Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP025979 Escherichia marmotae strain HT073016 chromosome, complete genome 3 crisprs DinG,DEDDh,cas3,RT,cas6f,cas7f,cas5f,cas8f,cas3f,cas1,csa3 0 3 19 0
CP025981 Escherichia marmotae strain HT073016 plasmid pEM76, complete sequence 0 crisprs NA 0 0 0 0
CP025980 Escherichia marmotae strain HT073016 plasmid pEM148, complete sequence 0 crisprs NA 0 0 1 0

Results visualization

1. CP025979
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025979_1 727000-727123 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025979_2 1505939-1506082 TypeI-F I-F
2 spacers
cas1,cas3f,cas8f,cas5f,cas7f,cas6f

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025979_3 1631652-1631796 Orphan NA
1 spacers
RT

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP025979_1 1.1|727043|38|CP025979|CRISPRCasFinder 727043-727080 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP023355 Escherichia coli strain 746 plasmid p72, complete sequence 23645-23678 2 0.941
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP031899 Escherichia coli O113:H21 strain FWSEC0010 plasmid unnamed1, complete sequence 155873-155906 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP030765 Escherichia coli strain 2017C-4109 plasmid p2017C-4109, complete sequence 75238-75271 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_KY416992 Escherichia coli strain FAM21805 plasmid unnamed, complete sequence 110974-111007 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NC_017627 Escherichia coli 042 plasmid pAA, complete sequence 91048-91081 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_MG569891 Shigella sonnei strain DE105 plasmid pDE105, complete sequence 70456-70489 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_KU664810 Escherichia coli strain 11.3-R3 plasmid pCERC5, complete sequence 96907-96940 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_KY007017 Escherichia coli strain 14.3-R4 plasmid pCERC9, complete sequence 90210-90243 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_KU254579 Escherichia coli strain YD786 plasmid pYD786-2, complete sequence 45846-45879 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP025861 Escherichia coli strain 504239 plasmid p504239_155, complete sequence 70480-70513 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP025912 Escherichia coli strain 204446 plasmid p204446_92, complete sequence 83148-83181 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 KR827684 Escherichia coli plasmid pCERC3, complete sequence 106437-106470 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP045864 Escherichia coli O157:H7 strain ATCC 43890 plasmid p1CFSAN076619, complete sequence 18755-18788 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_KT779550 Escherichia coli strain 369 plasmid p369, complete sequence 50782-50815 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_KT845955 Escherichia coli strain EP28 plasmid pHNEP28_cfr, complete sequence 84743-84776 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_KM052220 Escherichia coli strain H18 Hel20 TF1 plasmid pTF_H18 Hel20 TF1, complete sequence 6485-6518 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_KP789020 Escherichia coli strain WCHEC13-8 plasmid pCTXM15, complete sequence 77094-77127 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP042631 Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-4, complete sequence 85213-85246 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP010232 Escherichia coli strain S30 plasmid A, complete sequence 70190-70223 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP010233 Escherichia coli strain S30 plasmid B, complete sequence 121626-121659 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP023850 Escherichia coli strain 4/0 plasmid p4_0.1, complete sequence 43352-43385 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_AP017611 Escherichia coli strain 20Ec-P-124 plasmid pMRY16-002_1, complete sequence 131403-131436 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP042337 Escherichia coli strain GZ04-0086 plasmid pCTXM-GZ04, complete sequence 120843-120876 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP015816 Escherichia coli O157:H7 strain JEONG-1266 plasmid p0157, complete sequence 64819-64852 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_AP023192 Escherichia coli strain TUM18530 plasmid pMTY18530-2, complete sequence 92486-92519 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP028608 Escherichia coli strain 143 plasmid pTA143, complete sequence 71582-71615 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP010158 Escherichia coli strain D10 plasmid A, complete genome 35994-36027 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP025844 Escherichia coli strain 720632 plasmid p720632_94, complete sequence 38721-38754 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_AP017618 Escherichia coli strain MRY15-117 plasmid pMRY15-117_1, complete sequence 47127-47160 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 CP054336 Escherichia coli strain SCU-120 plasmid pSCU-120-1, complete sequence 101897-101930 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP013193 Escherichia coli strain FORC_031 plasmid pFORC31.3, complete sequence 10136-10169 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP010209 Escherichia coli strain M11 plasmid C, complete sequence 32613-32646 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP028587 Escherichia coli strain WCHEC4533 plasmid pCTXM15_000533, complete sequence 131979-132012 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP042600 Escherichia coli strain NCYU-29-69 plasmid pNCYU-29-69-1, complete sequence 74745-74778 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP023348 Escherichia coli strain ETEC-2265 plasmid unnamed2, complete sequence 48143-48176 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP024225 Escherichia coli O169:H41 strain 2014EL-1345-2 plasmid unnamed2 666-699 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP024227 Escherichia coli O169:H41 strain 2014EL-1345-2 plasmid unnamed4, complete sequence 137905-137938 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP048331 Escherichia coli strain 10 plasmid p010_A, complete sequence 93191-93224 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP049350 Escherichia coli strain 3R plasmid p3R-2, complete sequence 33925-33958 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP021087 Escherichia coli strain 13P460A plasmid p13P460A-2, complete sequence 130556-130589 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP011135 Escherichia coli VR50 plasmid pVR50A, complete sequence 37449-37482 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP024468 Shigella dysenteriae strain BU53M1 plasmid pBU53M1, complete sequence 107778-107811 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP053732 Escherichia coli strain CP55_Sichuan plasmid pCP55-IncFIB, complete sequence 131930-131963 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NC_023315 Escherichia coli strain EQ011 plasmid pEQ011, complete sequence 55852-55885 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 LN850163 Escherichia coli plasmid pI1-34TF, strain I1-34 42283-42316 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 CP043738 Escherichia coli strain CVM N17EC0616 plasmid pN17EC0616-2, complete sequence 26228-26261 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP022688 Escherichia coli strain CDC#03-98 plasmid p0157, complete sequence 26682-26715 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP010317 Escherichia coli strain 789 plasmid pAPEC-O78-2 44058-44091 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_LS999561 Escherichia coli isolate EC-TO143 plasmid 2, complete sequence 90107-90140 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_LS992167 Escherichia coli isolate Escherichia coli str. TO6 plasmid 2, complete sequence 22137-22170 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NC_010488 Escherichia coli SMS-3-5 plasmid pSMS35_130, complete sequence 44398-44431 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP020494 Salmonella enterica subsp. enterica strain 08-00436 plasmid pSE08-00436-2, complete sequence 25465-25498 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP024276 Escherichia coli O6:H16 strain M9682-C1 plasmid unnamed1 9002-9035 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP012627 Escherichia coli strain SF-468 plasmid pSF-468-2, complete sequence 76592-76625 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NC_009788 Escherichia coli O139:H28 str. E24377A plasmid pETEC_73, complete sequence 1388-1421 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP034739 Escherichia coli strain L65 plasmid pL65-2, complete sequence 144012-144045 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 MT077881 Escherichia coli plasmid p2, complete sequence 129241-129274 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP054369 Escherichia coli strain SCU-115 plasmid pSCU-115-1, complete sequence 126698-126731 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP054364 Escherichia coli strain SCU-171 plasmid pSCU-171-1, complete sequence 107784-107817 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP013836 Escherichia coli strain JJ1897 plasmid pJJ1897_1, complete sequence 43307-43340 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP024248 Escherichia coli O27:H7 strain B4103-1 plasmid unnamed3, complete sequence 37536-37569 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP019253 Escherichia coli strain 13KWH46 plasmid p13KWH46-3, complete sequence 55551-55584 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP019276 Escherichia coli strain 13P477T plasmid p13P477T-3, complete sequence 83079-83112 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP019276 Escherichia coli strain 13P477T plasmid p13P477T-3, complete sequence 9824-9857 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 MT077880 Escherichia coli plasmid p1, complete sequence 132655-132688 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 CP051693 Escherichia coli strain SCU-318 plasmid pSCU-318-1, complete sequence 3997-4030 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP041621 Shigella flexneri strain C32 plasmid pC32_2, complete sequence 39095-39128 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP045189 Escherichia coli strain NT1F31 plasmid pNT1F31-96kb, complete sequence 19125-19158 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP015847 Escherichia coli O157:H7 strain FRIK2069 plasmid p0157, complete sequence 82896-82929 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP024285 Escherichia albertii strain 2014C-4356 plasmid unnamed3, complete sequence 30013-30046 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP027327 Escherichia coli strain 2013C-4830 plasmid unnamed2, complete sequence 89999-90032 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP028118 Escherichia coli O111 str. RM9322 plasmid pRM9322-1, complete sequence 10139-10172 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP019248 Escherichia coli strain Combat13F7 plasmid pCombat13F7-3, complete sequence 52008-52041 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP019261 Escherichia coli strain 13C1065T plasmid p13C1065T-2, complete sequence 70054-70087 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP029243 Escherichia coli strain ECCRA-119 plasmid pTB201, complete sequence 60128-60161 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP031548 Escherichia coli strain cq9 plasmid unnamed2, complete sequence 204724-204757 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP014096 Shigella sonnei strain FDAARGOS_90 plasmid unnamed1, complete sequence 40304-40337 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP014966 Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2010K-1587 plasmid pSTY1-2010K-1587, complete sequence 172442-172475 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP021341 Escherichia coli strain 95NR1 plasmid p95NR1B, complete sequence 31409-31442 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP021337 Escherichia coli strain 95JB1 plasmid p95JB1B, complete sequence 31409-31442 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP024718 Escherichia coli strain LS4 plasmid p1LS4, complete sequence 104583-104616 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP027375 Escherichia coli strain 05-3629 plasmid unnamed2, complete sequence 26211-26244 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP028382 Escherichia coli strain RM10466 plasmid pRM10466-1, complete sequence 74125-74158 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP029748 Escherichia coli strain 2016C-3878 plasmid pMCR1-PA, complete sequence 219716-219749 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP044146 Escherichia coli O157 strain AR-0428 plasmid pAR-0428-1, complete sequence 66226-66259 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP023351 Escherichia coli strain ETEC-2264 plasmid unnamed2, complete sequence 50301-50334 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP024721 Escherichia coli isolate NQ3 plasmid p1NQ3, complete sequence 81401-81434 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP027384 Escherichia coli strain 2013C-3250 plasmid unnamed4 23253-23286 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP027385 Escherichia coli strain 2013C-3250 plasmid unnamed5, complete sequence 7160-7193 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP012632 Escherichia coli strain SF-173 plasmid pSF-173-1, complete sequence 24568-24601 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP032397 Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 plasmid p22429, complete sequence 199159-199192 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP027130 Escherichia coli strain AR_0372 plasmid unnamed1, complete sequence 125240-125273 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP049355 Escherichia coli strain T28R plasmid pT28R-2, complete sequence 138044-138077 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP047380 Escherichia coli strain CAU16175 plasmid pCAU16175_2, complete sequence 144542-144575 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP038375 Escherichia coli O157:H7 strain F3113 plasmid pF3113-1, complete sequence 50150-50183 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP033091 Escherichia coli DSM 30083 = JCM 1649 = ATCC 11775 plasmid unnamed, complete sequence 93842-93875 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 LT906556 Escherichia coli isolate E. coli RL465 genome assembly, plasmid: I 131662-131695 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP044139 Escherichia coli O157 strain AR-0430 plasmid pAR-0430-3, complete sequence 91909-91942 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP017250 Escherichia coli strain NADC 5570/86-24/6565 isolate mutant plasmid pO157, complete sequence 71480-71513 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP032264 Escherichia coli strain AR_0089 plasmid unnamed2, complete sequence 86113-86146 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP053232 Escherichia coli strain SCU-306 plasmid pSCU-306-1, complete sequence 123068-123101 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP053236 Escherichia coli strain SCU-106 plasmid pSCU-106-2, complete sequence 81017-81050 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP013832 Escherichia coli strain CD306 plasmid pCD306, complete sequence 124677-124710 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP041420 Escherichia coli strain STEC711 plasmid pSTEC711_4, complete sequence 11907-11940 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP049937 Escherichia coli strain JL05 plasmid pARG01, complete sequence 66522-66555 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP038332 Escherichia coli O157:H7 strain NE 1092-2 plasmid pNE1092-1, complete sequence 73965-73998 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP038308 Escherichia coli O157:H7 strain SS NE 1040-1 plasmid pNE1040-1, complete sequence 73983-74016 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP038299 Escherichia coli O157:H7 strain TB182A plasmid pTB182A-5, complete sequence 11411-11444 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP038314 Escherichia coli O157:H7 strain OK1 plasmid pOK1-1, complete sequence 46921-46954 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP019018 Escherichia coli strain Ecol_244 plasmid pEC244_2, complete sequence 112463-112496 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP042619 Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-4, complete sequence 73993-74026 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP011916 Escherichia coli strain PSUO2 plasmid pPSUO2, complete sequence 17727-17760 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP019456 Escherichia coli strain FHI_NMBU_03 plasmid pFHI_NMBU_03_1, complete sequence 158926-158959 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP041436 Escherichia coli strain STEC309 plasmid pSTEC309, complete sequence 46516-46549 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP018994 Escherichia coli strain Ecol_AZ147 plasmid pECAZ147_1, complete sequence 71011-71044 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP038323 Escherichia coli O157:H7 strain NE1127 plasmid pNE1127-1, complete sequence 71556-71589 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP038413 Escherichia coli O157:H7 strain 493/89 plasmid p493-89-1, complete sequence 72768-72801 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 LC019731 Escherichia coli plasmid pCMY2 DNA, complete sequence, strain: TVGHEC01 52594-52627 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP015239 Escherichia coli strain 2011C-3911 plasmid unnamed1, complete sequence 100396-100429 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP043415 Escherichia coli strain EC42405 plasmid pNTEC2-42405, complete sequence 106530-106563 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP011019 Escherichia coli strain CI5 plasmid unnamed, complete sequence 144926-144959 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP034796 Escherichia coli strain 08-3918 plasmid p08-3918-1, complete sequence 17212-17245 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 AP014654 Escherichia coli O169:H41 plasmid pEntYN10 DNA, complete sequence 101558-101591 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP012500 Escherichia coli strain 09-00049 plasmid pCFSAN004180G, complete sequence 88291-88324 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 CP031283 Escherichia fergusonii strain 40A plasmid p150_40A, complete sequence 133062-133095 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP047878 Escherichia coli strain LD22-1 plasmid pLD22-1-135kb, complete sequence 120416-120449 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_AP018805 Escherichia coli strain E2863 plasmid pE2863-3, complete sequence 39799-39832 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP046718 Escherichia coli strain T16R plasmid pT16R-2, complete sequence 147266-147299 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP041303 Escherichia coli strain MSHS 133 plasmid pCys-11, complete sequence 7935-7968 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP010181 Escherichia coli strain M1 plasmid A, complete sequence 180640-180673 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP024852 Escherichia coli strain AR_0006 plasmid tig00000164, complete sequence 119053-119086 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP026754 Escherichia coli strain AR_0077 plasmid tig00000042_pilon, complete sequence 86503-86536 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP027441 Escherichia coli strain 2012C-4502 plasmid unnamed, complete sequence 6866-6899 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP012636 Escherichia coli strain SF-088 plasmid pSF-088-1, complete sequence 140647-140680 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_LT985252 Escherichia coli strain 666 plasmid RCS51_p, complete sequence 172443-172476 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_LT985252 Escherichia coli strain 666 plasmid RCS51_p, complete sequence 130883-130916 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP007135 Escherichia coli O145:H28 str. RM12761 plasmid pO145-12761, complete sequence 63973-64006 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP025850 Escherichia coli strain 600468 plasmid p600468_158, complete sequence 125162-125195 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_AP019676 Escherichia coli strain GSH8M-2 plasmid pGSH8M-2-1, complete sequence 124658-124691 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NC_024956 Escherichia coli strain K-12 plasmid pDM0133, complete sequence 87638-87671 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP005999 Escherichia coli B7A plasmid pEB1, complete sequence 52446-52479 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP006001 Escherichia coli B7A plasmid pEB3, complete sequence 11626-11659 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP022227 Escherichia coli strain WCHEC96200 plasmid pCTXM15_000200, complete sequence 131979-132012 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP027448 Escherichia coli strain 2014C-3075 plasmid unnamed, complete sequence 140581-140614 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP006263 Escherichia coli O145:H28 str. RM13516 plasmid pO145-13516, complete sequence 63972-64005 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP029104 Escherichia coli strain AR437 plasmid unnamed2, complete sequence 6548-6581 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP051750 Escherichia coli strain SCU-486 plasmid pSCU-486-1, complete sequence 62787-62820 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP051739 Escherichia coli strain SCU-105 plasmid pSCU-105-1, complete sequence 85807-85840 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NC_019089 Escherichia coli plasmid pGUE-NDM, complete sequence 46280-46313 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NC_019094 Escherichia coli plasmid p417H-90, complete sequence 5803-5836 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP010241 Escherichia coli strain C7 plasmid A, complete sequence 53018-53051 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP024827 Escherichia coli strain CREC-544 plasmid pCREC-544_1, complete sequence 114316-114349 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP024856 Escherichia coli strain AR_0011 plasmid tig00001011_pilon, complete sequence 30301-30334 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP027222 Escherichia coli strain 2015C-3101 plasmid unnamed1, complete sequence 18466-18499 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP034793 Escherichia coli strain 2009C-3378 plasmid p2009C-3378, complete sequence 82664-82697 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 KU932028 Escherichia coli plasmid pEC14III, complete sequence 14165-14198 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NC_025175 Escherichia coli plasmid pH2332-166, complete sequence 55074-55107 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NC_025176 Escherichia coli plasmid pH2291-112, complete sequence 110768-110801 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP024265 Escherichia coli O169:H41 strain F6326-C1 plasmid unnamed2, complete sequence 120106-120139 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP024151 Escherichia coli strain 14EC033 plasmid p14EC033d, complete sequence 82105-82138 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP027598 Escherichia coli strain 86-3153 plasmid unnamed 26588-26621 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP051699 Escherichia coli strain SCU-152 plasmid pSCU-152-1, complete sequence 102672-102705 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NC_025139 Escherichia coli plasmid pH2291-144, complete sequence 2238-2271 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NC_025143 Escherichia coli plasmid pC59-112, complete sequence 86968-87001 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NC_025144 Escherichia coli plasmid pC49-108, complete sequence 64489-64522 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP022913 Escherichia coli O6:H16 strain 2011EL-1370-2 plasmid unnamed1, complete sequence 58629-58662 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP024258 Escherichia coli O25:H16 strain F5505-C1 plasmid unnamed1, complete sequence 52383-52416 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP027535 Escherichia coli strain AR_0081 plasmid unnamed1, complete sequence 76303-76336 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP027308 Escherichia coli strain 2015C-3108 plasmid unnamed1 45819-45852 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP013026 Escherichia coli strain 2009C-3133 plasmid unnamed2, complete sequence 46225-46258 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP010149 Escherichia coli strain D6 plasmid A, complete sequence 62759-62792 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_LS992172 Escherichia coli isolate Escherichia coli str. TO73 plasmid 2, complete sequence 74001-74034 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_AP017621 Escherichia coli strain MRY15-131 plasmid pMRY15-131_1, complete sequence 47127-47160 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 CP054458 Escherichia coli strain SCU-103 plasmid pSCU-103-1, complete sequence 111498-111531 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP024242 Escherichia coli O114:H49 strain 90-9280 plasmid unnamed2, complete sequence 11967-12000 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP041301 Escherichia coli strain MSHS 472 plasmid pCys-6, complete sequence 12948-12981 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NC_019037 Escherichia coli plasmid pChi7122-2, complete sequence 48954-48987 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP010215 Escherichia coli strain M15 plasmid B, complete sequence 36071-36104 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 CP050167 Escherichia coli plasmid Carbapenemase(NDM-4)_IncFIB, complete sequence 66749-66782 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 CP054455 Escherichia coli strain SCU-487 plasmid pSCU-487-1, complete sequence 107777-107810 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NC_014382 Escherichia coli plasmid pEC_B24, complete sequence 28550-28583 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 CP025909 Escherichia coli strain 204576 plasmid p204576_83, complete sequence 31022-31055 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 CP043759 Escherichia coli strain CVM N55972 plasmid pN55972-1, complete sequence 21951-21984 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP024129 Escherichia coli strain 14EC001 plasmid p14EC001b, complete sequence 97301-97334 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP027458 Escherichia coli strain 88-3493 plasmid unnamed, complete sequence 17837-17870 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP027341 Escherichia coli strain 2015C-3121 plasmid unnamed 29868-29901 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NC_017640 Escherichia coli UMNK88 plasmid pUMNK88_Ent, complete sequence 64481-64514 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP024238 Escherichia coli O15:H11 strain 90-9272 plasmid unnamed 11470-11503 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP041111 Escherichia coli strain ECCTRSRTH03 plasmid unnamed1, complete sequence 69206-69239 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP042247 Escherichia coli strain BCE049 plasmid pBCE049-1, complete sequence 111577-111610 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP024237 Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed5, complete sequence 50511-50544 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 KU578032 Escherichia coli plasmid pCERC4, complete sequence 98360-98393 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP042586 Escherichia coli strain LD91-1 plasmid pLD91-1-146kb, complete sequence 125323-125356 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP018973 Escherichia coli strain Ecol_545 plasmid pEC545_3, complete sequence 2500-2533 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_LS992193 Escherichia coli isolate Escherichia coli str. TO217 plasmid 2, complete sequence 80504-80537 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP012928 Salmonella enterica subsp. enterica serovar Heidelberg strain 12-4374 plasmid p12-4374_62, complete sequence 43728-43761 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NC_010409 Escherichia coli plasmid pVM01, complete sequence 134187-134220 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 LN908840 Escherichia coli plasmid pCss_E1373 64408-64441 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP039475 Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000968 plasmid pCFSAN000968_2, complete sequence 85780-85813 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP027372 Escherichia coli strain 2015C-3905 plasmid unnamed 9327-9360 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 CP043743 Escherichia coli strain CVM N17EC0211 plasmid pN17EC0211, complete sequence 40928-40961 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 CP034937 Escherichia coli strain PNUSAE013304 plasmid p2018C-3602, complete sequence 3908-3941 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 MN419430 Escherichia coli strain 2016-4017437 plasmid p17437, complete sequence 67091-67124 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 MN419431 Escherichia coli strain 2016-40-19138 plasmid p19138, complete sequence 76510-76543 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 MN419432 Escherichia coli strain 2016-40-21254 plasmid p21254, complete sequence 34229-34262 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 MN419433 Escherichia coli strain 2016-40-20426 plasmid p20426, complete sequence 95577-95610 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 MN419436 Escherichia coli strain 2016-40-22440 plasmid p22440, complete sequence 68996-69029 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 MN419437 Escherichia coli strain 2016-40-22638 plasmid p22638, complete sequence 63140-63173 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP020934 Escherichia coli strain HB-Coli0 plasmid unnamed1, complete sequence 105691-105724 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP048440 Escherichia coli strain NBRC 3301 plasmid putative_pEcol1, complete sequence 77431-77464 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP029058 Escherichia coli strain FORC_081 plasmid pFORC_081_1, complete sequence 69054-69087 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP029058 Escherichia coli strain FORC_081 plasmid pFORC_081_1, complete sequence 179410-179443 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NC_006671 Escherichia coli A2363 plasmid pAPEC-O2-R, complete sequence 46965-46998 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NC_011980 Escherichia coli chi7122 plasmid pAPEC-1, complete sequence 53797-53830 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP012499 Escherichia coli strain GB089 plasmid pCFSAN004181P, complete sequence 188017-188050 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP027551 Escherichia coli strain 2015C-4136CT1 plasmid unnamed, complete sequence 1921-1954 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP039604 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014868 plasmid p12-6919.1, complete sequence 18778-18811 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP028120 Escherichia coli O43 str. RM10042 plasmid pRM10042-1, complete sequence 60705-60738 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP053282 Escherichia coli strain SCU-308 plasmid pSCU-308-1, complete sequence 121218-121251 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP010239 Escherichia coli strain S50 plasmid A, complete sequence 6600-6633 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP010239 Escherichia coli strain S50 plasmid A, complete sequence 145080-145113 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP030785 Escherichia albertii strain 2012EL-1823B plasmid unnamed2, complete sequence 49955-49988 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP030780 Escherichia albertii strain 05-3106 plasmid unnamed2, complete sequence 51222-51255 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 MN823988 Escherichia coli strain 14406 plasmid p14406-FII, complete sequence 5184-5217 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NC_007365 Escherichia coli EH41 plasmid pO113, complete sequence 76082-76115 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 JX486126 Uncultured bacterium plasmid pEFC36a, complete sequence 47570-47603 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP047667 Escherichia coli strain LD26-1 plasmid pLD26-1-135kb, complete sequence 49573-49606 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP024249 Escherichia coli O182:H21 strain D181 plasmid unnamed1, complete sequence 65330-65363 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP024250 Escherichia coli O182:H21 strain D181 plasmid unnamed2, complete sequence 80697-80730 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP031107 Escherichia coli strain AMSCJX02 plasmid pAMSC2, complete sequence 60176-60209 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_AP019763 Escherichia coli O111:H- strain 110512 plasmid pO111-110512_2, complete sequence 39803-39836 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 AP023228 Escherichia coli YJ3 plasmid pYJ3-a DNA, complete genome 77480-77513 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP026579 Escherichia coli strain WCHEC005237 plasmid pRmtB1_005237, complete sequence 70782-70815 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP014112 Escherichia coli strain FDAARGOS_144 plasmid unnamed2, complete sequence 68338-68371 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP028628 Escherichia coli strain 137 plasmid pTA137, complete sequence 74001-74034 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP010184 Escherichia coli strain M3 plasmid A, complete sequence 179639-179672 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP010192 Escherichia coli strain M8 plasmid A, complete genome 152517-152550 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP022052 Escherichia coli O157 strain FDAARGOS_293 plasmid unnamed2, complete sequence 56001-56034 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP012113 Escherichia coli strain PSUO78 plasmid pPSUO78_1, complete sequence 59547-59580 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP048026 Escherichia coli strain GZEC065 plasmid pTEM1-GZEC065, complete sequence 119180-119213 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP029744 Escherichia coli strain AR_0085 plasmid unnamed3, complete sequence 30676-30709 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP023821 Escherichia coli strain 7/2 plasmid p7_2.1, complete sequence 45865-45898 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_AP023199 Escherichia coli strain TUM18780 plasmid pMTY18780-2, complete sequence 91999-92032 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP027703 Escherichia coli strain 675SK2 plasmid p675SK2_B, complete sequence 139840-139873 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP029975 Escherichia coli strain 51008369SK1 plasmid p51008369SK1_B, complete sequence 44221-44254 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP049202 Escherichia coli strain PapRG-04-4 plasmid pIncFIB, complete sequence 148872-148905 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP050751 Salmonella enterica subsp. enterica serovar Typhimurium strain ST46 plasmid pST46-1, complete sequence 208474-208507 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_AP018800 Escherichia coli strain E2855 plasmid pE2855-4, complete sequence 39803-39836 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP041920 Escherichia coli strain Ec40743 plasmid unnamed1, complete sequence 87093-87126 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP040454 Escherichia coli strain UPEC132 plasmid unnamed1, complete sequence 90600-90633 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP040455 Escherichia coli strain UPEC132 plasmid unnamed2, complete sequence 54766-54799 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP015844 Escherichia coli O157:H7 strain FRIK2455 plasmid pO157, complete sequence 82895-82928 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP051224 Escherichia coli strain SCZE5 plasmid pSCZE2 120204-120237 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP038455 Escherichia coli strain EC-129 plasmid pEC129_2, complete sequence 89849-89882 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NC_018954 Salmonella enterica subsp. enterica serovar Kentucky plasmid pCS0010A, complete sequence 58901-58934 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NC_018966 Salmonella enterica subsp. enterica serovar Kentucky plasmid pSSAP03302A, complete sequence 58899-58932 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP041997 Escherichia coli strain AR Bank #0349 plasmid pAR349, complete sequence 232837-232870 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP014489 Escherichia coli strain G749 plasmid pG749_1, complete sequence 43432-43465 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP032395 Salmonella enterica subsp. enterica serovar Dublin strain CVM 22453 plasmid p22453_1, complete sequence 68969-69002 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP032891 Escherichia coli strain SCEC020022 plasmid pVir_020022, complete sequence 44295-44328 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP034805 Escherichia coli strain 2009C-3554 plasmid p2009C-3554-2, complete sequence 15340-15373 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP050732 Salmonella enterica subsp. enterica serovar Typhimurium strain ST101 plasmid pST101-1, complete sequence 136229-136262 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP050754 Salmonella enterica subsp. enterica serovar Typhimurium strain ST45 plasmid pST45-1, complete sequence 208681-208714 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP043228 Escherichia coli strain Ec-050 plasmid pEc-050-TEM-30, complete sequence 18774-18807 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP020338 Shigella flexneri 4c strain 1602 plasmid unnamed2, complete sequence 14902-14935 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP024140 Escherichia coli strain 14EC020 plasmid p14EC020b, complete sequence 125526-125559 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NC_021155 Salmonella enterica subsp. enterica serovar Typhimurium str. U288 plasmid pSTU288-1, complete sequence 7874-7907 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_AP014804 Escherichia coli O119:H6 strain EC404/03 plasmid pEC404/03-1, complete sequence 107686-107719 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP044149 Escherichia coli O157 strain AR-0427 plasmid pAR-0427-1 67889-67922 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP044150 Escherichia coli O157 strain AR-0427 plasmid pAR-0427-2 25449-25482 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP021733 Escherichia coli strain AR_0114 plasmid unitig_1, complete sequence 17928-17961 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 CP025968 Escherichia coli strain 2407 a plasmid p2407a_135, complete sequence 108716-108749 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP019905 Escherichia coli strain MDR_56 plasmid unnamed6, complete sequence 8016-8049 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP049102 Escherichia coli strain EC28 plasmid p2, complete sequence 124480-124513 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NC_017659 Escherichia coli O83:H1 str. NRG 857C plasmid pO83_CORR, complete sequence 106391-106424 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP026940 Escherichia coli strain CFS3313 plasmid pCFS3313-1, complete sequence 124844-124877 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP037904 Escherichia coli strain LHM10-1 plasmid unnamed1, complete sequence 81076-81109 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP042245 Escherichia coli strain PU-1 plasmid pColV-PU1, complete sequence 21734-21767 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP018643 Salmonella enterica subsp. enterica serovar Enteritidis strain 74-1357 plasmid pSE74-1357, complete sequence 56987-57020 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP017252 Escherichia coli strain NADC 5570/86-24/6564 isolate wild type plasmid pO157, complete sequence 71406-71439 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_LT985265 Escherichia coli strain 364 plasmid RCS57TR364_p, complete sequence 71034-71067 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_LT985271 Escherichia coli strain 661 plasmid RCS59_p, complete sequence 44876-44909 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_LT985306 Escherichia coli strain ECOR 37 plasmid RCS88_p, complete sequence 47348-47381 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_LT985275 Escherichia coli strain R71 plasmid RCS70_p, complete sequence 69341-69374 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_LT985293 Escherichia coli strain 4410-1 plasmid RCS79_p, complete sequence 92124-92157 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_LT985221 Escherichia coli strain TN03 plasmid RCS22_p, complete sequence 70325-70358 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_LT985227 Escherichia coli strain 518 plasmid RCS28_pI, complete sequence 9035-9068 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP023471 Salmonella enterica subsp. enterica strain BAA-1672 plasmid pSalSendai, complete sequence 46263-46296 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 MN807689 Escherichia coli strain A241 plasmid pA241-TEM, complete sequence 106778-106811 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_MK430046 Escherichia coli strain 11.4-R4 plasmid pCERC13, complete sequence 112994-113027 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_MK461929 Escherichia coli strain 2009_36 plasmid p2009_36_F, complete sequence 113372-113405 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_MK461928 Escherichia coli strain F2_14D plasmid pF2_14D_F, complete sequence 109105-109138 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_MN053930 Escherichia coli strain 2.3-R4 plasmid pCERC14, complete sequence 108012-108045 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP045976 Escherichia coli strain AUSMDU00002545 plasmid pAUSMDU00002545_01, complete sequence 75388-75421 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_MH580302 Escherichia coli strain 1107 plasmid p1107-118K, complete sequence 91126-91159 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_MK070495 Escherichia coli strain MB6212 plasmid pMB5876, complete sequence 68148-68181 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP006635 Escherichia coli PCN033 plasmid p3PCN033, complete sequence 60118-60151 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP027127 Escherichia coli strain AR_0374 plasmid unnamed2 10896-10929 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_MF370216 Escherichia coli strain J53 plasmid pOX38-Gen, complete sequence 49931-49964 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_MG014722 Escherichia coli strain P2-3 plasmid pP2-3T, complete sequence 157750-157783 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_MG014720 Escherichia coli strain A74 plasmid pA74T, complete sequence 141950-141983 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_KY689635 Escherichia coli strain Mbl536 plasmid pMbl536, complete sequence 32091-32124 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_MG825378 Escherichia coli strain 1108 plasmid p1108-IncFIB, complete sequence 49134-49167 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_KY565558 Escherichia coli strain Mbl488 plasmid pMbl488, complete sequence 31630-31663 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_MH202955 Escherichia coli strain HXH-1 plasmid pHXH-1, complete sequence 101667-101700 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_MH195200 Escherichia coli strain 2009-52 plasmid pSDJ2009-52F, complete sequence 7505-7538 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP023828 Escherichia coli strain 4/4 plasmid p4_4.2, complete sequence 36974-37007 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 MN816372 Escherichia coli strain A130 plasmid pA130-TEM, complete sequence 87113-87146 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_MG299151 Shigella sonnei strain SH287-2 plasmid pSH287-2, complete sequence 38392-38425 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_KY471628 Shigella sonnei strain SH15sh99 plasmid pSH15sh99, complete sequence 32832-32865 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_MG299131 Shigella sonnei strain SH271-2 plasmid pSH271-2, complete sequence 38392-38425 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_KY471629 Shigella sonnei strain SH15sh105 plasmid pSH15sh104, complete sequence 32832-32865 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_MG299133 Shigella sonnei strain SH272-2 plasmid pSH272-2, complete sequence 38392-38425 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NC_022651 Escherichia coli JJ1886 plasmid pJJ1886_5, complete sequence 20616-20649 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 MF679146 Escherichia coli plasmid pBJ114-141, complete sequence 102321-102354 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 MF679147 Escherichia coli plasmid pBJ114T-190, complete sequence 150640-150673 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_MG299128 Shigella sonnei strain SH262-2 plasmid pSH262-2, complete sequence 38392-38425 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_MG299147 Shigella sonnei strain SH284-2 plasmid pSH284-2, complete sequence 38392-38425 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_KX276657 Escherichia coli strain MRSN388634 plasmid pMR0516mcr, complete sequence 183641-183674 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP025922 Escherichia coli strain 103605 plasmid p103605_83, complete sequence 2498-2531 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_KR653209 Escherichia coli strain GDZ13 plasmid pGD0503Z13, complete sequence 138881-138914 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_KT002541 Escherichia coli strain HeB7 plasmid pHeBE7, complete sequence 35095-35128 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_KR905384 Escherichia coli strain DV45 plasmid pDV45, complete sequence 14474-14507 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_KR905389 Escherichia coli isolate 4809.66 plasmid p4809.66, complete sequence 14466-14499 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_KR905385 Escherichia coli strain 5312.29 plasmid p5312.29, complete sequence 14474-14507 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_KM377238 Escherichia coli strain HV114 plasmid pHV114, complete sequence 43795-43828 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_KM377239 Escherichia coli strain HV292 plasmid pHV292, complete sequence 50075-50108 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_KP198616 Escherichia coli strain C0996A plasmid pCTXM123_C0996, complete sequence 45349-45382 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_KM377240 Escherichia coli strain HV295 plasmid pHV295, complete sequence 37892-37925 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_KP398867 Escherichia coli strain DB04277 plasmid pDB4277, complete sequence 92816-92849 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP018626 Escherichia coli strain FORC_044 plasmid pFORC44_2, complete sequence 41307-41340 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 CP043016 Escherichia coli strain 388808_gen plasmid unnamed1, complete sequence 21933-21966 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 CP043023 Escherichia coli strain 399730_gen plasmid unnamed1, complete sequence 84546-84579 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 CP043012 Escherichia coli strain 388755_gen plasmid unnamed1, complete sequence 51101-51134 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 CP043012 Escherichia coli strain 388755_gen plasmid unnamed1, complete sequence 63025-63058 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP010147 Escherichia coli strain D5 plasmid B, complete genome 44932-44965 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP042630 Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-3, complete sequence 95222-95255 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP032806 Escherichia coli strain ERL05-0623 plasmid pERL05-0623-1, complete sequence 67616-67649 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP015246 Escherichia coli O91 str. RM7190 plasmid pRM7190-2, complete sequence 110196-110229 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP041624 Escherichia coli O157:H7 strain ATCC 43888 plasmid pO157_like, complete sequence 47403-47436 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP032798 Escherichia coli strain ERL06-2497 plasmid pERL06-2497-1, complete sequence 67623-67656 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP032799 Escherichia coli strain ERL06-2497 plasmid pERL06-2497-2, complete sequence 20711-20744 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP024272 Escherichia coli strain F8111-1SC3 plasmid unnamed3, complete sequence 40391-40424 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP010138 Escherichia coli strain D2 plasmid A, complete sequence 9663-9696 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP010141 Escherichia coli strain D3 plasmid A, complete sequence 116565-116598 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP032445 Salmonella enterica subsp. enterica serovar Fresno strain USMARC-69835 plasmid pSFR1-USMARC-69835, complete sequence 19989-20022 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP035479 Escherichia coli strain U13A plasmid pU13A_B, complete sequence 28291-28324 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP031907 Escherichia coli O91:H21 strain FWSEC0008 plasmid unnamed17, complete sequence 90006-90039 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_KT754162 Shigella dysenteriae 1 strain BU53M1 plasmid pBU53M1, complete sequence 76539-76572 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP028651 Escherichia coli strain 124 plasmid pTA124, complete sequence 68937-68970 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP028653 Escherichia coli strain 123 plasmid pTA123, complete sequence 67626-67659 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP028679 Escherichia coli strain 114 plasmid pTA114, complete sequence 65654-65687 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP028701 Escherichia coli strain 105 plasmid pTA105, complete sequence 67618-67651 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP043219 Escherichia coli O80:H26 strain EC-107 plasmid pET6.2-IncFII, complete sequence 50299-50332 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP018116 Escherichia coli strain MRSN346638 plasmid pMRSN346638_119.3, complete sequence 54469-54502 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP018110 Escherichia coli strain MRSN346595 plasmid pMRSN346595_120.3, complete sequence 55541-55574 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP038182 Escherichia coli strain 2 HS-C plasmid p2HS-C-2, complete sequence 8253-8286 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP039299 Escherichia coli strain PigCaeca_1 plasmid unnamed1, complete sequence 37958-37991 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP028634 Escherichia coli strain 135 plasmid pTA135, complete sequence 65658-65691 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP028637 Escherichia coli strain 134 plasmid pTA134, complete sequence 65653-65686 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP040573 Escherichia coli O157:H7 strain ECP17-46 plasmid pCFSAN059540, complete sequence 83590-83623 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 CP042949 Escherichia coli strain ATCC 51435 plasmid pB2F1, complete sequence 22543-22576 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 CP042948 Escherichia coli strain 90-9133 plasmid p90-9133_1, complete sequence 25312-25345 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP010305 Escherichia coli O157:H7 str. SS52 plasmid p0157, complete sequence 30982-31015 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP032804 Escherichia coli strain ERL05-1306 plasmid pERL05-1306, complete sequence 66161-66194 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP018638 Salmonella enterica subsp. enterica serovar Enteritidis strain 69-3861 plasmid pSE69-3861-1, complete sequence 23464-23497 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP053733 Escherichia coli strain CP55_Sichuan plasmid pCP55-141k, complete sequence 47182-47215 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP053786 Escherichia coli isolate 2-101 plasmid p2-101, complete sequence 41829-41862 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP028640 Escherichia coli strain 133 plasmid pTA133, complete sequence 65651-65684 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NC_025106 Escherichia coli strain NMI5428/11 plasmid pMC-NDM, complete sequence 29812-29845 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP017848 Escherichia coli strain FMU073332 plasmid pEcoFMU07332d sequence 136130-136163 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP032802 Escherichia coli strain ERL06-2442 plasmid pERL06-2442, complete sequence 65910-65943 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP020510 Escherichia coli strain 165 plasmid unnamed1, complete sequence 61697-61730 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP020546 Escherichia coli strain ZJ3920 plasmid pZJ3920-1, complete sequence 60562-60595 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 CP043737 Escherichia coli strain CVM N17EC0616 plasmid pN17EC0616-1, complete sequence 177664-177697 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP010316 Escherichia coli strain 789 plasmid pAPEC-O78-ColV 77321-77354 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP029575 Escherichia coli strain DA33133 plasmid pDA33133-157, complete sequence 77663-77696 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_LS999562 Escherichia coli isolate EC-TO143 plasmid 3, complete sequence 41218-41251 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_LS998786 Escherichia coli isolate EC-TO75 plasmid 2, complete sequence 2370-2403 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_LS998786 Escherichia coli isolate EC-TO75 plasmid 2, complete sequence 97185-97218 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 129263-129296 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP053788 Escherichia coli isolate J31 plasmid pJ31, complete sequence 41829-41862 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP053737 Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncFII, complete sequence 41593-41626 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP053725 Escherichia coli strain CP66-6_Sichuan plasmid pCP66-6-IncFII, complete sequence 49424-49457 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_KF290378 Salmonella enterica subsp. enterica serovar Typhimurium strain STm2 plasmid pSTM2, complete sequence 32917-32950 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 138419-138452 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP028595 Escherichia coli strain 150 plasmid pTA150, complete sequence 68096-68129 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP028616 Escherichia coli strain 141 plasmid pTA141, complete sequence 66960-66993 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NC_013010 Escherichia coli O157:H7 str. TW14359 plasmid pO157, complete sequence 47046-47079 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP032796 Escherichia coli strain ERL06-2503 plasmid pERL06-2503, complete sequence 65893-65926 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP021847 Escherichia coli strain EC1515 plasmid pEC1515-3, complete sequence 37984-38017 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP021847 Escherichia coli strain EC1515 plasmid pEC1515-3, complete sequence 43559-43592 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP019282 Escherichia coli strain 13P484A plasmid p13P484A-2, complete sequence 108500-108533 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP012626 Escherichia coli strain SF-468 plasmid pSF-468-1, complete sequence 49241-49274 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP028431 Escherichia coli strain RM9131 plasmid pRM9131-2, complete sequence 21630-21663 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP051220 Escherichia coli strain SFE8 plasmid pSCZP1, complete sequence 65100-65133 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP048295 Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-3, complete sequence 44566-44599 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP048296 Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-2, complete sequence 29537-29570 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NC_013122 Escherichia coli plasmid pEK499, complete sequence 18940-18973 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP010372 Escherichia coli strain 6409 plasmid p6409-151.583kb, complete sequence 25675-25708 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP032790 Escherichia coli strain NZRM4169 plasmid pNZRM4169, complete sequence 68164-68197 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP024274 Escherichia coli strain F9792 plasmid unnamed, complete sequence 137518-137551 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP019251 Escherichia coli strain 13KWH46 plasmid p13KWH46-1, complete sequence 120736-120769 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP019252 Escherichia coli strain 13KWH46 plasmid p13KWH46-2, complete sequence 68068-68101 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP021728 Escherichia coli strain Combat11I9 plasmid pCombat11I9-2, complete sequence 127639-127672 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP006641 Escherichia coli PCN061 plasmid PCN061p5, complete sequence 36871-36904 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP035367 Escherichia coli O157:H7 strain C1-057 plasmid pC1-057, complete sequence 46042-46075 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP049079 Escherichia coli strain p11A plasmid p11A_p2, complete sequence 16305-16338 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 MN158990 Escherichia coli strain TREC4 plasmid pTREC4, complete sequence 111439-111472 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 MN158992 Escherichia coli strain TREC9 plasmid pTREC9, complete sequence 86378-86411 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP028315 Salmonella enterica subsp. enterica serovar Typhimurium var. 5- strain CFSAN067217 plasmid pSC-31-1, complete sequence 35909-35942 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP054942 Escherichia coli strain MS6192 plasmid pMS6192B, complete sequence 18492-18525 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP012683 Salmonella enterica subsp. enterica serovar Typhimurium strain 33676 plasmid p33673_IncF, complete sequence 73029-73062 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP024284 Escherichia albertii strain 2014C-4356 plasmid unnamed2, complete sequence 32299-32332 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP026854 Escherichia coli strain MS7163 plasmid pMS7163A, complete sequence 25454-25487 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP019247 Escherichia coli strain Combat13F7 plasmid pCombat13F7-2, complete sequence 108915-108948 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP019268 Escherichia coli strain 13C1079T plasmid p13C1079T-1, complete sequence 111971-112004 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP019244 Escherichia coli strain Combat2C1 plasmid pCombat2C1-1, complete sequence 23651-23684 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NC_018995 Escherichia coli plasmid pHUSEC41-1, complete sequence 16077-16110 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NC_023329 Escherichia coli strain B3804 plasmid pIFM3804, complete sequence 37577-37610 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 CP042642 Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-4_MCR3, complete sequence 32046-32079 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP022064 Salmonella enterica strain FDAARGOS_312 plasmid unnamed4, complete sequence 48640-48673 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP021843 Escherichia coli strain EC974 plasmid pEC974-3, complete sequence 35838-35871 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP029691 Escherichia coli strain SD134209 plasmid pSD134209-2, complete sequence 23261-23294 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 MN061455 Escherichia coli strain EC-15-3 plasmid pEC-15-3-NDM-1, complete sequence 62904-62937 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 MH450052 Escherichia coli plasmid pHN32wt, complete sequence 63384-63417 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 MH450053 Escherichia coli plasmid pHN32_1, complete sequence 59306-59339 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 LC549806 Escherichia coli VNCEc57 plasmid pVNCEc57 DNA, complete sequence 37477-37510 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP038410 Escherichia coli O157:H7 strain 86-24 plasmid p86-24-1, complete sequence 47425-47458 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP038422 Escherichia coli O157:H7 strain 7636 plasmid p7636-1, complete sequence 44811-44844 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NC_009602 Escherichia coli plasmid pSFO157, complete sequence 81443-81476 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP016572 Salmonella enterica subsp. enterica serovar Heidelberg strain AMR588-04-00320 plasmid pAMR588-04-00320_99, complete sequence 32697-32730 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 CM019851 Escherichia coli strain CVM N17EC0326 plasmid pN17EC0326-1, complete sequence, whole genome shotgun sequence 83582-83615 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP041415 Escherichia coli strain STEC719 plasmid pSTEC719_4, complete sequence 58427-58460 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP041428 Escherichia coli strain STEC388 plasmid pSTEC388_3, complete sequence 7109-7142 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP035752 Escherichia coli E110019 plasmid pE110019_66, complete sequence 1659-1692 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP047381 Escherichia coli strain CAU16175 plasmid pCAU16175_3, complete sequence 27002-27035 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP047381 Escherichia coli strain CAU16175 plasmid pCAU16175_3, complete sequence 32855-32888 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP038356 Escherichia coli O157:H7 str. F8092B plasmid pF8092B-1, complete sequence 50364-50397 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP038371 Escherichia coli O157:H7 strain F6321 plasmid pF6321-1, complete sequence 45299-45332 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP038385 Escherichia coli O157:H7 strain DEC5E plasmid pDEC5E-2, complete sequence 37772-37805 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP038404 Escherichia coli O157:H7 strain BB24-1 plasmid pBB24-1, complete sequence 45457-45490 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP038406 Escherichia coli O157:H7 strain ATCC 35150 plasmid pATCC35150-1, complete sequence 67620-67653 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP038418 Escherichia coli O157:H7 strain 3-5-1 plasmid pGM351-1, complete sequence 45159-45192 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP038420 Escherichia coli O157:H7 strain 2-6-2 plasmid pEX262-1, complete sequence 45451-45484 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP038429 Escherichia coli O157:H7 strain 611 plasmid p611-1, complete sequence 47437-47470 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP038335 Escherichia coli O157:H7 strain N8B7-2 plasmid pN8B7-1, complete sequence 44153-44186 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP038348 Escherichia coli O157:H7 strain G5295 plasmid pG5295-1, complete sequence 64117-64150 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP038359 Escherichia coli O157:H7 strain F7508 plasmid pF7508-1, complete sequence 47437-47470 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP038373 Escherichia coli O157:H7 strain F6294 plasmid pF6294-1, complete sequence 47431-47464 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP038382 Escherichia coli O157:H7 strain E32511 plasmid pE32511-1, complete sequence 44201-44234 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP044144 Escherichia coli O157 strain AR-0429 plasmid pAR-0429-2, complete sequence 26049-26082 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP044183 Salmonella enterica subsp. enterica serovar Heidelberg strain AR-0404 plasmid pAR-0404-2, complete sequence 15036-15069 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP045756 Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000752 plasmid p2CFSAN000752, complete sequence 79434-79467 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP024281 Escherichia coli strain ATCC 43896 plasmid unnamed3, complete sequence 63272-63305 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP032263 Escherichia coli strain AR_0089 plasmid unnamed1, complete sequence 153547-153580 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP032877 Escherichia coli strain WCHEC000837 plasmid pCTXM15_000837, complete sequence 906-939 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 MN158991 Escherichia coli strain TREC8 plasmid pTREC8, complete sequence 76147-76180 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP025239 Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1928 plasmid pSNE2-1928, complete sequence 31741-31774 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 MK181557 Escherichia coli plasmid p14019095, complete sequence 41249-41282 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 MK181558 Escherichia coli plasmid p15076331, complete sequence 41257-41290 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 MK181559 Escherichia coli plasmid p199, complete sequence 52835-52868 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 MK181560 Escherichia coli plasmid p14006165, complete sequence 41420-41453 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 MK181561 Escherichia coli plasmid p14011252, complete sequence 40973-41006 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 MK181562 Escherichia coli plasmid p15090172, complete sequence 39636-39669 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 MK181563 Escherichia coli plasmid p15095941, complete sequence 42486-42519 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 MK181564 Escherichia coli plasmid p15124679, complete sequence 41420-41453 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 MK181565 Escherichia coli plasmid pESBL20140131, complete sequence 42619-42652 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 MK181566 Escherichia coli plasmid p15078279, complete sequence 41875-41908 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 MK181567 Escherichia coli plasmid pESBL20150097, complete sequence 41236-41269 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 MK181568 Escherichia coli plasmid pESBL20150178, complete sequence 41216-41249 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP012803 Escherichia coli O157:H7 strain WS4202 isolate laboratory strain plasmid pO157-WS4202, complete sequence 47440-47473 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP028606 Escherichia coli strain 144 plasmid pTA144, complete sequence 68120-68153 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP030000 Salmonella enterica subsp. enterica serovar Brandenburg strain SA20113174 plasmid pSA20113174.1, complete sequence 32287-32320 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP013833 Escherichia coli strain JJ2434 plasmid pJJ2434_1, complete sequence 20627-20660 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP044347 Escherichia coli strain P225M plasmid pP225M-CTX-M-55, complete sequence 14454-14487 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP027357 Escherichia coli strain 2013C-4991 plasmid unnamed2 85796-85829 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP041438 Escherichia coli strain STEC005 plasmid pSTEC005, complete sequence 36028-36061 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP039562 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014847 plasmid p08-5333.1, complete sequence 3169-3202 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 MF152729 Escherichia coli plasmid pCTXM1-MU2, complete sequence 43116-43149 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 MN334220 Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm37 plasmid pSTM37-118, complete sequence 39122-39155 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP038345 Escherichia coli O157:H7 strain Gim1-1 plasmid pGM11-1, complete sequence 44374-44407 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP038293 Escherichia coli O157:H7 strain TB21-1 plasmid pTB21-1, complete sequence 45464-45497 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP038312 Escherichia coli O157:H7 strain Show KS 470-1 plasmid pKS470-1, complete sequence 45464-45497 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP038327 Escherichia coli O157:H7 strain NE 1169-1 plasmid pNE1169-1, complete sequence 67619-67652 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP038343 Escherichia coli O157:H7 strain H2495 plasmid pH2495-1, complete sequence 67630-67663 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP038354 Escherichia coli O157:H7 strain F8797 plasmid pF8797-1, complete sequence 43779-43812 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP038368 Escherichia coli O157:H7 strain F6667 plasmid pF6667-1, complete sequence 46856-46889 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP038379 Escherichia coli O157:H7 strain F1273 plasmid pF1273-1, complete sequence 45470-45503 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP038401 Escherichia coli O157:H7 strain DEC4E plasmid pDEC4E-1, complete sequence 44799-44832 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP038415 Escherichia coli O157:H7 strain 17B6-2 plasmid p17B6-1, complete sequence 44816-44849 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP038426 Escherichia coli O157:H7 strain 2571 plasmid p2571-1, complete sequence 45299-45332 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP038286 Escherichia coli O157:H7 strain YB14-1 plasmid pYB14-1, complete sequence 72952-72985 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NC_024979 Escherichia coli strain ESBL-305 plasmid pESBL-305, complete sequence 42894-42927 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP018240 Escherichia coli strain 272 plasmid pO157, complete sequence 45142-45175 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP042621 Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-6, complete sequence 30181-30214 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP040306 Escherichia coli strain HB6 plasmid pO157, complete sequence 68074-68107 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP040310 Escherichia coli strain 21B8 plasmid pO157, complete sequence 65628-65661 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP019007 Escherichia coli strain Ecol_AZ159 plasmid pECAZ159_1, complete sequence 5508-5541 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP019014 Escherichia coli strain Ecol_AZ162 plasmid pECAZ162_KPC, complete sequence 102969-103002 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP038291 Escherichia coli O157:H7 strain TX 265-1 plasmid pTX265-1, complete sequence 45464-45497 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP038304 Escherichia coli O157:H7 strain SS TX 313-1 plasmid pTX313-1, complete sequence 45469-45502 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP038320 Escherichia coli O157:H7 strain NE122 plasmid pNE122-1, complete sequence 47628-47661 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP038338 Escherichia coli O157:H7 strain LSU61 plasmid pLSU61-1, complete sequence 45933-45966 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP038341 Escherichia coli O157:H7 strain H6437 plasmid pH6437-1, complete sequence 45135-45168 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP038350 Escherichia coli O157:H7 strain F8952 plasmid pF8952-1, complete sequence 67610-67643 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP038352 Escherichia coli O157:H7 strain F8798 plasmid pF8798-1, complete sequence 46927-46960 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP038362 Escherichia coli O157:H7 strain F7386 plasmid pF7386-1, complete sequence 48185-48218 3 0.912
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP031548 Escherichia coli strain cq9 plasmid unnamed2, complete sequence 111570-111603 4 0.882
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP024238 Escherichia coli O15:H11 strain 90-9272 plasmid unnamed 124005-124038 4 0.882
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 CP025968 Escherichia coli strain 2407 a plasmid p2407a_135, complete sequence 13519-13552 4 0.882
CP025979_2 2.1|1505969|34|CP025979|PILER-CR 1505969-1506002 34 NZ_CP042245 Escherichia coli strain PU-1 plasmid pColV-PU1, complete sequence 106168-106201 4 0.882
CP025979_2 2.2|1506033|31|CP025979|PILER-CR 1506033-1506063 31 KM389217 UNVERIFIED: Pseudomonas phage F_ET605sp/Pa1651 clone contig00002 genomic sequence 1784-1814 5 0.839
CP025979_2 2.2|1506033|31|CP025979|PILER-CR 1506033-1506063 31 KC911857 Salmonella phage SPC32N, complete genome 37310-37340 7 0.774
CP025979_2 2.2|1506033|31|CP025979|PILER-CR 1506033-1506063 31 KC911856 Salmonella phage SPC32H, complete genome 37310-37340 7 0.774
CP025979_2 2.2|1506033|31|CP025979|PILER-CR 1506033-1506063 31 NC_016761 Salmonella phage SPN1S, complete genome 37334-37364 7 0.774
CP025979_2 2.2|1506033|31|CP025979|PILER-CR 1506033-1506063 31 JQ691610 Salmonella phage SPN9TCW, complete genome 37339-37369 7 0.774

1. spacer 1.1|727043|38|CP025979|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

2. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP023355 (Escherichia coli strain 746 plasmid p72, complete sequence) position: , mismatch: 2, identity: 0.941

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
atccttgttaagaccacgggcaccatgcagatgc	Protospacer
. ********************************

3. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP031899 (Escherichia coli O113:H21 strain FWSEC0010 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

4. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP030765 (Escherichia coli strain 2017C-4109 plasmid p2017C-4109, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

5. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_KY416992 (Escherichia coli strain FAM21805 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

6. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NC_017627 (Escherichia coli 042 plasmid pAA, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

7. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_MG569891 (Shigella sonnei strain DE105 plasmid pDE105, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

8. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_KU664810 (Escherichia coli strain 11.3-R3 plasmid pCERC5, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

9. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_KY007017 (Escherichia coli strain 14.3-R4 plasmid pCERC9, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

10. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_KU254579 (Escherichia coli strain YD786 plasmid pYD786-2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

11. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP025861 (Escherichia coli strain 504239 plasmid p504239_155, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

12. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP025912 (Escherichia coli strain 204446 plasmid p204446_92, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

13. spacer 2.1|1505969|34|CP025979|PILER-CR matches to KR827684 (Escherichia coli plasmid pCERC3, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

14. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP045864 (Escherichia coli O157:H7 strain ATCC 43890 plasmid p1CFSAN076619, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

15. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_KT779550 (Escherichia coli strain 369 plasmid p369, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

16. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_KT845955 (Escherichia coli strain EP28 plasmid pHNEP28_cfr, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

17. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_KM052220 (Escherichia coli strain H18 Hel20 TF1 plasmid pTF_H18 Hel20 TF1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

18. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_KP789020 (Escherichia coli strain WCHEC13-8 plasmid pCTXM15, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

19. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP042631 (Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-4, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

20. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP010232 (Escherichia coli strain S30 plasmid A, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

21. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP010233 (Escherichia coli strain S30 plasmid B, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

22. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP023850 (Escherichia coli strain 4/0 plasmid p4_0.1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

23. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_AP017611 (Escherichia coli strain 20Ec-P-124 plasmid pMRY16-002_1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

24. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP042337 (Escherichia coli strain GZ04-0086 plasmid pCTXM-GZ04, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

25. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP015816 (Escherichia coli O157:H7 strain JEONG-1266 plasmid p0157, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

26. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_AP023192 (Escherichia coli strain TUM18530 plasmid pMTY18530-2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

27. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP028608 (Escherichia coli strain 143 plasmid pTA143, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

28. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP010158 (Escherichia coli strain D10 plasmid A, complete genome) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

29. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP025844 (Escherichia coli strain 720632 plasmid p720632_94, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

30. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_AP017618 (Escherichia coli strain MRY15-117 plasmid pMRY15-117_1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

31. spacer 2.1|1505969|34|CP025979|PILER-CR matches to CP054336 (Escherichia coli strain SCU-120 plasmid pSCU-120-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

32. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP013193 (Escherichia coli strain FORC_031 plasmid pFORC31.3, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

33. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP010209 (Escherichia coli strain M11 plasmid C, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

34. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP028587 (Escherichia coli strain WCHEC4533 plasmid pCTXM15_000533, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

35. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP042600 (Escherichia coli strain NCYU-29-69 plasmid pNCYU-29-69-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

36. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP023348 (Escherichia coli strain ETEC-2265 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

37. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP024225 (Escherichia coli O169:H41 strain 2014EL-1345-2 plasmid unnamed2) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

38. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP024227 (Escherichia coli O169:H41 strain 2014EL-1345-2 plasmid unnamed4, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

39. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP048331 (Escherichia coli strain 10 plasmid p010_A, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

40. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP049350 (Escherichia coli strain 3R plasmid p3R-2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

41. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP021087 (Escherichia coli strain 13P460A plasmid p13P460A-2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

42. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP011135 (Escherichia coli VR50 plasmid pVR50A, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

43. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP024468 (Shigella dysenteriae strain BU53M1 plasmid pBU53M1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

44. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP053732 (Escherichia coli strain CP55_Sichuan plasmid pCP55-IncFIB, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

45. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NC_023315 (Escherichia coli strain EQ011 plasmid pEQ011, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

46. spacer 2.1|1505969|34|CP025979|PILER-CR matches to LN850163 (Escherichia coli plasmid pI1-34TF, strain I1-34) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

47. spacer 2.1|1505969|34|CP025979|PILER-CR matches to CP043738 (Escherichia coli strain CVM N17EC0616 plasmid pN17EC0616-2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

48. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP022688 (Escherichia coli strain CDC#03-98 plasmid p0157, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

49. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP010317 (Escherichia coli strain 789 plasmid pAPEC-O78-2) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

50. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_LS999561 (Escherichia coli isolate EC-TO143 plasmid 2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

51. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_LS992167 (Escherichia coli isolate Escherichia coli str. TO6 plasmid 2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

52. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NC_010488 (Escherichia coli SMS-3-5 plasmid pSMS35_130, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

53. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP020494 (Salmonella enterica subsp. enterica strain 08-00436 plasmid pSE08-00436-2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

54. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP024276 (Escherichia coli O6:H16 strain M9682-C1 plasmid unnamed1) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

55. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP012627 (Escherichia coli strain SF-468 plasmid pSF-468-2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

56. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NC_009788 (Escherichia coli O139:H28 str. E24377A plasmid pETEC_73, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

57. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP034739 (Escherichia coli strain L65 plasmid pL65-2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

58. spacer 2.1|1505969|34|CP025979|PILER-CR matches to MT077881 (Escherichia coli plasmid p2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

59. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP054369 (Escherichia coli strain SCU-115 plasmid pSCU-115-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

60. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP054364 (Escherichia coli strain SCU-171 plasmid pSCU-171-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

61. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP013836 (Escherichia coli strain JJ1897 plasmid pJJ1897_1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

62. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP024248 (Escherichia coli O27:H7 strain B4103-1 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

63. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP019253 (Escherichia coli strain 13KWH46 plasmid p13KWH46-3, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

64. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP019276 (Escherichia coli strain 13P477T plasmid p13P477T-3, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

65. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP019276 (Escherichia coli strain 13P477T plasmid p13P477T-3, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
atccttgttaaaaccacgggcaccatgcagatgc	Protospacer
. *********.**********************

66. spacer 2.1|1505969|34|CP025979|PILER-CR matches to MT077880 (Escherichia coli plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

67. spacer 2.1|1505969|34|CP025979|PILER-CR matches to CP051693 (Escherichia coli strain SCU-318 plasmid pSCU-318-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

68. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP041621 (Shigella flexneri strain C32 plasmid pC32_2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

69. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP045189 (Escherichia coli strain NT1F31 plasmid pNT1F31-96kb, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

70. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP015847 (Escherichia coli O157:H7 strain FRIK2069 plasmid p0157, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

71. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP024285 (Escherichia albertii strain 2014C-4356 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

72. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP027327 (Escherichia coli strain 2013C-4830 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

73. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP028118 (Escherichia coli O111 str. RM9322 plasmid pRM9322-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

74. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP019248 (Escherichia coli strain Combat13F7 plasmid pCombat13F7-3, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

75. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP019261 (Escherichia coli strain 13C1065T plasmid p13C1065T-2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

76. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP029243 (Escherichia coli strain ECCRA-119 plasmid pTB201, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

77. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP031548 (Escherichia coli strain cq9 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

78. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP014096 (Shigella sonnei strain FDAARGOS_90 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

79. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP014966 (Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2010K-1587 plasmid pSTY1-2010K-1587, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

80. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP021341 (Escherichia coli strain 95NR1 plasmid p95NR1B, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

81. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP021337 (Escherichia coli strain 95JB1 plasmid p95JB1B, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

82. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP024718 (Escherichia coli strain LS4 plasmid p1LS4, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

83. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP027375 (Escherichia coli strain 05-3629 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

84. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP028382 (Escherichia coli strain RM10466 plasmid pRM10466-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

85. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP029748 (Escherichia coli strain 2016C-3878 plasmid pMCR1-PA, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

86. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP044146 (Escherichia coli O157 strain AR-0428 plasmid pAR-0428-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

87. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP023351 (Escherichia coli strain ETEC-2264 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

88. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP024721 (Escherichia coli isolate NQ3 plasmid p1NQ3, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

89. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP027384 (Escherichia coli strain 2013C-3250 plasmid unnamed4) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

90. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP027385 (Escherichia coli strain 2013C-3250 plasmid unnamed5, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

91. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP012632 (Escherichia coli strain SF-173 plasmid pSF-173-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

92. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP032397 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 plasmid p22429, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

93. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP027130 (Escherichia coli strain AR_0372 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

94. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP049355 (Escherichia coli strain T28R plasmid pT28R-2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

95. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP047380 (Escherichia coli strain CAU16175 plasmid pCAU16175_2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

96. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP038375 (Escherichia coli O157:H7 strain F3113 plasmid pF3113-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

97. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP033091 (Escherichia coli DSM 30083 = JCM 1649 = ATCC 11775 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

98. spacer 2.1|1505969|34|CP025979|PILER-CR matches to LT906556 (Escherichia coli isolate E. coli RL465 genome assembly, plasmid: I) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

99. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP044139 (Escherichia coli O157 strain AR-0430 plasmid pAR-0430-3, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

100. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP017250 (Escherichia coli strain NADC 5570/86-24/6565 isolate mutant plasmid pO157, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

101. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP032264 (Escherichia coli strain AR_0089 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

102. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP053232 (Escherichia coli strain SCU-306 plasmid pSCU-306-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

103. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP053236 (Escherichia coli strain SCU-106 plasmid pSCU-106-2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

104. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP013832 (Escherichia coli strain CD306 plasmid pCD306, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

105. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP041420 (Escherichia coli strain STEC711 plasmid pSTEC711_4, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

106. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP049937 (Escherichia coli strain JL05 plasmid pARG01, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

107. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP038332 (Escherichia coli O157:H7 strain NE 1092-2 plasmid pNE1092-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

108. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP038308 (Escherichia coli O157:H7 strain SS NE 1040-1 plasmid pNE1040-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

109. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP038299 (Escherichia coli O157:H7 strain TB182A plasmid pTB182A-5, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

110. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP038314 (Escherichia coli O157:H7 strain OK1 plasmid pOK1-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

111. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP019018 (Escherichia coli strain Ecol_244 plasmid pEC244_2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

112. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP042619 (Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-4, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

113. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP011916 (Escherichia coli strain PSUO2 plasmid pPSUO2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

114. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP019456 (Escherichia coli strain FHI_NMBU_03 plasmid pFHI_NMBU_03_1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

115. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP041436 (Escherichia coli strain STEC309 plasmid pSTEC309, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

116. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP018994 (Escherichia coli strain Ecol_AZ147 plasmid pECAZ147_1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

117. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP038323 (Escherichia coli O157:H7 strain NE1127 plasmid pNE1127-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

118. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP038413 (Escherichia coli O157:H7 strain 493/89 plasmid p493-89-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

119. spacer 2.1|1505969|34|CP025979|PILER-CR matches to LC019731 (Escherichia coli plasmid pCMY2 DNA, complete sequence, strain: TVGHEC01) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

120. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP015239 (Escherichia coli strain 2011C-3911 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

121. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP043415 (Escherichia coli strain EC42405 plasmid pNTEC2-42405, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

122. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP011019 (Escherichia coli strain CI5 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

123. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP034796 (Escherichia coli strain 08-3918 plasmid p08-3918-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

124. spacer 2.1|1505969|34|CP025979|PILER-CR matches to AP014654 (Escherichia coli O169:H41 plasmid pEntYN10 DNA, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

125. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP012500 (Escherichia coli strain 09-00049 plasmid pCFSAN004180G, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

126. spacer 2.1|1505969|34|CP025979|PILER-CR matches to CP031283 (Escherichia fergusonii strain 40A plasmid p150_40A, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

127. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP047878 (Escherichia coli strain LD22-1 plasmid pLD22-1-135kb, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

128. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_AP018805 (Escherichia coli strain E2863 plasmid pE2863-3, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

129. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP046718 (Escherichia coli strain T16R plasmid pT16R-2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

130. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP041303 (Escherichia coli strain MSHS 133 plasmid pCys-11, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

131. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP010181 (Escherichia coli strain M1 plasmid A, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

132. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP024852 (Escherichia coli strain AR_0006 plasmid tig00000164, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

133. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP026754 (Escherichia coli strain AR_0077 plasmid tig00000042_pilon, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

134. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP027441 (Escherichia coli strain 2012C-4502 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

135. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP012636 (Escherichia coli strain SF-088 plasmid pSF-088-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

136. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_LT985252 (Escherichia coli strain 666 plasmid RCS51_p, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

137. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_LT985252 (Escherichia coli strain 666 plasmid RCS51_p, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
atccttgttaaaaccacgggcaccatgcagatgc	Protospacer
. *********.**********************

138. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP007135 (Escherichia coli O145:H28 str. RM12761 plasmid pO145-12761, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

139. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP025850 (Escherichia coli strain 600468 plasmid p600468_158, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

140. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_AP019676 (Escherichia coli strain GSH8M-2 plasmid pGSH8M-2-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

141. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NC_024956 (Escherichia coli strain K-12 plasmid pDM0133, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

142. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP005999 (Escherichia coli B7A plasmid pEB1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

143. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP006001 (Escherichia coli B7A plasmid pEB3, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

144. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP022227 (Escherichia coli strain WCHEC96200 plasmid pCTXM15_000200, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

145. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP027448 (Escherichia coli strain 2014C-3075 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

146. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP006263 (Escherichia coli O145:H28 str. RM13516 plasmid pO145-13516, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

147. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP029104 (Escherichia coli strain AR437 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

148. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP051750 (Escherichia coli strain SCU-486 plasmid pSCU-486-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

149. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP051739 (Escherichia coli strain SCU-105 plasmid pSCU-105-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

150. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NC_019089 (Escherichia coli plasmid pGUE-NDM, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

151. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NC_019094 (Escherichia coli plasmid p417H-90, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

152. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP010241 (Escherichia coli strain C7 plasmid A, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

153. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP024827 (Escherichia coli strain CREC-544 plasmid pCREC-544_1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

154. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP024856 (Escherichia coli strain AR_0011 plasmid tig00001011_pilon, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

155. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP027222 (Escherichia coli strain 2015C-3101 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

156. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP034793 (Escherichia coli strain 2009C-3378 plasmid p2009C-3378, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

157. spacer 2.1|1505969|34|CP025979|PILER-CR matches to KU932028 (Escherichia coli plasmid pEC14III, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

158. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NC_025175 (Escherichia coli plasmid pH2332-166, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

159. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NC_025176 (Escherichia coli plasmid pH2291-112, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

160. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP024265 (Escherichia coli O169:H41 strain F6326-C1 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

161. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP024151 (Escherichia coli strain 14EC033 plasmid p14EC033d, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

162. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP027598 (Escherichia coli strain 86-3153 plasmid unnamed) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

163. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP051699 (Escherichia coli strain SCU-152 plasmid pSCU-152-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

164. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NC_025139 (Escherichia coli plasmid pH2291-144, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

165. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NC_025143 (Escherichia coli plasmid pC59-112, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

166. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NC_025144 (Escherichia coli plasmid pC49-108, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

167. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP022913 (Escherichia coli O6:H16 strain 2011EL-1370-2 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

168. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP024258 (Escherichia coli O25:H16 strain F5505-C1 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

169. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP027535 (Escherichia coli strain AR_0081 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

170. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP027308 (Escherichia coli strain 2015C-3108 plasmid unnamed1) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

171. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP013026 (Escherichia coli strain 2009C-3133 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

172. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP010149 (Escherichia coli strain D6 plasmid A, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

173. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_LS992172 (Escherichia coli isolate Escherichia coli str. TO73 plasmid 2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

174. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_AP017621 (Escherichia coli strain MRY15-131 plasmid pMRY15-131_1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

175. spacer 2.1|1505969|34|CP025979|PILER-CR matches to CP054458 (Escherichia coli strain SCU-103 plasmid pSCU-103-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

176. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP024242 (Escherichia coli O114:H49 strain 90-9280 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

177. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP041301 (Escherichia coli strain MSHS 472 plasmid pCys-6, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

178. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NC_019037 (Escherichia coli plasmid pChi7122-2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

179. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP010215 (Escherichia coli strain M15 plasmid B, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

180. spacer 2.1|1505969|34|CP025979|PILER-CR matches to CP050167 (Escherichia coli plasmid Carbapenemase(NDM-4)_IncFIB, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

181. spacer 2.1|1505969|34|CP025979|PILER-CR matches to CP054455 (Escherichia coli strain SCU-487 plasmid pSCU-487-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

182. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NC_014382 (Escherichia coli plasmid pEC_B24, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

183. spacer 2.1|1505969|34|CP025979|PILER-CR matches to CP025909 (Escherichia coli strain 204576 plasmid p204576_83, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

184. spacer 2.1|1505969|34|CP025979|PILER-CR matches to CP043759 (Escherichia coli strain CVM N55972 plasmid pN55972-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

185. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP024129 (Escherichia coli strain 14EC001 plasmid p14EC001b, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

186. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP027458 (Escherichia coli strain 88-3493 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

187. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP027341 (Escherichia coli strain 2015C-3121 plasmid unnamed) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

188. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NC_017640 (Escherichia coli UMNK88 plasmid pUMNK88_Ent, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

189. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP024238 (Escherichia coli O15:H11 strain 90-9272 plasmid unnamed) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

190. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP041111 (Escherichia coli strain ECCTRSRTH03 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

191. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP042247 (Escherichia coli strain BCE049 plasmid pBCE049-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

192. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP024237 (Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed5, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

193. spacer 2.1|1505969|34|CP025979|PILER-CR matches to KU578032 (Escherichia coli plasmid pCERC4, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

194. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP042586 (Escherichia coli strain LD91-1 plasmid pLD91-1-146kb, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

195. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP018973 (Escherichia coli strain Ecol_545 plasmid pEC545_3, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

196. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_LS992193 (Escherichia coli isolate Escherichia coli str. TO217 plasmid 2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

197. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP012928 (Salmonella enterica subsp. enterica serovar Heidelberg strain 12-4374 plasmid p12-4374_62, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

198. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NC_010409 (Escherichia coli plasmid pVM01, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

199. spacer 2.1|1505969|34|CP025979|PILER-CR matches to LN908840 (Escherichia coli plasmid pCss_E1373) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

200. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP039475 (Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000968 plasmid pCFSAN000968_2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

201. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP027372 (Escherichia coli strain 2015C-3905 plasmid unnamed) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

202. spacer 2.1|1505969|34|CP025979|PILER-CR matches to CP043743 (Escherichia coli strain CVM N17EC0211 plasmid pN17EC0211, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

203. spacer 2.1|1505969|34|CP025979|PILER-CR matches to CP034937 (Escherichia coli strain PNUSAE013304 plasmid p2018C-3602, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

204. spacer 2.1|1505969|34|CP025979|PILER-CR matches to MN419430 (Escherichia coli strain 2016-4017437 plasmid p17437, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

205. spacer 2.1|1505969|34|CP025979|PILER-CR matches to MN419431 (Escherichia coli strain 2016-40-19138 plasmid p19138, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

206. spacer 2.1|1505969|34|CP025979|PILER-CR matches to MN419432 (Escherichia coli strain 2016-40-21254 plasmid p21254, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

207. spacer 2.1|1505969|34|CP025979|PILER-CR matches to MN419433 (Escherichia coli strain 2016-40-20426 plasmid p20426, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

208. spacer 2.1|1505969|34|CP025979|PILER-CR matches to MN419436 (Escherichia coli strain 2016-40-22440 plasmid p22440, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

209. spacer 2.1|1505969|34|CP025979|PILER-CR matches to MN419437 (Escherichia coli strain 2016-40-22638 plasmid p22638, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

210. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP020934 (Escherichia coli strain HB-Coli0 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

211. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP048440 (Escherichia coli strain NBRC 3301 plasmid putative_pEcol1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

212. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP029058 (Escherichia coli strain FORC_081 plasmid pFORC_081_1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

213. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP029058 (Escherichia coli strain FORC_081 plasmid pFORC_081_1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

214. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NC_006671 (Escherichia coli A2363 plasmid pAPEC-O2-R, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

215. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NC_011980 (Escherichia coli chi7122 plasmid pAPEC-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

216. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP012499 (Escherichia coli strain GB089 plasmid pCFSAN004181P, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

217. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP027551 (Escherichia coli strain 2015C-4136CT1 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

218. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP039604 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014868 plasmid p12-6919.1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

219. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP028120 (Escherichia coli O43 str. RM10042 plasmid pRM10042-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

220. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP053282 (Escherichia coli strain SCU-308 plasmid pSCU-308-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

221. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP010239 (Escherichia coli strain S50 plasmid A, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

222. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP010239 (Escherichia coli strain S50 plasmid A, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
atccttgttaaaaccacgggcaccatgcagatgc	Protospacer
. *********.**********************

223. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP030785 (Escherichia albertii strain 2012EL-1823B plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

224. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP030780 (Escherichia albertii strain 05-3106 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

225. spacer 2.1|1505969|34|CP025979|PILER-CR matches to MN823988 (Escherichia coli strain 14406 plasmid p14406-FII, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

226. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NC_007365 (Escherichia coli EH41 plasmid pO113, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

227. spacer 2.1|1505969|34|CP025979|PILER-CR matches to JX486126 (Uncultured bacterium plasmid pEFC36a, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

228. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP047667 (Escherichia coli strain LD26-1 plasmid pLD26-1-135kb, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

229. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP024249 (Escherichia coli O182:H21 strain D181 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

230. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP024250 (Escherichia coli O182:H21 strain D181 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

231. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP031107 (Escherichia coli strain AMSCJX02 plasmid pAMSC2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

232. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_AP019763 (Escherichia coli O111:H- strain 110512 plasmid pO111-110512_2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

233. spacer 2.1|1505969|34|CP025979|PILER-CR matches to AP023228 (Escherichia coli YJ3 plasmid pYJ3-a DNA, complete genome) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

234. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP026579 (Escherichia coli strain WCHEC005237 plasmid pRmtB1_005237, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

235. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP014112 (Escherichia coli strain FDAARGOS_144 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

236. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP028628 (Escherichia coli strain 137 plasmid pTA137, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

237. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP010184 (Escherichia coli strain M3 plasmid A, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

238. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP010192 (Escherichia coli strain M8 plasmid A, complete genome) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

239. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP022052 (Escherichia coli O157 strain FDAARGOS_293 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

240. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP012113 (Escherichia coli strain PSUO78 plasmid pPSUO78_1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

241. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP048026 (Escherichia coli strain GZEC065 plasmid pTEM1-GZEC065, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

242. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP029744 (Escherichia coli strain AR_0085 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

243. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP023821 (Escherichia coli strain 7/2 plasmid p7_2.1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

244. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_AP023199 (Escherichia coli strain TUM18780 plasmid pMTY18780-2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

245. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP027703 (Escherichia coli strain 675SK2 plasmid p675SK2_B, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

246. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP029975 (Escherichia coli strain 51008369SK1 plasmid p51008369SK1_B, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

247. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP049202 (Escherichia coli strain PapRG-04-4 plasmid pIncFIB, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

248. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP050751 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST46 plasmid pST46-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

249. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_AP018800 (Escherichia coli strain E2855 plasmid pE2855-4, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

250. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP041920 (Escherichia coli strain Ec40743 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

251. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP040454 (Escherichia coli strain UPEC132 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

252. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP040455 (Escherichia coli strain UPEC132 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

253. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP015844 (Escherichia coli O157:H7 strain FRIK2455 plasmid pO157, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

254. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP051224 (Escherichia coli strain SCZE5 plasmid pSCZE2) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

255. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP038455 (Escherichia coli strain EC-129 plasmid pEC129_2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

256. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NC_018954 (Salmonella enterica subsp. enterica serovar Kentucky plasmid pCS0010A, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

257. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NC_018966 (Salmonella enterica subsp. enterica serovar Kentucky plasmid pSSAP03302A, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

258. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP041997 (Escherichia coli strain AR Bank #0349 plasmid pAR349, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

259. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP014489 (Escherichia coli strain G749 plasmid pG749_1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

260. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP032395 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 22453 plasmid p22453_1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

261. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP032891 (Escherichia coli strain SCEC020022 plasmid pVir_020022, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

262. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP034805 (Escherichia coli strain 2009C-3554 plasmid p2009C-3554-2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

263. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP050732 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST101 plasmid pST101-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

264. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP050754 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST45 plasmid pST45-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

265. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP043228 (Escherichia coli strain Ec-050 plasmid pEc-050-TEM-30, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

266. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP020338 (Shigella flexneri 4c strain 1602 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

267. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP024140 (Escherichia coli strain 14EC020 plasmid p14EC020b, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

268. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NC_021155 (Salmonella enterica subsp. enterica serovar Typhimurium str. U288 plasmid pSTU288-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

269. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_AP014804 (Escherichia coli O119:H6 strain EC404/03 plasmid pEC404/03-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

270. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP044149 (Escherichia coli O157 strain AR-0427 plasmid pAR-0427-1) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

271. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP044150 (Escherichia coli O157 strain AR-0427 plasmid pAR-0427-2) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

272. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP021733 (Escherichia coli strain AR_0114 plasmid unitig_1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

273. spacer 2.1|1505969|34|CP025979|PILER-CR matches to CP025968 (Escherichia coli strain 2407 a plasmid p2407a_135, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

274. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP019905 (Escherichia coli strain MDR_56 plasmid unnamed6, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

275. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP049102 (Escherichia coli strain EC28 plasmid p2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

276. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NC_017659 (Escherichia coli O83:H1 str. NRG 857C plasmid pO83_CORR, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

277. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP026940 (Escherichia coli strain CFS3313 plasmid pCFS3313-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

278. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP037904 (Escherichia coli strain LHM10-1 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

279. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP042245 (Escherichia coli strain PU-1 plasmid pColV-PU1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

280. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP018643 (Salmonella enterica subsp. enterica serovar Enteritidis strain 74-1357 plasmid pSE74-1357, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

281. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP017252 (Escherichia coli strain NADC 5570/86-24/6564 isolate wild type plasmid pO157, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

282. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_LT985265 (Escherichia coli strain 364 plasmid RCS57TR364_p, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

283. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_LT985271 (Escherichia coli strain 661 plasmid RCS59_p, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

284. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_LT985306 (Escherichia coli strain ECOR 37 plasmid RCS88_p, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

285. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_LT985275 (Escherichia coli strain R71 plasmid RCS70_p, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

286. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_LT985293 (Escherichia coli strain 4410-1 plasmid RCS79_p, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

287. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_LT985221 (Escherichia coli strain TN03 plasmid RCS22_p, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

288. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_LT985227 (Escherichia coli strain 518 plasmid RCS28_pI, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

289. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP023471 (Salmonella enterica subsp. enterica strain BAA-1672 plasmid pSalSendai, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

290. spacer 2.1|1505969|34|CP025979|PILER-CR matches to MN807689 (Escherichia coli strain A241 plasmid pA241-TEM, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

291. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_MK430046 (Escherichia coli strain 11.4-R4 plasmid pCERC13, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

292. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_MK461929 (Escherichia coli strain 2009_36 plasmid p2009_36_F, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

293. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_MK461928 (Escherichia coli strain F2_14D plasmid pF2_14D_F, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

294. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_MN053930 (Escherichia coli strain 2.3-R4 plasmid pCERC14, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

295. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP045976 (Escherichia coli strain AUSMDU00002545 plasmid pAUSMDU00002545_01, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

296. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_MH580302 (Escherichia coli strain 1107 plasmid p1107-118K, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

297. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_MK070495 (Escherichia coli strain MB6212 plasmid pMB5876, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

298. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP006635 (Escherichia coli PCN033 plasmid p3PCN033, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

299. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP027127 (Escherichia coli strain AR_0374 plasmid unnamed2) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

300. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_MF370216 (Escherichia coli strain J53 plasmid pOX38-Gen, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

301. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_MG014722 (Escherichia coli strain P2-3 plasmid pP2-3T, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

302. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_MG014720 (Escherichia coli strain A74 plasmid pA74T, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

303. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_KY689635 (Escherichia coli strain Mbl536 plasmid pMbl536, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

304. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_MG825378 (Escherichia coli strain 1108 plasmid p1108-IncFIB, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

305. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_KY565558 (Escherichia coli strain Mbl488 plasmid pMbl488, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

306. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_MH202955 (Escherichia coli strain HXH-1 plasmid pHXH-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

307. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_MH195200 (Escherichia coli strain 2009-52 plasmid pSDJ2009-52F, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

308. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP023828 (Escherichia coli strain 4/4 plasmid p4_4.2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

309. spacer 2.1|1505969|34|CP025979|PILER-CR matches to MN816372 (Escherichia coli strain A130 plasmid pA130-TEM, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

310. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_MG299151 (Shigella sonnei strain SH287-2 plasmid pSH287-2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

311. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_KY471628 (Shigella sonnei strain SH15sh99 plasmid pSH15sh99, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

312. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_MG299131 (Shigella sonnei strain SH271-2 plasmid pSH271-2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

313. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_KY471629 (Shigella sonnei strain SH15sh105 plasmid pSH15sh104, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

314. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_MG299133 (Shigella sonnei strain SH272-2 plasmid pSH272-2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

315. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NC_022651 (Escherichia coli JJ1886 plasmid pJJ1886_5, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

316. spacer 2.1|1505969|34|CP025979|PILER-CR matches to MF679146 (Escherichia coli plasmid pBJ114-141, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

317. spacer 2.1|1505969|34|CP025979|PILER-CR matches to MF679147 (Escherichia coli plasmid pBJ114T-190, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

318. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_MG299128 (Shigella sonnei strain SH262-2 plasmid pSH262-2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

319. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_MG299147 (Shigella sonnei strain SH284-2 plasmid pSH284-2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

320. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_KX276657 (Escherichia coli strain MRSN388634 plasmid pMR0516mcr, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

321. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP025922 (Escherichia coli strain 103605 plasmid p103605_83, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

322. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_KR653209 (Escherichia coli strain GDZ13 plasmid pGD0503Z13, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

323. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_KT002541 (Escherichia coli strain HeB7 plasmid pHeBE7, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

324. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_KR905384 (Escherichia coli strain DV45 plasmid pDV45, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

325. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_KR905389 (Escherichia coli isolate 4809.66 plasmid p4809.66, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

326. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_KR905385 (Escherichia coli strain 5312.29 plasmid p5312.29, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

327. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_KM377238 (Escherichia coli strain HV114 plasmid pHV114, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

328. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_KM377239 (Escherichia coli strain HV292 plasmid pHV292, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

329. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_KP198616 (Escherichia coli strain C0996A plasmid pCTXM123_C0996, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

330. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_KM377240 (Escherichia coli strain HV295 plasmid pHV295, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

331. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_KP398867 (Escherichia coli strain DB04277 plasmid pDB4277, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

332. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP018626 (Escherichia coli strain FORC_044 plasmid pFORC44_2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

333. spacer 2.1|1505969|34|CP025979|PILER-CR matches to CP043016 (Escherichia coli strain 388808_gen plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

334. spacer 2.1|1505969|34|CP025979|PILER-CR matches to CP043023 (Escherichia coli strain 399730_gen plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

335. spacer 2.1|1505969|34|CP025979|PILER-CR matches to CP043012 (Escherichia coli strain 388755_gen plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

336. spacer 2.1|1505969|34|CP025979|PILER-CR matches to CP043012 (Escherichia coli strain 388755_gen plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

337. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP010147 (Escherichia coli strain D5 plasmid B, complete genome) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

338. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP042630 (Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-3, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

339. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP032806 (Escherichia coli strain ERL05-0623 plasmid pERL05-0623-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

340. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP015246 (Escherichia coli O91 str. RM7190 plasmid pRM7190-2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

341. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP041624 (Escherichia coli O157:H7 strain ATCC 43888 plasmid pO157_like, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

342. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP032798 (Escherichia coli strain ERL06-2497 plasmid pERL06-2497-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

343. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP032799 (Escherichia coli strain ERL06-2497 plasmid pERL06-2497-2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

344. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP024272 (Escherichia coli strain F8111-1SC3 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

345. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP010138 (Escherichia coli strain D2 plasmid A, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

346. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP010141 (Escherichia coli strain D3 plasmid A, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

347. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP032445 (Salmonella enterica subsp. enterica serovar Fresno strain USMARC-69835 plasmid pSFR1-USMARC-69835, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

348. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP035479 (Escherichia coli strain U13A plasmid pU13A_B, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

349. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP031907 (Escherichia coli O91:H21 strain FWSEC0008 plasmid unnamed17, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

350. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_KT754162 (Shigella dysenteriae 1 strain BU53M1 plasmid pBU53M1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

351. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP028651 (Escherichia coli strain 124 plasmid pTA124, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

352. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP028653 (Escherichia coli strain 123 plasmid pTA123, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

353. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP028679 (Escherichia coli strain 114 plasmid pTA114, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

354. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP028701 (Escherichia coli strain 105 plasmid pTA105, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

355. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP043219 (Escherichia coli O80:H26 strain EC-107 plasmid pET6.2-IncFII, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

356. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP018116 (Escherichia coli strain MRSN346638 plasmid pMRSN346638_119.3, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

357. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP018110 (Escherichia coli strain MRSN346595 plasmid pMRSN346595_120.3, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

358. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP038182 (Escherichia coli strain 2 HS-C plasmid p2HS-C-2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

359. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP039299 (Escherichia coli strain PigCaeca_1 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

360. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP028634 (Escherichia coli strain 135 plasmid pTA135, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

361. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP028637 (Escherichia coli strain 134 plasmid pTA134, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

362. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP040573 (Escherichia coli O157:H7 strain ECP17-46 plasmid pCFSAN059540, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

363. spacer 2.1|1505969|34|CP025979|PILER-CR matches to CP042949 (Escherichia coli strain ATCC 51435 plasmid pB2F1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

364. spacer 2.1|1505969|34|CP025979|PILER-CR matches to CP042948 (Escherichia coli strain 90-9133 plasmid p90-9133_1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

365. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP010305 (Escherichia coli O157:H7 str. SS52 plasmid p0157, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

366. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP032804 (Escherichia coli strain ERL05-1306 plasmid pERL05-1306, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

367. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP018638 (Salmonella enterica subsp. enterica serovar Enteritidis strain 69-3861 plasmid pSE69-3861-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

368. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP053733 (Escherichia coli strain CP55_Sichuan plasmid pCP55-141k, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

369. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP053786 (Escherichia coli isolate 2-101 plasmid p2-101, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

370. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP028640 (Escherichia coli strain 133 plasmid pTA133, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

371. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NC_025106 (Escherichia coli strain NMI5428/11 plasmid pMC-NDM, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

372. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP017848 (Escherichia coli strain FMU073332 plasmid pEcoFMU07332d sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

373. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP032802 (Escherichia coli strain ERL06-2442 plasmid pERL06-2442, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

374. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP020510 (Escherichia coli strain 165 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

375. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP020546 (Escherichia coli strain ZJ3920 plasmid pZJ3920-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

376. spacer 2.1|1505969|34|CP025979|PILER-CR matches to CP043737 (Escherichia coli strain CVM N17EC0616 plasmid pN17EC0616-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

377. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP010316 (Escherichia coli strain 789 plasmid pAPEC-O78-ColV) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

378. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP029575 (Escherichia coli strain DA33133 plasmid pDA33133-157, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

379. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_LS999562 (Escherichia coli isolate EC-TO143 plasmid 3, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

380. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_LS998786 (Escherichia coli isolate EC-TO75 plasmid 2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

381. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_LS998786 (Escherichia coli isolate EC-TO75 plasmid 2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

382. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

383. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP053788 (Escherichia coli isolate J31 plasmid pJ31, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

384. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP053737 (Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncFII, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

385. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP053725 (Escherichia coli strain CP66-6_Sichuan plasmid pCP66-6-IncFII, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

386. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_KF290378 (Salmonella enterica subsp. enterica serovar Typhimurium strain STm2 plasmid pSTM2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

387. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

388. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP028595 (Escherichia coli strain 150 plasmid pTA150, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

389. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP028616 (Escherichia coli strain 141 plasmid pTA141, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

390. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NC_013010 (Escherichia coli O157:H7 str. TW14359 plasmid pO157, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

391. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP032796 (Escherichia coli strain ERL06-2503 plasmid pERL06-2503, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

392. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP021847 (Escherichia coli strain EC1515 plasmid pEC1515-3, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

393. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP021847 (Escherichia coli strain EC1515 plasmid pEC1515-3, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

394. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP019282 (Escherichia coli strain 13P484A plasmid p13P484A-2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

395. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP012626 (Escherichia coli strain SF-468 plasmid pSF-468-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

396. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP028431 (Escherichia coli strain RM9131 plasmid pRM9131-2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

397. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP051220 (Escherichia coli strain SFE8 plasmid pSCZP1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

398. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP048295 (Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-3, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

399. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP048296 (Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

400. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NC_013122 (Escherichia coli plasmid pEK499, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

401. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP010372 (Escherichia coli strain 6409 plasmid p6409-151.583kb, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

402. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP032790 (Escherichia coli strain NZRM4169 plasmid pNZRM4169, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

403. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP024274 (Escherichia coli strain F9792 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

404. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP019251 (Escherichia coli strain 13KWH46 plasmid p13KWH46-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

405. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP019252 (Escherichia coli strain 13KWH46 plasmid p13KWH46-2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

406. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP021728 (Escherichia coli strain Combat11I9 plasmid pCombat11I9-2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

407. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP006641 (Escherichia coli PCN061 plasmid PCN061p5, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

408. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP035367 (Escherichia coli O157:H7 strain C1-057 plasmid pC1-057, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

409. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP049079 (Escherichia coli strain p11A plasmid p11A_p2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

410. spacer 2.1|1505969|34|CP025979|PILER-CR matches to MN158990 (Escherichia coli strain TREC4 plasmid pTREC4, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

411. spacer 2.1|1505969|34|CP025979|PILER-CR matches to MN158992 (Escherichia coli strain TREC9 plasmid pTREC9, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

412. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP028315 (Salmonella enterica subsp. enterica serovar Typhimurium var. 5- strain CFSAN067217 plasmid pSC-31-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

413. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP054942 (Escherichia coli strain MS6192 plasmid pMS6192B, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

414. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP012683 (Salmonella enterica subsp. enterica serovar Typhimurium strain 33676 plasmid p33673_IncF, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

415. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP024284 (Escherichia albertii strain 2014C-4356 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

416. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP026854 (Escherichia coli strain MS7163 plasmid pMS7163A, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

417. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP019247 (Escherichia coli strain Combat13F7 plasmid pCombat13F7-2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

418. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP019268 (Escherichia coli strain 13C1079T plasmid p13C1079T-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

419. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP019244 (Escherichia coli strain Combat2C1 plasmid pCombat2C1-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

420. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NC_018995 (Escherichia coli plasmid pHUSEC41-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

421. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NC_023329 (Escherichia coli strain B3804 plasmid pIFM3804, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

422. spacer 2.1|1505969|34|CP025979|PILER-CR matches to CP042642 (Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-4_MCR3, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

423. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP022064 (Salmonella enterica strain FDAARGOS_312 plasmid unnamed4, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

424. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP021843 (Escherichia coli strain EC974 plasmid pEC974-3, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

425. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP029691 (Escherichia coli strain SD134209 plasmid pSD134209-2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

426. spacer 2.1|1505969|34|CP025979|PILER-CR matches to MN061455 (Escherichia coli strain EC-15-3 plasmid pEC-15-3-NDM-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

427. spacer 2.1|1505969|34|CP025979|PILER-CR matches to MH450052 (Escherichia coli plasmid pHN32wt, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

428. spacer 2.1|1505969|34|CP025979|PILER-CR matches to MH450053 (Escherichia coli plasmid pHN32_1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

429. spacer 2.1|1505969|34|CP025979|PILER-CR matches to LC549806 (Escherichia coli VNCEc57 plasmid pVNCEc57 DNA, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

430. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP038410 (Escherichia coli O157:H7 strain 86-24 plasmid p86-24-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

431. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP038422 (Escherichia coli O157:H7 strain 7636 plasmid p7636-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

432. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NC_009602 (Escherichia coli plasmid pSFO157, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

433. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP016572 (Salmonella enterica subsp. enterica serovar Heidelberg strain AMR588-04-00320 plasmid pAMR588-04-00320_99, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

434. spacer 2.1|1505969|34|CP025979|PILER-CR matches to CM019851 (Escherichia coli strain CVM N17EC0326 plasmid pN17EC0326-1, complete sequence, whole genome shotgun sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

435. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP041415 (Escherichia coli strain STEC719 plasmid pSTEC719_4, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

436. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP041428 (Escherichia coli strain STEC388 plasmid pSTEC388_3, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

437. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP035752 (Escherichia coli E110019 plasmid pE110019_66, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

438. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP047381 (Escherichia coli strain CAU16175 plasmid pCAU16175_3, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

439. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP047381 (Escherichia coli strain CAU16175 plasmid pCAU16175_3, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

440. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP038356 (Escherichia coli O157:H7 str. F8092B plasmid pF8092B-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

441. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP038371 (Escherichia coli O157:H7 strain F6321 plasmid pF6321-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

442. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP038385 (Escherichia coli O157:H7 strain DEC5E plasmid pDEC5E-2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

443. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP038404 (Escherichia coli O157:H7 strain BB24-1 plasmid pBB24-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

444. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP038406 (Escherichia coli O157:H7 strain ATCC 35150 plasmid pATCC35150-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

445. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP038418 (Escherichia coli O157:H7 strain 3-5-1 plasmid pGM351-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

446. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP038420 (Escherichia coli O157:H7 strain 2-6-2 plasmid pEX262-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

447. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP038429 (Escherichia coli O157:H7 strain 611 plasmid p611-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

448. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP038335 (Escherichia coli O157:H7 strain N8B7-2 plasmid pN8B7-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

449. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP038348 (Escherichia coli O157:H7 strain G5295 plasmid pG5295-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

450. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP038359 (Escherichia coli O157:H7 strain F7508 plasmid pF7508-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

451. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP038373 (Escherichia coli O157:H7 strain F6294 plasmid pF6294-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

452. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP038382 (Escherichia coli O157:H7 strain E32511 plasmid pE32511-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

453. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP044144 (Escherichia coli O157 strain AR-0429 plasmid pAR-0429-2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

454. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP044183 (Salmonella enterica subsp. enterica serovar Heidelberg strain AR-0404 plasmid pAR-0404-2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

455. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP045756 (Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000752 plasmid p2CFSAN000752, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

456. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP024281 (Escherichia coli strain ATCC 43896 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

457. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP032263 (Escherichia coli strain AR_0089 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

458. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP032877 (Escherichia coli strain WCHEC000837 plasmid pCTXM15_000837, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

459. spacer 2.1|1505969|34|CP025979|PILER-CR matches to MN158991 (Escherichia coli strain TREC8 plasmid pTREC8, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

460. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP025239 (Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1928 plasmid pSNE2-1928, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

461. spacer 2.1|1505969|34|CP025979|PILER-CR matches to MK181557 (Escherichia coli plasmid p14019095, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

462. spacer 2.1|1505969|34|CP025979|PILER-CR matches to MK181558 (Escherichia coli plasmid p15076331, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

463. spacer 2.1|1505969|34|CP025979|PILER-CR matches to MK181559 (Escherichia coli plasmid p199, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

464. spacer 2.1|1505969|34|CP025979|PILER-CR matches to MK181560 (Escherichia coli plasmid p14006165, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

465. spacer 2.1|1505969|34|CP025979|PILER-CR matches to MK181561 (Escherichia coli plasmid p14011252, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

466. spacer 2.1|1505969|34|CP025979|PILER-CR matches to MK181562 (Escherichia coli plasmid p15090172, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

467. spacer 2.1|1505969|34|CP025979|PILER-CR matches to MK181563 (Escherichia coli plasmid p15095941, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

468. spacer 2.1|1505969|34|CP025979|PILER-CR matches to MK181564 (Escherichia coli plasmid p15124679, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

469. spacer 2.1|1505969|34|CP025979|PILER-CR matches to MK181565 (Escherichia coli plasmid pESBL20140131, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

470. spacer 2.1|1505969|34|CP025979|PILER-CR matches to MK181566 (Escherichia coli plasmid p15078279, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

471. spacer 2.1|1505969|34|CP025979|PILER-CR matches to MK181567 (Escherichia coli plasmid pESBL20150097, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

472. spacer 2.1|1505969|34|CP025979|PILER-CR matches to MK181568 (Escherichia coli plasmid pESBL20150178, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

473. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP012803 (Escherichia coli O157:H7 strain WS4202 isolate laboratory strain plasmid pO157-WS4202, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

474. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP028606 (Escherichia coli strain 144 plasmid pTA144, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

475. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP030000 (Salmonella enterica subsp. enterica serovar Brandenburg strain SA20113174 plasmid pSA20113174.1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

476. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP013833 (Escherichia coli strain JJ2434 plasmid pJJ2434_1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

477. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP044347 (Escherichia coli strain P225M plasmid pP225M-CTX-M-55, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

478. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP027357 (Escherichia coli strain 2013C-4991 plasmid unnamed2) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

479. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP041438 (Escherichia coli strain STEC005 plasmid pSTEC005, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

480. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP039562 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014847 plasmid p08-5333.1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

481. spacer 2.1|1505969|34|CP025979|PILER-CR matches to MF152729 (Escherichia coli plasmid pCTXM1-MU2, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

482. spacer 2.1|1505969|34|CP025979|PILER-CR matches to MN334220 (Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm37 plasmid pSTM37-118, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

483. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP038345 (Escherichia coli O157:H7 strain Gim1-1 plasmid pGM11-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

484. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP038293 (Escherichia coli O157:H7 strain TB21-1 plasmid pTB21-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

485. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP038312 (Escherichia coli O157:H7 strain Show KS 470-1 plasmid pKS470-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

486. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP038327 (Escherichia coli O157:H7 strain NE 1169-1 plasmid pNE1169-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

487. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP038343 (Escherichia coli O157:H7 strain H2495 plasmid pH2495-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

488. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP038354 (Escherichia coli O157:H7 strain F8797 plasmid pF8797-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

489. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP038368 (Escherichia coli O157:H7 strain F6667 plasmid pF6667-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

490. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP038379 (Escherichia coli O157:H7 strain F1273 plasmid pF1273-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

491. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP038401 (Escherichia coli O157:H7 strain DEC4E plasmid pDEC4E-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

492. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP038415 (Escherichia coli O157:H7 strain 17B6-2 plasmid p17B6-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

493. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP038426 (Escherichia coli O157:H7 strain 2571 plasmid p2571-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

494. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP038286 (Escherichia coli O157:H7 strain YB14-1 plasmid pYB14-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

495. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NC_024979 (Escherichia coli strain ESBL-305 plasmid pESBL-305, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

496. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP018240 (Escherichia coli strain 272 plasmid pO157, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

497. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP042621 (Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-6, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

498. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP040306 (Escherichia coli strain HB6 plasmid pO157, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

499. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP040310 (Escherichia coli strain 21B8 plasmid pO157, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

500. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP019007 (Escherichia coli strain Ecol_AZ159 plasmid pECAZ159_1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

501. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP019014 (Escherichia coli strain Ecol_AZ162 plasmid pECAZ162_KPC, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

502. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP038291 (Escherichia coli O157:H7 strain TX 265-1 plasmid pTX265-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

503. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP038304 (Escherichia coli O157:H7 strain SS TX 313-1 plasmid pTX313-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

504. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP038320 (Escherichia coli O157:H7 strain NE122 plasmid pNE122-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

505. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP038338 (Escherichia coli O157:H7 strain LSU61 plasmid pLSU61-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

506. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP038341 (Escherichia coli O157:H7 strain H6437 plasmid pH6437-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

507. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP038350 (Escherichia coli O157:H7 strain F8952 plasmid pF8952-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

508. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP038352 (Escherichia coli O157:H7 strain F8798 plasmid pF8798-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

509. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP038362 (Escherichia coli O157:H7 strain F7386 plasmid pF7386-1, complete sequence) position: , mismatch: 3, identity: 0.912

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacgggcaccatgcagatgc	Protospacer
. .*******************************

510. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP031548 (Escherichia coli strain cq9 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.882

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
atccttgttaaaaacacgggcaccatgcagatgc	Protospacer
. *********.* ********************

511. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP024238 (Escherichia coli O15:H11 strain 90-9272 plasmid unnamed) position: , mismatch: 4, identity: 0.882

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
atccttgtgaaaaccacgggcaccatgcagatgc	Protospacer
. ****** **.**********************

512. spacer 2.1|1505969|34|CP025979|PILER-CR matches to CP025968 (Escherichia coli strain 2407 a plasmid p2407a_135, complete sequence) position: , mismatch: 4, identity: 0.882

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
atccttgtgaaaaccacgggcaccatgcagatgc	Protospacer
. ****** **.**********************

513. spacer 2.1|1505969|34|CP025979|PILER-CR matches to NZ_CP042245 (Escherichia coli strain PU-1 plasmid pColV-PU1, complete sequence) position: , mismatch: 4, identity: 0.882

gaccttgttaagaccacgggcaccatgcagatgc	CRISPR spacer
attcttgttaagaccacaggcaccatgcagatgc	Protospacer
. .**************.****************

514. spacer 2.2|1506033|31|CP025979|PILER-CR matches to KM389217 (UNVERIFIED: Pseudomonas phage F_ET605sp/Pa1651 clone contig00002 genomic sequence) position: , mismatch: 5, identity: 0.839

gctggcgtccatctattcatatgccacgctg	CRISPR spacer
gaggccgtccctctatccatatgccacgctg	Protospacer
*  * ***** *****.**************

515. spacer 2.2|1506033|31|CP025979|PILER-CR matches to KC911857 (Salmonella phage SPC32N, complete genome) position: , mismatch: 7, identity: 0.774

gctggcgtccatctattcatatgccacgctg	CRISPR spacer
agtggacgccgtctattcatatgccgcgctg	Protospacer
. ***   **.**************.*****

516. spacer 2.2|1506033|31|CP025979|PILER-CR matches to KC911856 (Salmonella phage SPC32H, complete genome) position: , mismatch: 7, identity: 0.774

gctggcgtccatctattcatatgccacgctg	CRISPR spacer
agtggacgccgtctattcatatgccgcgctg	Protospacer
. ***   **.**************.*****

517. spacer 2.2|1506033|31|CP025979|PILER-CR matches to NC_016761 (Salmonella phage SPN1S, complete genome) position: , mismatch: 7, identity: 0.774

gctggcgtccatctattcatatgccacgctg	CRISPR spacer
agtggacgccgtctattcatatgccgcgctg	Protospacer
. ***   **.**************.*****

518. spacer 2.2|1506033|31|CP025979|PILER-CR matches to JQ691610 (Salmonella phage SPN9TCW, complete genome) position: , mismatch: 7, identity: 0.774

gctggcgtccatctattcatatgccacgctg	CRISPR spacer
agtggacgccgtctattcatatgccgcgctg	Protospacer
. ***   **.**************.*****

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 29125 : 42669 21 Enterobacteria_phage(75.0%) transposase NA
DBSCAN-SWA_2 263651 : 273098 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_3 497046 : 587018 106 Enterobacteria_phage(49.3%) portal,terminase,capsid,tail,tRNA,holin,transposase,plate,head,protease NA
DBSCAN-SWA_4 795974 : 884907 96 Enterobacteria_phage(39.58%) integrase,terminase,tail,holin,transposase,protease attL 809498:809557|attR 858905:860220
DBSCAN-SWA_5 934492 : 948387 12 Enterobacteria_phage(33.33%) tail,transposase NA
DBSCAN-SWA_6 1167561 : 1222990 59 Stx2-converting_phage(26.67%) integrase,transposase attL 1176293:1176308|attR 1224941:1224956
DBSCAN-SWA_7 1501548 : 1511499 6 Vibrio_phage(33.33%) protease NA
DBSCAN-SWA_8 1680953 : 1755041 88 Escherichia_phage(54.39%) tail,transposase,plate,head,protease NA
DBSCAN-SWA_9 1950192 : 2008213 51 Bacillus_phage(17.65%) protease,tRNA,transposase NA
DBSCAN-SWA_10 2161154 : 2170294 10 Stx2-converting_phage(42.86%) transposase NA
DBSCAN-SWA_11 2241165 : 2279968 30 Stx2-converting_phage(50.0%) plate,transposase NA
DBSCAN-SWA_12 2611586 : 2620328 9 Stx2-converting_phage(50.0%) integrase,transposase attL 2610585:2610599|attR 2615228:2615242
DBSCAN-SWA_13 2697083 : 2722004 35 Salmonella_phage(20.0%) integrase,protease,transposase attL 2702728:2702742|attR 2729664:2729678
DBSCAN-SWA_14 3337472 : 3353661 19 Enterobacteria_phage(60.0%) integrase,transposase NA
DBSCAN-SWA_15 3670765 : 3732831 57 uncultured_virus(33.33%) protease,transposase NA
DBSCAN-SWA_16 4034838 : 4081906 42 Stx2-converting_phage(40.0%) protease,plate,tRNA,transposase NA
DBSCAN-SWA_17 4301068 : 4309382 8 uncultured_Mediterranean_phage(28.57%) transposase NA
DBSCAN-SWA_18 4508674 : 4515155 7 Escherichia_phage(66.67%) transposase NA
DBSCAN-SWA_19 4634952 : 4671273 57 Enterobacteria_phage(47.27%) portal,lysis,terminase,transposase,head,coat NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP025980
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3996 : 30737 21 uncultured_virus(25.0%) transposase,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage