Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP024809 Staphylococcus haemolyticus strain 83131A chromosome, complete genome 1 crisprs WYL,csa3,DEDDh,cas3,DinG 0 1 8 0
CP024810 Staphylococcus haemolyticus strain 83131A plasmid p83131A-A, complete sequence 0 crisprs csa3 0 0 0 0

Results visualization

1. CP024809
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP024809_1 1985916-1986002 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP024809_1 1.1|1985946|27|CP024809|CRISPRCasFinder 1985946-1985972 27 MN693238 Marine virus AFVG_25M402, complete genome 24675-24701 6 0.778

1. spacer 1.1|1985946|27|CP024809|CRISPRCasFinder matches to MN693238 (Marine virus AFVG_25M402, complete genome) position: , mismatch: 6, identity: 0.778

ccccaaccccagcctgctttgcttgtg	CRISPR spacer
taagaatcccagcctgcgttgcttgtg	Protospacer
.   **.********** *********

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1101975 : 1143860 35 Staphylococcus_phage(90.0%) tRNA,transposase NA
DBSCAN-SWA_2 1412377 : 1424414 13 uncultured_Mediterranean_phage(25.0%) NA NA
DBSCAN-SWA_3 1607692 : 1678006 82 Staphylococcus_phage(67.27%) portal,head,integrase,terminase,tail,tRNA,capsid,holin,transposase,protease attL 1645408:1645467|attR 1679975:1681301
DBSCAN-SWA_4 1888139 : 1896609 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_5 2123038 : 2136971 12 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_6 2151267 : 2159415 9 Pandoravirus(12.5%) transposase NA
DBSCAN-SWA_7 2222018 : 2273299 51 Staphylococcus_phage(42.86%) tRNA,transposase,integrase attL 2221918:2221977|attR 2269618:2270941
DBSCAN-SWA_8 2497518 : 2542604 47 Staphylococcus_phage(26.32%) transposase,integrase,terminase attL 2501587:2501646|attR 2545823:2546612
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage