Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP026111 Paraburkholderia terrae strain DSM 17804 chromosome 1, complete sequence 2 crisprs DEDDh,csa3,DinG,cas3,WYL 0 2 2 0
CP026113 Paraburkholderia terrae strain DSM 17804 chromosome 3, complete sequence 3 crisprs csa3,WYL 0 2 0 0
CP026114 Paraburkholderia terrae strain DSM 17804 chromosome 4, complete sequence 2 crisprs PD-DExK 0 0 0 0
CP026112 Paraburkholderia terrae strain DSM 17804 chromosome 2, complete sequence 4 crisprs csa3,DinG,cas3,WYL 2 4 1 0

Results visualization

1. CP026111
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026111_1 1261064-1261158 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026111_2 1951025-1951169 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP026111_1 1.1|1261098|27|CP026111|CRISPRCasFinder 1261098-1261124 27 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 200170-200196 4 0.852
CP026111_1 1.1|1261098|27|CP026111|CRISPRCasFinder 1261098-1261124 27 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 200292-200318 4 0.852
CP026111_1 1.1|1261098|27|CP026111|CRISPRCasFinder 1261098-1261124 27 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 200353-200379 4 0.852
CP026111_1 1.1|1261098|27|CP026111|CRISPRCasFinder 1261098-1261124 27 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 486501-486527 4 0.852
CP026111_1 1.1|1261098|27|CP026111|CRISPRCasFinder 1261098-1261124 27 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 508534-508560 5 0.815
CP026111_1 1.1|1261098|27|CP026111|CRISPRCasFinder 1261098-1261124 27 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 359977-360003 6 0.778
CP026111_2 2.1|1951049|37|CP026111|CRISPRCasFinder 1951049-1951085 37 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 200107-200143 8 0.784
CP026111_2 2.1|1951049|37|CP026111|CRISPRCasFinder 1951049-1951085 37 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 200229-200265 8 0.784
CP026111_2 2.1|1951049|37|CP026111|CRISPRCasFinder 1951049-1951085 37 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1856743-1856779 8 0.784
CP026111_2 2.1|1951049|37|CP026111|CRISPRCasFinder 1951049-1951085 37 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1036093-1036129 9 0.757
CP026111_2 2.1|1951049|37|CP026111|CRISPRCasFinder 1951049-1951085 37 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 768035-768071 9 0.757

1. spacer 1.1|1261098|27|CP026111|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852

gcaaatcaaacggcgacgcgtgaagcg	CRISPR spacer
gaacaccgaacggcgacgcgtgaagcg	Protospacer
* * *.*.*******************

2. spacer 1.1|1261098|27|CP026111|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852

gcaaatcaaacggcgacgcgtgaagcg	CRISPR spacer
gaacaccgaacggcgacgcgtgaagcg	Protospacer
* * *.*.*******************

3. spacer 1.1|1261098|27|CP026111|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.852

gcaaatcaaacggcgacgcgtgaagcg	CRISPR spacer
gaacaccgaacggcgacgcgtgaagcg	Protospacer
* * *.*.*******************

4. spacer 1.1|1261098|27|CP026111|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 4, identity: 0.852

gcaaatcaaacggcgacgcgtgaagcg	CRISPR spacer
gcaaatcaaacggtgacgcgcgaggag	Protospacer
*************.******.**.* *

5. spacer 1.1|1261098|27|CP026111|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaaatcaaacggcgacgcgtgaagcg	CRISPR spacer
taacaccgaacggcgacgcgtgaagcg	Protospacer
  * *.*.*******************

6. spacer 1.1|1261098|27|CP026111|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778

gcaaatcaaacggcgacgcgtgaagcg	CRISPR spacer
aaaccccgaacggcgacgcgtgaagcg	Protospacer
. *  .*.*******************

7. spacer 2.1|1951049|37|CP026111|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.784

tgccttcgtgcttcaagcgtcgccattcggtgtttta	CRISPR spacer
cgttagcgtgcttcaagcgtcgccgttcggtgttctg	Protospacer
.*..  ******************.*********.*.

8. spacer 2.1|1951049|37|CP026111|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.784

tgccttcgtgcttcaagcgtcgccattcggtgtttta	CRISPR spacer
cggtagcgtgcttcaagcgtcgccgttcggtgttctg	Protospacer
.* .  ******************.*********.*.

9. spacer 2.1|1951049|37|CP026111|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.784

tgccttcgtgcttcaagcgtcgccattcggtgtttta	CRISPR spacer
ggttagcgtgcttcaggcgtcgccgttcggtgttttg	Protospacer
 *..  *********.********.***********.

10. spacer 2.1|1951049|37|CP026111|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.757

tgccttcgtgcttcaagcgtcgccattcggtgtttta	CRISPR spacer
cgttagcgtgcttcacgcgtcgccgttcggtgtttgg	Protospacer
.*..  ********* ********.********** .

11. spacer 2.1|1951049|37|CP026111|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.757

tgccttcgtgcttcaagcgtcgccattcggtgtttta	CRISPR spacer
cgttagcgtgcttcacgcgtcgccgttcggtgttatc	Protospacer
.*..  ********* ********.********* * 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2752050 : 2760060 8 Enterobacteria_phage(42.86%) NA NA
DBSCAN-SWA_2 2919444 : 2932540 11 Pandoravirus(25.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP026112
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026112_1 1103867-1103946 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026112_2 1167095-1167173 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026112_3 2048739-2048826 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026112_4 2119629-2119710 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP026112_1 1.1|1103891|32|CP026112|CRISPRCasFinder 1103891-1103922 32 CP026112.1 1945996-1946027 0 1.0
CP026112_1 1.1|1103891|32|CP026112|CRISPRCasFinder 1103891-1103922 32 CP026112.1 1955423-1955454 0 1.0
CP026112_1 1.1|1103891|32|CP026112|CRISPRCasFinder 1103891-1103922 32 CP026112.1 1226743-1226774 1 0.969
CP026112_3 3.1|2048770|26|CP026112|CRISPRCasFinder 2048770-2048795 26 CP026112.1 2048009-2048034 2 0.923

1. spacer 1.1|1103891|32|CP026112|CRISPRCasFinder matches to position: 1945996-1946027, mismatch: 0, identity: 1.0

ccttcgtggcgcgggcggtttggtttttatgg	CRISPR spacer
ccttcgtggcgcgggcggtttggtttttatgg	Protospacer
********************************

2. spacer 1.1|1103891|32|CP026112|CRISPRCasFinder matches to position: 1955423-1955454, mismatch: 0, identity: 1.0

ccttcgtggcgcgggcggtttggtttttatgg	CRISPR spacer
ccttcgtggcgcgggcggtttggtttttatgg	Protospacer
********************************

3. spacer 1.1|1103891|32|CP026112|CRISPRCasFinder matches to position: 1226743-1226774, mismatch: 1, identity: 0.969

ccttcgtggcgcgggcggtttggtttttatgg	CRISPR spacer
ccttcatggcgcgggcggtttggtttttatgg	Protospacer
*****.**************************

4. spacer 3.1|2048770|26|CP026112|CRISPRCasFinder matches to position: 2048009-2048034, mismatch: 2, identity: 0.923

cgccctccggatgccagcgaaaaccc	CRISPR spacer
cgccctccggatgccagcgcaaaacc	Protospacer
******************* *** **

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP026112_4 4.1|2119652|36|CP026112|CRISPRCasFinder 2119652-2119687 36 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 895576-895611 3 0.917
CP026112_4 4.1|2119652|36|CP026112|CRISPRCasFinder 2119652-2119687 36 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 895752-895787 3 0.917
CP026112_4 4.1|2119652|36|CP026112|CRISPRCasFinder 2119652-2119687 36 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 198200-198235 3 0.917
CP026112_4 4.1|2119652|36|CP026112|CRISPRCasFinder 2119652-2119687 36 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1855979-1856014 3 0.917
CP026112_4 4.1|2119652|36|CP026112|CRISPRCasFinder 2119652-2119687 36 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 200404-200439 3 0.917
CP026112_3 3.1|2048770|26|CP026112|CRISPRCasFinder 2048770-2048795 26 GU903191 Escherichia phage vB_EcoM_ECO1230-10, complete genome 32039-32064 4 0.846
CP026112_3 3.1|2048770|26|CP026112|CRISPRCasFinder 2048770-2048795 26 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 1283723-1283748 5 0.808
CP026112_3 3.1|2048770|26|CP026112|CRISPRCasFinder 2048770-2048795 26 NC_032102 Enterobacter cloacae strain G6809 plasmid pG6809-1, complete sequence 88499-88524 5 0.808
CP026112_4 4.1|2119652|36|CP026112|CRISPRCasFinder 2119652-2119687 36 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 726333-726368 5 0.861
CP026112_4 4.1|2119652|36|CP026112|CRISPRCasFinder 2119652-2119687 36 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 726392-726427 5 0.861
CP026112_1 1.1|1103891|32|CP026112|CRISPRCasFinder 1103891-1103922 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1749012-1749043 7 0.781
CP026112_1 1.1|1103891|32|CP026112|CRISPRCasFinder 1103891-1103922 32 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1653749-1653780 7 0.781
CP026112_1 1.1|1103891|32|CP026112|CRISPRCasFinder 1103891-1103922 32 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 1049601-1049632 8 0.75
CP026112_1 1.1|1103891|32|CP026112|CRISPRCasFinder 1103891-1103922 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 2242603-2242634 8 0.75
CP026112_2 2.1|1167118|33|CP026112|CRISPRCasFinder 1167118-1167150 33 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 2242659-2242691 9 0.727
CP026112_2 2.1|1167118|33|CP026112|CRISPRCasFinder 1167118-1167150 33 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 1049600-1049632 10 0.697

1. spacer 4.1|2119652|36|CP026112|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 3, identity: 0.917

gtgcttcacgcgtcgcccctgtacgtttgccttttc	CRISPR spacer
gtgcttcacgcgtcgcccctgtgcgcttgcctttgc	Protospacer
**********************.**.******** *

2. spacer 4.1|2119652|36|CP026112|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 3, identity: 0.917

gtgcttcacgcgtcgcccctgtacgtttgccttttc	CRISPR spacer
gtgcttcacgcgtcgcccctgtgcgcttgcctttgc	Protospacer
**********************.**.******** *

3. spacer 4.1|2119652|36|CP026112|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.917

gtgcttcacgcgtcgcccctgtacgtttgccttttc	CRISPR spacer
gtgcttcaggcgtcgcccctgtgcgtttgcctttgc	Protospacer
******** *************.*********** *

4. spacer 4.1|2119652|36|CP026112|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.917

gtgcttcacgcgtcgcccctgtacgtttgccttttc	CRISPR spacer
gtacttcacgcgtcgcccctgtgcgtttgcctttgc	Protospacer
**.*******************.*********** *

5. spacer 4.1|2119652|36|CP026112|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.917

gtgcttcacgcgtcgcccctgtacgtttgccttttc	CRISPR spacer
gtgcttcaggcgtcgcccctgtgcgtttgcctttgc	Protospacer
******** *************.*********** *

6. spacer 3.1|2048770|26|CP026112|CRISPRCasFinder matches to GU903191 (Escherichia phage vB_EcoM_ECO1230-10, complete genome) position: , mismatch: 4, identity: 0.846

cgccctccggatgccagcgaaaaccc	CRISPR spacer
ctgcctctggatgccagcgtaaaccc	Protospacer
*  ****.*********** ******

7. spacer 3.1|2048770|26|CP026112|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.808

cgccctccggatgccagcgaaaaccc	CRISPR spacer
cgtaacgcggatgccagcgaaaaccc	Protospacer
**.  . *******************

8. spacer 3.1|2048770|26|CP026112|CRISPRCasFinder matches to NC_032102 (Enterobacter cloacae strain G6809 plasmid pG6809-1, complete sequence) position: , mismatch: 5, identity: 0.808

cgccctccggatgccagcgaaaaccc	CRISPR spacer
gtccctccggatttcagcgaaaaccg	Protospacer
  ********** .*********** 

9. spacer 4.1|2119652|36|CP026112|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.861

gtgcttcacgcgtcgcccctgtacgtttgccttttc	CRISPR spacer
tcgcttcacgcgtcgcccctgtgcgtttgccgttgc	Protospacer
 .********************.******** ** *

10. spacer 4.1|2119652|36|CP026112|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.861

gtgcttcacgcgtcgcccctgtacgtttgccttttc	CRISPR spacer
tcgcttcacgcgtcgcccctgtgcgtttgccgttgc	Protospacer
 .********************.******** ** *

11. spacer 1.1|1103891|32|CP026112|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781

ccttcgtggcgcgggcggtttggtttttatgg	CRISPR spacer
aagtcgtggcgcggccggtttggatttttggg	Protospacer
   *********** ******** ****  **

12. spacer 1.1|1103891|32|CP026112|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 7, identity: 0.781

ccttcgtggcgcgggcggtttggtttttatgg	CRISPR spacer
cctcggtggcgcgggcggtttggttggcgagg	Protospacer
***. ********************  .. **

13. spacer 1.1|1103891|32|CP026112|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75

ccttcgtggcgcgggcggtttggtttttatgg	CRISPR spacer
aattcgtggcgcggccggtttggattttgctt	Protospacer
  ************ ******** ****..  

14. spacer 1.1|1103891|32|CP026112|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

ccttcgtggcgcgggcggtttggtttttatgg	CRISPR spacer
gcttcgcggcgcgggcggtttgttttgctcgt	Protospacer
 *****.*************** *** . .* 

15. spacer 2.1|1167118|33|CP026112|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

ggcaaagaaaccaaactggccgcgccacgaagg	CRISPR spacer
actagaacaaccaaaccggccgcgccgcgaagc	Protospacer
. .*.*. ********.*********.***** 

16. spacer 2.1|1167118|33|CP026112|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.697

ggcaaagaaaccaaactggccgcgccacgaagg	CRISPR spacer
aaagcaaaatccaaaccggccgcgccacgaatt	Protospacer
.. . *.** ******.**************  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1970119 : 2035951 68 Staphylococcus_phage(12.0%) tail,holin,terminase,portal,head NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. CP026114
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026114_1 755729-755823 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026114_2 755887-755947 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. CP026113
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026113_1 358707-358787 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026113_2 793638-793728 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026113_4 1930513-1930633 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP026113_2 2.1|793668|31|CP026113|CRISPRCasFinder 793668-793698 31 NC_010625 Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence 1079673-1079703 2 0.935
CP026113_2 2.1|793668|31|CP026113|CRISPRCasFinder 793668-793698 31 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 270527-270557 3 0.903
CP026113_2 2.1|793668|31|CP026113|CRISPRCasFinder 793668-793698 31 NC_010625 Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence 225412-225442 4 0.871
CP026113_2 2.1|793668|31|CP026113|CRISPRCasFinder 793668-793698 31 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 359254-359284 4 0.871
CP026113_2 2.1|793668|31|CP026113|CRISPRCasFinder 793668-793698 31 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1271644-1271674 4 0.871
CP026113_3 3.1|1575762|59|CP026113|CRISPRCasFinder 1575762-1575820 59 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 188893-188951 5 0.915
CP026113_2 2.1|793668|31|CP026113|CRISPRCasFinder 793668-793698 31 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 769956-769986 6 0.806
CP026113_3 3.1|1575762|59|CP026113|CRISPRCasFinder 1575762-1575820 59 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 1976710-1976768 6 0.898
CP026113_3 3.1|1575762|59|CP026113|CRISPRCasFinder 1575762-1575820 59 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 1723991-1724049 6 0.898
CP026113_3 3.1|1575762|59|CP026113|CRISPRCasFinder 1575762-1575820 59 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1856615-1856673 6 0.898
CP026113_3 3.1|1575762|59|CP026113|CRISPRCasFinder 1575762-1575820 59 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1348357-1348415 6 0.898
CP026113_3 3.1|1575762|59|CP026113|CRISPRCasFinder 1575762-1575820 59 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1461100-1461158 6 0.898
CP026113_2 2.1|793668|31|CP026113|CRISPRCasFinder 793668-793698 31 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1531748-1531778 7 0.774
CP026113_2 2.1|793668|31|CP026113|CRISPRCasFinder 793668-793698 31 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1314646-1314676 7 0.774
CP026113_2 2.1|793668|31|CP026113|CRISPRCasFinder 793668-793698 31 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 768111-768141 7 0.774
CP026113_3 3.1|1575762|59|CP026113|CRISPRCasFinder 1575762-1575820 59 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 9378-9436 7 0.881
CP026113_3 3.1|1575762|59|CP026113|CRISPRCasFinder 1575762-1575820 59 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 507744-507802 7 0.881
CP026113_3 3.1|1575762|59|CP026113|CRISPRCasFinder 1575762-1575820 59 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1036204-1036262 7 0.881
CP026113_3 3.1|1575762|59|CP026113|CRISPRCasFinder 1575762-1575820 59 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1316864-1316922 7 0.881

1. spacer 2.1|793668|31|CP026113|CRISPRCasFinder matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 2, identity: 0.935

ctgaagcacgaaggcaaatcgcggatgccaa	CRISPR spacer
acgaagcacgaaggcaaatcgcggatgccaa	Protospacer
 .*****************************

2. spacer 2.1|793668|31|CP026113|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.903

ctgaagcacgaaggcaaatcgcggatgccaa	CRISPR spacer
gtgaagcacgaaggcaaatcgcggatgcccg	Protospacer
 **************************** .

3. spacer 2.1|793668|31|CP026113|CRISPRCasFinder matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 4, identity: 0.871

ctgaagcacgaaggcaaatcgcggatgccaa	CRISPR spacer
atgaagcccgaaggcaaaacgcggatgccag	Protospacer
 ****** ********** ***********.

4. spacer 2.1|793668|31|CP026113|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.871

ctgaagcacgaaggcaaatcgcggatgccaa	CRISPR spacer
atgaagcacgaaagcaaatcgcggatgcctg	Protospacer
 ***********.**************** .

5. spacer 2.1|793668|31|CP026113|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.871

ctgaagcacgaaggcaaatcgcggatgccaa	CRISPR spacer
ttgaagcacgaaggcaaaatgcggatgccag	Protospacer
.***************** .**********.

6. spacer 3.1|1575762|59|CP026113|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.915

tttttggcatccgcgttacgttagcctgcttcaggcgtcgcccctgtgcggggcggcag	CRISPR spacer
tcgctggcatccgcgttacgttagcgtgcttcaggcgtcgcccctgtgcggggcggcac	Protospacer
*. .********************* ******************************** 

7. spacer 2.1|793668|31|CP026113|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.806

ctgaagcacgaaggcaaatcgcggatgccaa	CRISPR spacer
ccgctgcgcgaaggcaaaacgcggatgccag	Protospacer
*.*  **.********** ***********.

8. spacer 3.1|1575762|59|CP026113|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.898

tttttggcatccgcgttacgttagcctgcttcaggcgtcgcccctgtgcggggcggcag	CRISPR spacer
tcgctggcatccgcgttgcgttagcgtgcttcaggcgtcgcccctgtgcggggcggcac	Protospacer
*. .*************.******* ******************************** 

9. spacer 3.1|1575762|59|CP026113|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.898

tttttggcatccgcgttacgttagcctgcttcaggcgtcgcccctgtgcggggcggcag	CRISPR spacer
tcgctggcatccgcgttacgttagctcgcttcaggcgtcgcccctgtgcggggcggcac	Protospacer
*. .*********************..******************************* 

10. spacer 3.1|1575762|59|CP026113|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.898

tttttggcatccgcgttacgttagcctgcttcaggcgtcgcccctgtgcggggcggcag	CRISPR spacer
gcgctggcatccgcgttacgttagcgtgcttcaggcgtcgcccctgtgcggggcggcac	Protospacer
 . .********************* ******************************** 

11. spacer 3.1|1575762|59|CP026113|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.898

tttttggcatccgcgttacgttagcctgcttcaggcgtcgcccctgtgcggggcggcag	CRISPR spacer
gtgctggcatccgcgttacgttagcgtgcttcacgcgtcgcccctgtgcggggcggcac	Protospacer
 * .********************* ******* ************************ 

12. spacer 3.1|1575762|59|CP026113|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.898

tttttggcatccgcgttacgttagcctgcttcaggcgtcgcccctgtgcggggcggcag	CRISPR spacer
tcgctggcatccgcgttacgttagcgtgcttcacgcgtcgcccctgtgcggggcggcac	Protospacer
*. .********************* ******* ************************ 

13. spacer 2.1|793668|31|CP026113|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774

ctgaagcacgaaggcaaatcgcggatgccaa	CRISPR spacer
tgccagcgcaaaggcaaatcgcggatgccag	Protospacer
.   ***.*.********************.

14. spacer 2.1|793668|31|CP026113|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774

ctgaagcacgaaggcaaatcgcggatgccaa	CRISPR spacer
ccgccccgcgagggcaaatcgcggatgccag	Protospacer
*.*   *.***.******************.

15. spacer 2.1|793668|31|CP026113|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.774

ctgaagcacgaaggcaaatcgcggatgccaa	CRISPR spacer
ccgctccgcgaaggcaaagcgcggatgccag	Protospacer
*.*   *.********** ***********.

16. spacer 3.1|1575762|59|CP026113|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.881

tttttggcatccgcgttacgttagcctgcttcaggcgtcgcccctgtgcggggcggcag	CRISPR spacer
gcgctggcatccgcgttacgttagctcgcttcaggcgtcgcccctgtgcggggcggcac	Protospacer
 . .*********************..******************************* 

17. spacer 3.1|1575762|59|CP026113|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.881

tttttggcatccgcgttacgttagcctgcttcaggcgtcgcccctgtgcggggcggcag	CRISPR spacer
gcgctggcatccgcgttacgttagcgtgcttcacgcgtcgcccctgtgcggggcggcac	Protospacer
 . .********************* ******* ************************ 

18. spacer 3.1|1575762|59|CP026113|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.881

tttttggcatccgcgttacgttagcctgcttcaggcgtcgcccctgtgcggggcggcag	CRISPR spacer
gcgctggcatccgcgttacgttagcgtgcttcacgcgtcgcccctgtgcggggcggcac	Protospacer
 . .********************* ******* ************************ 

19. spacer 3.1|1575762|59|CP026113|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.881

tttttggcatccgcgttacgttagcctgcttcaggcgtcgcccctgtgcggggcggcag	CRISPR spacer
gcgctggcatccgcgtttcgttagcgtgcttcaggcgtcgcccctgtgcggggcggcac	Protospacer
 . .************* ******* ******************************** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage