1. spacer 8.7|1212299|22|CP025603|CRISPRCasFinder matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 1, identity: 0.955
tgtcggcggtgccggcggtgtc CRISPR spacer
tgtcggcggtgccggcggtgcc Protospacer
********************.*
2. spacer 8.7|1212299|22|CP025603|CRISPRCasFinder matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
tgtcggcggtgccggcggtggg Protospacer
********************
3. spacer 8.7|1212299|22|CP025603|CRISPRCasFinder matches to NC_015314 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
agtcggcggtgccgacggtgtc Protospacer
*************.*******
4. spacer 8.7|1212299|22|CP025603|CRISPRCasFinder matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
cgtcggcggtgccggcggcgtc Protospacer
.*****************.***
5. spacer 8.7|1212299|22|CP025603|CRISPRCasFinder matches to NC_021056 (Streptomyces sp. PAMC 26508 plasmid pSP01, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
cgtcggcggtgtcggcggtgtc Protospacer
.**********.**********
6. spacer 8.7|1212299|22|CP025603|CRISPRCasFinder matches to NZ_CP045122 (Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
ggtcggcggtgccggcggcgtc Protospacer
*****************.***
7. spacer 8.7|1212299|22|CP025603|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
tgtcggcggtgccggccgtgta Protospacer
**************** ****
8. spacer 8.7|1212299|22|CP025603|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
tgtcggcggtgccggccgtgta Protospacer
**************** ****
9. spacer 8.7|1212299|22|CP025603|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
ggtcggcggtgccggccgtgtc Protospacer
*************** *****
10. spacer 8.7|1212299|22|CP025603|CRISPRCasFinder matches to NC_047977 (Microbacterium phage Hendrix, complete genome) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
tgacggcggtgccggcggtgtg Protospacer
** ******************
11. spacer 8.15|1212683|22|CP025603|CRISPRCasFinder matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 2, identity: 0.909
ggacggtggtaccggcggtcag CRISPR spacer
tgacggtggtgccggcggtcag Protospacer
*********.***********
12. spacer 6.16|927326|24|CP025603|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
gaccgacctcggcggcgcgggcga Protospacer
.***************** ****.
13. spacer 6.16|927326|24|CP025603|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
caccggcctgggcggcgctggcgg Protospacer
****.*** **************
14. spacer 6.16|927326|24|CP025603|CRT matches to NZ_CP034768 (Enterobacter sp. N18-03635 plasmid pFRI-6, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
taacgtcctcggcggcgctggcgg Protospacer
* ** ******************
15. spacer 6.16|927326|24|CP025603|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
agccgacctcggcggcgatggcgc Protospacer
*.*************** *****
16. spacer 6.16|927326|24|CP025603|CRT matches to NZ_AP019631 (Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
taacgtcctcggcggcgctggcgg Protospacer
* ** ******************
17. spacer 6.16|927326|24|CP025603|CRT matches to NZ_AP019631 (Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
taacgtcctcggcggcgctggcgg Protospacer
* ** ******************
18. spacer 6.16|927326|24|CP025603|CRT matches to KU716094 (Mycobacterium phage Eidsmoe, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
gaccgcgctcggcggcgctggcgg Protospacer
.**** *****************
19. spacer 6.16|927326|24|CP025603|CRT matches to MH371122 (Mycobacterium phage Priya, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
gaccgcgctcggcggcgctggcgg Protospacer
.**** *****************
20. spacer 6.16|927326|24|CP025603|CRT matches to MK016502 (Mycobacterium phage Pat3, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
catcggcctcggcggcgctggcgg Protospacer
*.**.******************
21. spacer 6.16|927326|24|CP025603|CRT matches to MK937593 (Mycobacterium phage Flypotenuse, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
catcggcctcggcggcgctggcgg Protospacer
*.**.******************
22. spacer 6.16|927326|24|CP025603|CRT matches to MG872835 (Mycobacterium phage Conquerage, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
gaccgcgctcggcggcgctggcgg Protospacer
.**** *****************
23. spacer 6.16|927326|24|CP025603|CRT matches to MH536820 (Mycobacterium phage Glexan, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
catcggcctcggcggcgctggcgg Protospacer
*.**.******************
24. spacer 6.16|927326|24|CP025603|CRT matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
aaccggcctcggcggcgctgccgc Protospacer
*****.************** **
25. spacer 6.16|927326|24|CP025603|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
caccgagctcggcggcgctgccgg Protospacer
***** ************* ***
26. spacer 6.16|927326|24|CP025603|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
caccggcctcggcggcgcgggcgg Protospacer
****.************ *****
27. spacer 6.16|927326|24|CP025603|CRT matches to MH271298 (Microbacterium phage Floof, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
aacccacctcggcggcgatggcgc Protospacer
**** ************ *****
28. spacer 8.4|1212119|25|CP025603|CRISPRCasFinder matches to NZ_CP015739 (Shinella sp. HZN7 plasmid pShin-03, complete sequence) position: , mismatch: 3, identity: 0.88
tgccggcggcgccggcgtagcgccc CRISPR spacer
cgacggcggcgccggcgaagcgccc Protospacer
.* ************** *******
29. spacer 8.4|1212119|25|CP025603|CRISPRCasFinder matches to NZ_CP018821 (Sphingomonas koreensis strain ABOJV plasmid tig00000001, complete sequence) position: , mismatch: 3, identity: 0.88
tgccggcggcgccggcgtagcgccc CRISPR spacer
tgccggcggcgcccgcgcagcgccg Protospacer
************* ***.******
30. spacer 8.4|1212119|25|CP025603|CRISPRCasFinder matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 3, identity: 0.88
tgccggcggcgccggcgtagcgccc CRISPR spacer
tgtcgccggcgccggcgtagcgcgc Protospacer
**.** ***************** *
31. spacer 8.4|1212119|25|CP025603|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.88
tgccggcggcgccggcgtagcgccc CRISPR spacer
tgccggcggcgccggcgcggcgctc Protospacer
*****************..****.*
32. spacer 8.4|1212119|25|CP025603|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 3, identity: 0.88
tgccggcggcgccggcgtagcgccc CRISPR spacer
tgccggcggcgccggcgcggcgctc Protospacer
*****************..****.*
33. spacer 8.4|1212119|25|CP025603|CRISPRCasFinder matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 3, identity: 0.88
tgccggcggcgccggcgtagcgccc CRISPR spacer
tgccggcggcgctggcgtcgcgcgc Protospacer
************.***** **** *
34. spacer 8.7|1212299|22|CP025603|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
cgtcggcggtgccggcggtgag Protospacer
.*******************
35. spacer 8.7|1212299|22|CP025603|CRISPRCasFinder matches to NZ_CP040721 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
gtgcggcggtgccggcggtgtc Protospacer
*******************
36. spacer 8.7|1212299|22|CP025603|CRISPRCasFinder matches to NZ_CP040721 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
gtgcggcggtgccggcggtgtc Protospacer
*******************
37. spacer 8.7|1212299|22|CP025603|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
cgtcggcggtgccggcggtgag Protospacer
.*******************
38. spacer 8.7|1212299|22|CP025603|CRISPRCasFinder matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
cgtcggcggtgccggcggtggt Protospacer
.******************* .
39. spacer 8.7|1212299|22|CP025603|CRISPRCasFinder matches to KT381864 (Thiobacimonas phage vB_ThpS-P1, complete genome) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
catcggcggtgccggcggtgtg Protospacer
..*******************
40. spacer 8.11|1212482|22|CP025603|CRISPRCasFinder matches to NZ_CP048287 (Paenibacillus sp. 14171R-81 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.864
gctgtggggcggcggtggtgcc CRISPR spacer
cgtgtggggcggcggtggtgca Protospacer
*******************
41. spacer 10.9|2088449|24|CP025603|CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 3, identity: 0.875
atcgaagaagctgaacccgccgtt CRISPR spacer
cgcgaagaagctgaagccgccgtt Protospacer
************* ********
42. spacer 10.9|2088449|24|CP025603|CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 3, identity: 0.875
atcgaagaagctgaacccgccgtt CRISPR spacer
cgcgaagaagctgaagccgccgtt Protospacer
************* ********
43. spacer 16.18|3949827|27|CP025603|CRT matches to NC_023695 (Mycobacterium phage Violet, complete genome) position: , mismatch: 3, identity: 0.889
caccggcggcaaaggcggcatgggcgg CRISPR spacer
taccggcggcaaaggcggcaacggcgg Protospacer
.******************* *****
44. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 3, identity: 0.889
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cctcggcggcaaaggcggcattggcgg Protospacer
* .****************** *****
45. spacer 4.1|366487|27|CP025603|CRISPRCasFinder matches to NC_023591 (Mycobacterium phage Adler, complete genome) position: , mismatch: 4, identity: 0.852
-aacgcaccggtgtccacatcgcccgtg CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg Protospacer
*..** ********* ***********
46. spacer 4.1|366487|27|CP025603|CRISPRCasFinder matches to KF981876 (UNVERIFIED: Mycobacterium phage ADLER F1725, complete genome) position: , mismatch: 4, identity: 0.852
-aacgcaccggtgtccacatcgcccgtg CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg Protospacer
*..** ********* ***********
47. spacer 4.7|366883|27|CP025603|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 4, identity: 0.852
gcgaagccgatgttgtagctgccggtg CRISPR spacer
ccgaagccgatgtcgtagcggccggcg Protospacer
************.***** *****.*
48. spacer 4.10|367093|27|CP025603|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgaaggtgaggtcgccgggg Protospacer
.* ********* ***********.**
49. spacer 4.10|367093|27|CP025603|CRISPRCasFinder matches to NC_016652 (Rhodococcus phage REQ2, complete genome) position: , mismatch: 4, identity: 0.852
accccgccgaagttgaggtcgccgagg CRISPR spacer
acggcgccgaagttgaggccgccgacg Protospacer
** **************.****** *
50. spacer 6.10|927041|27|CP025603|CRT matches to KY945355 (Mycobacterium phage Shandong1, complete genome) position: , mismatch: 4, identity: 0.852
cggatccggcggcggcggtagcgttgc CRISPR spacer
cgcatccggcggcggcggttgcgttct Protospacer
** **************** ***** .
51. spacer 6.10|927041|27|CP025603|CRT matches to NZ_CP015095 (Pelagibaca abyssi strain JLT2014 plasmid pPABY4, complete sequence) position: , mismatch: 4, identity: 0.852
cggatccggcggcggcggtagcgttgc CRISPR spacer
cggcctcggcggcggcggtggcgttgc Protospacer
*** ..*************.*******
52. spacer 6.10|927041|27|CP025603|CRT matches to NC_041888 (Mycobacterium phage Tortellini, complete genome) position: , mismatch: 4, identity: 0.852
cggatccggcggcggcggtagcgttgc CRISPR spacer
cggccgcggcggcggcggtagcggtgc Protospacer
*** . ***************** ***
53. spacer 6.15|927278|30|CP025603|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 4, identity: 0.867
cctgctgttcggctccggcggcgctggcgg- CRISPR spacer
gctgctgttcggcgccggcggcg-tggtggc Protospacer
************ ********* ***.**
54. spacer 6.16|927326|24|CP025603|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ctacgaccacggcggcgctggcgg Protospacer
***** ***************
55. spacer 6.16|927326|24|CP025603|CRT matches to NZ_CP025431 (Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
gcccgatctcggcggcgctggcgt Protospacer
. ****.****************
56. spacer 6.16|927326|24|CP025603|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
tcccgacctcggcggtgctggcgc Protospacer
*************.*******
57. spacer 6.16|927326|24|CP025603|CRT matches to NZ_CP016822 (Rhodococcus sp. p52 plasmid pDF03, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
cgtcgacgtcggcggcgctggcgg Protospacer
..**** ****************
58. spacer 6.16|927326|24|CP025603|CRT matches to MN582086 (Siphoviridae sp. ctdEk19, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
cttcgacttcggcggcgctggcgg Protospacer
.****.****************
59. spacer 6.16|927326|24|CP025603|CRT matches to MF919502 (Mycobacterium phage Demsculpinboyz, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ccgcggcctcggcggcgctggcgg Protospacer
**.******************
60. spacer 6.16|927326|24|CP025603|CRT matches to MT889380 (Mycobacterium phage Coco12, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ccgcggcctcggcggcgctggcgg Protospacer
**.******************
61. spacer 6.16|927326|24|CP025603|CRT matches to NC_023698 (Mycobacterium phage Avani, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ccgcggcctcggcggcgctggcgg Protospacer
**.******************
62. spacer 6.16|927326|24|CP025603|CRT matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ccgcggcctcggcggcgctggcgg Protospacer
**.******************
63. spacer 6.16|927326|24|CP025603|CRT matches to NZ_CP050953 (Rhodococcus sp. DMU1 plasmid unnamed) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
cgccgacctcggcggcggtggcga Protospacer
.*************** *****.
64. spacer 6.16|927326|24|CP025603|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
tcccgacctcggcggtgctggcgc Protospacer
*************.*******
65. spacer 6.16|927326|24|CP025603|CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ctacgaccacggcggcgctggcgg Protospacer
***** ***************
66. spacer 6.16|927326|24|CP025603|CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
tctcgacctcggcggcgatggcgg Protospacer
.************** ******
67. spacer 6.16|927326|24|CP025603|CRT matches to MN096355 (Mycobacterium phage Purky, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
tgccgacctcggctgcgctggcgc Protospacer
.*********** *********
68. spacer 6.16|927326|24|CP025603|CRT matches to MK279853 (Gordonia phage Gray, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ggtcgacctcgacggcgctggcgg Protospacer
...********.************
69. spacer 8.4|1212119|25|CP025603|CRISPRCasFinder matches to NZ_CP018821 (Sphingomonas koreensis strain ABOJV plasmid tig00000001, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcgccggcgtagcgccc CRISPR spacer
agccggcggcgccggcatagcgctt Protospacer
***************.******..
70. spacer 8.4|1212119|25|CP025603|CRISPRCasFinder matches to NZ_CP011450 (Sphingomonas sanxanigenens DSM 19645 = NX02 plasmid pNXO2, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcgccggcgtagcgccc CRISPR spacer
agccggcggcgccggcatagcgctt Protospacer
***************.******..
71. spacer 8.4|1212119|25|CP025603|CRISPRCasFinder matches to NZ_CP023738 (Methylosinus trichosporium OB3b plasmid pOB3b1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcgccggcgtagcgccc CRISPR spacer
gatcggcggcgccggcgaagcgccc Protospacer
..************** *******
72. spacer 8.4|1212119|25|CP025603|CRISPRCasFinder matches to NZ_CP049029 (Fluviibacterium aquatile strain SC52 plasmid pSC52_1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcgccggcgtagcgccc CRISPR spacer
agccggcggcgcgggcgcagcgcca Protospacer
*********** ****.******
73. spacer 8.4|1212119|25|CP025603|CRISPRCasFinder matches to NZ_CP027024 (Streptomyces sp. WAC00288 plasmid p2, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcgccggcgtagcgccc CRISPR spacer
tgccgacggcgccggtgtagcgcag Protospacer
*****.*********.*******
74. spacer 8.4|1212119|25|CP025603|CRISPRCasFinder matches to NZ_KF418775 (Burkholderia pseudomallei strain MSHR1950 plasmid pBPSE01, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcgccggcgtagcgccc CRISPR spacer
tgccgaaggcgccggcgtagcgcat Protospacer
*****. **************** .
75. spacer 8.4|1212119|25|CP025603|CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcgccggcgtagcgccc CRISPR spacer
cgccggcggcaccggcgtggcgccg Protospacer
.*********.*******.*****
76. spacer 8.4|1212119|25|CP025603|CRISPRCasFinder matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcgccggcgtagcgccc CRISPR spacer
cgccggcggcgccggcgtggcgacg Protospacer
.*****************.*** *
77. spacer 8.4|1212119|25|CP025603|CRISPRCasFinder matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcgccggcgtagcgccc CRISPR spacer
gaccggctgcgccggcgcagcgccc Protospacer
.***** *********.*******
78. spacer 8.4|1212119|25|CP025603|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcgccggcgtagcgccc CRISPR spacer
cgccggcggcgccggcgtggcgacg Protospacer
.*****************.*** *
79. spacer 8.4|1212119|25|CP025603|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcgccggcgtagcgccc CRISPR spacer
cgccggcggcgccggcgtggcgacg Protospacer
.*****************.*** *
80. spacer 8.4|1212119|25|CP025603|CRISPRCasFinder matches to MK937610 (Microbacterium phage Arroyo, complete genome) position: , mismatch: 4, identity: 0.84
tgccggcggcgccggcgtagcgccc CRISPR spacer
ccccggaggcgccggcgtagcgctc Protospacer
. **** ****************.*
81. spacer 8.4|1212119|25|CP025603|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcgccggcgtagcgccc CRISPR spacer
cgccggcggcgccggcgtggcgacg Protospacer
.*****************.*** *
82. spacer 8.4|1212119|25|CP025603|CRISPRCasFinder matches to NC_012723 (Burkholderia glumae BGR1 plasmid bglu_1p, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcgccggcgtagcgccc CRISPR spacer
tgccggcggccccggcgtcgcgcga Protospacer
********** ******* ****
83. spacer 8.4|1212119|25|CP025603|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcgccggcgtagcgccc CRISPR spacer
cgccggcggcgccggcgtcgcgacg Protospacer
.***************** *** *
84. spacer 8.4|1212119|25|CP025603|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcgccggcgtagcgccc CRISPR spacer
cgccgtcggcgccggcgtcgcgccg Protospacer
.**** ************ *****
85. spacer 8.4|1212119|25|CP025603|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcgccggcgtagcgccc CRISPR spacer
cgccggcggcgccggcgtcgcgacg Protospacer
.***************** *** *
86. spacer 8.4|1212119|25|CP025603|CRISPRCasFinder matches to NZ_CP026539 (Desulfovibrio carbinolicus strain DSM 3852 plasmid pDCAR1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcgccggcgtagcgccc CRISPR spacer
ggccggcggcggcggcgtagcgggc Protospacer
********** ********** *
87. spacer 10.9|2088449|24|CP025603|CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
atcgaagaagctgaacacgcccgc Protospacer
**************** **** .
88. spacer 10.9|2088449|24|CP025603|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
gtcgatgaagctgaacccgccgaa Protospacer
.**** ****************
89. spacer 10.9|2088449|24|CP025603|CRT matches to NZ_CP015007 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
atcggagaagctgaacccgcccgg Protospacer
****.****************
90. spacer 16.18|3949827|27|CP025603|CRT matches to MH001451 (Mycobacterium phage Nairb, complete genome) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cccgggcggcaagggcggcaagggcgg Protospacer
* * ********.******* ******
91. spacer 16.18|3949827|27|CP025603|CRT matches to MF155936 (Mycobacterium phage ZenTime222, complete genome) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cccgggcggcaagggcggcaagggcgg Protospacer
* * ********.******* ******
92. spacer 16.18|3949827|27|CP025603|CRT matches to MK494089 (Mycobacterium phage Ibrahim, complete genome) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cccgggcggcaagggcggcaagggcgg Protospacer
* * ********.******* ******
93. spacer 16.18|3949827|27|CP025603|CRT matches to NC_024135 (Mycobacterium phage Bernal13, complete genome) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cccgggcggcaagggcggcaagggcgg Protospacer
* * ********.******* ******
94. spacer 16.18|3949827|27|CP025603|CRT matches to KM591905 (Mycobacterium phage RonRayGun, complete genome) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cccgggcggcaagggcggcaagggcgg Protospacer
* * ********.******* ******
95. spacer 16.18|3949827|27|CP025603|CRT matches to MN735432 (Mycobacteriophage Whitty, complete genome) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cccgggcggcaagggcggcaagggcgg Protospacer
* * ********.******* ******
96. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP022541 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
acccggcggcaaaggcgcaatgggcgg Protospacer
*************** ********
97. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP041048 (Citrobacter sp. CF971 plasmid pBM527-2, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
98. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_KX832927 (Providencia rettgeri strain 16pre36 plasmid p16Pre36-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
99. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_KX786648 (Enterobacter cloacae strain B557 plasmid pB557-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
100. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_KY399975 (Enterobacter cloacae strain EClY2403 plasmid pNDM1_EClY2403, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
101. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_KY399974 (Enterobacter cloacae strain EClY2402 plasmid pNDM1_EClY2402, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
102. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP053895 (Proteus mirabilis strain JPM24 plasmid pJPM24, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
103. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_AP023051 (Citrobacter portucalensis strain IOMTU157 plasmid pIOMTU157, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
104. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP034756 (Enterobacter hormaechei subsp. hoffmannii strain Eh1 plasmid p2, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
105. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_KX636095 (Klebsiella pneumoniae strain RJ119 plasmid pRJ119-NDM1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
106. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_KU302802 (Enterobacter cloacae strain SZECL1 plasmid pNDM1_SZ2 clone ST231, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
107. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_KU302801 (Enterobacter cloacae strain SZECL1 plasmid pNDM1_SZ1 clone ST231, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
108. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_KJ588779 (Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pNDM-US-2, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
109. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_KR351290 (Klebsiella pneumoniae subsp. pneumoniae strain K351 plasmid pK351, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
110. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_KJ802405 (Providencia stuartii isolate GN576 plasmid pNDM-PstGN576, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
111. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_KJ812998 (Enterobacter cloacae isolate GN574 plasmid pNDM-Ec1GN574, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
112. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_KP900016 (Leclercia adecarboxylata strain P10164 plasmid pP10164-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
113. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_KP765744 (Enterobacter cloacae strain ECN49 plasmid pNDM-ECN49, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
114. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_KP868647 (Enterobacter cloacae strain WCHECl-14653 plasmid pNDM1_EC14653, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
115. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_KJ802404 (Escherichia coli isolate GN568 plasmid pNDM-EcoGN568, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
116. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_KT965092 (Acinetobacter towneri strain G165 plasmid pNDM-GJ01, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
117. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_KT965093 (Acinetobacter towneri strain G295 plasmid pNDM-GJ02, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
118. spacer 16.18|3949827|27|CP025603|CRT matches to NC_023322 (Acinetobacter bereziniae strain CHI-40-1 plasmid pNDM-40-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
119. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP029731 (Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
120. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_KC887916 (Escherichia coli strain ARL10/167 isolate EC4 plasmid pEC4-NDM-6, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
121. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_KC887917 (Enterobacter cloacae isolate ECL3 plasmid pECL3-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
122. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP020524 (Escherichia coli strain 190 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
123. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP010370 (Acinetobacter nosocomialis strain 6411 plasmid p6411-9.012kb, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
124. spacer 16.18|3949827|27|CP025603|CRT matches to MN061454 (Enterobacter cloacae strain EC-14-60 plasmid pECL-14-60-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
125. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP032278 (Acinetobacter sp. WCHAc010034 plasmid pNDM1_010034, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
126. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP045561 (Acinetobacter nosocomialis strain AC1530 plasmid pAC1530, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
127. spacer 16.18|3949827|27|CP025603|CRT matches to NC_019045 (Escherichia coli strain N10-2337 plasmid pNDM102337, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
128. spacer 16.18|3949827|27|CP025603|CRT matches to NC_025130 (Raoultella planticola strain RJA274 plasmid NDM-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
129. spacer 16.18|3949827|27|CP025603|CRT matches to NC_019158 (Klebsiella pneumoniae plasmid pNDM10469, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
130. spacer 16.18|3949827|27|CP025603|CRT matches to MN310375 (Klebsiella quasipneumoniae strain QD1501 plasmid pQD1501-Ct1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
131. spacer 16.18|3949827|27|CP025603|CRT matches to MN310377 (Klebsiella pneumoniae strain 12085 plasmid p12085-Ct1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
132. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
133. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
134. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP037965 (Klebsiella pneumoniae strain SCKP020135 plasmid pNDM1_020135, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
135. spacer 16.18|3949827|27|CP025603|CRT matches to NC_025184 (Klebsiella pneumoniae strain RJF866 plasmid pRJF866, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
136. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP025613 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcgg-catgggcgg CRISPR spacer
caccggcggcaaaggcggccatcgaca- Protospacer
****************** *** *.*.
137. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP011518 (Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcagaggcggcaagggcgg Protospacer
*. ********.******** ******
138. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
139. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP021962 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000008, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
140. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP022350 (Klebsiella michiganensis strain K516 plasmid pK516_NDM1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
141. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP046274 (Enterobacter hormaechei strain E70 plasmid pE70-NDM1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
142. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP039811 (Klebsiella pneumoniae strain C2660 plasmid pC2660-4-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
143. spacer 16.18|3949827|27|CP025603|CRT matches to NC_011366 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cctcggccgcaaaggcggcattggcgg Protospacer
* .**** ************* *****
144. spacer 16.18|3949827|27|CP025603|CRT matches to NC_025000 (Acinetobacter lwoffii strain Iz4b plasmid pNDM-Iz4b, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
145. spacer 16.18|3949827|27|CP025603|CRT matches to NC_024959 (Acinetobacter calcoaceticus strain NDM-WS2 plasmid pNDM-WS2, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
146. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP014276 (Martelella sp. AD-3 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gatcggcggcaagggcggcatggccgg Protospacer
*.*********.********** ***
147. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP021536 (Escherichia coli strain AR_0119 plasmid unitig_2, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
148. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP010399 (Acinetobacter baumannii strain 6200 plasmid p6200-47.274kb, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
149. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP035935 (Acinetobacter cumulans strain WCHAc060092 plasmid pNDM1_060092, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
150. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP006661 (Klebsiella pneumoniae strain ATCC BAA-2146 plasmid pNDM-US, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
151. spacer 16.18|3949827|27|CP025603|CRT matches to CP050164 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncA/C2, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
152. spacer 16.18|3949827|27|CP025603|CRT matches to MK933278 (Enterobacter hormaechei strain SCNJ07 plasmid pNDM-SCNJ07, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
153. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
154. spacer 16.18|3949827|27|CP025603|CRT matches to NC_019069 (Escherichia coli plasmid pNDM10505, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
155. spacer 16.18|3949827|27|CP025603|CRT matches to AMXH01000087 (Acinetobacter pittii strain XM1570 plasmid pXM1, complete sequence, whole genome shotgun sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
156. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_JQ739158 (Acinetobacter lwoffii strain ABZ78 plasmid pABZ78, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
157. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP043383 (Enterobacter hormaechei subsp. xiangfangensis strain WCHEX045001 plasmid pNDM1_045001, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
158. spacer 16.18|3949827|27|CP025603|CRT matches to NC_019985 (Acinetobacter baumannii ZW85-1 plasmid pAbNDM-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
159. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP053365 (Klebsiella pneumoniae strain BA2275 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
160. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP018366 (Klebsiella pneumoniae strain Kp_Goe_62629 plasmid pKp_Goe_629-2, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
161. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP023187 (Klebsiella michiganensis strain K518 plasmid pK518_NDM1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
162. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP028786 (Klebsiella pneumoniae strain SCKP020049 plasmid pNDM1_020049, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
163. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP021936 (Escherichia coli strain AR_0055 plasmid unitig_2, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
164. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
165. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP023948 (Klebsiella pneumoniae strain FDAARGOS_446 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
166. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP041938 (Klebsiella pneumoniae strain KP14003 plasmid pNDM-KP14003, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
167. spacer 16.18|3949827|27|CP025603|CRT matches to NC_022589 (Providencia rettgeri strain 09ACRGNY2001 plasmid pPrY2001, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
168. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP015835 (Escherichia coli strain MS6198 plasmid pMS6198A, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
169. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
170. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP014478 (Acinetobacter pittii strain AP_882 plasmid pNDM-AP_882, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
171. spacer 16.18|3949827|27|CP025603|CRT matches to NC_023908 (Klebsiella pneumoniae strain KP1 plasmid pKP1-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
172. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_AP018830 (Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
173. spacer 16.18|3949827|27|CP025603|CRT matches to NC_019268 (Acinetobacter lwoffii plasmid pNDM-BJ01, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
174. spacer 16.18|3949827|27|CP025603|CRT matches to NC_019281 (Acinetobacter lwoffii plasmid pNDM-BJ02, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
175. spacer 16.18|3949827|27|CP025603|CRT matches to NC_025116 (Acinetobacter sp. M131 plasmid pM131_NDM1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
176. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP040884 (Escherichia coli strain K71-77 plasmid pK71-77-1-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
177. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP026015 (Klebsiella variicola strain 13450 plasmid p13450-3, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
178. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_AP018143 (Escherichia coli strain M214 isolate M214 plasmid pM214_AC2, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
179. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cctcggccgcaaaggcggcattggcgg Protospacer
* .**** ************* *****
180. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP048797 (Providencia vermicola strain P8538 plasmid p8538-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
181. spacer 16.18|3949827|27|CP025603|CRT matches to MN937240 (Enterobacter cloacae strain BSI034 plasmid pBSI034-NDM1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
182. spacer 16.18|3949827|27|CP025603|CRT matches to MN603981 (Klebsiella aerogenes strain 1564 plasmid p1564, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
183. spacer 16.18|3949827|27|CP025603|CRT matches to MN604268 (Escherichia coli strain J53 plasmid pJ53_SAL-19-0623_NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
184. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_LN833432 (Acinetobacter baumannii isolate CHI-32 plasmid pNDM-32, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
185. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_MK123268 (Serratia marcescens strain M17468 plasmid pSMA17468, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
186. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP053897 (Providencia rettgeri strain YPR31 plasmid pYPR31, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
187. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP032132 (Acinetobacter chinensis strain WCHAc010005 plasmid pNDM1_010005, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
188. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_MH995508 (Enterobacter cloacae strain ECL17464 plasmid pECL17464, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
189. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_MH995506 (Citrobacter freundii strain CFR17394 plasmid pCFR17394, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
190. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_MH917283 (Klebsiella pneumoniae strain A575 plasmid pA575-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
191. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_MH909345 (Klebsiella pneumoniae strain N201205880 plasmid p205880-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
192. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_MH105050 (Salmonella enterica subsp. enterica serovar Lomita strain SL131 plasmid pSL131_IncA/C-IncX3, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
193. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_MH909343 (Klebsiella pneumoniae strain 1012018 plasmid p12018-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
194. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_MH909347 (Klebsiella pneumoniae strain 362713 plasmid p362713-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
195. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_MH263652 (Providencia rettgeri strain QD51 plasmid pNDM-QD51, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
196. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_MH917281 (Klebsiella pneumoniae strain 14504 plasmid p14504-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
197. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_MK101346 (Citrobacter freundii strain CRE3 plasmid pCRE7-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
198. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_MK757441 (Alcaligenes faecalis strain AN70 plasmid pAN70-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
199. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP020090 (Enterobacter cloacae strain PIMB10EC27 plasmid pEC27-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
200. spacer 16.18|3949827|27|CP025603|CRT matches to MN657245 (Enterobacteriaceae bacterium strain 23-16 plasmid pEC6332-T6, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
201. spacer 16.18|3949827|27|CP025603|CRT matches to MN657246 (Enterobacteriaceae bacterium strain 23-17 plasmid pEC6332-T7, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
202. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_MF344560 (Enterobacter hormaechei strain 128379 plasmid p128379-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
203. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_MG462729 (Escherichia coli strain AMA1742 plasmid pAMA1742, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
204. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP035537 (Klebsiella pneumoniae subsp. pneumoniae strain CCRI-22199 plasmid pKp199-2, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
205. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
206. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
207. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
208. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_KX470734 (Escherichia coli strain Ecoli14-55 plasmid pEC55-NDM4, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
209. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_KY296103 (Enterobacter cloacae strain 13E169 plasmid pHN84NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
210. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_KY978629 (Cronobacter sakazakii strain 505108 plasmid p505108-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
211. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_MF072961 (Citrobacter freundii strain P10159 plasmid pP10159-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
212. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_MF042356 (Enterobacter cloacae strain 20ES plasmid pNDM_20ES, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
213. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_MF042359 (Serratia marcescens strain 7209 plasmid pNDM_7209, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
214. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_KU726616 (Salmonella enterica subsp. enterica serovar Stanley strain LS001 plasmid pHS36-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
215. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_KU314941 (Klebsiella pneumoniae isolate KP04 plasmid pKP04NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
216. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_KX094555 (Escherichia coli strain ZHDC33 plasmid pZHDC33, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
217. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_KR059864 (Klebsiella pneumoniae strain KP-YQ13450 plasmid pYQ12450, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
218. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_KP987216 (Citrobacter freundii strain 112298 plasmid p112298-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
219. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP022126 (Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752AC2, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
220. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP010373 (Escherichia coli strain 6409 plasmid p6409-202.186kb, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
221. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP010373 (Escherichia coli strain 6409 plasmid p6409-202.186kb, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
222. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP010373 (Escherichia coli strain 6409 plasmid p6409-202.186kb, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
223. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP028588 (Escherichia coli strain WCHEC4533 plasmid pNDM4_000533, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
224. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP041930 (Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374C, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
225. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP028560 (Acinetobacter sp. WCHA45 plasmid pNDM1_010045, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
226. spacer 16.18|3949827|27|CP025603|CRT matches to NC_018994 (Escherichia coli plasmid pNDM-1_Dok01, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
227. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
228. spacer 16.18|3949827|27|CP025603|CRT matches to NC_019153 (Klebsiella pneumoniae plasmid pNDM-KN, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
229. spacer 16.18|3949827|27|CP025603|CRT matches to NC_019162 (Klebsiella pneumoniae strain CRE380 plasmid pNDM-HN380, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
230. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP032878 (Escherichia coli strain WCHEC000837 plasmid pNDM4_000837, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
231. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP018817 (Klebsiella pneumoniae strain AR_0049 plasmid unitig_1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
232. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cctcggccgcaaaggcggcattggcgg Protospacer
* .**** ************* *****
233. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cctcggccgcaaaggcggcattggcgg Protospacer
* .**** ************* *****
234. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP041642 (Klebsiella pneumoniae strain PIMB15ND2KP27 plasmid pKP27-NDM4, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
235. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP048828 (Acinetobacter baumannii strain ABF9692 plasmid pABF9692, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
236. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP021206 (Escherichia coli strain Z1002 plasmid p1002-NDM1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
237. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP050416 (Acinetobacter baumannii strain PM193665 plasmid pPM193665_1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
238. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP032284 (Acinetobacter sp. WCHA55 plasmid pNDM1_010055, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
239. spacer 16.18|3949827|27|CP025603|CRT matches to NC_020811 (Klebsiella pneumoniae strain KPN5047 plasmid pKPN5047, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
240. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP050426 (Acinetobacter baumannii strain PM194188 plasmid pPM194122_1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
241. spacer 16.18|3949827|27|CP025603|CRT matches to NC_023914 (Enterobacter cloacae strain CRE727 plasmid pNDM-HF727, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
242. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP044035 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
243. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP029118 (Escherichia coli strain AR435 plasmid unnamed5, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
244. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
245. spacer 16.18|3949827|27|CP025603|CRT matches to MN178638 (Kluyvera cryocrescens strain SCW13 plasmid pNDM1_SCW13, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
246. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP038280 (Raoultella ornithinolytica strain WLK218 plasmid pWLK-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
247. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
248. spacer 16.18|3949827|27|CP025603|CRT matches to CP050158 (Enterobacter cloacae plasmid Carbapenemase(NDM-1)_IncX3, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
249. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
250. spacer 16.18|3949827|27|CP025603|CRT matches to CP050161 (Escherichia coli plasmid Carbapenemase(NDM-1)_IncX3, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
251. spacer 16.18|3949827|27|CP025603|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
252. spacer 16.18|3949827|27|CP025603|CRT matches to NC_021501 (Klebsiella michiganensis E718 plasmid pKOX_NDM1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
253. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP017672 (Providencia rettgeri strain RB151 plasmid pRB151-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
254. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP023914 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
255. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP029386 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pNDM6_040074, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
256. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP022226 (Escherichia coli strain WCHEC96200 plasmid pNDM4_WCHEC96200, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
257. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
258. spacer 16.18|3949827|27|CP025603|CRT matches to NC_020552 (Citrobacter freundii plasmid pYE315203, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
259. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP040598 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15_NDM-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
260. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP014297 (Klebsiella pneumoniae strain KP38731 plasmid unnamed13 sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
261. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP020056 (Escherichia coli strain AR_0069 plasmid unitig_2, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
262. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP031884 (Klebsiella pneumoniae strain WCHKP095845 plasmid pNDM1_095845, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
263. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP031297 (Escherichia coli strain EC17GD31 plasmid pGD31-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
264. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP041229 (Acinetobacter haemolyticus strain AN54 plasmid pAhaeAN54e, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
265. spacer 16.18|3949827|27|CP025603|CRT matches to MN604267 (Salmonella enterica subsp. enterica serovar London strain SAL-19-0623 plasmid pSAL-19-0623_NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
266. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_MK372385 (Morganella morganii strain ABC140 plasmid pABC140-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
267. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_MK372381 (Klebsiella pneumoniae strain ABC52 plasmid pABC52-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
268. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP053899 (Proteus mirabilis strain YPM35 plasmid pJPM35-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
269. spacer 16.18|3949827|27|CP025603|CRT matches to MN657249 (Enterobacteriaceae bacterium strain 1086-16 plasmid pKP39-T3, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
270. spacer 16.18|3949827|27|CP025603|CRT matches to MN657250 (Enterobacteriaceae bacterium strain 1083-16 plasmid pKP39-T4, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
271. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_MH909333 (Klebsiella pneumoniae strain 7-SP plasmid p7SP-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
272. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_MH909346 (Klebsiella pneumoniae strain 20130907-4 plasmid p309074-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
273. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_MH909335 (Klebsiella pneumoniae strain 11-SP plasmid p11SP-NDM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
274. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_MH234505 (Escherichia coli strain CRE3694 plasmid pNDM-HK3694, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
275. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_MH917282 (Klebsiella pneumoniae strain A457 plasmid pA457-NDA, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
276. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_MH349095 (Escherichia coli strain 948 plasmid pMTC948, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
277. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_MK372386 (Klebsiella pneumoniae strain BC700 plasmid pBC700-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
278. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_MK372380 (Enterobacter cloacae strain ABC40 plasmid pABC40-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
279. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_MK372382 (Escherichia coli strain ABC54 plasmid pABC54-NDM-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
280. spacer 16.18|3949827|27|CP025603|CRT matches to MN657241 (Enterobacteriaceae bacterium strain 20-16 plasmid pCF104a-T3, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
281. spacer 16.18|3949827|27|CP025603|CRT matches to MN657242 (Enterobacteriaceae bacterium strain 128-16 plasmid pEC405a-T3, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
282. spacer 16.18|3949827|27|CP025603|CRT matches to MN657243 (Enterobacteriaceae bacterium strain 24-16 plasmid pEC744-T5, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
283. spacer 16.18|3949827|27|CP025603|CRT matches to MN657244 (Enterobacteriaceae bacterium strain 690-16 plasmid pEC6332-T3, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
284. spacer 16.18|3949827|27|CP025603|CRT matches to MN657247 (Enterobacteriaceae bacterium strain 460-16 plasmid pECl-T3, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
285. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_MG462728 (Escherichia coli strain AMA1416 plasmid pAMA1416, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
286. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_MH457126 (Vibrio alginolyticus strain Vb1394 plasmid pC1394, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
287. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_MH105052 (Escherichia coli strain EC600 plasmid pSL131T_IncX3, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
288. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP044464 (Acinetobacter schindleri strain HZE23-1 plasmid pHZE23-1-1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
289. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_MF042350 (Klebsiella pneumoniae strain 18ES plasmid pNDM_18ES, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
290. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_MF042354 (Klebsiella pneumoniae strain 6TM plasmid pNDM_6TM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
291. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_MF042353 (Klebsiella pneumoniae strain 1TM plasmid pNDM_1TM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
292. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_MF042351 (Serratia marcescens strain 12TM plasmid pNDM_12TM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
293. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_MF042358 (Enterobacter cloacae strain 22ES plasmid pNDM_22ES, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
294. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_MF415608 (Enterobacter cloacae strain hhy03 plasmid pNDM-BJ03, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
295. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_MF042352 (Serratia marcescens strain 4TM plasmid pNDM_4TM, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
296. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_MF042357 (Serratia marcescens strain 9580 plasmid pNDM_9580, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
297. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_MG252893 (Raoultella ornithinolytica strain pRor-30818cz plasmid Ror-30818cz, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cggcggcggcatgggcggcatgggcgg Protospacer
*. ******** .**************
298. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
ctcaggcggcaaaggcggcagcggcgg Protospacer
* * **************** *****
299. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP011481 (Hoeflea sp. IMCC20628 plasmid, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cgcgggcggcacagccggcatgggcgg Protospacer
*.* ******* ** ************
300. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
ctcaggcggcaaaggcggcagcggcgg Protospacer
* * **************** *****
301. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
ctcaggcggcaaaggcggcagcggcgg Protospacer
* * **************** *****
302. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cgcgggcggcaacggcggcaggggcgg Protospacer
*.* ******** ******* ******
303. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
catgggcggcatgggcggcatgggcgg Protospacer
**. ******* .**************
304. spacer 16.18|3949827|27|CP025603|CRT matches to MN694268 (Marine virus AFVG_250M110, complete genome) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
catgggcggcatgggcggcatgggcgg Protospacer
**. ******* .**************
305. spacer 16.18|3949827|27|CP025603|CRT matches to MN694268 (Marine virus AFVG_250M110, complete genome) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
catgggcggcatgggcggcatgggcgg Protospacer
**. ******* .**************
306. spacer 16.18|3949827|27|CP025603|CRT matches to MN694268 (Marine virus AFVG_250M110, complete genome) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
catgggcggcatgggcggcatgggcgg Protospacer
**. ******* .**************
307. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 4, identity: 0.852
caccggcggcaaaggcggcatgggcgg CRISPR spacer
caagggcggcaagggcggcatcggcgg Protospacer
** ********.******** *****
308. spacer 4.1|366487|27|CP025603|CRISPRCasFinder matches to LR794124 (Vibrio phage vB_Vc_SrVc9 genome assembly, chromosome: 1) position: , mismatch: 5, identity: 0.815
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
aacgcaccgttgtccacatcaccaatc Protospacer
********* **********.** .*
309. spacer 4.1|366487|27|CP025603|CRISPRCasFinder matches to NC_012662 (Vibrio phage VP93, complete genome) position: , mismatch: 5, identity: 0.815
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
aacgcaccgttgtccacatcaccaatc Protospacer
********* **********.** .*
310. spacer 4.7|366883|27|CP025603|CRISPRCasFinder matches to NZ_CP016084 (Streptomyces sp. SAT1 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815
gcgaagccgatgttgtagctgccggtg CRISPR spacer
gcgaagccgaagttgtagctgcgctcg Protospacer
********** *********** .*
311. spacer 4.7|366883|27|CP025603|CRISPRCasFinder matches to MN693945 (Marine virus AFVG_250M952, complete genome) position: , mismatch: 5, identity: 0.815
gcgaagccgatgttgtagctgccggtg CRISPR spacer
atgaagccgatgttgtcgctaccgggg Protospacer
..************** ***.**** *
312. spacer 4.10|367093|27|CP025603|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
313. spacer 4.10|367093|27|CP025603|CRISPRCasFinder matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
314. spacer 4.10|367093|27|CP025603|CRISPRCasFinder matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
315. spacer 4.10|367093|27|CP025603|CRISPRCasFinder matches to NZ_CP015368 (Methylobacterium phyllosphaerae strain CBMB27 plasmid CBMB27-p1, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tccccgcggaagttgaggtcgcgggtg Protospacer
****** ************** *. *
316. spacer 4.10|367093|27|CP025603|CRISPRCasFinder matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
317. spacer 4.10|367093|27|CP025603|CRISPRCasFinder matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
318. spacer 4.10|367093|27|CP025603|CRISPRCasFinder matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
319. spacer 4.10|367093|27|CP025603|CRISPRCasFinder matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
320. spacer 4.10|367093|27|CP025603|CRISPRCasFinder matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
321. spacer 4.10|367093|27|CP025603|CRISPRCasFinder matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
322. spacer 4.10|367093|27|CP025603|CRISPRCasFinder matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
323. spacer 4.10|367093|27|CP025603|CRISPRCasFinder matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
324. spacer 4.10|367093|27|CP025603|CRISPRCasFinder matches to NZ_CP020444 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
325. spacer 4.10|367093|27|CP025603|CRISPRCasFinder matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
326. spacer 4.10|367093|27|CP025603|CRISPRCasFinder matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
327. spacer 4.10|367093|27|CP025603|CRISPRCasFinder matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
328. spacer 4.10|367093|27|CP025603|CRISPRCasFinder matches to NZ_CP044078 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
329. spacer 4.10|367093|27|CP025603|CRISPRCasFinder matches to NZ_CP031081 (Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
330. spacer 4.10|367093|27|CP025603|CRISPRCasFinder matches to MN586031 (Gordonia phage Gambino, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
331. spacer 4.10|367093|27|CP025603|CRISPRCasFinder matches to KU998236 (Gordonia phage Blueberry, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
332. spacer 4.10|367093|27|CP025603|CRISPRCasFinder matches to MN062704 (Gordonia phage JuJu, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
333. spacer 4.10|367093|27|CP025603|CRISPRCasFinder matches to MK501729 (Gordonia phage Walrus, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
334. spacer 4.10|367093|27|CP025603|CRISPRCasFinder matches to NC_031226 (Gordonia phage BaxterFox, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
335. spacer 4.10|367093|27|CP025603|CRISPRCasFinder matches to MK967393 (Rhodococcus phage Whack, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tccttaccgaagttgaggtcgacgagg Protospacer
**...*************** *****
336. spacer 4.10|367093|27|CP025603|CRISPRCasFinder matches to MT723935 (Gordonia phage Azula, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
337. spacer 4.10|367093|27|CP025603|CRISPRCasFinder matches to KU963249 (Gordonia phage Yeezy, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
338. spacer 4.10|367093|27|CP025603|CRISPRCasFinder matches to MH153808 (Gordonia phage Petra, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
339. spacer 4.10|367093|27|CP025603|CRISPRCasFinder matches to MT639650 (Gordonia phage Ohgeesy, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
340. spacer 4.10|367093|27|CP025603|CRISPRCasFinder matches to MH536818 (Gordonia phage Frokostdame, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
341. spacer 4.10|367093|27|CP025603|CRISPRCasFinder matches to KX557275 (Gordonia phage CarolAnn, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
342. spacer 6.5|926831|27|CP025603|CRT matches to KX683875 (Mycobacterium phage Baehexic, complete genome) position: , mismatch: 5, identity: 0.815
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttgccggtgggctgttcagcggcgg Protospacer
****************.******
343. spacer 6.5|926831|27|CP025603|CRT matches to KM197169 (Mycobacterium phage Piro94, complete genome) position: , mismatch: 5, identity: 0.815
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttgccggtgggctgttcagcggcgg Protospacer
****************.******
344. spacer 6.5|926831|27|CP025603|CRT matches to MF668269 (Mycobacterium phage Drake55, complete genome) position: , mismatch: 5, identity: 0.815
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttgccggtgggctgttcagcggcgg Protospacer
****************.******
345. spacer 6.5|926831|27|CP025603|CRT matches to MK284522 (Mycobacterium phage Malec, complete genome) position: , mismatch: 5, identity: 0.815
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttgccggtgggctgttcagcggcgg Protospacer
****************.******
346. spacer 6.5|926831|27|CP025603|CRT matches to KM677210 (Mycobacterium phage Larenn, complete genome) position: , mismatch: 5, identity: 0.815
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttgccggtgggctgttcagcggcgg Protospacer
****************.******
347. spacer 6.10|927041|27|CP025603|CRT matches to NZ_CP022264 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
ggcaggcggcggcggcggtagcgttgg Protospacer
* * ********************
348. spacer 6.10|927041|27|CP025603|CRT matches to NZ_CP022264 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
ggcaggcggcggcggcggtagcgttgg Protospacer
* * ********************
349. spacer 6.10|927041|27|CP025603|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
aggatccggccgcggcggtagcgctcg Protospacer
********* ************.*
350. spacer 6.10|927041|27|CP025603|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
aggatccggccgcggcggtagcgctcg Protospacer
********* ************.*
351. spacer 6.10|927041|27|CP025603|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
cgggtccggcggcggcggtggcggttt Protospacer
***.***************.*** * .
352. spacer 6.10|927041|27|CP025603|CRT matches to NZ_CP049908 (Hymenobacter sp. HDW8 plasmid p_unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
cgactccggcggcgggggtagcgttcg Protospacer
**. *********** *********
353. spacer 6.10|927041|27|CP025603|CRT matches to NZ_CP049700 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2a, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
cgccgccggcggcggcggtggcgttgg Protospacer
** **************.******
354. spacer 6.10|927041|27|CP025603|CRT matches to MH576962 (Streptomyces phage Satis, complete genome) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
tgactccggcggcggccgtggcgttgc Protospacer
.*. ************ **.*******
355. spacer 6.10|927041|27|CP025603|CRT matches to MK620894 (Streptomyces phage Kradal, complete genome) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
tgactccggcggcggccgtggcgttgc Protospacer
.*. ************ **.*******
356. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgaggccggcctgctggtcgtctccgggct Protospacer
*** **************** ******
357. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
agattccggcctgttcgtcggctccggcgg Protospacer
**. ********.* **************
358. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgccatcggcctgctgctcggcaccggcgg Protospacer
** *..********** ***** *******
359. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP031193 (Humibacter sp. BT305 plasmid unnamed1) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgccgccggcctgctggtcggcgcggcggg Protospacer
** ******************* * * **
360. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggc-tccggcgg CRISPR spacer
cgacgccggcatgccggtcggcttcctgct- Protospacer
********** ***.******* *** **
361. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.833
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
attgctgttcggctgcggcggcgcgggcgc Protospacer
.************ ********* ****
362. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
attgctgttcggctgcggcggcgcgggcgc Protospacer
.************ ********* ****
363. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 5, identity: 0.833
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgctcggcaccggcggcgcactcgg Protospacer
*******.***** ********** ***
364. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP046705 (Nostoc sp. ATCC 53789 plasmid pNsp_b, complete sequence) position: , mismatch: 5, identity: 0.833
cctgctg--ttcggctccggcggcgctggcgg CRISPR spacer
--tactgattacggctccggcggtgctggcgg Protospacer
*.*** * ************.********
365. spacer 6.15|927278|30|CP025603|CRT matches to AY950802 (Haloarcula phage SH1, complete genome) position: , mismatch: 5, identity: 0.833
--cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ggcctac--ttcggctccggcggctccggcgg Protospacer
***.* *************** *.*****
366. spacer 6.16|927326|24|CP025603|CRT matches to NC_006911 (Streptomyces sp. F11 plasmid pFP11, complete sequence) position: , mismatch: 5, identity: 0.792
aaccgacctcggcggcgctggcgg CRISPR spacer
gggcgacctcggcggcgctggcct Protospacer
.. *******************
367. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to MG925349 (Mycobacterium phage Mendokysei, complete genome) position: , mismatch: 5, identity: 0.853
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcggcaacggcggcgacggcgggttcccc Protospacer
******************** ******** *.
368. spacer 8.4|1212119|25|CP025603|CRISPRCasFinder matches to NZ_CP032686 (Rhizobium sp. CCGE531 plasmid pRCCGE531c, complete sequence) position: , mismatch: 5, identity: 0.8
tgccggcggcgccggcgtagcgccc CRISPR spacer
tgccggcggcgccggcgttgccgtt Protospacer
****************** ** ..
369. spacer 8.4|1212119|25|CP025603|CRISPRCasFinder matches to NZ_CP032691 (Rhizobium sp. CCGE532 plasmid pRCCGE532c, complete sequence) position: , mismatch: 5, identity: 0.8
tgccggcggcgccggcgtagcgccc CRISPR spacer
tgccggcggcgccggcgttgccgtt Protospacer
****************** ** ..
370. spacer 8.4|1212119|25|CP025603|CRISPRCasFinder matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.8
tgccggcggcgccggcgtagcgccc CRISPR spacer
tgccggcggcgccggcgtggccgag Protospacer
******************.**
371. spacer 8.4|1212119|25|CP025603|CRISPRCasFinder matches to NZ_CP021373 (Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence) position: , mismatch: 5, identity: 0.8
tgccggcggcgccggcgtagcgccc CRISPR spacer
cgccggcggcgccggcgtcgcggtg Protospacer
.***************** *** .
372. spacer 8.4|1212119|25|CP025603|CRISPRCasFinder matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 5, identity: 0.8
tgccggcggcgccggcgtagcgccc CRISPR spacer
tgccggcggcgccggcgtggccgag Protospacer
******************.**
373. spacer 8.4|1212119|25|CP025603|CRISPRCasFinder matches to LR134122 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2) position: , mismatch: 5, identity: 0.8
tgccggcggcgccggcgtagcgccc CRISPR spacer
caacggcggcgccggcgtatcgccg Protospacer
.. **************** ****
374. spacer 8.4|1212119|25|CP025603|CRISPRCasFinder matches to NZ_CP011518 (Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence) position: , mismatch: 5, identity: 0.8
tgccggcggcgccggcgtagcgccc CRISPR spacer
ctttggcggcgcccgcgtagcgccc Protospacer
. ..********* ***********
375. spacer 8.4|1212119|25|CP025603|CRISPRCasFinder matches to NC_025427 (Rhizobium phage vB_RleM_PPF1, complete genome) position: , mismatch: 5, identity: 0.8
tgccggcggcgccggcgtagcgccc CRISPR spacer
acgcggcggcgccggcgtagcggac Protospacer
******************* *
376. spacer 15.7|3741171|31|CP025603|CRT matches to NC_010850 (Rhodococcus sp. NS1 plasmid pNSL1, complete sequence) position: , mismatch: 5, identity: 0.839
aacgccc-acttcaccgccgttgccgccgtca CRISPR spacer
-acacccgacttcaccgccgctgccgccgaga Protospacer
**.*** ************.******** *
377. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
caccggcggcaacggcggcatcgggca Protospacer
************ ******** ** .
378. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP053729 (Escherichia coli strain CP61_Sichuan plasmid pCP61-IncFIB, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
379. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP053737 (Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncFII, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
380. spacer 16.18|3949827|27|CP025603|CRT matches to MT077883 (Escherichia coli plasmid p23, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
381. spacer 16.18|3949827|27|CP025603|CRT matches to NC_009838 (Escherichia coli APEC O1 plasmid pAPEC-O1-R, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
382. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP013221 (Salmonella enterica subsp. enterica serovar Anatum strain GT-01 plasmid PDM02, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
383. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP024285 (Escherichia albertii strain 2014C-4356 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
384. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
caccggcggcaacggcggcatcgggca Protospacer
************ ******** ** .
385. spacer 16.18|3949827|27|CP025603|CRT matches to CP049307 (Salmonella enterica subsp. enterica serovar Heidelberg strain CVM N58631 plasmid p58631, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
386. spacer 16.18|3949827|27|CP025603|CRT matches to NC_009140 (Salmonella enterica subsp. enterica serovar Newport str. SL254 plasmid pSN254, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
387. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP012168 (Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-239.973kb, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
388. spacer 16.18|3949827|27|CP025603|CRT matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcaaaggcggcaagagcgg Protospacer
. ***************** *.****
389. spacer 16.18|3949827|27|CP025603|CRT matches to NC_012690 (Escherichia coli plasmid peH4H, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
390. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP015882 (Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcaaacgcggcctgggcgg Protospacer
. ********** ***** *******
391. spacer 16.18|3949827|27|CP025603|CRT matches to CP048298 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL_SAL-A00527 plasmid pN1566-1, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
392. spacer 16.18|3949827|27|CP025603|CRT matches to NC_019066 (Escherichia coli plasmid pAPEC1990_61, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
393. spacer 16.18|3949827|27|CP025603|CRT matches to NC_021813 (Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002069 plasmid pCFSAN002069_01, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
394. spacer 16.18|3949827|27|CP025603|CRT matches to NC_012692 (Escherichia coli plasmid pAR060302, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
395. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
caccggcggcaacggcggcatcgggca Protospacer
************ ******** ** .
396. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP037904 (Escherichia coli strain LHM10-1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
397. spacer 16.18|3949827|27|CP025603|CRT matches to MK994522 (Methanobacterium virus PhiF1, complete genome) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
aggcggcggcaaaggcggcaagggagg Protospacer
. ***************** *** **
398. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP013224 (Salmonella enterica subsp. enterica serovar Anatum strain GT-38 plasmid PDM04, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
399. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP009413 (Salmonella enterica strain CFSAN007427 isolate N20272 plasmid pCFSAN007427_01, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
400. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP048296 (Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-2, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
401. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gccgggccggaaaggcggcatgggcgg Protospacer
* *** * *****************
402. spacer 16.18|3949827|27|CP025603|CRT matches to CP049311 (Salmonella enterica subsp. enterica serovar Heidelberg strain CVM N53023 plasmid pN53023, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
403. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP030191 (Salmonella enterica strain SA20104250 plasmid pSA20104250.1, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
404. spacer 16.18|3949827|27|CP025603|CRT matches to NC_019123 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH1148_107, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
405. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcaaaagcggcctgggcgg Protospacer
. **********.***** *******
406. spacer 16.18|3949827|27|CP025603|CRT matches to MN823999 (Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
tggcggcggcatgggcggcatgggcgg Protospacer
.. ******** .**************
407. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
tgtcggcggcaatggcggcgtgggcgg Protospacer
...********* ******.*******
408. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
caccggcggcaacggcggcatcgggca Protospacer
************ ******** ** .
409. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP016453 (Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gaccggcggcaatggcggcattggcct Protospacer
*********** ******** ***
410. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP027409 (Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_317 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
411. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP027409 (Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_317 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
412. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_LT985293 (Escherichia coli strain 4410-1 plasmid RCS79_p, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
413. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_LT985268 (Escherichia coli strain 699 plasmid RCS58_p, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcatgggcggcatgggcgg Protospacer
. ******** .**************
414. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP046705 (Nostoc sp. ATCC 53789 plasmid pNsp_b, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gaagggcggcaatggcggcatcggcgg Protospacer
* ******** ******** *****
415. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cgccggcggcaagggcggcacgggcct Protospacer
*.**********.*******.****
416. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gccgggccggaaaggcggcatgggcgg Protospacer
* *** * *****************
417. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP023072 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666a, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gccgggcggcatgggcggcatgggcgg Protospacer
* ******* .**************
418. spacer 16.18|3949827|27|CP025603|CRT matches to NC_009621 (Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gcctggcggcatgggcggcatgggcgg Protospacer
*.******* .**************
419. spacer 16.18|3949827|27|CP025603|CRT matches to JN698993 (Mycobacterium phage Firecracker, complete genome) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gatgggcggcaagggcggcaagggcgg Protospacer
*. ********.******* ******
420. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP010957 (Sphingobium sp. YBL2 plasmid 3pYBL2-3, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cgacggcggcgaaggcggcacgggcgc Protospacer
*. *******.*********.*****
421. spacer 16.18|3949827|27|CP025603|CRT matches to LT599585 (Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
tatgggcggcatgggcggcatgggcgg Protospacer
.*. ******* .**************
422. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gccgggccggaaaggcggcatgggcgg Protospacer
* *** * *****************
423. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP021821 (Sinorhizobium meliloti strain M162 plasmid accessoryA, complete sequence) position: , mismatch: 5, identity: 0.815
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gcctggcggcatgggcggcatgggcgg Protospacer
*.******* .**************
424. spacer 4.1|366487|27|CP025603|CRISPRCasFinder matches to NZ_CP045917 (Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence) position: , mismatch: 6, identity: 0.778
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
agttcactggtgtccacatcgcccgaa Protospacer
*.. ***.***************** .
425. spacer 4.6|366817|33|CP025603|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agcaggtcgatcacgatctggccgttgccggcg Protospacer
** *.***** ******************.*
426. spacer 4.7|366883|27|CP025603|CRISPRCasFinder matches to NZ_CP022542 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence) position: , mismatch: 6, identity: 0.778
gcgaagccgatgttgtagctgccggtg CRISPR spacer
ggataggcgatgttgtagctgccggaa Protospacer
* . ** ****************** .
427. spacer 4.9|367033|27|CP025603|CRISPRCasFinder matches to NC_009959 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI05, complete sequence) position: , mismatch: 6, identity: 0.778
gccaagccgatatcgaagatcccggtg CRISPR spacer
accatgccgatatcgacgatcccgtcc Protospacer
.*** *********** ******* .
428. spacer 4.10|367093|27|CP025603|CRISPRCasFinder matches to NZ_CP009112 (Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
tagacgccgaagtcgaggtcggcgagg Protospacer
*********.******* *****
429. spacer 4.10|367093|27|CP025603|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
ctcccgccgaagttgagggtgccgaac Protospacer
.**************** .*****.
430. spacer 4.10|367093|27|CP025603|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
aagaagccgaagttgaggtcgccgtag Protospacer
* ******************* .*
431. spacer 4.10|367093|27|CP025603|CRISPRCasFinder matches to MK494099 (Mycobacterium phage Typha, complete genome) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
cggtcgccgaggtcgaggtcgccgagg Protospacer
.******.**.*************
432. spacer 5.1|692016|31|CP025603|CRISPRCasFinder matches to GQ141189 (Bifidobacterium phage Bbif-1, complete sequence) position: , mismatch: 6, identity: 0.806
agcgcgaacggcaagccgaac----cgttggaccc CRISPR spacer
agcgcgaacggccagccgaaccatgcgctgg---- Protospacer
************ ******** **.***
433. spacer 6.5|926831|27|CP025603|CRT matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
gatggccggtaggctgttgaacggcgc Protospacer
.. *******.******* *******
434. spacer 6.5|926831|27|CP025603|CRT matches to NC_023606 (Mycobacterium phage CRB1, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
435. spacer 6.5|926831|27|CP025603|CRT matches to MK524491 (Mycobacterium phage Whabigail7, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
436. spacer 6.5|926831|27|CP025603|CRT matches to KX619650 (Mycobacterium phage Jerm, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
437. spacer 6.5|926831|27|CP025603|CRT matches to MN585998 (Mycobacterium phage Bugsy, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
438. spacer 6.5|926831|27|CP025603|CRT matches to JN408460 (Mycobacterium phage Turbido, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
439. spacer 6.5|926831|27|CP025603|CRT matches to MH077576 (Mycobacterium phage AbbyPaige, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
440. spacer 6.5|926831|27|CP025603|CRT matches to MH825704 (Mycobacterium phage LilTurb, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
441. spacer 6.10|927041|27|CP025603|CRT matches to NZ_AP021845 (Azospira sp. I09 plasmid pAZI09, complete sequence) position: , mismatch: 6, identity: 0.778
cggatccggcggcggcggtagcgttgc CRISPR spacer
cggatcctgcggcggcggtagaaagcc Protospacer
******* ************* . *
442. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gagcgtcggcctgctggtcggcttcggcgc Protospacer
..**.*****************.*****
443. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gagcgtcggcctgctggtcggcttcggcgc Protospacer
..**.*****************.*****
444. spacer 6.13|927182|30|CP025603|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgacgacggcctggtggtcggctacctcga Protospacer
***** ******* ********* * **.
445. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg Protospacer
** ..********** ***** *******
446. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg Protospacer
** ..********** ***** *******
447. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgcgcggcgtgccggtcggctccggcgg Protospacer
** **** ***.***************
448. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg Protospacer
** ..********** ***** *******
449. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgcgcggcgtgccggtcggctccggcgg Protospacer
** **** ***.***************
450. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcggcgggcctgctggtcggcttcggcac Protospacer
** ** ****************.****.
451. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
452. spacer 6.13|927182|30|CP025603|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
453. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
454. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP037868 (Hydrogenophaga pseudoflava strain DSM 1084 plasmid pDSM1084, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcg----gctccggcgg CRISPR spacer
cgacgccggccggctggtcggagagctgcg---- Protospacer
*********** ******** *** **
455. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
456. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
457. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgtcgccggcctgctgatcggcttcttctg Protospacer
** *************.******.* * *
458. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
459. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
460. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
461. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
462. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
463. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
464. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
465. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
466. spacer 6.13|927182|30|CP025603|CRT matches to NC_019408 (Caulobacter phage CcrRogue, complete genome) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgtcatcggcctgctggtcgtcgccggcgc Protospacer
** *..************** * ******
467. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgacgccgacctgctggtcggggcggactg Protospacer
********.************ * *.* *
468. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP017941 (Phyllobacterium zundukense strain Tri-48 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
caagctggtcggccccggcggcgctggcaa Protospacer
* **** *****.**************..
469. spacer 6.15|927278|30|CP025603|CRT matches to MK937608 (Microbacterium phage Cressida, complete genome) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tcacctgtccggctccggcggcggtggcga Protospacer
.* ****.************** *****.
470. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg Protospacer
*******.***** ********** .**
471. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg Protospacer
*******.***** ********** .**
472. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP017592 (Pantoea stewartii subsp. stewartii DC283 plasmid ppDSJ01, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg-- CRISPR spacer
tctgctgttcggctgcggcggcg--agcagcg Protospacer
.************* ******** .**.*
473. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP008898 (Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pENT-576, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
474. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP023489 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_02, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
475. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP043515 (Enterobacter kobei strain EB_P8_L5_01.19 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
476. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg Protospacer
*******.***** ********** .**
477. spacer 6.15|927278|30|CP025603|CRT matches to NZ_LT984809 (Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
catcgcgctcggcttcggcggcgctggcgg Protospacer
* * .*.******.***************
478. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP026371 (Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
479. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP050069 (Klebsiella aerogenes strain 035 plasmid p035_A-VIM-1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
480. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP039425 (Citricoccus sp. SGAir0253 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgttcggcaccgacggcgccctccg Protospacer
************* ***.******. * *
481. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP009856 (UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-784, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
482. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP039430 (Citricoccus sp. SGAir0453 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgttcggcaccgacggcgccctccg Protospacer
************* ***.******. * *
483. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP040937 (Hymenobacter sp. DG01 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgt-tcggctccggcggcgctggcgg CRISPR spacer
-ccgccgcgccggctccggccgcgctggcgg Protospacer
*.**.*. .********** **********
484. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cgtccagctcggcgccggcggcgctggcgt Protospacer
* * * *.***** ***************
485. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cgtccagctcggcgccggcggcgctggcgt Protospacer
* * * *.***** ***************
486. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP006588 (Hymenobacter sp. APR13 plasmid pHA, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgt-tcggctccggcggcgctggcgg CRISPR spacer
-ccgccgcgccggctccggccgcgctggcgg Protospacer
*.**.*. .********** **********
487. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgtt--cggctccggcggcgctggcgg CRISPR spacer
--cgccgctggcggcgccggcggcgctggcgg Protospacer
.**.*.* **** ****************
488. spacer 6.15|927278|30|CP025603|CRT matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgtt----cggctccggcggcgctggcgg CRISPR spacer
----cagttggggcggctccggcggcgcgggcgg Protospacer
* *** *************** *****
489. spacer 6.15|927278|30|CP025603|CRT matches to MH029534 (Myoviridae environmental samples clone NHS-Seq2, complete sequence) position: , mismatch: 6, identity: 0.8
-cctgctgttcggctccggcggcgctggcgg CRISPR spacer
atttggt-ttcggcgctggcggcgctggcgg Protospacer
..** * ****** *.**************
490. spacer 6.17|927368|36|CP025603|CRT matches to MT723940 (Mycobacterium phage Ellie, complete genome) position: , mismatch: 6, identity: 0.833
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
cgttgtcggcaacggcggtaacggcgggggtggcgg Protospacer
* .************************ .*****
491. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.824
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
ggccggcggcaagggcggcgacggcggcgccggc-- Protospacer
************ ******* ***** * .***
492. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.824
ggccggcggcaacggcggcgccggcgggt--ggcta CRISPR spacer
caccggcggcaacggcggcggcggcggcttcggc-- Protospacer
.****************** ****** * ***
493. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 6, identity: 0.824
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
caccggcggcagcggcggcgccggcggcacggct- Protospacer
.*********.*************** ..****
494. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 6, identity: 0.824
ggccggcggcaacggcggcgccggcgggtggcta- CRISPR spacer
cggcggcggcaacggcggcgctggt-ggtggcaac Protospacer
* ******************.**. ****** *
495. spacer 15.7|3741171|31|CP025603|CRT matches to NC_009478 (Clavibacter michiganensis subsp. michiganensis NCPPB 382 plasmid pCM1, complete sequence) position: , mismatch: 6, identity: 0.806
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgaccacttcaccgccgtcgccgccggcg Protospacer
. ** ***************.******* *.
496. spacer 16.5|3948699|33|CP025603|CRT matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 6, identity: 0.818
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gagcagcgccaccggcggggccggcggcgactc Protospacer
*. .*** *****************.******
497. spacer 16.8|3948936|36|CP025603|CRT matches to NZ_CP054842 (Acidovorax sp. 16-35-5 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.833
tagcagcggtgccggcggcaccaacggctccggcgg- CRISPR spacer
ccgcatcggtgccggcggcaccatcggc-acggcggc Protospacer
. *** ***************** **** ******
498. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP025613 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggccaaggcggcatcggcgc Protospacer
. ******* ********** ****
499. spacer 16.18|3949827|27|CP025603|CRT matches to CP047389 (Agrobacterium sp. CGMCC 11546 plasmid pA) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
taccggcggcaaaggcggcatccacct Protospacer
.******************** .*
500. spacer 16.18|3949827|27|CP025603|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
caccggcggcaaaggcggcaacctctt Protospacer
******************** *
501. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP009975 (Pseudomonas putida S12 plasmid pTTS12, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
ggtgggcggcaagggcggcaagggcgg Protospacer
.. ********.******* ******
502. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP045381 (Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
tgtgggcggcacaggcggcacgggcgg Protospacer
... ******* ********.******
503. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
ggccggcggcaatgtcggcatgggcac Protospacer
.********** * **********.
504. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP010860 (Marinovum algicola DG 898 plasmid pMaD5, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcaaaggcggcgagggcga Protospacer
. ****************. *****.
505. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
caccggcggcaggggcggcatggcgac Protospacer
***********..********** .
506. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
atccggcggcaccggcggcatgggcaa Protospacer
********* ************..
507. spacer 16.18|3949827|27|CP025603|CRT matches to AY129335 (Mycobacterium virus Corndog, complete genome) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
ggtgggcggcaagggcggcaagggcgg Protospacer
.. ********.******* ******
508. spacer 16.18|3949827|27|CP025603|CRT matches to NC_004685 (Mycobacterium phage Corndog, complete genome) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
ggtgggcggcaagggcggcaagggcgg Protospacer
.. ********.******* ******
509. spacer 16.18|3949827|27|CP025603|CRT matches to MG099943 (Mycobacterium phage Familton, complete genome) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
ggtgggcggcaagggcggcaagggcgg Protospacer
.. ********.******* ******
510. spacer 16.18|3949827|27|CP025603|CRT matches to MN585964 (Mycobacterium phage Blessica, complete genome) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
ggtgggcggcaagggcggcaagggcgg Protospacer
.. ********.******* ******
511. spacer 16.18|3949827|27|CP025603|CRT matches to KJ829260 (Mycobacterium phage YungJamal, complete genome) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
ggtgggcggcaagggcggcaagggcgg Protospacer
.. ********.******* ******
512. spacer 16.18|3949827|27|CP025603|CRT matches to NC_022057 (Mycobacterium phage Catdawg, complete genome) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
ggtgggcggcaagggcggcaagggcgg Protospacer
.. ********.******* ******
513. spacer 16.18|3949827|27|CP025603|CRT matches to MN428052 (Mycobacterium phage Smooch, complete genome) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
ggtgggcggcaagggcggcaagggcgg Protospacer
.. ********.******* ******
514. spacer 16.18|3949827|27|CP025603|CRT matches to NC_048047 (Caulobacter phage CcrBL9, complete genome) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
tggtggcggcgcaggcggcatgggcgg Protospacer
.. .******. ***************
515. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
caccggcggcgagggcggcatggtgac Protospacer
**********.*.********** .
516. spacer 16.18|3949827|27|CP025603|CRT matches to NC_007713 (Sodalis glossinidius str. 'morsitans' plasmid pSG1, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gcccggcggcgaaggcggcctgggcca Protospacer
********.******** ***** .
517. spacer 16.18|3949827|27|CP025603|CRT matches to NC_014840 (Pantoea sp. At-9b plasmid pPAT9B03, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gatcgtcggcaaaggcggcatggggcc Protospacer
*.** ******************
518. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP032313 (Pannonibacter phragmitetus BB plasmid p.BB_1, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gggcggcggcaaaggtggcatcggcga Protospacer
. ************.***** ****.
519. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_LN854558 (Sodalis glossinidius str. 'morsitans' isolate B4 plasmid pSG1, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gcccggcggcgaaggcggcctgggcca Protospacer
********.******** ***** .
520. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
caccggcggcgagggcggcatggtgac Protospacer
**********.*.********** .
521. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP013528 (Rhizobium phaseoli strain R723 plasmid pRphaR723a, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cgccggcggcaagggcggcatggcgtc Protospacer
*.**********.**********
522. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_LT960615 (Hartmannibacter diazotrophicus strain E19T plasmid HDIAp1, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
tgccggcggcaaaggcggcatctgtgt Protospacer
..******************* *.*
523. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP033036 (Agrobacterium fabrum strain 12D13 plasmid pAt12D13a, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
caccggcggcaaaggcgacatccttga Protospacer
*****************.*** .*.
524. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gatcgtcggcaaaggcggcatggggcc Protospacer
*.** ******************
525. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP013581 (Rhizobium phaseoli strain N261 plasmid pRphaN261a, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
cgccggcggcaagggcggcatggcgtc Protospacer
*.**********.**********
526. spacer 16.18|3949827|27|CP025603|CRT matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
tggcggcggcgacggcggcatgggcgt Protospacer
.. *******.* *************
527. spacer 16.18|3949827|27|CP025603|CRT matches to NC_007182 (Sodalis glossinidius pSG1 plasmid from Glossina austeni) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gcccggcggcgaaggcggcctgggcca Protospacer
********.******** ***** .
528. spacer 16.18|3949827|27|CP025603|CRT matches to NC_007183 (Sodalis glossinidius pSG1 plasmid from Glossina palpalis palpalis) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gcccggcggcgaaggcggcctgggcca Protospacer
********.******** ***** .
529. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP053024 (Sphingobium yanoikuyae strain YC-XJ2 plasmid p-C-Sy, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
caccggcggcgagggcggcatggtgac Protospacer
**********.*.********** .
530. spacer 16.18|3949827|27|CP025603|CRT matches to NC_003064 (Agrobacterium fabrum str. C58 plasmid At, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
caccggcggcaaaggcgacatccttga Protospacer
*****************.*** .*.
531. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_AP022338 (Mameliella alba strain KU6B plasmid pKUB257, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gacaggcggcaagggcggcatgggtca Protospacer
** ********.***********. .
532. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP021816 (Sinorhizobium meliloti strain M270 plasmid accessoryB, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg- CRISPR spacer
caccggcggcaaaggcggc-cgtctgac Protospacer
******************* .* .*.
533. spacer 16.18|3949827|27|CP025603|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
caccggcggcgagggcggcatggtgac Protospacer
**********.*.********** .
534. spacer 16.18|3949827|27|CP025603|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
caccggcggcgagggcggcatggtgac Protospacer
**********.*.********** .
535. spacer 16.18|3949827|27|CP025603|CRT matches to NZ_CP033024 (Agrobacterium fabrum strain 1D132 plasmid pAt1D132a, complete sequence) position: , mismatch: 6, identity: 0.778
caccggcggcaaaggcggcatgggcgg CRISPR spacer
caccggcggcaaaggcgacatccttga Protospacer
*****************.*** .*.
536. spacer 4.4|366682|27|CP025603|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.741
aagccgcccgagttcgcgagaccgaag CRISPR spacer
tgaccgcccgagttcgcgagacgttgg Protospacer
..******************* .*
537. spacer 5.1|692016|31|CP025603|CRISPRCasFinder matches to MK977708 (Mycobacterium phage Fulbright, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
538. spacer 5.1|692016|31|CP025603|CRISPRCasFinder matches to MG099948 (Mycobacterium phage Philonius, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
539. spacer 5.1|692016|31|CP025603|CRISPRCasFinder matches to MH926055 (Mycobacterium phage Chewbacca, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
540. spacer 5.1|692016|31|CP025603|CRISPRCasFinder matches to MT723932 (Mycobacterium phage Schnauzer, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
541. spacer 5.1|692016|31|CP025603|CRISPRCasFinder matches to KU935726 (Mycobacterium phage Xerxes, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
542. spacer 5.1|692016|31|CP025603|CRISPRCasFinder matches to KU935730 (Mycobacterium phage Pipsqueaks, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
543. spacer 5.1|692016|31|CP025603|CRISPRCasFinder matches to MH316570 (Mycobacterium phage Silvafighter, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
544. spacer 5.1|692016|31|CP025603|CRISPRCasFinder matches to MK524518 (Mycobacterium phage Smurph, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
545. spacer 5.1|692016|31|CP025603|CRISPRCasFinder matches to MK524515 (Mycobacterium phage Parmesanjohn, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
546. spacer 5.1|692016|31|CP025603|CRISPRCasFinder matches to MH697585 (Mycobacterium phage Gex, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
547. spacer 5.1|692016|31|CP025603|CRISPRCasFinder matches to KM588359 (Mycobacterium phage Carcharodon, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
548. spacer 5.1|692016|31|CP025603|CRISPRCasFinder matches to MH697576 (Mycobacterium phage Aggie, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
549. spacer 5.1|692016|31|CP025603|CRISPRCasFinder matches to MH697593 (Mycobacterium phage Tapioca, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
550. spacer 5.1|692016|31|CP025603|CRISPRCasFinder matches to MG099936 (Mycobacterium phage Andies, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
551. spacer 5.1|692016|31|CP025603|CRISPRCasFinder matches to NC_031243 (Mycobacterium phage Xeno, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
552. spacer 5.1|692016|31|CP025603|CRISPRCasFinder matches to JN256079 (Mycobacterium phage Charlie, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
553. spacer 6.13|927182|30|CP025603|CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggtcgccggcctgctggtcgggttcggatc Protospacer
* ****************** *.***
554. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
555. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
556. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ctgctgcagcctgctggtcagctccggcgc Protospacer
* .* *.***********.*********
557. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
558. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
559. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ctgctgcagcctgctggtcagctccggcgc Protospacer
* .* *.***********.*********
560. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
561. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
562. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
563. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
564. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
565. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
566. spacer 6.13|927182|30|CP025603|CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgggaccggcccgctggtcggccccggctt Protospacer
**. .******.**********.*****
567. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gctgggcggcctgctggtcggctggggcgg Protospacer
* ***************** *****
568. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
569. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
570. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
571. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
572. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
573. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
574. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgcaggtcggcttcacctt Protospacer
************* ********.*. *
575. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
576. spacer 6.13|927182|30|CP025603|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
577. spacer 6.13|927182|30|CP025603|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
578. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
579. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
580. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
581. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
582. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
583. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
584. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
585. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
586. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
587. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
588. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
589. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
590. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
591. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
592. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
593. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
594. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
595. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
596. spacer 6.13|927182|30|CP025603|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
597. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
598. spacer 6.13|927182|30|CP025603|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
599. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
600. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
601. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
602. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
603. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
604. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
605. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
606. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
607. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
608. spacer 6.13|927182|30|CP025603|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
609. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
610. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
611. spacer 6.13|927182|30|CP025603|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
612. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
613. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
614. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
615. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
616. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
617. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
618. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
619. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
620. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
621. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
622. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
623. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
624. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
625. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
626. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
627. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
628. spacer 6.13|927182|30|CP025603|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
629. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
630. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
631. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
632. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
633. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
634. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
635. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
636. spacer 6.13|927182|30|CP025603|CRT matches to HM560026 (Uncultured bacterium plasmid pTRACA45, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
acacgccgccctgctggtcggcttaggtcg Protospacer
****** **************. **. *
637. spacer 6.13|927182|30|CP025603|CRT matches to NC_010867 (Neisseria lactamica plasmid pNL3.1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gaacgccgccctgctggtcggcttagtcgc Protospacer
.****** **************. * **
638. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP020471 (Rhodobacter blasticus strain 28/5 plasmid pRsa, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
agacgccggcctgctgttcggcctcgaccc Protospacer
*************** *****..**.*
639. spacer 6.13|927182|30|CP025603|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgggctcggcctgctgctcggcttcggcga Protospacer
**. .********** ******.*****.
640. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggc-tccggcgg CRISPR spacer
gtcggccggcctgctggtcggcgcccggct- Protospacer
****************** .*****
641. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP035710 (Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgacgacggcctgctggtcgacttcatccc Protospacer
***** **************.**.*. *
642. spacer 6.13|927182|30|CP025603|CRT matches to KT997827 (Uncultured Mediterranean phage uvDeep-CGR0-KM15-C219, complete genome) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gttcgccggcctgctggaccgctccgtggg Protospacer
************** * ****** **
643. spacer 6.13|927182|30|CP025603|CRT matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgtgtccggcctgctggtcgggttcggcac Protospacer
** **************** *.****.
644. spacer 6.13|927182|30|CP025603|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
tgacgccgccctgctggtcggcaaagtcga Protospacer
.******* ************* * **.
645. spacer 6.13|927182|30|CP025603|CRT matches to KT997829 (Uncultured Mediterranean phage uvDeep-CGR0-KM22-C158, complete genome) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gttcgccggcctgctggaccgctccgtggg Protospacer
************** * ****** **
646. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttcggggtcggctccggcggcgctggcga Protospacer
..* * *********************.
647. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttcggggtcggctccggcggcgctggcga Protospacer
..* * *********************.
648. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctccgcgctcggctccggcggcggtggcgg Protospacer
*.. .*.*************** ******
649. spacer 6.15|927278|30|CP025603|CRT matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
650. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP006989 (Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
651. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP020909 (Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
652. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP024423 (Paracoccus yeei strain TT13 plasmid pTT13-1, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tctcgggctcggccccggcggcgctggcgc Protospacer
.** *.*****.***************
653. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
654. spacer 6.15|927278|30|CP025603|CRT matches to NC_021908 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
655. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP020441 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tctcgggctcggccccggcggcgctggcgc Protospacer
.** *.*****.***************
656. spacer 6.15|927278|30|CP025603|CRT matches to CP007642 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
657. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tctcgggctcggccccggcggcgctggcgc Protospacer
.** *.*****.***************
658. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
659. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
660. spacer 6.15|927278|30|CP025603|CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg- CRISPR spacer
actgctgtccggctccggcggca-tgatgtc Protospacer
*******.*************. **..*
661. spacer 6.15|927278|30|CP025603|CRT matches to MN582086 (Siphoviridae sp. ctdEk19, complete genome) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gccggccttcgacttcggcggcgctggcgg Protospacer
*.* . ****.**.***************
662. spacer 6.15|927278|30|CP025603|CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
663. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP022700 (Acetobacter tropicalis strain BDGP1 plasmid pAtBDGP1A, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gttcctccacggttccggcggcgctggcgg Protospacer
.* ** . ***.*****************
664. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
665. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
666. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
667. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP031082 (Paracoccus yeei strain CCUG 32053 plasmid pYEE4, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tctcgggctcggccccggcggcgctggcgc Protospacer
.** *.*****.***************
668. spacer 6.17|927368|36|CP025603|CRT matches to NC_022087 (Mycobacterium phage AnnaL29, complete genome) position: , mismatch: 7, identity: 0.806
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
cgtgatcggcaacggcggaaacggcgggagctgggg Protospacer
**************** *********. * * **
669. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
ggccggaggcaccggcggcgccggcggcacgggc- Protospacer
****** **** *************** ..** .
670. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcggg--tggcta CRISPR spacer
gaccggcggcagcggcggcgcgggcggagccggc-- Protospacer
*.*********.********* *****. .***
671. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP025548 (Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
cgcaggcggcaacggcggccccggcggcgccgcc- Protospacer
** *************** ******* *. **.
672. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgggtggcta---- CRISPR spacer
ggccgggggcaacggcggcgacggc----gtctacgac Protospacer
****** ************* **** * ***
673. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to MT889380 (Mycobacterium phage Coco12, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
tgccggcggcaacggcggcaacggcggcagcagc-- Protospacer
******************. ****** *..**
674. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
tgccggcggcaacggcggcaacggcggcagcagc-- Protospacer
******************. ****** *..**
675. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcggg--tggcta CRISPR spacer
tgtcggcggcagcggcggcggcggcggggccggc-- Protospacer
*.********.******** ******* .***
676. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP039644 (Azospirillum sp. TSA2s plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgggt--ggcta CRISPR spacer
ggccggcggcatcggcgacgccggctgcttcagc-- Protospacer
*********** *****.******* * * .**
677. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgggtggcta- CRISPR spacer
caccggcggccacggcggcaccggc-ggcggcgat Protospacer
.******** ********.***** **.*** *
678. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP039641 (Azospirillum sp. TSH100 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
agacggcggcaccggcggcggcggcggtgaggcc- Protospacer
.* ******** ******** ****** * ***.
679. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to MH697583 (Mycobacterium phage EricMillard, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
680. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to MH727551 (Mycobacterium phage Kalah2, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
681. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to MH077579 (Mycobacterium phage Halley, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
682. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to MH669017 (Mycobacterium phage Zelink, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
683. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to MN062701 (Mycobacterium phage Dallas, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
684. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to MK524527 (Mycobacterium phage ThreeRngTarjay, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
685. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to MK524529 (Mycobacterium phage Phoebus, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
686. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to MF919512 (Mycobacterium phage Klein, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
687. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to KF114875 (Mycobacterium phage Redno2, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
688. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to MK967379 (Mycobacterium phage HokkenD, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
689. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP025513 (Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
agacggtggcagcggcggcgccggcggcggtgct- Protospacer
.* ***.****.*************** * ***
690. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_LR134450 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcggg-tggcta CRISPR spacer
ggtcggcgccaacggcggcgccggtgaactgggt- Protospacer
**.***** ***************.*.. *** *
691. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggc--gggtggcta CRISPR spacer
cgctggcggcaacgtcggcgccggccatggcggc-- Protospacer
**.********** ********** **.***
692. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgggtggcta- CRISPR spacer
tggcggcggcaacggcggcggtggc-ggtggcggt Protospacer
* ***************** .*** ****** .
693. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggc--gggtggcta CRISPR spacer
cgctggcggcaacgtcggcgccggccatggcggc-- Protospacer
**.********** ********** **.***
694. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to MN813686 (Mycobacterium phage BirdsNest, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
tgctggcggcaacggcggcgtcggcatcgctggc-- Protospacer
**.****************.****. * ****
695. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NC_042035 (Mycobacterium phage Zemanar, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgggtggcta- CRISPR spacer
cgacggcggcaacggcggcggtggc-ggtggtcac Protospacer
* ***************** .*** *****..*
696. spacer 8.9|1212383|37|CP025603|CRISPRCasFinder matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 7, identity: 0.811
tgtcggcggtgccggcggcaccggcgggttaggcaac CRISPR spacer
tgtcggcggtgccggcggtgccggcggtgccggcgac Protospacer
******************..******* . ***.**
697. spacer 10.7|2088359|30|CP025603|CRT matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
698. spacer 10.7|2088359|30|CP025603|CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
699. spacer 10.7|2088359|30|CP025603|CRT matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
700. spacer 15.7|3741171|31|CP025603|CRT matches to NZ_CP010990 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence) position: , mismatch: 7, identity: 0.774
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
cccacccacttcaccgacgtcgccgccgacg Protospacer
*.************ ***.******* *.
701. spacer 15.7|3741171|31|CP025603|CRT matches to NZ_CP012186 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-1, complete sequence) position: , mismatch: 7, identity: 0.774
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
cccacccacttcaccgacgtcgccgccgacg Protospacer
*.************ ***.******* *.
702. spacer 15.7|3741171|31|CP025603|CRT matches to NZ_CP042263 (Litoreibacter sp. LN3S51 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.774
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
atccgccatttcaccgccgttgccgacgccg Protospacer
* * ***.**************** **.*.
703. spacer 16.3|3948555|36|CP025603|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
caacggcggggccggcggtagcggcggcgcaggcgc Protospacer
**.************************ ** ..* .
704. spacer 16.3|3948555|36|CP025603|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
cagcggcggggacggcggcagcggcggcgggctctt Protospacer
*********** ******.******** * ***
705. spacer 16.3|3948555|36|CP025603|CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
706. spacer 16.3|3948555|36|CP025603|CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
707. spacer 16.3|3948555|36|CP025603|CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
708. spacer 16.3|3948555|36|CP025603|CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
709. spacer 16.3|3948555|36|CP025603|CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
710. spacer 16.3|3948555|36|CP025603|CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
711. spacer 16.3|3948555|36|CP025603|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
712. spacer 16.3|3948555|36|CP025603|CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
713. spacer 16.3|3948555|36|CP025603|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
714. spacer 16.5|3948699|33|CP025603|CRT matches to CP006582 (Mesorhizobium huakuii 7653R plasmid pMHa, complete sequence) position: , mismatch: 7, identity: 0.788
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaagacggcgccggcggggccgggatcggcgc Protospacer
*****.****.************* . **.* *
715. spacer 16.17|3949755|36|CP025603|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
caacggcggggccggcggtagcggcggcgcaggcgc Protospacer
**.************************ ** ..* .
716. spacer 16.17|3949755|36|CP025603|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
cagcggcggggacggcggcagcggcggcgggctctt Protospacer
*********** ******.******** * ***
717. spacer 16.17|3949755|36|CP025603|CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
718. spacer 16.17|3949755|36|CP025603|CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
719. spacer 16.17|3949755|36|CP025603|CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
720. spacer 16.17|3949755|36|CP025603|CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
721. spacer 16.17|3949755|36|CP025603|CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
722. spacer 16.17|3949755|36|CP025603|CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
723. spacer 16.17|3949755|36|CP025603|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
724. spacer 16.17|3949755|36|CP025603|CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
725. spacer 16.17|3949755|36|CP025603|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.806
cagcggcggggccggcggtagcggcgg---ggccaactt CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcga--- Protospacer
********* *.*************** **.*.*
726. spacer 16.18|3949827|27|CP025603|CRT matches to NC_008271 (Rhodococcus jostii RHA1 plasmid pRHL3, complete sequence) position: , mismatch: 7, identity: 0.741
caccggcggcaaaggcggcatgggcgg CRISPR spacer
gcttctcggcaaaggcggcatgggcga Protospacer
.. ********************.
727. spacer 4.6|366817|33|CP025603|CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttggtgtcgatctcgatctggccgttgcccgca Protospacer
* **.*****.**************** *..
728. spacer 4.6|366817|33|CP025603|CRISPRCasFinder matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agctggttgatgccgatctggccgctgccggtc Protospacer
** . *..*** ************.*******
729. spacer 4.6|366817|33|CP025603|CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
atgctgccgaccccgatctggtcgttttcgact Protospacer
* ********.**********.**** .**..
730. spacer 4.6|366817|33|CP025603|CRISPRCasFinder matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtcgaccttc Protospacer
***************** ** ***.* * *
731. spacer 4.6|366817|33|CP025603|CRISPRCasFinder matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agctggttgatgccgatctggccgctgccggtc Protospacer
** . *..*** ************.*******
732. spacer 6.6|926876|36|CP025603|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.778
cggggccggcggcaacggcggggctggcggggccgg CRISPR spacer
actgctcatcggcaacggcggggccggcggggccgg Protospacer
* .*. ***************.***********
733. spacer 6.13|927182|30|CP025603|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgacgccggcctgctggtcgggctgacctc Protospacer
********************* .. . *
734. spacer 6.13|927182|30|CP025603|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ccgcaaactcctgctggtcggcgccggcgg Protospacer
* .*. ************* *******
735. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgatgccggcctgctggtcggggttcccag Protospacer
***.***************** .. *.*
736. spacer 6.13|927182|30|CP025603|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ccgcaaactcctgctggtcggcgccggcgg Protospacer
* .*. ************* *******
737. spacer 6.13|927182|30|CP025603|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ccttcagggcgtgctggtcggctccggcgc Protospacer
* . *** ******************
738. spacer 6.13|927182|30|CP025603|CRT matches to NZ_KY126370 (Enterobacter cloacae subsp. cloacae strain MN201516 plasmid pOP-I, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
739. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP054625 (Cupriavidus gilardii strain FDAARGOS_639 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggccgccggcctgctgtgcggctccgcgct Protospacer
* ************* ********
740. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgatgccggcctgctggtcggggttcccag Protospacer
***.***************** .. *.*
741. spacer 6.13|927182|30|CP025603|CRT matches to NZ_LT960615 (Hartmannibacter diazotrophicus strain E19T plasmid HDIAp1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gttcaccgccctgctgatcggctccggcat Protospacer
*.*** *******.***********.
742. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP046347 (Citrobacter portucalensis strain FDAARGOS_738 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
743. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP044100 (Citrobacter werkmanii strain FDAARGOS_616 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
744. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP032156 (Mycobacterium sp. ELW1 plasmid pELW1-1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
aatcgccggcctgctggtcggtgccgcggt Protospacer
. ******************. *** *
745. spacer 6.13|927182|30|CP025603|CRT matches to KY555144 (Caulobacter phage Ccr5, complete genome) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggtgatcggcctgctggtcgtcgccggcgc Protospacer
* ..************** * ******
746. spacer 6.13|927182|30|CP025603|CRT matches to NZ_KP873172 (Pseudomonas aeruginosa PAO1 plasmid pAMBL1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
747. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP045203 (Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
748. spacer 6.13|927182|30|CP025603|CRT matches to NC_021492 (Enterobacter sp. R4-368 plasmid pENT01, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
749. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP022156 (Escherichia coli strain ABWA45 plasmid pABWA45_2, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
750. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP024682 (Citrobacter freundii strain UMH14 plasmid pUMH14_2, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
751. spacer 6.13|927182|30|CP025603|CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgatgccggcctgctggtcggggttcccag Protospacer
***.***************** .. *.*
752. spacer 6.15|927278|30|CP025603|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cgaccatctcggctccgacggcgctggcgc Protospacer
* * .*********.***********
753. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
754. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gccaccccgcggctccggaggcgctggcgg Protospacer
*..*. . ********* ***********
755. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcaccggcggcgctggcga Protospacer
. * *.***** ***************.
756. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcaccggcggcgctggcga Protospacer
. * *.***** ***************.
757. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
758. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
759. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
760. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
761. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
762. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
763. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
764. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
765. spacer 6.15|927278|30|CP025603|CRT matches to NC_010998 (Rhizobium etli CIAT 652 plasmid pA, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcaccggcggcgctggcga Protospacer
. * *.***** ***************.
766. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgatcggctccggcgccggcttctc Protospacer
******* ************ ** . *
767. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgtgcggctccggcggcaaccccga Protospacer
******* *************. . **.
768. spacer 6.15|927278|30|CP025603|CRT matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgatgttcgactccggcggcgacgcacc Protospacer
**** ******.*********** .*
769. spacer 6.15|927278|30|CP025603|CRT matches to NZ_AP014706 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gcaccgcgccggctccggcggcggtggcgg Protospacer
* * .************** ******
770. spacer 6.17|927368|36|CP025603|CRT matches to MG770216 (Mycobacterium phage Rem711, complete genome) position: , mismatch: 8, identity: 0.778
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
attcggcggcaacggcggcaacggcgcggccggcgc Protospacer
..* . ************.******* ********
771. spacer 6.17|927368|36|CP025603|CRT matches to KY087993 (Mycobacterium phage Hammy, complete genome) position: , mismatch: 8, identity: 0.778
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
gcagatcggcaccggcggtaacggcggcggtgcagc Protospacer
** ******** *************** * .* *
772. spacer 6.17|927368|36|CP025603|CRT matches to MF140406 (Mycobacterium phage DarthP, complete genome) position: , mismatch: 8, identity: 0.778
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
gcagatcggcaccggcggtaacggcggcggtgcagc Protospacer
** ******** *************** * .* *
773. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
caacggcggcaacggcggcgacggcggtcgcggt-- Protospacer
. ***************** ****** *.**.
774. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ccccggcggcaacggcggcaacggcggcaatgcc-- Protospacer
*****************. ****** .** *
775. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
cgccggcggcagcgccggcgccggcagtatcggc-- Protospacer
**********.** **********.* .***
776. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta-- CRISPR spacer
tgtcggcggtaacggcggcgtcggcgg--agccagc Protospacer
*.******.**********.****** .**.*
777. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt Protospacer
************** *********. **.*
778. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NC_047958 (Burkholderia phage vB_BmuP_KL4, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tgccggccgcaacgacggcgccggcggccggtgc Protospacer
****** ******.************ .**.
779. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt Protospacer
************** *********. **.*
780. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta-- CRISPR spacer
ctccggcggcaacggcggtgccgccgg--gaccact Protospacer
****************.**** *** *.*.*
781. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcgggaagggcggcgccggcggcggtctg Protospacer
******* ** ************** * **.
782. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt Protospacer
************** *********. **.*
783. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt Protospacer
************** *********. **.*
784. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgccggcggaaacggtggcgccggcggcacggtg Protospacer
******** *****.*********** * *.
785. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
taccggcggcaatggaggcgccggcggcatcgcc- Protospacer
.**********.** *********** .* **.
786. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta-- CRISPR spacer
ctccggcggcaacggcggtgccgccgg--gaccact Protospacer
****************.**** *** *.*.*
787. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta-- CRISPR spacer
ctccggcggcaacggcggtgccgccgg--gaccact Protospacer
****************.**** *** *.*.*
788. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to MN234223 (Mycobacterium phage Philly, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
789. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to KJ194581 (Mycobacterium phage Audrey, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
790. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to MH051265 (Mycobacterium phage Yahalom, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
791. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to MH316565 (Mycobacterium phage Mortcellus, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
792. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to MT310871 (Mycobacterium phage Jackstina, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
793. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to EU816589 (Mycobacterium phage Phaedrus, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
794. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to MT952851 (Mycobacterium phage Gervas, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
795. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to MG920059 (Mycobacterium phage Baloo, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
796. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NC_023686 (Mycobacterium phage Gadjet, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
797. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NC_041965 (Mycobacterium phage Athena, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
798. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to DQ398049 (Mycobacterium phage Pipefish, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
799. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to MT310892 (Mycobacterium phage Compostia, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
800. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to JN699018 (Mycobacterium phage Kamiyu, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
801. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg----gtggcta CRISPR spacer
cggcggcggcaccggcggcaccggcggtgccgtg---- Protospacer
* ******** *******.******* ***
802. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta-- CRISPR spacer
ggccggcggcaacgggagcgccggc--ctcgccgcc Protospacer
*************** .******** * **..
803. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcg-gcaacggcggcgccggcgggtggcta CRISPR spacer
-ccgagcgcgccacggcggctccggcgggtggccc Protospacer
* .*** ** ******** ************.
804. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to MK814754 (Mycobacterium phage Sumter, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
805. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to MK814754 (Mycobacterium phage Sumter, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
806. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to MN369739 (Mycobacterium phage Kenuha5, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
807. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to MK967397 (Mycobacterium phage Mahavrat, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
808. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to MT522000 (Mycobacterium phage Soul22, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
809. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to KY348865 (Mycobacterium phage Bubbles123, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
810. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to MN428047 (Mycobacterium phage Doomphist, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
811. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to MF919502 (Mycobacterium phage Demsculpinboyz, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
812. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to AY129336 (Mycobacteriophage Che9d, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
813. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to MT771340 (Mycobacterium phage Jorgensen, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
814. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to MK359343 (Mycobacterium phage Pollywog, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
815. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NC_042030 (Mycobacterium phage Yoshi, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
816. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NC_048729 (Mycobacterium phage Renaud18, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
817. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NC_026585 (Mycobacteriophage Estave1, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
818. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to MK305886 (Mycobacterium phage Poenanya, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
819. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to JN859129 (Mycobacterium virus DotProduct, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
820. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to MG925354 (Mycobacterium phage Ogopogo, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
821. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to JN698995 (Mycobacterium phage Dori, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggccctggcggctcggtg Protospacer
.***************** *.***** * * *.
822. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NC_023698 (Mycobacterium phage Avani, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
823. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NC_011054 (Mycobacterium phage Boomer, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
824. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to MN234184 (Mycobacterium phage IdentityCrisis, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
caccggcggcagcggcggcgcaggcggaaacggc-- Protospacer
.*********.********* ***** ..***
825. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to MH077585 (Mycobacterium phage TChen, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
826. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NC_048788 (Mycobacterium phage ThetaBob, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
827. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
tctcggcggcgacggcggcgacggcggtgttgat- Protospacer
.*******.********* ****** ** * *
828. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP015733 (Arthrobacter sp. U41 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcaacggcggccgcggctgccagcca Protospacer
.****************** **** * ..**.*
829. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to MN096355 (Mycobacterium phage Purky, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta- CRISPR spacer
gcgcggcggcaccggcggcaccggc-ggcggtcat Protospacer
* ******** *******.***** **.**..*
830. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to MN234183 (Mycobacterium phage Antsirabe, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgtcggcggcagcggcggcggcggcggacgtcca Protospacer
*.********.******** ******..* *.*
831. spacer 8.9|1212383|37|CP025603|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 8, identity: 0.784
tgtcggcggtgccggcggcaccggcgggttaggcaac CRISPR spacer
agtcggcggcggcggcggcaccggcgggaccggcggc Protospacer
********.* **************** . ***..*
832. spacer 9.2|1573011|37|CP025603|PILER-CR matches to NC_012855 (Ralstonia pickettii 12D plasmid pRp12D01, complete sequence) position: , mismatch: 8, identity: 0.784
tcctgagctgacgccggttccgccctgcccgccgtgt CRISPR spacer
tactaggtcgacgccggttccgcgctgcccgcggtgc Protospacer
* **..*..************** ******** ***.
833. spacer 10.7|2088359|30|CP025603|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc Protospacer
.** ... **************.******.
834. spacer 10.7|2088359|30|CP025603|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc Protospacer
.** ... **************.******.
835. spacer 14.24|3122393|29|CP025603|PILER-CR matches to MK599315 (Pseudomonas phage PA1C, complete genome) position: , mismatch: 8, identity: 0.724
tccgcgaaattcactgcgcgttattcaag CRISPR spacer
gacgcgaaatacactgcgctttattttca Protospacer
******** ******** *****. .
836. spacer 15.7|3741171|31|CP025603|CRT matches to CP033373 (Lactobacillus fermentum strain DR9 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
ttagcccacttcacggccgttgccgacgcgg Protospacer
*********** ********** **. .
837. spacer 15.7|3741171|31|CP025603|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
838. spacer 15.7|3741171|31|CP025603|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
839. spacer 15.7|3741171|31|CP025603|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
840. spacer 15.7|3741171|31|CP025603|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
841. spacer 15.7|3741171|31|CP025603|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
842. spacer 15.7|3741171|31|CP025603|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
843. spacer 15.7|3741171|31|CP025603|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
844. spacer 15.7|3741171|31|CP025603|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
845. spacer 15.7|3741171|31|CP025603|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
846. spacer 15.7|3741171|31|CP025603|CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
cgcaactccttcaccgccgctgccgccgtct Protospacer
.*. *. ***********.**********
847. spacer 15.7|3741171|31|CP025603|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
848. spacer 15.7|3741171|31|CP025603|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
849. spacer 15.7|3741171|31|CP025603|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
850. spacer 15.7|3741171|31|CP025603|CRT matches to NZ_CP027299 (Streptomyces sp. SGAir0924 plasmid unnamed_5) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
ctcggtggcttcgccgccgtcgccgccgtca Protospacer
** . .****.*******.**********
851. spacer 15.7|3741171|31|CP025603|CRT matches to NC_014213 (Meiothermus silvanus DSM 9946 plasmid pMESIL01, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
atcgcccacttcaccggcgtttccgaccctt Protospacer
* ************** **** *** * ..
852. spacer 16.5|3948699|33|CP025603|CRT matches to NZ_LR134468 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 26, complete sequence) position: , mismatch: 8, identity: 0.758
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaaggcggccccggcggtgccggcgataccga Protospacer
*.******** ******* ********.. *
853. spacer 16.5|3948699|33|CP025603|CRT matches to NZ_CP053714 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed7, complete sequence) position: , mismatch: 8, identity: 0.758
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cggcggcggcgccggcggggccggcggcgggac Protospacer
*.. ******.***************.**. *
854. spacer 16.5|3948699|33|CP025603|CRT matches to NZ_CP033508 (Mesorhizobium jarvisii strain ATCC 700743 plasmid pMJ700743a, complete sequence) position: , mismatch: 8, identity: 0.758
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaagacggcgccggcggggccgggatcaccac Protospacer
*****.****.************* . *. * *
855. spacer 16.5|3948699|33|CP025603|CRT matches to NZ_CP033369 (Mesorhizobium loti strain SU343 plasmid pMLSU343a, complete sequence) position: , mismatch: 8, identity: 0.758
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
caaagacggcgccggcggggccgggatcaccac Protospacer
*****.****.************* . *. * *
856. spacer 16.8|3948936|36|CP025603|CRT matches to NZ_CP026546 (Cupriavidus metallidurans strain Ni-2 plasmid unnamed2) position: , mismatch: 8, identity: 0.778
tagcagcggtgccggcggcaccaacggctccggcgg CRISPR spacer
gcgctgatgcgccggcgacaccaaaggctccggcgg Protospacer
** * *.*******.****** ***********
857. spacer 4.6|366817|33|CP025603|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtattcgatcccgatctggccgtcgccggcc Protospacer
*. .******************.*****.
858. spacer 4.6|366817|33|CP025603|CRISPRCasFinder matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
859. spacer 4.6|366817|33|CP025603|CRISPRCasFinder matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
860. spacer 4.6|366817|33|CP025603|CRISPRCasFinder matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
861. spacer 5.1|692016|31|CP025603|CRISPRCasFinder matches to NZ_CP014964 (Geobacter anodireducens strain SD-1 plasmid pSD, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
ggaacgaacggcaagccgaaatgttggtgga Protospacer
.* .**************** .*****
862. spacer 5.1|692016|31|CP025603|CRISPRCasFinder matches to NC_015974 (Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg Protospacer
. ********.***********.**.. *
863. spacer 5.1|692016|31|CP025603|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg Protospacer
. ********.***********.**.. *
864. spacer 6.13|927182|30|CP025603|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.7
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggcgccggcctgctggtcggactgctcac Protospacer
**.****************** .. *.
865. spacer 6.15|927278|30|CP025603|CRT matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 9, identity: 0.7
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gaccacgttcggctccggccgcgctcgcgt Protospacer
. .************* ***** ***
866. spacer 6.15|927278|30|CP025603|CRT matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 9, identity: 0.7
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gaccacgttcggctccggccgcgctcgcgt Protospacer
. .************* ***** ***
867. spacer 6.17|927368|36|CP025603|CRT matches to MF140398 (Mycobacterium phage Amohnition, complete genome) position: , mismatch: 9, identity: 0.75
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
gcagatcggcaccggcggtaacggcggcggtacggc Protospacer
** ******** *************** * .. *
868. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
caacggcggcaacggcggcaacggcggcaacggc-- Protospacer
. ****************. ****** ..***
869. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
cagcggcggcaacggcggccgcggcggcgacggc-- Protospacer
. **************** ***** *..***
870. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgccggcggcaactgcggcgccggcgcccaccgc Protospacer
************ ************ .. *
871. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
cagcggcagcaatggcggcgccggcggcgccggc-- Protospacer
. ****.****.************* * .***
872. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cggcggcgggaccggcggcgccggcggcagtatc Protospacer
* ****** * *************** * *
873. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to EF602154 (Burkholderia phage BcepNY3, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcggcaacggcggtgccggtgcgccagcc Protospacer
******************.*****.* *. . .
874. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to AY369265 (Burkholderia cenocepacia phage Bcep1, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcggcaacggcggtgccggtgcgccagcc Protospacer
******************.*****.* *. . .
875. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NC_005263 (Burkholderia phage Bcep1, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcggcaacggcggtgccggtgcgccagcc Protospacer
******************.*****.* *. . .
876. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcggcattttc Protospacer
.********** ************** .*
877. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcggcattttc Protospacer
.********** ************** .*
878. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgtcggcggccacggcggcgtcggcggtcaggaa Protospacer
*.******* *********.****** ..* *
879. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP053906 (Hymenobacter sp. BRD67 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaccggcggcggcggcgggggcacc Protospacer
.********* ******** ******* * .
880. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to KC170279 (Uncultured bacterium plasmid pMBUI8, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggcgccggcgtctaccag Protospacer
********** ************* *. * .
881. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
882. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gaccggcggcaccggcggcgccgccggccatcat Protospacer
*.********* *********** *** .. *
883. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
884. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
885. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
886. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
887. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cggcggcggcaatggcggcaccggcggcacggtc Protospacer
* *********.******.******* * *
888. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
889. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
890. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ctccggcggcaacggcggcggcagcggtggtgga Protospacer
****************** *.**** * *
891. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
892. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
893. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
894. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
895. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
896. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
897. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
898. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
899. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
900. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
901. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
902. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
903. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
904. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
905. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to MH001451 (Mycobacterium phage Nairb, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
906. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to MF155936 (Mycobacterium phage ZenTime222, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
907. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to MH588544 (Caulobacter phage CcrBL10, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gaccggcggcaacggcggcggcggtggctcctcg Protospacer
*.****************** ***.** * ...
908. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to MK494089 (Mycobacterium phage Ibrahim, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
909. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NC_024135 (Mycobacterium phage Bernal13, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
910. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to KM591905 (Mycobacterium phage RonRayGun, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
911. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to MN735432 (Mycobacteriophage Whitty, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
912. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_KX443399 (Rhodococcus hoagii strain PAM1354 plasmid pVAPA1354, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga Protospacer
*************** ** ***** .**.*
913. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_KX443400 (Rhodococcus hoagii strain PAM1557 plasmid pVAPN1557, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga Protospacer
*************** ** ***** .**.*
914. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_KX443398 (Rhodococcus hoagii strain PAM1204 plasmid pVAPN1204, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga Protospacer
*************** ** ***** .**.*
915. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to CP054922 (Streptomyces sp. NA03103 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tgccggcggccccggcggcgccggccagctgcac Protospacer
********* ************* .*. **
916. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_KP851975 (Rhodococcus hoagii strain PAM2012 plasmid pVAPN2012, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga Protospacer
*************** ** ***** .**.*
917. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NC_015314 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
ctgcggcggcgacggcggcaccggcggaggcagc-- Protospacer
*******.********.****** **..**
918. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gttcggcggcgagggcggcgccggcggcaagcgt Protospacer
* .*******.* ************** .**
919. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_KF439868 (Rhodococcus hoagii strain PAM1571 plasmid pVAPN1571, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga Protospacer
*************** ** ***** .**.*
920. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgacggcggcaacggcggccgcggcggctccgtg Protospacer
* **************** ****** * *.
921. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP021025 (Rhizobium sp. TAL182 plasmid pRetTAL182a, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
922. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gcgcggcggcgccggcggcgccggcggcgaggga Protospacer
* *******. *************** .* *
923. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat Protospacer
********.* *************.* *. *
924. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP013600 (Rhizobium sp. N741 plasmid pRspN741e, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
925. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NC_019789 (Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
caccggcggcaacggcggcaccgccgacaacggc-- Protospacer
.*****************.*** ** ...***
926. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP013504 (Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
927. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP013510 (Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
928. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP013521 (Rhizobium sp. N113 plasmid pRspN113d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
929. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP013494 (Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
930. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP013512 (Rhizobium sp. N1314 plasmid pRspN1314a, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
931. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP013594 (Rhizobium sp. N871 plasmid pRspN871d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
932. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat Protospacer
********.* *************.* *. *
933. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to KC736071 (Mycobacterium phage WIVsmall, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
caacggcggcaacggcggcaacggcggcggcagc-- Protospacer
. ****************. ***** **..**
934. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat Protospacer
********.* *************.* *. *
935. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_LR134446 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 4, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gagcggcggcaacggcggcaacggcggcttcccc Protospacer
*. ****************. ****** * *.
936. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP041653 (Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgacggccgcaacggcggctccggcggcgggaac Protospacer
* **** *********** ******* **
937. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat Protospacer
********.* *************.* *. *
938. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat Protospacer
********.* *************.* *. *
939. spacer 8.9|1212383|37|CP025603|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 9, identity: 0.757
tgtcggcggtgccggcggcaccggcgggttaggcaac CRISPR spacer
ggtgggcggtgccggcggcagcggcggcatggccttc Protospacer
** **************** ****** *.* * *
940. spacer 15.5|3741030|34|CP025603|CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.735
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
attgagatccgcgacgatgggtgtggcgccggcg Protospacer
.** .********.**** ***********.
941. spacer 15.5|3741030|34|CP025603|CRT matches to MG812496 (Gordonia phage SallySpecial, complete genome) position: , mismatch: 9, identity: 0.735
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
gcgcaccaccgcggcggtgcgggtggcgccggcg Protospacer
*. . *. *****.***** *************.
942. spacer 16.3|3948555|36|CP025603|CRT matches to NZ_CP046906 (Streptomyces sp. QHH-9511 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.75
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
cagcggcggggacggcggcagcggcgtgcagcgctg Protospacer
*********** ******.******* * .**
943. spacer 16.5|3948699|33|CP025603|CRT matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
tggtgacggcaccggcggtgccggcggcgatgc Protospacer
... *.************ *******.***. *
944. spacer 16.5|3948699|33|CP025603|CRT matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cggccgcggcaccggcggggccgccgccgatca Protospacer
*.. ****************** ** ***..
945. spacer 16.5|3948699|33|CP025603|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
946. spacer 16.5|3948699|33|CP025603|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
947. spacer 16.5|3948699|33|CP025603|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
948. spacer 16.5|3948699|33|CP025603|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
949. spacer 16.5|3948699|33|CP025603|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
950. spacer 16.5|3948699|33|CP025603|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaaggcggcaccggcggtgacggcggaaccgg Protospacer
*.**************** * *****. . *
951. spacer 16.5|3948699|33|CP025603|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
cgaaggcggcaccggcggtgacggcggaaccgg Protospacer
*.**************** * *****. . *
952. spacer 16.5|3948699|33|CP025603|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
953. spacer 16.5|3948699|33|CP025603|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
954. spacer 16.5|3948699|33|CP025603|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
955. spacer 16.5|3948699|33|CP025603|CRT matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ggtacccggcaccgccgaggccggcgacgagtt Protospacer
. * ******** **.************ *.
956. spacer 16.5|3948699|33|CP025603|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
957. spacer 16.5|3948699|33|CP025603|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
958. spacer 16.5|3948699|33|CP025603|CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
catgaccggcaccggcagggctggcgacgagca Protospacer
** .. **********.****.******** .
959. spacer 16.5|3948699|33|CP025603|CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
catgaccggcaccggcagggctggcgacgagca Protospacer
** .. **********.****.******** .
960. spacer 16.5|3948699|33|CP025603|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ccaaggcggcaccggcggtgacggcggaaccgg Protospacer
* **************** * *****. . *
961. spacer 16.11|3949164|36|CP025603|CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.75
ggccggcggtagcggcggggccaacttcaacggcgg CRISPR spacer
ggccggcggtatcggcgggcccaactggctcgacct Protospacer
*********** ******* ****** **.*
962. spacer 16.11|3949164|36|CP025603|CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 9, identity: 0.75
ggccggcggtagcggcggggccaacttcaacggcgg CRISPR spacer
ggccggcggtatcggcgggcccaactggctcgacct Protospacer
*********** ******* ****** **.*
963. spacer 16.17|3949755|36|CP025603|CRT matches to NZ_CP046906 (Streptomyces sp. QHH-9511 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.75
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
cagcggcggggacggcggcagcggcgtgcagcgctg Protospacer
*********** ******.******* * .**
964. spacer 4.6|366817|33|CP025603|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
965. spacer 4.6|366817|33|CP025603|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
966. spacer 4.6|366817|33|CP025603|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtattcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
967. spacer 6.2|926678|39|CP025603|CRT matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.744
cggcgcgggcggggccgtcacgggaaccggcgccaccgg CRISPR spacer
cacgggggccggggccgccacgggaaccggcgccccgcc Protospacer
*. * ** ********.**************** *
968. spacer 6.17|927368|36|CP025603|CRT matches to MN369764 (Mycobacterium phage Rahalelujah, complete genome) position: , mismatch: 10, identity: 0.722
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
atctggaggcaacggcggtaacggcggggccagcac Protospacer
... . ************************.**.
969. spacer 6.17|927368|36|CP025603|CRT matches to NZ_CP025548 (Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.722
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
gaccggcggcaacggcggaaacggcggcgccgcagc Protospacer
* . . ************ ******** **** *
970. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcg-----ggtggcta CRISPR spacer
ccgcggcggcgacggcggcgcgggcggcaccggt----- Protospacer
*******.********** **** ***
971. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gagcggcggcaacggcggtaccggcggtgacgtc Protospacer
*. ***************..******* . *
972. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP034352 (Streptomyces sp. W1SF4 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
acccggcggcaccggcggcgcgggcggtccggcc Protospacer
. ********* ********* ***** . * .
973. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to CP000620 (Burkholderia vietnamiensis G4 plasmid pBVIE04, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tgccggcggcatcggcgccgccggcgcggcatcg Protospacer
********** ***** ******** * ....
974. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP020810 (Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ctccggcggcaccggaggcgccggcggaggcacc Protospacer
********* *** ***********. * .
975. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NC_016588 (Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
atccggcggcgccggcggcgccggcggcggaact Protospacer
. ********. *************** *. .
976. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to MK524490 (Mycobacterium phage Donny, complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggctccacg Protospacer
*****************. ****** * ..
977. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to MK494095 (Mycobacterium phage Daegal, complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaccggcggcaccggcggcaccgga Protospacer
.********* *******.******* *
978. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to JN699007 (Mycobacterium phage Acadian, complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggctccacg Protospacer
*****************. ****** * ..
979. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to MT889381 (Mycobacterium phage Suigeneris, complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggctccacg Protospacer
*****************. ****** * ..
980. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP015373 (Pandoraea pnomenusa strain MCB032 plasmid unnamed 2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
981. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to AP018709 (Uncultured bacterium plasmid pSN1104-59 DNA, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
982. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP013744 (Streptomyces sp. CdTB01 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta------- CRISPR spacer
ggccgacggcaagggcggcgcc-------ggttacgcctcc Protospacer
*****.****** ********* **.**
983. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcatcggcggcgcgggcgaggcccag Protospacer
********* ********* ****.* * .
984. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NC_008766 (Acidovorax sp. JS42 plasmid pAOVO02, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
985. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tgacggcggcaacagcggcaccggcggagcgaag Protospacer
* **********.*****.*******. * .
986. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP019238 (Rhodoferax koreense strain DCY-110 plasmid unnamed2) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
987. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP019238 (Rhodoferax koreense strain DCY-110 plasmid unnamed2) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
988. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcatcggcggcgcgggcgaggcccag Protospacer
********* ********* ****.* * .
989. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NC_021077 (Comamonas sp. 7D-2 plasmid pBHB, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
990. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NC_024998 (Acidovorax avenae subsp. avenae plasmid pAAA83 DNA, complete sequence, strain: 83) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
991. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NC_008385 (Burkholderia ambifaria AMMD plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
992. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP018471 (Xanthomonas vesicatoria strain LM159 plasmid pLM159.2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
993. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_KJ588780 (Achromobacter xylosoxidans strain A22732 plasmid pA22732-IMP, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
994. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_MN366359 (Bacterium plasmid pALTS31, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
995. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP027024 (Streptomyces sp. WAC00288 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcaacaacggcggcgccggcgccttcttc Protospacer
.*****..***************** * .*
996. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NC_001735 (Enterobacter aerogenes plasmid R751, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
997. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to AGRM01000006 (Salmonella enterica subsp. houtenae str. ATCC BAA-1581 plasmid pSEHO0A1, complete sequence, whole genome shotgun sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
998. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to AJ863570 (Uncultured bacterium IncP-1beta multiresistance plasmid pB8) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
999. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP034651 (Xanthomonas vasicola strain NCPPB 1060 plasmid pXVH45, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1000. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gcgtctgggccacggcggcgctggcgggtgggtg Protospacer
* . *** **********.********* *.
1001. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gcgtctgggccacggcggcgctggcgggtgggtg Protospacer
* . *** **********.********* *.
1002. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NC_021492 (Enterobacter sp. R4-368 plasmid pENT01, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1003. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to JX469828 (Uncultured bacterium plasmid pRSB223, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tcccggcggcaagggcggtgccggcgtctatcag Protospacer
********** *****.******* *. * .
1004. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to JX469829 (Uncultured bacterium plasmid pB1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tcccggcggcaagggcggtgccggcgtctatcag Protospacer
********** *****.******* *. * .
1005. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to JX469831 (Uncultured bacterium plasmid pKSP212, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1006. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to JN106172 (Uncultured bacterium plasmid pAKD29, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1007. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to JN106173 (Uncultured bacterium plasmid pAKD31, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1008. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to JN106174 (Uncultured bacterium plasmid pAKD33, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1009. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to JN106164 (Uncultured bacterium plasmid pAKD1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1010. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to JN106165 (Uncultured bacterium plasmid pAKD14, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1011. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to JN106166 (Uncultured bacterium plasmid pAKD15, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1012. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to JN106168 (Uncultured bacterium plasmid pAKD17, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1013. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to JN106169 (Uncultured bacterium plasmid pAKD18, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1014. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to MN386974 (Pseudomonas aeruginosa strain 1943 plasmid pPaeBURNS1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1015. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NC_001381 (Mycobacterium fortuitum plasmid pAL5000, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gcgcggcggcagcggcggcgctggcggcggcacg Protospacer
* ********.*********.***** * ..
1016. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to MG879028 (Uncultured bacterium plasmid pEG1-1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1017. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP021650 (Acidovorax sp. T1 plasmid p2-T1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1018. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to JX486125 (Uncultured bacterium plasmid pRWC72a, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1019. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP038640 (Cupriavidus oxalaticus strain X32 plasmid unnamed5, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1020. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to AJ639924 (Uncultured bacterium plasmid pB3 complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1021. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to KU356987 (Variovorax paradoxus plasmid pBS64, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1022. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to KU356988 (Variovorax paradoxus plasmid pHB44, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1023. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcgacggcggcgacggcgccccgcgc Protospacer
********.********* ***** . **
1024. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP009797 (Burkholderia ambifaria AMMD plasmid pBII_1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1025. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NC_013176 (Pseudomonas putida plasmid pW2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1026. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NC_019320 (Variovorax sp. DB1 plasmid pDB1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1027. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP017455 (Dickeya solani strain PPO 9019 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1028. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NC_007337 (Cupriavidus pinatubonensis JMP134 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1029. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_MN366358 (Bacterium plasmid pALTS29, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
1030. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to MN234219 (Mycobacterium phage Mercurio, complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgacgtcggcaccggcggcgccggcggcgcgaag Protospacer
* ** ***** *************** * .
1031. spacer 8.9|1212383|37|CP025603|CRISPRCasFinder matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 10, identity: 0.73
tgtcggcggtgccggcggcaccggcgggttaggcaac CRISPR spacer
cctcgacggtgccggcggcatcggcgggcgctggacc Protospacer
. ***.**************.*******. * * *
1032. spacer 8.9|1212383|37|CP025603|CRISPRCasFinder matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 10, identity: 0.73
tgtcggcggtgccggcggcaccggcgggttaggcaac CRISPR spacer
cctcgacggtgccggcggcatcggcgggcgctggacc Protospacer
. ***.**************.*******. * * *
1033. spacer 13.9|3119790|35|CP025603|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 10, identity: 0.714
acttgcgcgcacaacgcatccgccatccacggggc CRISPR spacer
gtcaccgcgcacaacacattcgccatccacacggt Protospacer
... **********.***.**********. **.
1034. spacer 14.20|3123265|34|CP025603|CRISPRCasFinder,CRT matches to NZ_AP022335 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence) position: , mismatch: 10, identity: 0.706
tagaaggcgatcactggaagcacggcgcttgcga CRISPR spacer
ggcaaggcgatcagtggaagctcggcggcggcac Protospacer
. ********** ******* ***** . **.
1035. spacer 14.36|3123269|34|CP025603|PILER-CR matches to NZ_AP022335 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence) position: , mismatch: 10, identity: 0.706
tagaaggcgatcactggaagcacggcgcttgcga CRISPR spacer
ggcaaggcgatcagtggaagctcggcggcggcac Protospacer
. ********** ******* ***** . **.
1036. spacer 15.5|3741030|34|CP025603|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 10, identity: 0.706
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
cagcgcggccgcgtcggtgggggtggcgcccgcc Protospacer
. * ***** **************** **
1037. spacer 15.5|3741030|34|CP025603|CRT matches to NZ_CP024986 (Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc Protospacer
* .* *******.** *************.
1038. spacer 15.5|3741030|34|CP025603|CRT matches to NC_024970 (Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc Protospacer
* .* *******.** *************.
1039. spacer 15.5|3741030|34|CP025603|CRT matches to NZ_KJ396772 (Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc Protospacer
* .* *******.** *************.
1040. spacer 16.3|3948555|36|CP025603|CRT matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 10, identity: 0.722
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
ggccggcggggccggcgggaccggcggggccggggg Protospacer
. *************** * **********..
1041. spacer 16.5|3948699|33|CP025603|CRT matches to NZ_LR594668 (Variovorax sp. SRS16 plasmid 3) position: , mismatch: 10, identity: 0.697
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gacgcgcggcaccggctggtccggcgacgcgcg Protospacer
* . *********** ** ********* .
1042. spacer 16.5|3948699|33|CP025603|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 10, identity: 0.697
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
ggcaggcggcgccggcgaggccggcgaggggca Protospacer
. *******.******.********* *. .
1043. spacer 16.17|3949755|36|CP025603|CRT matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 10, identity: 0.722
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
ggccggcggggccggcgggaccggcggggccggggg Protospacer
. *************** * **********..
1044. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caacggcggcaacggcggcaacggcggcacgtcg Protospacer
. ****************. ****** *...
1045. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tttcggcggcagcggcggcggcggcggaaccccg Protospacer
.********.******** ******. *..
1046. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to MH051334 (Escherichia phage vB_EcoS-Ro145c2YLVW, complete genome) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggcggctacggcggcggcggcggcaattgg Protospacer
.******** ********* ****** . . .
1047. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to MG852086 (Escherichia phage vB_EcoS-Ro145clw, complete genome) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggcggctacggcggcggcggcggcaattgg Protospacer
.******** ********* ****** . . .
1048. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggccacggcggggccggcggcgacgcg Protospacer
.******** ******* ******** . ..
1049. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tttcggcggcaagggcggcgccgccggcgatcag Protospacer
.********* ********** *** . * .
1050. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP020372 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caggggcggcaacggcggccccggcaggacggcg Protospacer
. *************** *****.** * ..
1051. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cataggcggcgatggcggcgccggcgggatggcg Protospacer
.. ******.*.*************** * ..
1052. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to ASHF01000034 (Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccgacggcaagggcggcgccggatacgccccc Protospacer
*****.****** *********** . *.
1053. spacer 8.5|1212167|40|CP025603|CRISPRCasFinder matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.725
tgccggcggcgccggcggtgtcggcggacccgccgggttg CRISPR spacer
ggttggcggcaccggcggtgtcggcggagccggtgacatc Protospacer
*..******.***************** *** .*. *
1054. spacer 15.5|3741030|34|CP025603|CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 11, identity: 0.676
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
cgcccccggcgtgacggtggaggtggcgccggcc Protospacer
...*. **.********.************
1055. spacer 16.3|3948555|36|CP025603|CRT matches to MT498048 (Mycobacterium phage Raymond7, complete genome) position: , mismatch: 11, identity: 0.694
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
cgctggcggggccggcggtagcggtggcgcgtcacc Protospacer
*. .********************.** ** ..
1056. spacer 16.3|3948555|36|CP025603|CRT matches to KF986246 (Mycobacterium phage MichelleMyBell, complete genome) position: , mismatch: 11, identity: 0.694
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
cgctggcggggccggcggtagcggtggcgcgtcacc Protospacer
*. .********************.** ** ..
1057. spacer 16.5|3948699|33|CP025603|CRT matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 11, identity: 0.667
caaaggcggcaccggcggggccggcgacgactc CRISPR spacer
gcccggccgcaccggcggtgccggcgaccgagg Protospacer
*** ********** ********* .
1058. spacer 16.17|3949755|36|CP025603|CRT matches to MT498048 (Mycobacterium phage Raymond7, complete genome) position: , mismatch: 11, identity: 0.694
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
cgctggcggggccggcggtagcggtggcgcgtcacc Protospacer
*. .********************.** ** ..
1059. spacer 16.17|3949755|36|CP025603|CRT matches to KF986246 (Mycobacterium phage MichelleMyBell, complete genome) position: , mismatch: 11, identity: 0.694
cagcggcggggccggcggtagcggcggggccaactt CRISPR spacer
cgctggcggggccggcggtagcggtggcgcgtcacc Protospacer
*. .********************.** ** ..
1060. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 12, identity: 0.647
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
aaccggcggcgacggcgtcgccggcgccaattcg Protospacer
..********.****** ******** . ...
1061. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_CP026703 (Serratia marcescens strain AR_0027 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 12, identity: 0.647
ggccggcggcaacggcggcgc-----cggcgggtggcta CRISPR spacer
-gccggaaacgccggcgccgctgttgcggccggtg---- Protospacer
***** ..*. ***** *** **** ****
1062. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 14, identity: 0.588
-----ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
acggcggccgccggcgccggcgtttccgccgaga----- Protospacer
***** ****. ***** . *** **.*
1063. spacer 8.3|1212062|34|CP025603|CRISPRCasFinder matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 15, identity: 0.559
-----ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
acggcggccgccggcgccgacgtttccgccgaga----- Protospacer
***** ****. **.** . *** **.*