.* ***************** .*

115. spacer 37.3|5809017|26|CP029338|CRISPRCasFinder matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 6, identity: 0.769

agtcaggtgccggccgggcttgagga	CRISPR spacer
gatcaggtgcgggccgggcttgacct	Protospacer
..******** ************   

116. spacer 9.2|2022994|32|CP029338|CRISPRCasFinder matches to NZ_CP015007 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence) position: , mismatch: 7, identity: 0.781

acggtcaacggctacgccgccgactggaaaca	CRISPR spacer
acccgccgcgcctacgccgccgactggaagca	Protospacer
**   * .** ******************.**

117. spacer 9.2|2022994|32|CP029338|CRISPRCasFinder matches to NZ_CP020447 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed7, complete sequence) position: , mismatch: 7, identity: 0.781

acggtcaacggctacgccgccgactggaaaca	CRISPR spacer
acccgccgcgcctatgccgccgactggaaaca	Protospacer
**   * .** ***.*****************

118. spacer 9.2|2022994|32|CP029338|CRISPRCasFinder matches to NZ_CP026528 (Sinorhizobium meliloti strain AK21 plasmid pSmeAK21a, complete sequence) position: , mismatch: 7, identity: 0.781

acggtcaacggctacgccgccgactggaaaca	CRISPR spacer
acccgccgcgcctatgccgccgactggaaaca	Protospacer
**   * .** ***.*****************

119. spacer 9.2|2022994|32|CP029338|CRISPRCasFinder matches to NZ_CP044078 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

acggtcaacggctacgccgccgactggaaaca	CRISPR spacer
acccgccgcgcctatgccgccgactggaaaca	Protospacer
**   * .** ***.*****************

120. spacer 9.2|2022994|32|CP029338|CRISPRCasFinder matches to NZ_CP031081 (Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence) position: , mismatch: 7, identity: 0.781

acggtcaacggctacgccgccgactggaaaca	CRISPR spacer
acccgccgcgcctatgccgccgactggaaaca	Protospacer
**   * .** ***.*****************

121. spacer 9.2|2022994|32|CP029338|CRISPRCasFinder matches to NC_011273 (Mycobacterium phage Myrna, complete genome) position: , mismatch: 7, identity: 0.781

acggtcaacggctacgccgccgactggaaaca-	CRISPR spacer
tcggtcaacggcaacgccgccaacc-gaggcat	Protospacer
 *********** ********.**. **..** 

122. spacer 10.1|2448255|30|CP029338|CRISPRCasFinder matches to MN062717 (Microbacterium phage Sharkboy, complete genome) position: , mismatch: 7, identity: 0.767

ctcccgcaccggcgggtgtggctggtcggc	CRISPR spacer
ctcccgcaccgccgggtgcggctgcgggtg	Protospacer
*********** ******.*****   *  

123. spacer 10.1|2448255|30|CP029338|CRISPRCasFinder matches to NC_042099 (Microbacterium phage Dismas, complete genome) position: , mismatch: 7, identity: 0.767

ctcccgcaccggcgggtgtggctggtcggc	CRISPR spacer
ctcccgcaccgccgggtgcggctgcgggtg	Protospacer
*********** ******.*****   *  

124. spacer 10.1|2448255|30|CP029338|CRISPRCasFinder matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 7, identity: 0.767

ctcccgcaccggcgggtgtggctggtcggc	CRISPR spacer
cgcccgcaccagcgggtgcggctgggcatt	Protospacer
* ********.*******.****** *. .

125. spacer 10.1|2448255|30|CP029338|CRISPRCasFinder matches to NC_004808 (Streptomyces rochei plasmid pSLA2-L DNA, complete sequence) position: , mismatch: 7, identity: 0.767

ctcccgcaccggcgggtgtggctggtcggc	CRISPR spacer
gagcagcagcggcgggtgcggctggtcgcc	Protospacer
   * *** *********.********* *

126. spacer 10.2|2448316|30|CP029338|CRISPRCasFinder matches to NZ_CP033038 (Agrobacterium fabrum strain 12D13 plasmid pAt12D13c, complete sequence) position: , mismatch: 7, identity: 0.767

tacctcgtcctcgacgagctgtggcgcgtc	CRISPR spacer
ttcgcggtcctcgacgagctgtcgcgcgga	Protospacer
* * . **************** *****  

127. spacer 10.2|2448316|30|CP029338|CRISPRCasFinder matches to NZ_CP015237 (Rhodococcus fascians D188 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767

tacctcgtcctcgacgagctgtggcgcgtc	CRISPR spacer
ggctacgacctcgacgagctgtgccgcgac	Protospacer
 .*. ** *************** **** *

128. spacer 10.2|2448316|30|CP029338|CRISPRCasFinder matches to CP054924 (Verrucosispora sp. NA02020 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

tacctcgtcctcgacgagctgtggcgcgtc	CRISPR spacer
ttcaccgtgctcgacgagctgtggcgggcg	Protospacer
* * .*** ***************** *. 

129. spacer 10.2|2448316|30|CP029338|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 7, identity: 0.767

tacctcgtcctcgacgagctgtggcgcgtc	CRISPR spacer
ccgcccgacctggacgagctgtggcgcgac	Protospacer
.  *.** *** **************** *

130. spacer 10.2|2448316|30|CP029338|CRISPRCasFinder matches to NC_015409 (Verrucosispora maris AB-18-032 plasmid pVMKU, complete sequence) position: , mismatch: 7, identity: 0.767

tacctcgtcctcgacgagctgtggcgcgtc	CRISPR spacer
ttcaccgtgctcgacgagctgtggcgggcg	Protospacer
* * .*** ***************** *. 

131. spacer 10.2|2448316|30|CP029338|CRISPRCasFinder matches to NC_034248 (Rhizobium phage RHEph10, complete genome) position: , mismatch: 7, identity: 0.767

tacctcgtcctcgacgagctgtggcgcgtc	CRISPR spacer
cagattatcctcgacgagctgttgcgcgcc	Protospacer
.*  *..*************** *****.*

132. spacer 10.3|2448377|30|CP029338|CRISPRCasFinder matches to NZ_AP018921 (Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence) position: , mismatch: 7, identity: 0.767

gaggccactccggtcgtcacgaacatcatc	CRISPR spacer
caggggcgcccggtcgtcacgaacgtcatc	Protospacer
 ***    .***************.*****

133. spacer 24.1|3927704|29|CP029338|CRISPRCasFinder matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 7, identity: 0.759

cggtggcctcaagcgccggccgggctcag	CRISPR spacer
tcatggcctcaagcgccgaccgggtcgag	Protospacer
. .***************.*****.. **

134. spacer 24.1|3927704|29|CP029338|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 7, identity: 0.759

cggtggcctcaagcgccggccgggctcag	CRISPR spacer
atatggcctcattcgccggccgggcttcg	Protospacer
  .********  *************. *

135. spacer 24.1|3927704|29|CP029338|CRISPRCasFinder matches to NZ_CP042809 (Acetobacter oryzoeni strain B6 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.759

cggtggcctcaagcgccggccgggctcag	CRISPR spacer
gtgtggcctccagcaccggccgggcaatg	Protospacer
  ******** ***.**********   *

136. spacer 24.1|3927704|29|CP029338|CRISPRCasFinder matches to MH045568 (Microbacterium phage Kieran, complete genome) position: , mismatch: 7, identity: 0.759

cggtggcctcaagcgccggccgggctcag	CRISPR spacer
cgacggcctcatgcgccggccgggcgggt	Protospacer
**..******* *************  . 

137. spacer 24.1|3927704|29|CP029338|CRISPRCasFinder matches to MN062717 (Microbacterium phage Sharkboy, complete genome) position: , mismatch: 7, identity: 0.759

cggtggcctcaagcgccggccgggctcag	CRISPR spacer
cgacggcctcatgcgccggccgggcgggt	Protospacer
**..******* *************  . 

138. spacer 24.1|3927704|29|CP029338|CRISPRCasFinder matches to MT310853 (Microbacterium phage AvGardian, complete genome) position: , mismatch: 7, identity: 0.759

cggtggcctcaagcgccggccgggctcag	CRISPR spacer
cgacggcctcatgcgccggccgggcgggt	Protospacer
**..******* *************  . 

139. spacer 24.1|3927704|29|CP029338|CRISPRCasFinder matches to NC_042099 (Microbacterium phage Dismas, complete genome) position: , mismatch: 7, identity: 0.759

cggtggcctcaagcgccggccgggctcag	CRISPR spacer
cgacggcctcatgcgccggccgggcgggt	Protospacer
**..******* *************  . 

140. spacer 30.1|4522686|54|CP029338|CRISPRCasFinder matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.87

cgccggggcgcggctgcgccggcagggcgtggagcgcgtccgcatcgtggagac	CRISPR spacer
cgccggggcgcggctgcgccggcagggcgtggaacgcgtccgcctgatcgacaa	Protospacer
*********************************.********* * .* ** * 

141. spacer 33.3|5116459|33|CP029338|CRISPRCasFinder matches to CP054924 (Verrucosispora sp. NA02020 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788

tgcctgcgaggtcagttcctcggccgcggccag	CRISPR spacer
cgtctccgaggtcaggtcctcggccgcctcccg	Protospacer
.*.** ********* ***********  ** *

142. spacer 33.5|5116600|33|CP029338|CRISPRCasFinder matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 7, identity: 0.788

cgcctcggtcaccgtccgctcggcctcggcccg	CRISPR spacer
ggcggcggtcgccgtccgcacggcctcggccat	Protospacer
 **  *****.******** ***********  

143. spacer 33.5|5116600|33|CP029338|CRISPRCasFinder matches to NZ_CP040761 (Paracoccus sp. 2251 plasmid unnamed5, complete sequence) position: , mismatch: 7, identity: 0.788

cgcctcggtcaccgtccgctcggcctcggcccg	CRISPR spacer
cgaggcgcgcacgatccgctcggcctcggcccg	Protospacer
**   **  *** .*******************

144. spacer 33.5|5116600|33|CP029338|CRISPRCasFinder matches to NZ_LR134463 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 21, complete sequence) position: , mismatch: 7, identity: 0.788

-----cgcctcggtcaccgtccgctcggcctcggcccg	CRISPR spacer
tcaggcgcc-----caccgtccgcgcgacctcggcccg	Protospacer
     ****     ********** **.**********

145. spacer 37.2|5808959|32|CP029338|CRISPRCasFinder matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 7, identity: 0.781

gggtggcctcaggcgccggccgggctcgaagg	CRISPR spacer
ggtgcggtacaggcgccggccgggttcgaagg	Protospacer
**   * . ***************.*******

146. spacer 37.2|5808959|32|CP029338|CRISPRCasFinder matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

gggtggcc--tcaggcgccggccgggctcgaagg	CRISPR spacer
--gttgtcgtccagccgccggccgggcacgaagg	Protospacer
  ** *.*  .*** ************ ******

147. spacer 9.2|2022994|32|CP029338|CRISPRCasFinder matches to NZ_CP041652 (Streptomyces sp. RLB1-9 plasmid pRLB1-9.2, complete sequence) position: , mismatch: 8, identity: 0.75

acggtcaacggctacgccgccgactggaaaca	CRISPR spacer
ctggtcgacggctacgcggccgactggacggt	Protospacer
 .****.********** ********** .  

148. spacer 9.2|2022994|32|CP029338|CRISPRCasFinder matches to NZ_CP015006 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA01, complete sequence) position: , mismatch: 8, identity: 0.75

acggtcaacggctacgccgccgactggaaaca	CRISPR spacer
acccggcgcgcctacgccgccgactggaagca	Protospacer
**     .** ******************.**

149. spacer 9.2|2022994|32|CP029338|CRISPRCasFinder matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75

acggtcaacggctacgccgccgactggaaaca-----	CRISPR spacer
acggtcaacggcttcaccgcc-----gagacaattac	Protospacer
************* *.*****     **.***     

150. spacer 9.2|2022994|32|CP029338|CRISPRCasFinder matches to NZ_CP042915 (Rhodococcus qingshengii strain RL1 plasmid unnamed2) position: , mismatch: 8, identity: 0.75

acggtcaacggctacgccgccgactggaaaca	CRISPR spacer
agggtcaacgacttcgccgccgactatctaga	Protospacer
* ********.** ***********.   * *

151. spacer 10.1|2448255|30|CP029338|CRISPRCasFinder matches to NZ_CP015446 (Streptomyces sp. S8 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733

ctcccgcaccggcgggtgtggctggtcggc	CRISPR spacer
gagcagcagcggcgggtgcggctggtcgct	Protospacer
   * *** *********.********* .

152. spacer 10.2|2448316|30|CP029338|CRISPRCasFinder matches to NZ_CP013299 (Arthrobacter sp. YC-RL1 plasmid unnamed 2, complete sequence) position: , mismatch: 8, identity: 0.733

tacctcgtcctcgacgagctgtggcgcgtc	CRISPR spacer
tttgtgatcctcgatgagctgtggcgcgcg	Protospacer
* . * .*******.*************. 

153. spacer 10.2|2448316|30|CP029338|CRISPRCasFinder matches to NZ_CP016082 (Streptomyces sp. SAT1 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733

tacctcgtcctcgacgagctgtggcgcgtc	CRISPR spacer
ctgctcgtcctcgacgagccgtggtccggg	Protospacer
.  ****************.****. **  

154. spacer 10.2|2448316|30|CP029338|CRISPRCasFinder matches to NZ_CP017301 (Rhodococcus sp. YL-1 plasmid pYLC2, complete sequence) position: , mismatch: 8, identity: 0.733

tacctcgtcctcgacgagctgtggcgcgtc	CRISPR spacer
tacctcgtcgtcgacgagctgcacgactac	Protospacer
********* ***********..  .*  *

155. spacer 10.2|2448316|30|CP029338|CRISPRCasFinder matches to NZ_CP050127 (Rhodococcus erythropolis strain KB1 plasmid plas4, complete sequence) position: , mismatch: 8, identity: 0.733

tacctcgtcctcgacgagctgtggcgcgtc	CRISPR spacer
tacctcgtcgtcgacgagctgcacgactac	Protospacer
********* ***********..  .*  *

156. spacer 10.2|2448316|30|CP029338|CRISPRCasFinder matches to NZ_CP020556 (Streptomyces sp. Sge12 plasmid pSGE, complete sequence) position: , mismatch: 8, identity: 0.733

tacctcgtcctcgacgagctgtggcgcgtc	CRISPR spacer
atcgtcgtccgcgacgagctctggcgccag	Protospacer
  * ****** ********* ******   

157. spacer 10.2|2448316|30|CP029338|CRISPRCasFinder matches to NZ_CP011869 (Pseudonocardia sp. HH130629-09 plasmid pLS1-1, complete sequence) position: , mismatch: 8, identity: 0.733

tacctcgtcctcgacgagctgtggcgcgtc	CRISPR spacer
atcgtcgtccgcgacgaggtgtggcgccag	Protospacer
  * ****** ******* ********   

158. spacer 10.2|2448316|30|CP029338|CRISPRCasFinder matches to NC_005284 (Burkholderia phage phi1026b, complete genome) position: , mismatch: 8, identity: 0.733

tacctcgtcctcgacgagctgtggcgcgtc	CRISPR spacer
tacctcgtcctcgacgcgctgctgtagtgc	Protospacer
**************** ****. *..   *

159. spacer 10.2|2448316|30|CP029338|CRISPRCasFinder matches to AY453853 (Bacteriophage phi1026b, complete genome) position: , mismatch: 8, identity: 0.733

tacctcgtcctcgacgagctgtggcgcgtc	CRISPR spacer
tacctcgtcctcgacgcgctgctgtagtgc	Protospacer
**************** ****. *..   *

160. spacer 24.1|3927704|29|CP029338|CRISPRCasFinder matches to NC_010335 (Caulobacter sp. K31 plasmid pCAUL01, complete sequence) position: , mismatch: 8, identity: 0.724

cggtggcctcaagcgccggccgggctcag	CRISPR spacer
gcgtgacctcaagcgccggctgggcgagc	Protospacer
  ***.**************.****  . 

161. spacer 25.1|3929008|34|CP029338|CRT matches to MN062714 (Microbacterium Phage DirtyBubble, complete genome) position: , mismatch: 8, identity: 0.765

acctagcccgggcggcgcttgaggccgtctttcg	CRISPR spacer
gacccgcccgggcggcgcatgaggccgtcgggcg	Protospacer
. *. ************* **********   **

162. spacer 25.1|3929008|34|CP029338|CRT matches to MT024860 (Microbacterium phage Stromboli, complete genome) position: , mismatch: 8, identity: 0.765

acctagcccgggcggcgcttgaggccgtctttcg	CRISPR spacer
gacccgcccgggcggcgcatgaggccgtcgggcg	Protospacer
. *. ************* **********   **

163. spacer 33.5|5116600|33|CP029338|CRISPRCasFinder matches to NZ_CP016593 (Ketogulonicigenium vulgare strain SKV plasmid pKvSKV1, complete sequence) position: , mismatch: 8, identity: 0.758

cgcctcgg---tcaccgtccgctcggcctcggcccg	CRISPR spacer
---atcgaaatgcacggtcagctcggcctcggcccg	Protospacer
    ***.    *** *** ****************

164. spacer 33.5|5116600|33|CP029338|CRISPRCasFinder matches to NC_017386 (Ketogulonicigenium vulgare WSH-001 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.758

cgcctcgg---tcaccgtccgctcggcctcggcccg	CRISPR spacer
---atcgaaatgcacggtcagctcggcctcggcccg	Protospacer
    ***.    *** *** ****************

165. spacer 33.5|5116600|33|CP029338|CRISPRCasFinder matches to NC_014621 (Ketogulonicigenium vulgare Y25 plasmid pYP1, complete sequence) position: , mismatch: 8, identity: 0.758

cgcctcgg---tcaccgtccgctcggcctcggcccg	CRISPR spacer
---atcgaaatgcacggtcagctcggcctcggcccg	Protospacer
    ***.    *** *** ****************

166. spacer 33.5|5116600|33|CP029338|CRISPRCasFinder matches to NZ_CP012909 (Ketogulonicigenium vulgare strain Hbe602 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.758

cgcctcgg---tcaccgtccgctcggcctcggcccg	CRISPR spacer
---atcgaaatgcacggtcagctcggcctcggcccg	Protospacer
    ***.    *** *** ****************

167. spacer 33.5|5116600|33|CP029338|CRISPRCasFinder matches to NZ_CP016620 (Microvirga ossetica strain V5/3m plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.758

cgcctcggtcaccgtccgctcggcctcggcccg	CRISPR spacer
cttctcggacaccatccgctcggcctccaccat	Protospacer
* .***** ****.************* .**  

168. spacer 37.2|5808959|32|CP029338|CRISPRCasFinder matches to NZ_CP054841 (Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

gggtggcctcaggcgccggccgggctcgaagg	CRISPR spacer
gggtggccgcaggcgctggccggcaccagcgg	Protospacer
******** *******.******  .*.. **

169. spacer 37.2|5808959|32|CP029338|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 8, identity: 0.75

gggtggcctcaggcgccggccgggctcgaagg	CRISPR spacer
agggggcctcagccgccggccggggcggacag	Protospacer
.** ******** *********** . ** .*

170. spacer 37.2|5808959|32|CP029338|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 8, identity: 0.75

gggtggcc--tcaggcgccggccgggctcgaagg	CRISPR spacer
--atcgtcgatcaggcgccgaacgggctcgaagt	Protospacer
  .* *.*  **********. *********** 

171. spacer 9.2|2022994|32|CP029338|CRISPRCasFinder matches to NZ_CP014649 (Klebsiella pneumoniae strain KPNIH36 plasmid pKPN-fff, complete sequence) position: , mismatch: 9, identity: 0.719

acggtcaacggctacgccgccgactggaaaca	CRISPR spacer
ttaaaatacggctacgacgcggactggaaaca	Protospacer
 ...   ********* *** ***********

172. spacer 9.2|2022994|32|CP029338|CRISPRCasFinder matches to NC_021654 (Klebsiella pneumoniae plasmid pKN-LS6, complete sequence) position: , mismatch: 9, identity: 0.719

acggtcaacggctacgccgccgactggaaaca	CRISPR spacer
ttaaaatacggctacgacgcggactggaaaca	Protospacer
 ...   ********* *** ***********

173. spacer 9.2|2022994|32|CP029338|CRISPRCasFinder matches to NZ_CP007729 (Klebsiella pneumoniae subsp. pneumoniae KPNIH10 plasmid pKPN-498, complete sequence) position: , mismatch: 9, identity: 0.719

acggtcaacggctacgccgccgactggaaaca	CRISPR spacer
ttaaaatacggctacgacgcggactggaaaca	Protospacer
 ...   ********* *** ***********

174. spacer 9.2|2022994|32|CP029338|CRISPRCasFinder matches to NZ_CP037929 (Klebsiella pneumoniae subsp. pneumoniae strain KP-8788 plasmid pKPN-IT-8788, complete sequence) position: , mismatch: 9, identity: 0.719

acggtcaacggctacgccgccgactggaaaca	CRISPR spacer
ttaaaatacggctacgacgcggactggaaaca	Protospacer
 ...   ********* *** ***********

175. spacer 9.2|2022994|32|CP029338|CRISPRCasFinder matches to MN922301 (Klebsiella pneumoniae strain KP-14159 plasmid pKPN-IT-14159, complete sequence) position: , mismatch: 9, identity: 0.719

acggtcaacggctacgccgccgactggaaaca	CRISPR spacer
ttaaaatacggctacgacgcggactggaaaca	Protospacer
 ...   ********* *** ***********

176. spacer 9.2|2022994|32|CP029338|CRISPRCasFinder matches to MK422448 (Klebsiella phage ST512-KPC3phi13.3, complete genome) position: , mismatch: 9, identity: 0.719

acggtcaacggctacgccgccgactggaaaca	CRISPR spacer
ttaaaatacggctacgacgcggactggaaaca	Protospacer
 ...   ********* *** ***********

177. spacer 9.2|2022994|32|CP029338|CRISPRCasFinder matches to NZ_CP013072 (Sphingobium indicum B90A plasmid pSRL2, complete sequence) position: , mismatch: 9, identity: 0.719

acggtcaacggctacgccgccgactggaaaca	CRISPR spacer
acggtgaacggcgacgccgccgacatagaggg	Protospacer
***** ****** ***********  ..*. .

178. spacer 9.2|2022994|32|CP029338|CRISPRCasFinder matches to NZ_KF418775 (Burkholderia pseudomallei strain MSHR1950 plasmid pBPSE01, complete sequence) position: , mismatch: 9, identity: 0.719

acggtcaacggctacgccgccgactggaaaca	CRISPR spacer
cctgtcaacggctacgccgccggccggcgcgc	Protospacer
 * *******************.*.** .   

179. spacer 9.2|2022994|32|CP029338|CRISPRCasFinder matches to NZ_CP005190 (Sphingobium sp. MI1205 plasmid pMI1, complete sequence) position: , mismatch: 9, identity: 0.719

acggtcaacggctacgccgccgactggaaaca	CRISPR spacer
acggtgaacggcgacgccgccgacatagaggg	Protospacer
***** ****** ***********  ..*. .

180. spacer 9.2|2022994|32|CP029338|CRISPRCasFinder matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 9, identity: 0.719

acggtcaacggctacgccgccgactggaaaca	CRISPR spacer
ccgacgtgcgcctatgccgccgactggaaacc	Protospacer
 **..  .** ***.**************** 

181. spacer 9.2|2022994|32|CP029338|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

acggtcaacggctacgccgccgactggaaaca	CRISPR spacer
cccgccaacgcctccgccgccgactggatcgc	Protospacer
 * *.***** ** **************    

182. spacer 9.3|2023055|32|CP029338|CRISPRCasFinder matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 9, identity: 0.719

gggtcgtcgcccttgtccgccgcaaacaccac	CRISPR spacer
gggacgtcgcccttctccgccgcctcgcgcag	Protospacer
*** ********** ********      ** 

183. spacer 9.3|2023055|32|CP029338|CRISPRCasFinder matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719

gggtcgtcgcccttgtccgccgcaaacaccac	CRISPR spacer
gggacgtcgcccttctccgccgcctcgcgcag	Protospacer
*** ********** ********      ** 

184. spacer 10.2|2448316|30|CP029338|CRISPRCasFinder matches to NC_023283 (Streptomyces sp. FR1 plasmid pFRL3, complete sequence) position: , mismatch: 9, identity: 0.7

tacctcgtcctcgacgagctgtggcgcgtc	CRISPR spacer
cttggggtcctcgacgatcagtggcgcgta	Protospacer
. .   *********** * ********* 

185. spacer 10.2|2448316|30|CP029338|CRISPRCasFinder matches to NC_023284 (Streptomyces sp. F2 plasmid pFRL4, complete sequence) position: , mismatch: 9, identity: 0.7

tacctcgtcctcgacgagctgtggcgcgtc	CRISPR spacer
cttggggtcctcgacgatcagtggcgcgta	Protospacer
. .   *********** * ********* 

186. spacer 10.2|2448316|30|CP029338|CRISPRCasFinder matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 9, identity: 0.7

tacctcgtcctcgacgagctgtggcgcgtc	CRISPR spacer
cggctcgtcctcggcgagctgcggcggcca	Protospacer
.. **********.*******.****  . 

187. spacer 23.2|3663855|37|CP029338|CRISPRCasFinder matches to ASHF01000034 (Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence) position: , mismatch: 9, identity: 0.757

gacttcaccgtcttcaacccccgccgccgagccggaa	CRISPR spacer
gacttcaccgtcttcaaccacccccgcgaaccccacg	Protospacer
******************* ** **** .* ** . .

188. spacer 25.1|3929008|34|CP029338|CRT matches to MT310853 (Microbacterium phage AvGardian, complete genome) position: , mismatch: 9, identity: 0.735

acctagcccgggcggcgcttgaggccgtctttcg	CRISPR spacer
gacccgcccggccggcgcatgaggccgtcgggcg	Protospacer
. *. ****** ****** **********   **

189. spacer 33.5|5116600|33|CP029338|CRISPRCasFinder matches to NC_017588 (Thermus thermophilus JL-18 plasmid pTTJL1801, complete sequence) position: , mismatch: 9, identity: 0.727

cgcctcggtcaccgtccgctcggcctcggcccg	CRISPR spacer
cgcctcggtcaccgtgcgcccggcggtggagaa	Protospacer
*************** ***.****  .**   .

190. spacer 33.5|5116600|33|CP029338|CRISPRCasFinder matches to NZ_LR027520 (Thermus thermophilus isolate TTHNAR1 plasmid 4, complete sequence) position: , mismatch: 9, identity: 0.727

cgcctcggtcaccgtccgctcggcctcggcccg	CRISPR spacer
cgcctcggtcaccgtgcgcccggcggtggagaa	Protospacer
*************** ***.****  .**   .

191. spacer 33.6|5116666|33|CP029338|CRISPRCasFinder matches to NZ_LR134455 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 13, complete sequence) position: , mismatch: 9, identity: 0.727

ggaacgcgcccccagcgactcggcctccgtggc	CRISPR spacer
catacgctcccccaccgactcggcctcgtccgc	Protospacer
 . **** ****** ************  . **

192. spacer 37.2|5808959|32|CP029338|CRISPRCasFinder matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 9, identity: 0.719

gggtggcctcaggcgccggccgggctcgaagg	CRISPR spacer
gctgaagcgcacgcgccggccgggcgcgaagg	Protospacer
*   .. * ** ************* ******

193. spacer 37.2|5808959|32|CP029338|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 9, identity: 0.719

gggtggcctcaggcgccggccgggctcgaagg	CRISPR spacer
gccgcgccgcaggcgctggccgggctcggggc	Protospacer
*    *** *******.***********..* 

194. spacer 37.2|5808959|32|CP029338|CRISPRCasFinder matches to NZ_CP006369 (Aureimonas sp. AU20 plasmid pAU20b, complete sequence) position: , mismatch: 9, identity: 0.719

gggtggcctcaggcgccggccgggctcgaagg	CRISPR spacer
acggcgcttcaggcgctggccgggctcgtgcg	Protospacer
. *  **.********.*********** . *

195. spacer 37.2|5808959|32|CP029338|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 9, identity: 0.719

-----gggtggcctcaggcgccggccgggctcgaagg	CRISPR spacer
atcgtgga-----tcaggcgccggacggcctcgaagt	Protospacer
     **.     *********** *** ******* 

196. spacer 37.2|5808959|32|CP029338|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 9, identity: 0.719

gggtggcctcaggcgccggccgggctcgaagg	CRISPR spacer
gccgcgccgcaggcgctggccgggctcggggc	Protospacer
*    *** *******.***********..* 

197. spacer 9.2|2022994|32|CP029338|CRISPRCasFinder matches to NZ_CP017426 (Arthrobacter sp. ZXY-2 plasmid pZXY25, complete sequence) position: , mismatch: 10, identity: 0.688

acggtcaacggctacgccgccgactggaaaca	CRISPR spacer
ttcagcaacggcaacgcctccgactggaaggc	Protospacer
 . . ******* ***** **********.  

198. spacer 25.1|3929008|34|CP029338|CRT matches to MH045568 (Microbacterium phage Kieran, complete genome) position: , mismatch: 10, identity: 0.706

acctagcccgggcggcgcttgaggccgtctttcg	CRISPR spacer
gacccgcccggccggcgcatgaggccgtcggcgg	Protospacer
. *. ****** ****** **********  . *

199. spacer 25.1|3929008|34|CP029338|CRT matches to MN062717 (Microbacterium phage Sharkboy, complete genome) position: , mismatch: 10, identity: 0.706

acctagcccgggcggcgcttgaggccgtctttcg	CRISPR spacer
gacccgcccggccggcgcatgaggccgtcggcgg	Protospacer
. *. ****** ****** **********  . *

200. spacer 25.1|3929008|34|CP029338|CRT matches to NC_042099 (Microbacterium phage Dismas, complete genome) position: , mismatch: 10, identity: 0.706

acctagcccgggcggcgcttgaggccgtctttcg	CRISPR spacer
gacccgcccggccggcgcatgaggccgtcggcgg	Protospacer
. *. ****** ****** **********  . *

201. spacer 33.5|5116600|33|CP029338|CRISPRCasFinder matches to NC_006462 (Thermus thermophilus HB8 plasmid pTT27, complete sequence) position: , mismatch: 10, identity: 0.697

cgcctcggtcaccgtccgctcggcctcggcccg	CRISPR spacer
cgcctcggtcaccgtccgccccgcggtcacgaa	Protospacer
*******************.* **  . .*  .

202. spacer 33.5|5116600|33|CP029338|CRISPRCasFinder matches to NZ_AP019802 (Thermus thermophilus strain HC11 plasmid pHC11, complete sequence) position: , mismatch: 10, identity: 0.697

cgcctcggtcaccgtccgctcggcctcggcccg	CRISPR spacer
cgcctcggtcaccgtccgccccgcggtcacgaa	Protospacer
*******************.* **  . .*  .

203. spacer 33.5|5116600|33|CP029338|CRISPRCasFinder matches to MN234201 (Mycobacterium phage Guanica15, complete genome) position: , mismatch: 10, identity: 0.697

cgcctcggtcaccgtccgctcggcctcggcccg	CRISPR spacer
agcctcggtcgccgcccgctcggccgctttatc	Protospacer
 *********.***.********** *  . . 

204. spacer 37.2|5808959|32|CP029338|CRISPRCasFinder matches to NZ_CP032697 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525a, complete sequence) position: , mismatch: 10, identity: 0.688

gggtggcctcaggcgccggccgggctcgaagg	CRISPR spacer
aggtgacctcaggcaccggccgggcagtggca	Protospacer
.****.********.**********   .. .

205. spacer 37.2|5808959|32|CP029338|CRISPRCasFinder matches to NZ_CP032697 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525a, complete sequence) position: , mismatch: 10, identity: 0.688

gggtggcctcaggcgccggccgggctcgaagg	CRISPR spacer
aggtgacctcaggcaccggccgggcagtggca	Protospacer
.****.********.**********   .. .

206. spacer 37.2|5808959|32|CP029338|CRISPRCasFinder matches to NZ_CP032697 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525a, complete sequence) position: , mismatch: 10, identity: 0.688

gggtggcctcaggcgccggccgggctcgaagg	CRISPR spacer
aggtgacctcaggcaccggccgggcagtggca	Protospacer
.****.********.**********   .. .

207. spacer 37.2|5808959|32|CP029338|CRISPRCasFinder matches to NZ_CP024313 (Rhizobium sp. NXC24 plasmid pRspNXC24b, complete sequence) position: , mismatch: 10, identity: 0.688

gggtggcctcaggcgccggccgggctcgaagg	CRISPR spacer
aggtggtctcaggcaccggccgggcagtggca	Protospacer
.*****.*******.**********   .. .

208. spacer 37.2|5808959|32|CP029338|CRISPRCasFinder matches to NZ_CP024313 (Rhizobium sp. NXC24 plasmid pRspNXC24b, complete sequence) position: , mismatch: 10, identity: 0.688

gggtggcctcaggcgccggccgggctcgaagg	CRISPR spacer
aggtggtctcaggcaccggccgggcagtggca	Protospacer
.*****.*******.**********   .. .

209. spacer 33.4|5116525|42|CP029338|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.738

ggcccgcgcggcccgctcctcggcctccgccacggcgcgcgc	CRISPR spacer
cagcgtcgcggcgcgctcctcggccaccgccacggccgccgg	Protospacer
 . *  ****** ************ **********   ** 

210. spacer 33.5|5116600|33|CP029338|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.667

cgcctcggtcaccgtccgctcggcctcggcccg	CRISPR spacer
gatgcaggtcaccgtccgctcggccatggcgat	Protospacer
 .. . ******************* .***   

211. spacer 37.2|5808959|32|CP029338|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 11, identity: 0.656

gggtggcctcaggcgccggccgggctcgaagg	CRISPR spacer
atatggcctcattcgccggccgggcttcggcc	Protospacer
. .********  *************. ..  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3717646 : 3789136 53 Mycobacterium_phage(18.18%) integrase,protease,transposase,holin attL 3714691:3714706|attR 3729315:3729330
DBSCAN-SWA_2 6141298 : 6153827 12 Synechococcus_phage(50.0%) plate,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. CP029340
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage