1. spacer 5.4|1572333|22|CP025599|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcggcc Protospacer
*********************
2. spacer 5.4|1572333|22|CP025599|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcggcc Protospacer
*********************
3. spacer 5.4|1572333|22|CP025599|CRISPRCasFinder matches to NZ_CP016457 (Sphingobium sp. RAC03 plasmid pBSY17_2, complete sequence) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcgggccggcggca Protospacer
**********.***********
4. spacer 5.15|1573152|22|CP025599|CRISPRCasFinder matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
5. spacer 5.15|1573152|22|CP025599|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
6. spacer 5.15|1573152|22|CP025599|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
7. spacer 5.15|1573152|22|CP025599|CRISPRCasFinder matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
8. spacer 5.2|1572225|22|CP025599|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
9. spacer 5.2|1572225|22|CP025599|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
10. spacer 5.2|1572225|22|CP025599|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
11. spacer 5.2|1572225|22|CP025599|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
12. spacer 5.2|1572225|22|CP025599|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
13. spacer 5.3|1572279|22|CP025599|CRISPRCasFinder matches to NZ_CP025510 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvD, complete sequence) position: , mismatch: 2, identity: 0.909
ggtaccgtcctcgccggcggtg CRISPR spacer
ggcaccgtcctcgccggcggtt Protospacer
**.******************
14. spacer 5.4|1572333|22|CP025599|CRISPRCasFinder matches to NZ_CP021032 (Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcc Protospacer
.********************
15. spacer 5.4|1572333|22|CP025599|CRISPRCasFinder matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
16. spacer 5.4|1572333|22|CP025599|CRISPRCasFinder matches to NZ_CP021028 (Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
17. spacer 5.4|1572333|22|CP025599|CRISPRCasFinder matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcc Protospacer
.********************
18. spacer 5.4|1572333|22|CP025599|CRISPRCasFinder matches to NZ_CP013503 (Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
19. spacer 5.4|1572333|22|CP025599|CRISPRCasFinder matches to NZ_CP013509 (Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
20. spacer 5.4|1572333|22|CP025599|CRISPRCasFinder matches to NZ_CP013520 (Rhizobium sp. N113 plasmid pRspN113c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
21. spacer 5.4|1572333|22|CP025599|CRISPRCasFinder matches to NZ_CP013493 (Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
22. spacer 5.4|1572333|22|CP025599|CRISPRCasFinder matches to NZ_CP013516 (Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
23. spacer 5.4|1572333|22|CP025599|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgggg Protospacer
******************** .
24. spacer 5.4|1572333|22|CP025599|CRISPRCasFinder matches to NZ_CP012698 (Microbacterium sp. No. 7 plasmid A, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
accgccgatcaggccggcggca Protospacer
..********************
25. spacer 5.4|1572333|22|CP025599|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
ctcggcgatcaggccggcggca Protospacer
*** *****************
26. spacer 5.4|1572333|22|CP025599|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
27. spacer 5.4|1572333|22|CP025599|CRISPRCasFinder matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
28. spacer 5.4|1572333|22|CP025599|CRISPRCasFinder matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
29. spacer 5.4|1572333|22|CP025599|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
30. spacer 5.4|1572333|22|CP025599|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcg Protospacer
***************** ***.
31. spacer 5.4|1572333|22|CP025599|CRISPRCasFinder matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
ggcgccgatcaggccggcggcc Protospacer
* *******************
32. spacer 5.4|1572333|22|CP025599|CRISPRCasFinder matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggcctgcggcg Protospacer
*************** *****.
33. spacer 5.4|1572333|22|CP025599|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
34. spacer 5.4|1572333|22|CP025599|CRISPRCasFinder matches to NZ_CP024312 (Rhizobium sp. NXC24 plasmid pRspNXC24a, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgccg Protospacer
******************* *.
35. spacer 5.4|1572333|22|CP025599|CRISPRCasFinder matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgagcaggccggcggcc Protospacer
******** ************
36. spacer 5.4|1572333|22|CP025599|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
37. spacer 5.5|1572387|25|CP025599|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
38. spacer 5.5|1572387|25|CP025599|CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
39. spacer 5.5|1572387|25|CP025599|CRISPRCasFinder matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
40. spacer 3.16|927323|24|CP025599|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
gaccgacctcggcggcgcgggcga Protospacer
.***************** ****.
41. spacer 3.16|927323|24|CP025599|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
caccggcctgggcggcgctggcgg Protospacer
****.*** **************
42. spacer 3.16|927323|24|CP025599|CRT matches to NZ_CP034768 (Enterobacter sp. N18-03635 plasmid pFRI-6, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
taacgtcctcggcggcgctggcgg Protospacer
* ** ******************
43. spacer 3.16|927323|24|CP025599|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
agccgacctcggcggcgatggcgc Protospacer
*.*************** *****
44. spacer 3.16|927323|24|CP025599|CRT matches to NZ_AP019631 (Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
taacgtcctcggcggcgctggcgg Protospacer
* ** ******************
45. spacer 3.16|927323|24|CP025599|CRT matches to NZ_AP019631 (Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
taacgtcctcggcggcgctggcgg Protospacer
* ** ******************
46. spacer 3.16|927323|24|CP025599|CRT matches to KU716094 (Mycobacterium phage Eidsmoe, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
gaccgcgctcggcggcgctggcgg Protospacer
.**** *****************
47. spacer 3.16|927323|24|CP025599|CRT matches to MH371122 (Mycobacterium phage Priya, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
gaccgcgctcggcggcgctggcgg Protospacer
.**** *****************
48. spacer 3.16|927323|24|CP025599|CRT matches to MK016502 (Mycobacterium phage Pat3, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
catcggcctcggcggcgctggcgg Protospacer
*.**.******************
49. spacer 3.16|927323|24|CP025599|CRT matches to MK937593 (Mycobacterium phage Flypotenuse, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
catcggcctcggcggcgctggcgg Protospacer
*.**.******************
50. spacer 3.16|927323|24|CP025599|CRT matches to MG872835 (Mycobacterium phage Conquerage, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
gaccgcgctcggcggcgctggcgg Protospacer
.**** *****************
51. spacer 3.16|927323|24|CP025599|CRT matches to MH536820 (Mycobacterium phage Glexan, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
catcggcctcggcggcgctggcgg Protospacer
*.**.******************
52. spacer 3.16|927323|24|CP025599|CRT matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
aaccggcctcggcggcgctgccgc Protospacer
*****.************** **
53. spacer 3.16|927323|24|CP025599|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
caccgagctcggcggcgctgccgg Protospacer
***** ************* ***
54. spacer 3.16|927323|24|CP025599|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
caccggcctcggcggcgcgggcgg Protospacer
****.************ *****
55. spacer 3.16|927323|24|CP025599|CRT matches to MH271298 (Microbacterium phage Floof, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
aacccacctcggcggcgatggcgc Protospacer
**** ************ *****
56. spacer 5.4|1572333|22|CP025599|CRISPRCasFinder matches to NZ_KY349138 (Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence) position: , mismatch: 3, identity: 0.864
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgcgg Protospacer
******************* .
57. spacer 5.4|1572333|22|CP025599|CRISPRCasFinder matches to NZ_CP021649 (Acidovorax sp. T1 plasmid p1-T1, complete sequence) position: , mismatch: 3, identity: 0.864
gtcgccgatcaggccggcggca CRISPR spacer
ttcgccgatcaggccggcggtg Protospacer
*******************..
58. spacer 5.5|1572387|25|CP025599|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
ctcgccgaacacgcggaagccgtct Protospacer
**.*********** *********
59. spacer 5.5|1572387|25|CP025599|CRISPRCasFinder matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
attgtcgaacacgcggaagccgtcg Protospacer
***.********* **********
60. spacer 5.5|1572387|25|CP025599|CRISPRCasFinder matches to MN586053 (Arthrobacter phage BeatusComedenti, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
61. spacer 5.5|1572387|25|CP025599|CRISPRCasFinder matches to NC_031254 (Arthrobacter phage Kitkat, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
62. spacer 5.5|1572387|25|CP025599|CRISPRCasFinder matches to NC_031231 (Arthrobacter phage KellEzio, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
63. spacer 5.5|1572387|25|CP025599|CRISPRCasFinder matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
catgcggaacacgccgaatccgtcg Protospacer
* *** ************ ******
64. spacer 5.5|1572387|25|CP025599|CRISPRCasFinder matches to NZ_CP030129 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgatcacgccgtagccgttg Protospacer
******** ******* ******.*
65. spacer 5.15|1573152|22|CP025599|CRISPRCasFinder matches to NC_008270 (Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence) position: , mismatch: 3, identity: 0.864
caatccggcggcgccgccggca CRISPR spacer
gaatccggcggcgccgccgggc Protospacer
*******************
66. spacer 6.5|2088465|24|CP025599|CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 3, identity: 0.875
atcgaagaagctgaacccgccgtt CRISPR spacer
cgcgaagaagctgaagccgccgtt Protospacer
************* ********
67. spacer 6.5|2088465|24|CP025599|CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 3, identity: 0.875
atcgaagaagctgaacccgccgtt CRISPR spacer
cgcgaagaagctgaagccgccgtt Protospacer
************* ********
68. spacer 1.1|366494|27|CP025599|CRISPRCasFinder matches to NC_023591 (Mycobacterium phage Adler, complete genome) position: , mismatch: 4, identity: 0.852
-aacgcaccggtgtccacatcgcccgtg CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg Protospacer
*..** ********* ***********
69. spacer 1.1|366494|27|CP025599|CRISPRCasFinder matches to KF981876 (UNVERIFIED: Mycobacterium phage ADLER F1725, complete genome) position: , mismatch: 4, identity: 0.852
-aacgcaccggtgtccacatcgcccgtg CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg Protospacer
*..** ********* ***********
70. spacer 1.7|366890|27|CP025599|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 4, identity: 0.852
gcgaagccgatgttgtagctgccggtg CRISPR spacer
ccgaagccgatgtcgtagcggccggcg Protospacer
************.***** *****.*
71. spacer 1.10|367100|27|CP025599|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgaaggtgaggtcgccgggg Protospacer
.* ********* ***********.**
72. spacer 1.10|367100|27|CP025599|CRISPRCasFinder matches to NC_016652 (Rhodococcus phage REQ2, complete genome) position: , mismatch: 4, identity: 0.852
accccgccgaagttgaggtcgccgagg CRISPR spacer
acggcgccgaagttgaggccgccgacg Protospacer
** **************.****** *
73. spacer 3.6|926882|27|CP025599|CRT matches to NZ_CP010326 (Pantoea sp. PSNIH1 plasmid pPSP-3a9, complete sequence) position: , mismatch: 4, identity: 0.852
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgtcagcggctgggctggcggggatat Protospacer
********** ************* .
74. spacer 3.6|926882|27|CP025599|CRT matches to NZ_CP021045 (Phaeobacter gallaeciensis strain P129 plasmid pP129_e, complete sequence) position: , mismatch: 4, identity: 0.852
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgacagcggcggggctggcggcgacag Protospacer
** ****************** ** .*
75. spacer 3.6|926882|27|CP025599|CRT matches to NZ_CP010678 (Phaeobacter gallaeciensis strain P75 plasmid pP75_e, complete sequence) position: , mismatch: 4, identity: 0.852
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgacagcggcggggctggcggcgacag Protospacer
** ****************** ** .*
76. spacer 3.6|926882|27|CP025599|CRT matches to NC_023142 (Phaeobacter gallaeciensis DSM 26640 plasmid pGal_F69, complete sequence) position: , mismatch: 4, identity: 0.852
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgacagcggcggggctggcggcgacag Protospacer
** ****************** ** .*
77. spacer 3.6|926882|27|CP025599|CRT matches to NZ_CP010789 (Phaeobacter gallaeciensis strain P63 plasmid pP63_e, complete sequence) position: , mismatch: 4, identity: 0.852
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgacagcggcggggctggcggcgacag Protospacer
** ****************** ** .*
78. spacer 3.6|926882|27|CP025599|CRT matches to NZ_CP010642 (Phaeobacter gallaeciensis strain P73 plasmid pP73_f, complete sequence) position: , mismatch: 4, identity: 0.852
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgacagcggcggggctggcggcgacag Protospacer
** ****************** ** .*
79. spacer 3.6|926882|27|CP025599|CRT matches to NZ_CP010593 (Phaeobacter gallaeciensis strain P11 plasmid pP11_e, complete sequence) position: , mismatch: 4, identity: 0.852
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgacagcggcggggctggcggcgacag Protospacer
** ****************** ** .*
80. spacer 3.6|926882|27|CP025599|CRT matches to AM419438 (Archaeal BJ1 virus complete genome) position: , mismatch: 4, identity: 0.852
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgtcggcggcgggggtggcgggggcgg Protospacer
****.********* ********. **
81. spacer 3.6|926882|27|CP025599|CRT matches to NC_008695 (Archaeal BJ1 virus, complete genome) position: , mismatch: 4, identity: 0.852
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgtcggcggcgggggtggcgggggcgg Protospacer
****.********* ********. **
82. spacer 3.10|927038|27|CP025599|CRT matches to KY945355 (Mycobacterium phage Shandong1, complete genome) position: , mismatch: 4, identity: 0.852
cggatccggcggcggcggtagcgttgc CRISPR spacer
cgcatccggcggcggcggttgcgttct Protospacer
** **************** ***** .
83. spacer 3.10|927038|27|CP025599|CRT matches to NZ_CP015095 (Pelagibaca abyssi strain JLT2014 plasmid pPABY4, complete sequence) position: , mismatch: 4, identity: 0.852
cggatccggcggcggcggtagcgttgc CRISPR spacer
cggcctcggcggcggcggtggcgttgc Protospacer
*** ..*************.*******
84. spacer 3.10|927038|27|CP025599|CRT matches to NC_041888 (Mycobacterium phage Tortellini, complete genome) position: , mismatch: 4, identity: 0.852
cggatccggcggcggcggtagcgttgc CRISPR spacer
cggccgcggcggcggcggtagcggtgc Protospacer
*** . ***************** ***
85. spacer 3.15|927275|30|CP025599|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 4, identity: 0.867
cctgctgttcggctccggcggcgctggcgg- CRISPR spacer
gctgctgttcggcgccggcggcg-tggtggc Protospacer
************ ********* ***.**
86. spacer 3.16|927323|24|CP025599|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ctacgaccacggcggcgctggcgg Protospacer
***** ***************
87. spacer 3.16|927323|24|CP025599|CRT matches to NZ_CP025431 (Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
gcccgatctcggcggcgctggcgt Protospacer
. ****.****************
88. spacer 3.16|927323|24|CP025599|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
tcccgacctcggcggtgctggcgc Protospacer
*************.*******
89. spacer 3.16|927323|24|CP025599|CRT matches to NZ_CP016822 (Rhodococcus sp. p52 plasmid pDF03, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
cgtcgacgtcggcggcgctggcgg Protospacer
..**** ****************
90. spacer 3.16|927323|24|CP025599|CRT matches to MN582086 (Siphoviridae sp. ctdEk19, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
cttcgacttcggcggcgctggcgg Protospacer
.****.****************
91. spacer 3.16|927323|24|CP025599|CRT matches to MF919502 (Mycobacterium phage Demsculpinboyz, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ccgcggcctcggcggcgctggcgg Protospacer
**.******************
92. spacer 3.16|927323|24|CP025599|CRT matches to MT889380 (Mycobacterium phage Coco12, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ccgcggcctcggcggcgctggcgg Protospacer
**.******************
93. spacer 3.16|927323|24|CP025599|CRT matches to NC_023698 (Mycobacterium phage Avani, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ccgcggcctcggcggcgctggcgg Protospacer
**.******************
94. spacer 3.16|927323|24|CP025599|CRT matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ccgcggcctcggcggcgctggcgg Protospacer
**.******************
95. spacer 3.16|927323|24|CP025599|CRT matches to NZ_CP050953 (Rhodococcus sp. DMU1 plasmid unnamed) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
cgccgacctcggcggcggtggcga Protospacer
.*************** *****.
96. spacer 3.16|927323|24|CP025599|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
tcccgacctcggcggtgctggcgc Protospacer
*************.*******
97. spacer 3.16|927323|24|CP025599|CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ctacgaccacggcggcgctggcgg Protospacer
***** ***************
98. spacer 3.16|927323|24|CP025599|CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
tctcgacctcggcggcgatggcgg Protospacer
.************** ******
99. spacer 3.16|927323|24|CP025599|CRT matches to MN096355 (Mycobacterium phage Purky, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
tgccgacctcggctgcgctggcgc Protospacer
.*********** *********
100. spacer 3.16|927323|24|CP025599|CRT matches to MK279853 (Gordonia phage Gray, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ggtcgacctcgacggcgctggcgg Protospacer
...********.************
101. spacer 5.1|1572165|28|CP025599|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
102. spacer 5.1|1572165|28|CP025599|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
103. spacer 5.1|1572165|28|CP025599|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
104. spacer 5.5|1572387|25|CP025599|CRISPRCasFinder matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
tccgccgaacgcgccgaagccgtcg Protospacer
...*******.**************
105. spacer 5.5|1572387|25|CP025599|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gctgccgaacacgccgatgccgacg Protospacer
.*************** **** **
106. spacer 5.5|1572387|25|CP025599|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gctgccgaacacgccgatgccgacg Protospacer
.*************** **** **
107. spacer 5.5|1572387|25|CP025599|CRISPRCasFinder matches to MT553342 (Microbacterium phage Kelcole, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
108. spacer 5.5|1572387|25|CP025599|CRISPRCasFinder matches to NC_048068 (Microbacterium phage OneinaGillian, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
109. spacer 5.5|1572387|25|CP025599|CRISPRCasFinder matches to MT310894 (Microbacterium phage Tempo, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
110. spacer 5.5|1572387|25|CP025599|CRISPRCasFinder matches to NZ_CP047175 (Rathayibacter sp. VKM Ac-2760 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacacgccgatgccctgc Protospacer
***************** *** *
111. spacer 5.5|1572387|25|CP025599|CRISPRCasFinder matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
aatgccgaattcgccgaagccgtcg Protospacer
*******. **************
112. spacer 5.5|1572387|25|CP025599|CRISPRCasFinder matches to MN034284 (Leviviridae sp. isolate H2_Rhizo_Litter_49_scaffold_25938 sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
cccgtagaacacgccgaagccgtcg Protospacer
*..*. *******************
113. spacer 5.14|1573095|25|CP025599|CRISPRCasFinder matches to MN582064 (Podoviridae sp. ctka020, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgccaccgacccccccttgc CRISPR spacer
ttttccgacaccgacccccccttga Protospacer
.** *** ****************
114. spacer 6.5|2088465|24|CP025599|CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
atcgaagaagctgaacacgcccgc Protospacer
**************** **** .
115. spacer 6.5|2088465|24|CP025599|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
gtcgatgaagctgaacccgccgaa Protospacer
.**** ****************
116. spacer 6.5|2088465|24|CP025599|CRT matches to NZ_CP015007 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
atcggagaagctgaacccgcccgg Protospacer
****.****************
117. spacer 1.1|366494|27|CP025599|CRISPRCasFinder matches to LR794124 (Vibrio phage vB_Vc_SrVc9 genome assembly, chromosome: 1) position: , mismatch: 5, identity: 0.815
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
aacgcaccgttgtccacatcaccaatc Protospacer
********* **********.** .*
118. spacer 1.1|366494|27|CP025599|CRISPRCasFinder matches to NC_012662 (Vibrio phage VP93, complete genome) position: , mismatch: 5, identity: 0.815
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
aacgcaccgttgtccacatcaccaatc Protospacer
********* **********.** .*
119. spacer 1.7|366890|27|CP025599|CRISPRCasFinder matches to NZ_CP016084 (Streptomyces sp. SAT1 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815
gcgaagccgatgttgtagctgccggtg CRISPR spacer
gcgaagccgaagttgtagctgcgctcg Protospacer
********** *********** .*
120. spacer 1.7|366890|27|CP025599|CRISPRCasFinder matches to MN693945 (Marine virus AFVG_250M952, complete genome) position: , mismatch: 5, identity: 0.815
gcgaagccgatgttgtagctgccggtg CRISPR spacer
atgaagccgatgttgtcgctaccgggg Protospacer
..************** ***.**** *
121. spacer 1.10|367100|27|CP025599|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
122. spacer 1.10|367100|27|CP025599|CRISPRCasFinder matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
123. spacer 1.10|367100|27|CP025599|CRISPRCasFinder matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
124. spacer 1.10|367100|27|CP025599|CRISPRCasFinder matches to NZ_CP015368 (Methylobacterium phyllosphaerae strain CBMB27 plasmid CBMB27-p1, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tccccgcggaagttgaggtcgcgggtg Protospacer
****** ************** *. *
125. spacer 1.10|367100|27|CP025599|CRISPRCasFinder matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
126. spacer 1.10|367100|27|CP025599|CRISPRCasFinder matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
127. spacer 1.10|367100|27|CP025599|CRISPRCasFinder matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
128. spacer 1.10|367100|27|CP025599|CRISPRCasFinder matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
129. spacer 1.10|367100|27|CP025599|CRISPRCasFinder matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
130. spacer 1.10|367100|27|CP025599|CRISPRCasFinder matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
131. spacer 1.10|367100|27|CP025599|CRISPRCasFinder matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
132. spacer 1.10|367100|27|CP025599|CRISPRCasFinder matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
133. spacer 1.10|367100|27|CP025599|CRISPRCasFinder matches to NZ_CP020444 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
134. spacer 1.10|367100|27|CP025599|CRISPRCasFinder matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
135. spacer 1.10|367100|27|CP025599|CRISPRCasFinder matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
136. spacer 1.10|367100|27|CP025599|CRISPRCasFinder matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
137. spacer 1.10|367100|27|CP025599|CRISPRCasFinder matches to NZ_CP044078 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
138. spacer 1.10|367100|27|CP025599|CRISPRCasFinder matches to NZ_CP031081 (Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
139. spacer 1.10|367100|27|CP025599|CRISPRCasFinder matches to MN586031 (Gordonia phage Gambino, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
140. spacer 1.10|367100|27|CP025599|CRISPRCasFinder matches to KU998236 (Gordonia phage Blueberry, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
141. spacer 1.10|367100|27|CP025599|CRISPRCasFinder matches to MN062704 (Gordonia phage JuJu, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
142. spacer 1.10|367100|27|CP025599|CRISPRCasFinder matches to MK501729 (Gordonia phage Walrus, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
143. spacer 1.10|367100|27|CP025599|CRISPRCasFinder matches to NC_031226 (Gordonia phage BaxterFox, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
144. spacer 1.10|367100|27|CP025599|CRISPRCasFinder matches to MK967393 (Rhodococcus phage Whack, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tccttaccgaagttgaggtcgacgagg Protospacer
**...*************** *****
145. spacer 1.10|367100|27|CP025599|CRISPRCasFinder matches to MT723935 (Gordonia phage Azula, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
146. spacer 1.10|367100|27|CP025599|CRISPRCasFinder matches to KU963249 (Gordonia phage Yeezy, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
147. spacer 1.10|367100|27|CP025599|CRISPRCasFinder matches to MH153808 (Gordonia phage Petra, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
148. spacer 1.10|367100|27|CP025599|CRISPRCasFinder matches to MT639650 (Gordonia phage Ohgeesy, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
149. spacer 1.10|367100|27|CP025599|CRISPRCasFinder matches to MH536818 (Gordonia phage Frokostdame, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
150. spacer 1.10|367100|27|CP025599|CRISPRCasFinder matches to KX557275 (Gordonia phage CarolAnn, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
151. spacer 3.6|926882|27|CP025599|CRT matches to CP009871 (Pantoea sp. PSNIH2 plasmid pPSP-cd6, complete sequence) position: , mismatch: 5, identity: 0.815
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgtcagcggctgggcaggcggggatat Protospacer
********** **** ******** .
152. spacer 3.6|926882|27|CP025599|CRT matches to NZ_CP030354 (Novosphingobium sp. P6W plasmid pP6W1, complete sequence) position: , mismatch: 5, identity: 0.815
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgtcaccggcggggctggcggcatcgg Protospacer
***** *************** . **
153. spacer 3.6|926882|27|CP025599|CRT matches to NZ_CP045223 (Achromobacter xylosoxidans strain DN002 plasmid unnamed) position: , mismatch: 5, identity: 0.815
cgtcagcggcggggctggcggggaggg CRISPR spacer
ccaaagcggcgagactggcggggaggg Protospacer
* *******.*.*************
154. spacer 3.6|926882|27|CP025599|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 5, identity: 0.815
cgtcagcggcggggctggcggggaggg CRISPR spacer
tgttcacggcggggctggcggggacgg Protospacer
.**. .****************** **
155. spacer 3.6|926882|27|CP025599|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.815
cgtcagcggcggggctggcggggaggg CRISPR spacer
cggcagcggcggggctggcggagccgc Protospacer
** ******************.* *
156. spacer 3.6|926882|27|CP025599|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 5, identity: 0.815
cgtcagcggcggggctggcggggaggg CRISPR spacer
cggcagcggcggggctggcggagccgc Protospacer
** ******************.* *
157. spacer 3.6|926882|27|CP025599|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
cgtcagcggcggggctggcggggaggg CRISPR spacer
actcgccggcgcggctggcggggaggg Protospacer
**. ***** ***************
158. spacer 3.10|927038|27|CP025599|CRT matches to NZ_CP022264 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
ggcaggcggcggcggcggtagcgttgg Protospacer
* * ********************
159. spacer 3.10|927038|27|CP025599|CRT matches to NZ_CP022264 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
ggcaggcggcggcggcggtagcgttgg Protospacer
* * ********************
160. spacer 3.10|927038|27|CP025599|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
aggatccggccgcggcggtagcgctcg Protospacer
********* ************.*
161. spacer 3.10|927038|27|CP025599|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
aggatccggccgcggcggtagcgctcg Protospacer
********* ************.*
162. spacer 3.10|927038|27|CP025599|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
cgggtccggcggcggcggtggcggttt Protospacer
***.***************.*** * .
163. spacer 3.10|927038|27|CP025599|CRT matches to NZ_CP049908 (Hymenobacter sp. HDW8 plasmid p_unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
cgactccggcggcgggggtagcgttcg Protospacer
**. *********** *********
164. spacer 3.10|927038|27|CP025599|CRT matches to NZ_CP049700 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2a, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
cgccgccggcggcggcggtggcgttgg Protospacer
** **************.******
165. spacer 3.10|927038|27|CP025599|CRT matches to MH576962 (Streptomyces phage Satis, complete genome) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
tgactccggcggcggccgtggcgttgc Protospacer
.*. ************ **.*******
166. spacer 3.10|927038|27|CP025599|CRT matches to MK620894 (Streptomyces phage Kradal, complete genome) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
tgactccggcggcggccgtggcgttgc Protospacer
.*. ************ **.*******
167. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgaggccggcctgctggtcgtctccgggct Protospacer
*** **************** ******
168. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
agattccggcctgttcgtcggctccggcgg Protospacer
**. ********.* **************
169. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgccatcggcctgctgctcggcaccggcgg Protospacer
** *..********** ***** *******
170. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP031193 (Humibacter sp. BT305 plasmid unnamed1) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgccgccggcctgctggtcggcgcggcggg Protospacer
** ******************* * * **
171. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggc-tccggcgg CRISPR spacer
cgacgccggcatgccggtcggcttcctgct- Protospacer
********** ***.******* *** **
172. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.833
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
attgctgttcggctgcggcggcgcgggcgc Protospacer
.************ ********* ****
173. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
attgctgttcggctgcggcggcgcgggcgc Protospacer
.************ ********* ****
174. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 5, identity: 0.833
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgctcggcaccggcggcgcactcgg Protospacer
*******.***** ********** ***
175. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP046705 (Nostoc sp. ATCC 53789 plasmid pNsp_b, complete sequence) position: , mismatch: 5, identity: 0.833
cctgctg--ttcggctccggcggcgctggcgg CRISPR spacer
--tactgattacggctccggcggtgctggcgg Protospacer
*.*** * ************.********
176. spacer 3.15|927275|30|CP025599|CRT matches to AY950802 (Haloarcula phage SH1, complete genome) position: , mismatch: 5, identity: 0.833
--cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ggcctac--ttcggctccggcggctccggcgg Protospacer
***.* *************** *.*****
177. spacer 3.16|927323|24|CP025599|CRT matches to NC_006911 (Streptomyces sp. F11 plasmid pFP11, complete sequence) position: , mismatch: 5, identity: 0.792
aaccgacctcggcggcgctggcgg CRISPR spacer
gggcgacctcggcggcgctggcct Protospacer
.. *******************
178. spacer 5.1|1572165|28|CP025599|CRISPRCasFinder matches to NZ_LN907828 (Erwinia gerundensis isolate E_g_EM595 plasmid pEM01, complete sequence) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gctgccgtgggtgccatcgttgccgagt Protospacer
*.***** *****************. .
179. spacer 5.1|1572165|28|CP025599|CRISPRCasFinder matches to KU728633 (Mycobacterium phage Bipper, complete genome) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gcgtccgggggtgccgtcgttgccgtcc Protospacer
*. ***********.********* **
180. spacer 5.1|1572165|28|CP025599|CRISPRCasFinder matches to MK977701 (Mycobacterium phage Cracklewink, complete genome) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gcgtccgggggtgccgtcgttgccgtcc Protospacer
*. ***********.********* **
181. spacer 5.1|1572165|28|CP025599|CRISPRCasFinder matches to NZ_CP016354 (Prauserella marina strain DSM 45268 plasmid pPmarDSM45268, complete sequence) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gttgccgcgggtgccctcgttgcggacg Protospacer
******* ******* ******* *.*
182. spacer 5.5|1572387|25|CP025599|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 5, identity: 0.8
cttgccgaacacgccgaagccgtcg CRISPR spacer
gccgccgaacacgccgaagccgttt Protospacer
..********************.
183. spacer 5.5|1572387|25|CP025599|CRISPRCasFinder matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 5, identity: 0.8
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaacacgccgacgccgcgc Protospacer
**************** ****.
184. spacer 5.10|1572780|31|CP025599|CRISPRCasFinder matches to NC_018746 (Pseudomonas putida ND6 plasmid pND6-2, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
185. spacer 5.10|1572780|31|CP025599|CRISPRCasFinder matches to MN961671 (Pseudomonas aeruginosa strain 201330 plasmid p201330-IMP, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
186. spacer 5.10|1572780|31|CP025599|CRISPRCasFinder matches to MN961672 (Pseudomonas aeruginosa strain PA15W plasmid pPA15W-NR, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
187. spacer 5.13|1573029|34|CP025599|CRISPRCasFinder matches to NC_006362 (Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence) position: , mismatch: 5, identity: 0.853
gtcgccgtgcagccagccaccaccgcca-ccggcg CRISPR spacer
ttcgccgtgcagccggccaccacctccagcctgc- Protospacer
*************.********* *** ** **
188. spacer 10.7|3741130|31|CP025599|CRT matches to NC_010850 (Rhodococcus sp. NS1 plasmid pNSL1, complete sequence) position: , mismatch: 5, identity: 0.839
aacgccc-acttcaccgccgttgccgccgtca CRISPR spacer
-acacccgacttcaccgccgctgccgccgaga Protospacer
**.*** ************.******** *
189. spacer 1.1|366494|27|CP025599|CRISPRCasFinder matches to NZ_CP045917 (Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence) position: , mismatch: 6, identity: 0.778
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
agttcactggtgtccacatcgcccgaa Protospacer
*.. ***.***************** .
190. spacer 1.6|366824|33|CP025599|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agcaggtcgatcacgatctggccgttgccggcg Protospacer
** *.***** ******************.*
191. spacer 1.7|366890|27|CP025599|CRISPRCasFinder matches to NZ_CP022542 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence) position: , mismatch: 6, identity: 0.778
gcgaagccgatgttgtagctgccggtg CRISPR spacer
ggataggcgatgttgtagctgccggaa Protospacer
* . ** ****************** .
192. spacer 1.9|367040|27|CP025599|CRISPRCasFinder matches to NC_009959 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI05, complete sequence) position: , mismatch: 6, identity: 0.778
gccaagccgatatcgaagatcccggtg CRISPR spacer
accatgccgatatcgacgatcccgtcc Protospacer
.*** *********** ******* .
193. spacer 1.10|367100|27|CP025599|CRISPRCasFinder matches to NZ_CP009112 (Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
tagacgccgaagtcgaggtcggcgagg Protospacer
*********.******* *****
194. spacer 1.10|367100|27|CP025599|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
ctcccgccgaagttgagggtgccgaac Protospacer
.**************** .*****.
195. spacer 1.10|367100|27|CP025599|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
aagaagccgaagttgaggtcgccgtag Protospacer
* ******************* .*
196. spacer 1.10|367100|27|CP025599|CRISPRCasFinder matches to MK494099 (Mycobacterium phage Typha, complete genome) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
cggtcgccgaggtcgaggtcgccgagg Protospacer
.******.**.*************
197. spacer 2.1|692007|31|CP025599|CRISPRCasFinder matches to GQ141189 (Bifidobacterium phage Bbif-1, complete sequence) position: , mismatch: 6, identity: 0.806
agcgcgaacggcaagccgaac----cgttggaccc CRISPR spacer
agcgcgaacggccagccgaaccatgcgctgg---- Protospacer
************ ******** **.***
198. spacer 3.6|926882|27|CP025599|CRT matches to NZ_LN907829 (Erwinia gerundensis isolate E_g_EM595 plasmid pEM02, complete sequence) position: , mismatch: 6, identity: 0.778
cgtcagcggcggggctggcggggaggg CRISPR spacer
tgtaagcggctgggctggcggggatat Protospacer
.** ****** ************* .
199. spacer 3.6|926882|27|CP025599|CRT matches to NZ_CP041653 (Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence) position: , mismatch: 6, identity: 0.778
cgtcagcggcggggctggcggggaggg CRISPR spacer
tgtcagcggcggggctggcgttcatcg Protospacer
.******************* * *
200. spacer 3.6|926882|27|CP025599|CRT matches to NZ_CP010826 (Thermus aquaticus Y51MC23 plasmid pTA78, complete sequence) position: , mismatch: 6, identity: 0.778
cgtcagcggcggggctggcggggaggg CRISPR spacer
tagaagcggcggggctggtggagaggg Protospacer
.. **************.**.*****
201. spacer 3.6|926882|27|CP025599|CRT matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 6, identity: 0.778
cgtcagcggcggggctggcggggaggg CRISPR spacer
gcgcaccggcggggctggcggggcggc Protospacer
** ***************** **
202. spacer 3.10|927038|27|CP025599|CRT matches to NZ_AP021845 (Azospira sp. I09 plasmid pAZI09, complete sequence) position: , mismatch: 6, identity: 0.778
cggatccggcggcggcggtagcgttgc CRISPR spacer
cggatcctgcggcggcggtagaaagcc Protospacer
******* ************* . *
203. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gagcgtcggcctgctggtcggcttcggcgc Protospacer
..**.*****************.*****
204. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gagcgtcggcctgctggtcggcttcggcgc Protospacer
..**.*****************.*****
205. spacer 3.13|927179|30|CP025599|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgacgacggcctggtggtcggctacctcga Protospacer
***** ******* ********* * **.
206. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg Protospacer
** ..********** ***** *******
207. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg Protospacer
** ..********** ***** *******
208. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgcgcggcgtgccggtcggctccggcgg Protospacer
** **** ***.***************
209. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg Protospacer
** ..********** ***** *******
210. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgcgcggcgtgccggtcggctccggcgg Protospacer
** **** ***.***************
211. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcggcgggcctgctggtcggcttcggcac Protospacer
** ** ****************.****.
212. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
213. spacer 3.13|927179|30|CP025599|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
214. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
215. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP037868 (Hydrogenophaga pseudoflava strain DSM 1084 plasmid pDSM1084, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcg----gctccggcgg CRISPR spacer
cgacgccggccggctggtcggagagctgcg---- Protospacer
*********** ******** *** **
216. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
217. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
218. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgtcgccggcctgctgatcggcttcttctg Protospacer
** *************.******.* * *
219. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
220. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
221. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
222. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
223. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
224. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
225. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
226. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
227. spacer 3.13|927179|30|CP025599|CRT matches to NC_019408 (Caulobacter phage CcrRogue, complete genome) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgtcatcggcctgctggtcgtcgccggcgc Protospacer
** *..************** * ******
228. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgacgccgacctgctggtcggggcggactg Protospacer
********.************ * *.* *
229. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP017941 (Phyllobacterium zundukense strain Tri-48 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
caagctggtcggccccggcggcgctggcaa Protospacer
* **** *****.**************..
230. spacer 3.15|927275|30|CP025599|CRT matches to MK937608 (Microbacterium phage Cressida, complete genome) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tcacctgtccggctccggcggcggtggcga Protospacer
.* ****.************** *****.
231. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg Protospacer
*******.***** ********** .**
232. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg Protospacer
*******.***** ********** .**
233. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP017592 (Pantoea stewartii subsp. stewartii DC283 plasmid ppDSJ01, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg-- CRISPR spacer
tctgctgttcggctgcggcggcg--agcagcg Protospacer
.************* ******** .**.*
234. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP008898 (Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pENT-576, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
235. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP023489 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_02, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
236. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP043515 (Enterobacter kobei strain EB_P8_L5_01.19 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
237. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg Protospacer
*******.***** ********** .**
238. spacer 3.15|927275|30|CP025599|CRT matches to NZ_LT984809 (Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
catcgcgctcggcttcggcggcgctggcgg Protospacer
* * .*.******.***************
239. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP026371 (Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
240. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP050069 (Klebsiella aerogenes strain 035 plasmid p035_A-VIM-1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
241. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP039425 (Citricoccus sp. SGAir0253 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgttcggcaccgacggcgccctccg Protospacer
************* ***.******. * *
242. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP009856 (UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-784, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
243. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP039430 (Citricoccus sp. SGAir0453 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgttcggcaccgacggcgccctccg Protospacer
************* ***.******. * *
244. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP040937 (Hymenobacter sp. DG01 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgt-tcggctccggcggcgctggcgg CRISPR spacer
-ccgccgcgccggctccggccgcgctggcgg Protospacer
*.**.*. .********** **********
245. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cgtccagctcggcgccggcggcgctggcgt Protospacer
* * * *.***** ***************
246. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cgtccagctcggcgccggcggcgctggcgt Protospacer
* * * *.***** ***************
247. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP006588 (Hymenobacter sp. APR13 plasmid pHA, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgt-tcggctccggcggcgctggcgg CRISPR spacer
-ccgccgcgccggctccggccgcgctggcgg Protospacer
*.**.*. .********** **********
248. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgtt--cggctccggcggcgctggcgg CRISPR spacer
--cgccgctggcggcgccggcggcgctggcgg Protospacer
.**.*.* **** ****************
249. spacer 3.15|927275|30|CP025599|CRT matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgtt----cggctccggcggcgctggcgg CRISPR spacer
----cagttggggcggctccggcggcgcgggcgg Protospacer
* *** *************** *****
250. spacer 3.15|927275|30|CP025599|CRT matches to MH029534 (Myoviridae environmental samples clone NHS-Seq2, complete sequence) position: , mismatch: 6, identity: 0.8
-cctgctgttcggctccggcggcgctggcgg CRISPR spacer
atttggt-ttcggcgctggcggcgctggcgg Protospacer
..** * ****** *.**************
251. spacer 3.17|927365|36|CP025599|CRT matches to MT723940 (Mycobacterium phage Ellie, complete genome) position: , mismatch: 6, identity: 0.833
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
cgttgtcggcaacggcggtaacggcgggggtggcgg Protospacer
* .************************ .*****
252. spacer 5.1|1572165|28|CP025599|CRISPRCasFinder matches to NZ_AP022571 (Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccgggggtggcaccgttgccgcgg Protospacer
* *********** **.********
253. spacer 5.1|1572165|28|CP025599|CRISPRCasFinder matches to NC_008703 (Mycobacterium sp. KMS plasmid pMKMS01, complete sequence) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccgggggtggcaccgttgccgcgg Protospacer
* *********** **.********
254. spacer 5.1|1572165|28|CP025599|CRISPRCasFinder matches to NZ_LR594663 (Variovorax sp. RA8 plasmid 2) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccggcggtgccatcggtgccgagg Protospacer
* ****** ********** *****.
255. spacer 5.10|1572780|31|CP025599|CRISPRCasFinder matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 6, identity: 0.806
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ccttgcgccttgcccgccgctgccgcagggc Protospacer
*****************.****** **
256. spacer 5.10|1572780|31|CP025599|CRISPRCasFinder matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 6, identity: 0.806
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ccttgcgccttgcccgccgctgccgcagggc Protospacer
*****************.****** **
257. spacer 5.13|1573029|34|CP025599|CRISPRCasFinder matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 6, identity: 0.824
--gtcgccgtgcagccagccaccaccgccaccggcg CRISPR spacer
ctgtcgtc--gcagcgcgccaccaccgccaccggca Protospacer
****.* ***** ******************.
258. spacer 10.7|3741130|31|CP025599|CRT matches to NC_009478 (Clavibacter michiganensis subsp. michiganensis NCPPB 382 plasmid pCM1, complete sequence) position: , mismatch: 6, identity: 0.806
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgaccacttcaccgccgtcgccgccggcg Protospacer
. ** ***************.******* *.
259. spacer 1.4|366689|27|CP025599|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.741
aagccgcccgagttcgcgagaccgaag CRISPR spacer
tgaccgcccgagttcgcgagacgttgg Protospacer
..******************* .*
260. spacer 2.1|692007|31|CP025599|CRISPRCasFinder matches to MK977708 (Mycobacterium phage Fulbright, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
261. spacer 2.1|692007|31|CP025599|CRISPRCasFinder matches to MG099948 (Mycobacterium phage Philonius, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
262. spacer 2.1|692007|31|CP025599|CRISPRCasFinder matches to MH926055 (Mycobacterium phage Chewbacca, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
263. spacer 2.1|692007|31|CP025599|CRISPRCasFinder matches to MT723932 (Mycobacterium phage Schnauzer, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
264. spacer 2.1|692007|31|CP025599|CRISPRCasFinder matches to KU935726 (Mycobacterium phage Xerxes, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
265. spacer 2.1|692007|31|CP025599|CRISPRCasFinder matches to KU935730 (Mycobacterium phage Pipsqueaks, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
266. spacer 2.1|692007|31|CP025599|CRISPRCasFinder matches to MH316570 (Mycobacterium phage Silvafighter, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
267. spacer 2.1|692007|31|CP025599|CRISPRCasFinder matches to MK524518 (Mycobacterium phage Smurph, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
268. spacer 2.1|692007|31|CP025599|CRISPRCasFinder matches to MK524515 (Mycobacterium phage Parmesanjohn, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
269. spacer 2.1|692007|31|CP025599|CRISPRCasFinder matches to MH697585 (Mycobacterium phage Gex, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
270. spacer 2.1|692007|31|CP025599|CRISPRCasFinder matches to KM588359 (Mycobacterium phage Carcharodon, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
271. spacer 2.1|692007|31|CP025599|CRISPRCasFinder matches to MH697576 (Mycobacterium phage Aggie, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
272. spacer 2.1|692007|31|CP025599|CRISPRCasFinder matches to MH697593 (Mycobacterium phage Tapioca, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
273. spacer 2.1|692007|31|CP025599|CRISPRCasFinder matches to MG099936 (Mycobacterium phage Andies, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
274. spacer 2.1|692007|31|CP025599|CRISPRCasFinder matches to NC_031243 (Mycobacterium phage Xeno, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
275. spacer 2.1|692007|31|CP025599|CRISPRCasFinder matches to JN256079 (Mycobacterium phage Charlie, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
276. spacer 3.6|926882|27|CP025599|CRT matches to NZ_CP010614 (Phaeobacter inhibens strain P92 plasmid pP92_d, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
277. spacer 3.6|926882|27|CP025599|CRT matches to NZ_CP010626 (Phaeobacter inhibens strain P51 plasmid pP51_c, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
278. spacer 3.6|926882|27|CP025599|CRT matches to NZ_CP010671 (Phaeobacter inhibens strain P57 plasmid pP57_c, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
279. spacer 3.6|926882|27|CP025599|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgtcagcggcgggggtggcggcacacc Protospacer
************** ****** . .
280. spacer 3.6|926882|27|CP025599|CRT matches to NZ_CP010598 (Phaeobacter inhibens strain P10 plasmid pP10_c, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
281. spacer 3.6|926882|27|CP025599|CRT matches to NC_018288 (Phaeobacter inhibens DSM 17395 plasmid pPGA1_65, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
282. spacer 3.6|926882|27|CP025599|CRT matches to NZ_CP031955 (Phaeobacter inhibens strain 2.10 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
283. spacer 3.6|926882|27|CP025599|CRT matches to NZ_CP016368 (Phaeobacter porticola strain P97 plasmid pP97_d, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattggcggcggggctggcggggatct Protospacer
.*..*******************
284. spacer 3.6|926882|27|CP025599|CRT matches to NC_018422 (Phaeobacter inhibens 2.10 plasmid pPGA2_71, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
285. spacer 3.6|926882|27|CP025599|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgtcagcggcgggggtggcggcacacc Protospacer
************** ****** . .
286. spacer 3.6|926882|27|CP025599|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
cgtcagcggcgggggtggcggcacacc Protospacer
************** ****** . .
287. spacer 3.6|926882|27|CP025599|CRT matches to NZ_CP010605 (Phaeobacter inhibens strain P83 plasmid pP83_f, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
288. spacer 3.6|926882|27|CP025599|CRT matches to NZ_CP010744 (Phaeobacter inhibens strain P59 plasmid pP59_c, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
289. spacer 3.6|926882|27|CP025599|CRT matches to NZ_CP010622 (Phaeobacter inhibens strain P30 isolate M4-3.1A plasmid pP30_e, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
290. spacer 3.6|926882|27|CP025599|CRT matches to NZ_CP010732 (Phaeobacter inhibens strain P88 plasmid pP88_g, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
291. spacer 3.6|926882|27|CP025599|CRT matches to NZ_CP010655 (Phaeobacter inhibens strain P54 plasmid pP54_e, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
292. spacer 3.6|926882|27|CP025599|CRT matches to NZ_CP010711 (Phaeobacter inhibens strain P66 plasmid pP66_f, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
293. spacer 3.6|926882|27|CP025599|CRT matches to NZ_CP010702 (Phaeobacter inhibens strain P24 plasmid pP24_f, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
294. spacer 3.6|926882|27|CP025599|CRT matches to NZ_CP010748 (Phaeobacter inhibens strain P48 isolate M21-2.3 plasmid pP48_c, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
295. spacer 3.6|926882|27|CP025599|CRT matches to NZ_CP010739 (Phaeobacter inhibens strain P72 plasmid pP72_d, complete sequence) position: , mismatch: 7, identity: 0.741
cgtcagcggcggggctggcggggaggg CRISPR spacer
gattcgcggcggggctggcggggatct Protospacer
.*. *******************
296. spacer 3.13|927179|30|CP025599|CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggtcgccggcctgctggtcgggttcggatc Protospacer
* ****************** *.***
297. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
298. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
299. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ctgctgcagcctgctggtcagctccggcgc Protospacer
* .* *.***********.*********
300. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
301. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
302. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ctgctgcagcctgctggtcagctccggcgc Protospacer
* .* *.***********.*********
303. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
304. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
305. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
306. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
307. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
308. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
309. spacer 3.13|927179|30|CP025599|CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgggaccggcccgctggtcggccccggctt Protospacer
**. .******.**********.*****
310. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gctgggcggcctgctggtcggctggggcgg Protospacer
* ***************** *****
311. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
312. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
313. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
314. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
315. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
316. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
317. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgcaggtcggcttcacctt Protospacer
************* ********.*. *
318. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
319. spacer 3.13|927179|30|CP025599|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
320. spacer 3.13|927179|30|CP025599|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
321. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
322. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
323. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
324. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
325. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
326. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
327. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
328. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
329. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
330. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
331. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
332. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
333. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
334. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
335. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
336. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
337. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
338. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
339. spacer 3.13|927179|30|CP025599|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
340. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
341. spacer 3.13|927179|30|CP025599|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
342. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
343. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
344. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
345. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
346. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
347. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
348. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
349. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
350. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
351. spacer 3.13|927179|30|CP025599|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
352. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
353. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
354. spacer 3.13|927179|30|CP025599|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
355. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
356. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
357. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
358. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
359. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
360. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
361. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
362. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
363. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
364. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
365. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
366. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
367. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
368. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
369. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
370. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
371. spacer 3.13|927179|30|CP025599|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
372. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
373. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
374. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
375. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
376. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
377. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
378. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
379. spacer 3.13|927179|30|CP025599|CRT matches to HM560026 (Uncultured bacterium plasmid pTRACA45, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
acacgccgccctgctggtcggcttaggtcg Protospacer
****** **************. **. *
380. spacer 3.13|927179|30|CP025599|CRT matches to NC_010867 (Neisseria lactamica plasmid pNL3.1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gaacgccgccctgctggtcggcttagtcgc Protospacer
.****** **************. * **
381. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP020471 (Rhodobacter blasticus strain 28/5 plasmid pRsa, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
agacgccggcctgctgttcggcctcgaccc Protospacer
*************** *****..**.*
382. spacer 3.13|927179|30|CP025599|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgggctcggcctgctgctcggcttcggcga Protospacer
**. .********** ******.*****.
383. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggc-tccggcgg CRISPR spacer
gtcggccggcctgctggtcggcgcccggct- Protospacer
****************** .*****
384. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP035710 (Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgacgacggcctgctggtcgacttcatccc Protospacer
***** **************.**.*. *
385. spacer 3.13|927179|30|CP025599|CRT matches to KT997827 (Uncultured Mediterranean phage uvDeep-CGR0-KM15-C219, complete genome) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gttcgccggcctgctggaccgctccgtggg Protospacer
************** * ****** **
386. spacer 3.13|927179|30|CP025599|CRT matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgtgtccggcctgctggtcgggttcggcac Protospacer
** **************** *.****.
387. spacer 3.13|927179|30|CP025599|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
tgacgccgccctgctggtcggcaaagtcga Protospacer
.******* ************* * **.
388. spacer 3.13|927179|30|CP025599|CRT matches to KT997829 (Uncultured Mediterranean phage uvDeep-CGR0-KM22-C158, complete genome) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gttcgccggcctgctggaccgctccgtggg Protospacer
************** * ****** **
389. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttcggggtcggctccggcggcgctggcga Protospacer
..* * *********************.
390. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttcggggtcggctccggcggcgctggcga Protospacer
..* * *********************.
391. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctccgcgctcggctccggcggcggtggcgg Protospacer
*.. .*.*************** ******
392. spacer 3.15|927275|30|CP025599|CRT matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
393. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP006989 (Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
394. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP020909 (Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
395. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP024423 (Paracoccus yeei strain TT13 plasmid pTT13-1, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tctcgggctcggccccggcggcgctggcgc Protospacer
.** *.*****.***************
396. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
397. spacer 3.15|927275|30|CP025599|CRT matches to NC_021908 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
398. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP020441 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tctcgggctcggccccggcggcgctggcgc Protospacer
.** *.*****.***************
399. spacer 3.15|927275|30|CP025599|CRT matches to CP007642 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
400. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tctcgggctcggccccggcggcgctggcgc Protospacer
.** *.*****.***************
401. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
402. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
403. spacer 3.15|927275|30|CP025599|CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg- CRISPR spacer
actgctgtccggctccggcggca-tgatgtc Protospacer
*******.*************. **..*
404. spacer 3.15|927275|30|CP025599|CRT matches to MN582086 (Siphoviridae sp. ctdEk19, complete genome) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gccggccttcgacttcggcggcgctggcgg Protospacer
*.* . ****.**.***************
405. spacer 3.15|927275|30|CP025599|CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
406. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP022700 (Acetobacter tropicalis strain BDGP1 plasmid pAtBDGP1A, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gttcctccacggttccggcggcgctggcgg Protospacer
.* ** . ***.*****************
407. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
408. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
409. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
410. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP031082 (Paracoccus yeei strain CCUG 32053 plasmid pYEE4, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tctcgggctcggccccggcggcgctggcgc Protospacer
.** *.*****.***************
411. spacer 3.17|927365|36|CP025599|CRT matches to NC_022087 (Mycobacterium phage AnnaL29, complete genome) position: , mismatch: 7, identity: 0.806
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
cgtgatcggcaacggcggaaacggcgggagctgggg Protospacer
**************** *********. * * **
412. spacer 5.1|1572165|28|CP025599|CRISPRCasFinder matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 7, identity: 0.75
gttgccgggggtgccatcgttgccggcc CRISPR spacer
agcacccggggtgccgtcgttgccggcg Protospacer
. ..** ********.***********
413. spacer 5.10|1572780|31|CP025599|CRISPRCasFinder matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 7, identity: 0.774
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gttgccgccatgcccgccgctgccgccggcc Protospacer
. * **** *********.**********
414. spacer 5.10|1572780|31|CP025599|CRISPRCasFinder matches to CP017041 (Propionibacterium sp. oral taxon 193 strain F0672 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
aacggcgtcttgcccgccgtggccgccaccg Protospacer
**. ***.************ ******. *.
415. spacer 6.3|2088375|30|CP025599|CRT matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
416. spacer 6.3|2088375|30|CP025599|CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
417. spacer 6.3|2088375|30|CP025599|CRT matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
418. spacer 10.7|3741130|31|CP025599|CRT matches to NZ_CP010990 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence) position: , mismatch: 7, identity: 0.774
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
cccacccacttcaccgacgtcgccgccgacg Protospacer
*.************ ***.******* *.
419. spacer 10.7|3741130|31|CP025599|CRT matches to NZ_CP012186 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-1, complete sequence) position: , mismatch: 7, identity: 0.774
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
cccacccacttcaccgacgtcgccgccgacg Protospacer
*.************ ***.******* *.
420. spacer 10.7|3741130|31|CP025599|CRT matches to NZ_CP042263 (Litoreibacter sp. LN3S51 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.774
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
atccgccatttcaccgccgttgccgacgccg Protospacer
* * ***.**************** **.*.
421. spacer 1.6|366824|33|CP025599|CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttggtgtcgatctcgatctggccgttgcccgca Protospacer
* **.*****.**************** *..
422. spacer 1.6|366824|33|CP025599|CRISPRCasFinder matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agctggttgatgccgatctggccgctgccggtc Protospacer
** . *..*** ************.*******
423. spacer 1.6|366824|33|CP025599|CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
atgctgccgaccccgatctggtcgttttcgact Protospacer
* ********.**********.**** .**..
424. spacer 1.6|366824|33|CP025599|CRISPRCasFinder matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtcgaccttc Protospacer
***************** ** ***.* * *
425. spacer 1.6|366824|33|CP025599|CRISPRCasFinder matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agctggttgatgccgatctggccgctgccggtc Protospacer
** . *..*** ************.*******
426. spacer 3.13|927179|30|CP025599|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgacgccggcctgctggtcgggctgacctc Protospacer
********************* .. . *
427. spacer 3.13|927179|30|CP025599|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ccgcaaactcctgctggtcggcgccggcgg Protospacer
* .*. ************* *******
428. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgatgccggcctgctggtcggggttcccag Protospacer
***.***************** .. *.*
429. spacer 3.13|927179|30|CP025599|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ccgcaaactcctgctggtcggcgccggcgg Protospacer
* .*. ************* *******
430. spacer 3.13|927179|30|CP025599|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ccttcagggcgtgctggtcggctccggcgc Protospacer
* . *** ******************
431. spacer 3.13|927179|30|CP025599|CRT matches to NZ_KY126370 (Enterobacter cloacae subsp. cloacae strain MN201516 plasmid pOP-I, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
432. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP054625 (Cupriavidus gilardii strain FDAARGOS_639 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggccgccggcctgctgtgcggctccgcgct Protospacer
* ************* ********
433. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgatgccggcctgctggtcggggttcccag Protospacer
***.***************** .. *.*
434. spacer 3.13|927179|30|CP025599|CRT matches to NZ_LT960615 (Hartmannibacter diazotrophicus strain E19T plasmid HDIAp1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gttcaccgccctgctgatcggctccggcat Protospacer
*.*** *******.***********.
435. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP046347 (Citrobacter portucalensis strain FDAARGOS_738 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
436. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP044100 (Citrobacter werkmanii strain FDAARGOS_616 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
437. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP032156 (Mycobacterium sp. ELW1 plasmid pELW1-1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
aatcgccggcctgctggtcggtgccgcggt Protospacer
. ******************. *** *
438. spacer 3.13|927179|30|CP025599|CRT matches to KY555144 (Caulobacter phage Ccr5, complete genome) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggtgatcggcctgctggtcgtcgccggcgc Protospacer
* ..************** * ******
439. spacer 3.13|927179|30|CP025599|CRT matches to NZ_KP873172 (Pseudomonas aeruginosa PAO1 plasmid pAMBL1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
440. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP045203 (Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
441. spacer 3.13|927179|30|CP025599|CRT matches to NC_021492 (Enterobacter sp. R4-368 plasmid pENT01, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
442. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP022156 (Escherichia coli strain ABWA45 plasmid pABWA45_2, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
443. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP024682 (Citrobacter freundii strain UMH14 plasmid pUMH14_2, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
444. spacer 3.13|927179|30|CP025599|CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgatgccggcctgctggtcggggttcccag Protospacer
***.***************** .. *.*
445. spacer 3.15|927275|30|CP025599|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cgaccatctcggctccgacggcgctggcgc Protospacer
* * .*********.***********
446. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
447. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gccaccccgcggctccggaggcgctggcgg Protospacer
*..*. . ********* ***********
448. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcaccggcggcgctggcga Protospacer
. * *.***** ***************.
449. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcaccggcggcgctggcga Protospacer
. * *.***** ***************.
450. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
451. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
452. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
453. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
454. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
455. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
456. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
457. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
458. spacer 3.15|927275|30|CP025599|CRT matches to NC_010998 (Rhizobium etli CIAT 652 plasmid pA, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcaccggcggcgctggcga Protospacer
. * *.***** ***************.
459. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgatcggctccggcgccggcttctc Protospacer
******* ************ ** . *
460. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgtgcggctccggcggcaaccccga Protospacer
******* *************. . **.
461. spacer 3.15|927275|30|CP025599|CRT matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgatgttcgactccggcggcgacgcacc Protospacer
**** ******.*********** .*
462. spacer 3.15|927275|30|CP025599|CRT matches to NZ_AP014706 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gcaccgcgccggctccggcggcggtggcgg Protospacer
* * .************** ******
463. spacer 3.17|927365|36|CP025599|CRT matches to MG770216 (Mycobacterium phage Rem711, complete genome) position: , mismatch: 8, identity: 0.778
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
attcggcggcaacggcggcaacggcgcggccggcgc Protospacer
..* . ************.******* ********
464. spacer 3.17|927365|36|CP025599|CRT matches to KY087993 (Mycobacterium phage Hammy, complete genome) position: , mismatch: 8, identity: 0.778
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
gcagatcggcaccggcggtaacggcggcggtgcagc Protospacer
** ******** *************** * .* *
465. spacer 3.17|927365|36|CP025599|CRT matches to MF140406 (Mycobacterium phage DarthP, complete genome) position: , mismatch: 8, identity: 0.778
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
gcagatcggcaccggcggtaacggcggcggtgcagc Protospacer
** ******** *************** * .* *
466. spacer 5.10|1572780|31|CP025599|CRISPRCasFinder matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcgggcgccttgtccgccgctgccgccgggc Protospacer
. ********.******.*********
467. spacer 5.10|1572780|31|CP025599|CRISPRCasFinder matches to NZ_CP039899 (Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877a, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
468. spacer 5.10|1572780|31|CP025599|CRISPRCasFinder matches to NZ_CP039913 (Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625b, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
469. spacer 5.10|1572780|31|CP025599|CRISPRCasFinder matches to NZ_CP039890 (Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499a, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
470. spacer 5.10|1572780|31|CP025599|CRISPRCasFinder matches to NZ_CP018001 (Rhizobium sp. Y9 plasmid pY9, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
471. spacer 5.10|1572780|31|CP025599|CRISPRCasFinder matches to NC_022536 (Rhizobium sp. IRBG74 plasmid IRBL74_p, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
472. spacer 5.10|1572780|31|CP025599|CRISPRCasFinder matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
473. spacer 5.10|1572780|31|CP025599|CRISPRCasFinder matches to NZ_CP018075 (Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcgagcgccttgcccgccgtggtcgccgccc Protospacer
. **************** *.***** *
474. spacer 5.10|1572780|31|CP025599|CRISPRCasFinder matches to CP036360 (Agrobacterium sp. 33MFTa1.1 plasmid p_JBx_073812, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
475. spacer 5.10|1572780|31|CP025599|CRISPRCasFinder matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgc--gccttgcccgccgttgccgccggca CRISPR spacer
--ccgctggccttgcccggggttgccgccgggg Protospacer
..** ********** *********** .
476. spacer 5.10|1572780|31|CP025599|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
attgccgccctggccgccgttgccgccgatc Protospacer
* * ****.** ***************..
477. spacer 6.3|2088375|30|CP025599|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc Protospacer
.** ... **************.******.
478. spacer 6.3|2088375|30|CP025599|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc Protospacer
.** ... **************.******.
479. spacer 9.24|3122383|29|CP025599|PILER-CR matches to MK599315 (Pseudomonas phage PA1C, complete genome) position: , mismatch: 8, identity: 0.724
tccgcgaaattcactgcgcgttattcaag CRISPR spacer
gacgcgaaatacactgcgctttattttca Protospacer
******** ******** *****. .
480. spacer 10.7|3741130|31|CP025599|CRT matches to CP033373 (Lactobacillus fermentum strain DR9 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
ttagcccacttcacggccgttgccgacgcgg Protospacer
*********** ********** **. .
481. spacer 10.7|3741130|31|CP025599|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
482. spacer 10.7|3741130|31|CP025599|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
483. spacer 10.7|3741130|31|CP025599|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
484. spacer 10.7|3741130|31|CP025599|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
485. spacer 10.7|3741130|31|CP025599|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
486. spacer 10.7|3741130|31|CP025599|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
487. spacer 10.7|3741130|31|CP025599|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
488. spacer 10.7|3741130|31|CP025599|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
489. spacer 10.7|3741130|31|CP025599|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
490. spacer 10.7|3741130|31|CP025599|CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
cgcaactccttcaccgccgctgccgccgtct Protospacer
.*. *. ***********.**********
491. spacer 10.7|3741130|31|CP025599|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
492. spacer 10.7|3741130|31|CP025599|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
493. spacer 10.7|3741130|31|CP025599|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
494. spacer 10.7|3741130|31|CP025599|CRT matches to NZ_CP027299 (Streptomyces sp. SGAir0924 plasmid unnamed_5) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
ctcggtggcttcgccgccgtcgccgccgtca Protospacer
** . .****.*******.**********
495. spacer 10.7|3741130|31|CP025599|CRT matches to NC_014213 (Meiothermus silvanus DSM 9946 plasmid pMESIL01, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
atcgcccacttcaccggcgtttccgaccctt Protospacer
* ************** **** *** * ..
496. spacer 1.6|366824|33|CP025599|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtattcgatcccgatctggccgtcgccggcc Protospacer
*. .******************.*****.
497. spacer 1.6|366824|33|CP025599|CRISPRCasFinder matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
498. spacer 1.6|366824|33|CP025599|CRISPRCasFinder matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
499. spacer 1.6|366824|33|CP025599|CRISPRCasFinder matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
500. spacer 2.1|692007|31|CP025599|CRISPRCasFinder matches to NZ_CP014964 (Geobacter anodireducens strain SD-1 plasmid pSD, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
ggaacgaacggcaagccgaaatgttggtgga Protospacer
.* .**************** .*****
501. spacer 2.1|692007|31|CP025599|CRISPRCasFinder matches to NC_015974 (Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg Protospacer
. ********.***********.**.. *
502. spacer 2.1|692007|31|CP025599|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg Protospacer
. ********.***********.**.. *
503. spacer 3.13|927179|30|CP025599|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.7
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggcgccggcctgctggtcggactgctcac Protospacer
**.****************** .. *.
504. spacer 3.15|927275|30|CP025599|CRT matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 9, identity: 0.7
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gaccacgttcggctccggccgcgctcgcgt Protospacer
. .************* ***** ***
505. spacer 3.15|927275|30|CP025599|CRT matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 9, identity: 0.7
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gaccacgttcggctccggccgcgctcgcgt Protospacer
. .************* ***** ***
506. spacer 3.17|927365|36|CP025599|CRT matches to MF140398 (Mycobacterium phage Amohnition, complete genome) position: , mismatch: 9, identity: 0.75
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
gcagatcggcaccggcggtaacggcggcggtacggc Protospacer
** ******** *************** * .. *
507. spacer 5.10|1572780|31|CP025599|CRISPRCasFinder matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcctcgccctgcccgccgttgccgcccacg Protospacer
.... ****.***************** .*.
508. spacer 5.10|1572780|31|CP025599|CRISPRCasFinder matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
tggcccgccttgccctccattgccgccggac Protospacer
. . ********** **.**********
509. spacer 5.10|1572780|31|CP025599|CRISPRCasFinder matches to NC_022049 (Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
atccttgccttgaccgccgttgccgccgctg Protospacer
* .. .****** *************** ..
510. spacer 5.10|1572780|31|CP025599|CRISPRCasFinder matches to MN234199 (Mycobacterium phage Ekdilam, complete genome) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
accccagccctgcccgccgttgccgccgctc Protospacer
* .. ***.****************** .
511. spacer 5.10|1572780|31|CP025599|CRISPRCasFinder matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcttgcgcctggcccgccgtagccggacacc Protospacer
. ******** ********* **** .*
512. spacer 5.10|1572780|31|CP025599|CRISPRCasFinder matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
accggcaccttgcccgccattgccgccatgt Protospacer
* . **.***********.********.
513. spacer 5.10|1572780|31|CP025599|CRISPRCasFinder matches to NZ_CP013740 (Streptomyces globisporus C-1027 plasmid pSGL1, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
cgggccgccttgtccgccgtggccgccgacc Protospacer
. *******.******* *******.*
514. spacer 5.10|1572780|31|CP025599|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
agcgtggccttggccgccgttgccggcggtc Protospacer
*.. ****** ************ ***.
515. spacer 10.5|3740989|34|CP025599|CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.735
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
attgagatccgcgacgatgggtgtggcgccggcg Protospacer
.** .********.**** ***********.
516. spacer 10.5|3740989|34|CP025599|CRT matches to MG812496 (Gordonia phage SallySpecial, complete genome) position: , mismatch: 9, identity: 0.735
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
gcgcaccaccgcggcggtgcgggtggcgccggcg Protospacer
*. . *. *****.***** *************.
517. spacer 1.6|366824|33|CP025599|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
518. spacer 1.6|366824|33|CP025599|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
519. spacer 1.6|366824|33|CP025599|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtattcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
520. spacer 3.2|926675|39|CP025599|CRT matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.744
cggcgcgggcggggccgtcacgggaaccggcgccaccgg CRISPR spacer
cacgggggccggggccgccacgggaaccggcgccccgcc Protospacer
*. * ** ********.**************** *
521. spacer 3.5|926828|36|CP025599|CRT matches to KX683875 (Mycobacterium phage Baehexic, complete genome) position: , mismatch: 10, identity: 0.722
aggggccggtgggctgttcaacggcggcggggccgg CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct Protospacer
****************.****** ** * *
522. spacer 3.5|926828|36|CP025599|CRT matches to KM197169 (Mycobacterium phage Piro94, complete genome) position: , mismatch: 10, identity: 0.722
aggggccggtgggctgttcaacggcggcggggccgg CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct Protospacer
****************.****** ** * *
523. spacer 3.5|926828|36|CP025599|CRT matches to MF668269 (Mycobacterium phage Drake55, complete genome) position: , mismatch: 10, identity: 0.722
aggggccggtgggctgttcaacggcggcggggccgg CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct Protospacer
****************.****** ** * *
524. spacer 3.5|926828|36|CP025599|CRT matches to MK284522 (Mycobacterium phage Malec, complete genome) position: , mismatch: 10, identity: 0.722
aggggccggtgggctgttcaacggcggcggggccgg CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct Protospacer
****************.****** ** * *
525. spacer 3.5|926828|36|CP025599|CRT matches to KM677210 (Mycobacterium phage Larenn, complete genome) position: , mismatch: 10, identity: 0.722
aggggccggtgggctgttcaacggcggcggggccgg CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct Protospacer
****************.****** ** * *
526. spacer 3.17|927365|36|CP025599|CRT matches to MN369764 (Mycobacterium phage Rahalelujah, complete genome) position: , mismatch: 10, identity: 0.722
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
atctggaggcaacggcggtaacggcggggccagcac Protospacer
... . ************************.**.
527. spacer 3.17|927365|36|CP025599|CRT matches to NZ_CP025548 (Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.722
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
gaccggcggcaacggcggaaacggcggcgccgcagc Protospacer
* . . ************ ******** **** *
528. spacer 5.10|1572780|31|CP025599|CRISPRCasFinder matches to NC_017273 (Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gggctcgcctcgcccgccgttcccgccgctc Protospacer
.. . *****.********** ****** .
529. spacer 5.10|1572780|31|CP025599|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ttcctcgccttccccgccgctgccgccgcgg Protospacer
.. ****** *******.******** .
530. spacer 5.10|1572780|31|CP025599|CRISPRCasFinder matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggccagaacttccccgctgttgccgccggca Protospacer
..... . *** *****.*************
531. spacer 5.10|1572780|31|CP025599|CRISPRCasFinder matches to NC_017590 (Thermus thermophilus JL-18 plasmid pTTJL1802, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gggctcgcctcgcccgccgttcccgccgctc Protospacer
.. . *****.********** ****** .
532. spacer 5.10|1572780|31|CP025599|CRISPRCasFinder matches to NZ_AP014581 (Burkholderia sp. RPE67 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcgtggccttggccgccgttgccggcggtc Protospacer
... ****** ************ ***.
533. spacer 5.13|1573029|34|CP025599|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 10, identity: 0.706
gtcgccgtgcagccagccaccaccgccaccggcg CRISPR spacer
ccgatgatgcagccggccaccaccgccaccagca Protospacer
. .. .*******.***************.**.
534. spacer 8.9|3119784|35|CP025599|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 10, identity: 0.714
acttgcgcgcacaacgcatccgccatccacggggc CRISPR spacer
gtcaccgcgcacaacacattcgccatccacacggt Protospacer
... **********.***.**********. **.
535. spacer 9.20|3123256|34|CP025599|CRISPRCasFinder,CRT matches to NZ_AP022335 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence) position: , mismatch: 10, identity: 0.706
tagaaggcgatcactggaagcacggcgcttgcga CRISPR spacer
ggcaaggcgatcagtggaagctcggcggcggcac Protospacer
. ********** ******* ***** . **.
536. spacer 9.36|3123260|34|CP025599|PILER-CR matches to NZ_AP022335 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence) position: , mismatch: 10, identity: 0.706
tagaaggcgatcactggaagcacggcgcttgcga CRISPR spacer
ggcaaggcgatcagtggaagctcggcggcggcac Protospacer
. ********** ******* ***** . **.
537. spacer 10.5|3740989|34|CP025599|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 10, identity: 0.706
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
cagcgcggccgcgtcggtgggggtggcgcccgcc Protospacer
. * ***** **************** **
538. spacer 10.5|3740989|34|CP025599|CRT matches to NZ_CP024986 (Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc Protospacer
* .* *******.** *************.
539. spacer 10.5|3740989|34|CP025599|CRT matches to NC_024970 (Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc Protospacer
* .* *******.** *************.
540. spacer 10.5|3740989|34|CP025599|CRT matches to NZ_KJ396772 (Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc Protospacer
* .* *******.** *************.
541. spacer 10.5|3740989|34|CP025599|CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 11, identity: 0.676
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
cgcccccggcgtgacggtggaggtggcgccggcc Protospacer
...*. **.********.************