Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP026129 Acinetobacter baumannii strain ABNIH28 plasmid pABA-2f10, complete sequence 0 crisprs NA 0 0 1 0
CP026127 Acinetobacter baumannii strain ABNIH28 plasmid pNDM-0285, complete sequence 0 crisprs NA 0 0 3 0
CP026128 Acinetobacter baumannii strain ABNIH28 plasmid pABA-1fe1, complete sequence 0 crisprs DEDDh 0 0 2 0
CP026125 Acinetobacter baumannii strain ABNIH28 chromosome, complete genome 2 crisprs DEDDh,RT,csa3,cas3,WYL,TnsE_C 0 1 11 0
CP026126 Acinetobacter baumannii strain ABNIH28 plasmid pABA-6973, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. CP026129
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 13020 : 68846 49 Acinetobacter_phage(25.0%) transposase,integrase,protease attL 12972:13031|attR 74994:76501
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP026127
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 3425 3 Geobacillus_virus(100.0%) NA NA
DBSCAN-SWA_2 7813 : 24576 18 Moraxella_phage(14.29%) transposase NA
DBSCAN-SWA_3 29801 : 30491 1 Mycobacterium_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. CP026128
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 80730 77 Salmonella_phage(31.58%) terminase,capsid,transposase,tail NA
DBSCAN-SWA_2 84574 : 105698 23 Rhizobium_phage(25.0%) transposase,integrase attL 76368:76384|attR 99700:99716
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. CP026125
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026125_3 976469-976580 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026125_4 1256917-1257058 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP026125_1 1.2|637955|25|CP026125|CRISPRCasFinder 637955-637979 25 AP013861 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C15H-MedDCM-OCT-S40-C106, *** SEQUENCING IN PROGRESS *** 15391-15415 3 0.88
CP026125_1 1.2|637955|25|CP026125|CRISPRCasFinder 637955-637979 25 NC_010630 Nostoc punctiforme PCC 73102 plasmid pNPUN03, complete sequence 18448-18472 3 0.88
CP026125_1 1.2|637955|25|CP026125|CRISPRCasFinder 637955-637979 25 MN856032 Bacteriophage sp. isolate 242, complete genome 4970-4994 4 0.84
CP026125_1 1.2|637955|25|CP026125|CRISPRCasFinder 637955-637979 25 NC_015937 Thermus phage TMA, complete genome 130919-130943 4 0.84
CP026125_1 1.2|637955|25|CP026125|CRISPRCasFinder 637955-637979 25 MN693192 Marine virus AFVG_25M42, complete genome 30603-30627 4 0.84
CP026125_1 1.2|637955|25|CP026125|CRISPRCasFinder 637955-637979 25 GU071095 Synechococcus phage S-SM2, complete genome 177140-177164 4 0.84
CP026125_1 1.2|637955|25|CP026125|CRISPRCasFinder 637955-637979 25 AP011617 Thermus phage TMA DNA, complete genome 130919-130943 4 0.84

1. spacer 1.2|637955|25|CP026125|CRISPRCasFinder matches to AP013861 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C15H-MedDCM-OCT-S40-C106, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.88

ctggttattttgttgctgttgatta	CRISPR spacer
ctggtaattttgttactgttgattt	Protospacer
***** ********.********* 

2. spacer 1.2|637955|25|CP026125|CRISPRCasFinder matches to NC_010630 (Nostoc punctiforme PCC 73102 plasmid pNPUN03, complete sequence) position: , mismatch: 3, identity: 0.88

ctggttattttgttgctgttgatta	CRISPR spacer
caggctattttgttgctgctgatta	Protospacer
* **.*************.******

3. spacer 1.2|637955|25|CP026125|CRISPRCasFinder matches to MN856032 (Bacteriophage sp. isolate 242, complete genome) position: , mismatch: 4, identity: 0.84

ctggttattttgttgctgttgatta	CRISPR spacer
tggtttattttgttgctgttgaata	Protospacer
. * ****************** **

4. spacer 1.2|637955|25|CP026125|CRISPRCasFinder matches to NC_015937 (Thermus phage TMA, complete genome) position: , mismatch: 4, identity: 0.84

ctggttattttgttgctgttgatta	CRISPR spacer
caaattattttgttgcttttgatta	Protospacer
* ..************* *******

5. spacer 1.2|637955|25|CP026125|CRISPRCasFinder matches to MN693192 (Marine virus AFVG_25M42, complete genome) position: , mismatch: 4, identity: 0.84

ctggttattttgttgctgttgatta	CRISPR spacer
gtggttcttttgttgcttttgattc	Protospacer
 ***** ********** ****** 

6. spacer 1.2|637955|25|CP026125|CRISPRCasFinder matches to GU071095 (Synechococcus phage S-SM2, complete genome) position: , mismatch: 4, identity: 0.84

ctggttattttgttgctgttgatta	CRISPR spacer
caccttattttgttgctattgatta	Protospacer
*   *************.*******

7. spacer 1.2|637955|25|CP026125|CRISPRCasFinder matches to AP011617 (Thermus phage TMA DNA, complete genome) position: , mismatch: 4, identity: 0.84

ctggttattttgttgctgttgatta	CRISPR spacer
caaattattttgttgcttttgatta	Protospacer
* ..************* *******

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 89879 : 157255 58 Escherichia_phage(19.05%) terminase,transposase,integrase attL 118659:118677|attR 143710:143728
DBSCAN-SWA_2 231587 : 293270 56 Planktothrix_phage(16.67%) protease,transposase,tRNA NA
DBSCAN-SWA_3 339217 : 424347 101 Acinetobacter_phage(60.32%) terminase,integrase,capsid,head,lysis,transposase,tail,tRNA attL 371920:371940|attR 421626:421646
DBSCAN-SWA_4 447204 : 510520 63 Acinetobacter_phage(28.57%) head,transposase,integrase,tRNA attL 475023:475038|attR 513444:513459
DBSCAN-SWA_5 744795 : 794405 49 Paenibacillus_phage(33.33%) integrase,transposase,holin,tRNA attL 744714:744773|attR 787083:787950
DBSCAN-SWA_6 1697629 : 1711803 13 Acinetobacter_phage(72.73%) transposase NA
DBSCAN-SWA_7 1724006 : 1760858 45 Acinetobacter_phage(73.53%) head NA
DBSCAN-SWA_8 2017562 : 2054210 28 Bacillus_phage(22.22%) protease,transposase,tRNA NA
DBSCAN-SWA_9 2272949 : 2334263 53 Enterobacteria_phage(25.0%) transposase,tRNA NA
DBSCAN-SWA_10 2617707 : 2678992 57 Escherichia_phage(13.33%) transposase,holin NA
DBSCAN-SWA_11 3107155 : 3162907 46 uncultured_Caudovirales_phage(14.29%) transposase,tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage