Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP025594 Mycobacterium tuberculosis strain GG-5-10 chromosome, complete genome 6 crisprs csa3,c2c9_V-U4,cas3,DinG,WYL,cas4,DEDDh,cas2,cas1,csm6,csm5gr7,csm4gr5,csm3gr7,csm2gr11,cas10,cas6 15 42 4 0

Results visualization

1. CP025594
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025594_1 335382-335945 Orphan NA
9 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025594_2 338091-338313 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025594_12 3119136-3120491 TypeIII II-B,III-A
18 spacers
cas2,cas1,csm6,csm5gr7,csm4gr5,csm3gr7,csm2gr11,cas10,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025594_13 3121814-3123528 TypeIII II-B,III-A
23 spacers
cas2,cas1,csm6,csm5gr7,csm4gr5,csm3gr7,csm2gr11,cas10,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025594_14 3740623-3741164 Orphan NA
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025594_16 4110586-4110674 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP025594_1 1.7|335793|24|CP025594|CRT 335793-335816 24 CP025594.1 338573-338596 0 1.0
CP025594_1 1.9|335892|33|CP025594|CRT 335892-335924 33 CP025594.1 338654-338686 0 1.0
CP025594_8 8.8|1212334|16|CP025594|CRISPRCasFinder 1212334-1212349 16 CP025594.1 2088550-2088565 0 1.0
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 CP025594.1 338600-338632 1 0.97
CP025594_4 4.1|631263|18|CP025594|CRT 631263-631280 18 CP025594.1 22465-22482 1 0.944
CP025594_4 4.1|631263|18|CP025594|CRT 631263-631280 18 CP025594.1 1412001-1412018 1 0.944
CP025594_4 4.3|631347|18|CP025594|CRT 631347-631364 18 CP025594.1 973213-973230 1 0.944
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 674737-674755 1 0.947
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 1213432-1213450 1 0.947
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 1217574-1217592 1 0.947
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 1217646-1217664 1 0.947
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 1630615-1630633 1 0.947
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 1633441-1633459 1 0.947
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 1990751-1990769 1 0.947
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 2061475-2061493 1 0.947
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 2061922-2061940 1 0.947
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 2062021-2062039 1 0.947
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 2802040-2802058 1 0.947
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 2805568-2805586 1 0.947
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 CP025594.1 623838-623859 1 0.955
CP025594_10 10.2|2088316|18|CP025594|CRT 2088316-2088333 18 CP025594.1 401048-401065 1 0.944
CP025594_10 10.2|2088316|18|CP025594|CRT 2088316-2088333 18 CP025594.1 607384-607401 1 0.944
CP025594_10 10.4|2088406|18|CP025594|CRT 2088406-2088423 18 CP025594.1 3450136-3450153 1 0.944
CP025594_3 3.5|366738|42|CP025594|CRISPRCasFinder 366738-366779 42 CP025594.1 374769-374810 2 0.952
CP025594_3 3.6|366813|33|CP025594|CRISPRCasFinder 366813-366845 33 CP025594.1 373584-373616 2 0.939
CP025594_6 6.17|927367|36|CP025594|CRT 927367-927402 36 CP025594.1 675056-675091 2 0.944
CP025594_6 6.17|927367|36|CP025594|CRT 927367-927402 36 CP025594.1 1213705-1213740 2 0.944
CP025594_6 6.17|927367|36|CP025594|CRT 927367-927402 36 CP025594.1 2423710-2423745 2 0.944
CP025594_8 8.7|1212289|22|CP025594|CRISPRCasFinder 1212289-1212310 22 CP025594.1 2960488-2960509 2 0.909
CP025594_8 8.11|1212472|22|CP025594|CRISPRCasFinder 1212472-1212493 22 CP025594.1 837397-837418 2 0.909
CP025594_8 8.11|1212472|22|CP025594|CRISPRCasFinder 1212472-1212493 22 CP025594.1 1217601-1217622 2 0.909
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 150182-150200 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 333761-333779 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 335180-335198 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 337972-337990 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 338368-338386 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 338415-338433 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 338491-338509 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 363022-363040 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 443396-443414 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 546738-546756 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 623946-623964 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 624168-624186 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 673903-673921 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 840180-840198 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 1090954-1090972 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 1091602-1091620 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 1095641-1095659 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 1212961-1212979 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 1213351-1213369 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 1217994-1218012 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 1489127-1489145 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 1618579-1618597 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 1619032-1619050 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 1635954-1635972 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 1635963-1635981 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 1864242-1864260 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 1864770-1864788 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 1990025-1990043 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 2001405-2001423 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 2088745-2088763 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 2303443-2303461 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 2356895-2356913 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 2419571-2419589 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 2423640-2423658 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 2569134-2569152 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 2693449-2693467 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 2795355-2795373 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 2795937-2795955 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 3054545-3054563 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 3054644-3054662 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 3705452-3705470 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 3737411-3737429 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 3738035-3738053 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 3738278-3738296 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 3738411-3738429 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 3802298-3802316 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 3802481-3802499 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 3802649-3802667 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 3930436-3930454 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 3932166-3932184 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 3940673-3940691 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 3948668-3948686 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 4031634-4031652 2 0.895
CP025594_8 8.13|1212589|19|CP025594|CRISPRCasFinder 1212589-1212607 19 CP025594.1 4094169-4094187 2 0.895
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 CP025594.1 37040-37061 2 0.909
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 CP025594.1 132094-132115 2 0.909
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 CP025594.1 2922260-2922281 2 0.909

1. spacer 1.7|335793|24|CP025594|CRT matches to position: 338573-338596, mismatch: 0, identity: 1.0

atgagcccgccggcgccgccgttg	CRISPR spacer
atgagcccgccggcgccgccgttg	Protospacer
************************

2. spacer 1.9|335892|33|CP025594|CRT matches to position: 338654-338686, mismatch: 0, identity: 1.0

attaaccagccgccgtccccgccattggccccg	CRISPR spacer
attaaccagccgccgtccccgccattggccccg	Protospacer
*********************************

3. spacer 8.8|1212334|16|CP025594|CRISPRCasFinder matches to position: 2088550-2088565, mismatch: 0, identity: 1.0

gtggctgtacggcgac	CRISPR spacer
gtggctgtacggcgac	Protospacer
****************

4. spacer 1.8|335838|33|CP025594|CRT matches to position: 338600-338632, mismatch: 1, identity: 0.97

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ccggccccgccgttgacgccggccgcgccggat	Protospacer
***** ***************************

5. spacer 4.1|631263|18|CP025594|CRT matches to position: 22465-22482, mismatch: 1, identity: 0.944

accacgtcggcgacgacg	CRISPR spacer
acgacgtcggcgacgacg	Protospacer
** ***************

6. spacer 4.1|631263|18|CP025594|CRT matches to position: 1412001-1412018, mismatch: 1, identity: 0.944

accacgtcggcgacgacg	CRISPR spacer
acctcgtcggcgacgacg	Protospacer
*** **************

7. spacer 4.3|631347|18|CP025594|CRT matches to position: 973213-973230, mismatch: 1, identity: 0.944

accacgccgccaacgacg	CRISPR spacer
accacgccgcccacgacg	Protospacer
*********** ******

8. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 674737-674755, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggtggggccggtggc	Protospacer
******.************

9. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 1213432-1213450, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccggcggc	Protospacer
***************.***

10. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 1217574-1217592, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccggaggc	Protospacer
*************** ***

11. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 1217646-1217664, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccggcggc	Protospacer
***************.***

12. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 1630615-1630633, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggtggc	Protospacer
********* *********

13. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 1633441-1633459, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccggaggc	Protospacer
*************** ***

14. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 1990751-1990769, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccggcggc	Protospacer
***************.***

15. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 2061475-2061493, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccggcggc	Protospacer
***************.***

16. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 2061922-2061940, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccggcggc	Protospacer
***************.***

17. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 2062021-2062039, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccggcggc	Protospacer
***************.***

18. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 2802040-2802058, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgacggcggggccggtggc	Protospacer
** ****************

19. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 2805568-2805586, mismatch: 1, identity: 0.947

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggcgggtggc	Protospacer
************ ******

20. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to position: 623838-623859, mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgccggcggcgtcggcggtgtc	Protospacer
**.*******************

21. spacer 10.2|2088316|18|CP025594|CRT matches to position: 401048-401065, mismatch: 1, identity: 0.944

gatcagcccgacggcgtt	CRISPR spacer
gatcagcccgtcggcgtt	Protospacer
********** *******

22. spacer 10.2|2088316|18|CP025594|CRT matches to position: 607384-607401, mismatch: 1, identity: 0.944

gatcagcccgacggcgtt	CRISPR spacer
gatcagcccgtcggcgtt	Protospacer
********** *******

23. spacer 10.4|2088406|18|CP025594|CRT matches to position: 3450136-3450153, mismatch: 1, identity: 0.944

gatcagcgtcccgccggt	CRISPR spacer
gatcagcgtcccgctggt	Protospacer
**************.***

24. spacer 3.5|366738|42|CP025594|CRISPRCasFinder matches to position: 374769-374810, mismatch: 2, identity: 0.952

ccggtgcccgagttgaagaacccgatgtttccgctgccggag	CRISPR spacer
ccggtgcccgagttgaacaacccgacgtttccgctgccggag	Protospacer
***************** *******.****************

25. spacer 3.6|366813|33|CP025594|CRISPRCasFinder matches to position: 373584-373616, mismatch: 2, identity: 0.939

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
aggctgccgaacccgatctggccgctgccggtg	Protospacer
********** *************.********

26. spacer 6.17|927367|36|CP025594|CRT matches to position: 675056-675091, mismatch: 2, identity: 0.944

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
gctgatgggcaacggcggcaacggcggggccggcgg	Protospacer
****** ***********.*****************

27. spacer 6.17|927367|36|CP025594|CRT matches to position: 1213705-1213740, mismatch: 2, identity: 0.944

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
gctgatcggcaacggcggccacggcggggccggcgg	Protospacer
******************. ****************

28. spacer 6.17|927367|36|CP025594|CRT matches to position: 2423710-2423745, mismatch: 2, identity: 0.944

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
gctgatcggcaacggcggcaacggcggtgccggcgg	Protospacer
******************.******** ********

29. spacer 8.7|1212289|22|CP025594|CRISPRCasFinder matches to position: 2960488-2960509, mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
tggcgggggtgccggcggtgtc	Protospacer
** *** ***************

30. spacer 8.11|1212472|22|CP025594|CRISPRCasFinder matches to position: 837397-837418, mismatch: 2, identity: 0.909

gctgtggggcggcggtggtgcc	CRISPR spacer
gctgtggggcgccggtggggcc	Protospacer
*********** ****** ***

31. spacer 8.11|1212472|22|CP025594|CRISPRCasFinder matches to position: 1217601-1217622, mismatch: 2, identity: 0.909

gctgtggggcggcggtggtgcc	CRISPR spacer
gctgtggggcgtcggtggcgcc	Protospacer
*********** ******.***

32. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 150182-150200, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcggcggtggc	Protospacer
********* * *******

33. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 333761-333779, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

34. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 335180-335198, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

35. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 337972-337990, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggcgggcggc	Protospacer
************ **.***

36. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 338368-338386, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgacggcggggtcggtggc	Protospacer
** ********.*******

37. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 338415-338433, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcgccgccggtggc	Protospacer
********  *********

38. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 338491-338509, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccgccggc	Protospacer
************** .***

39. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 363022-363040, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccgtcggcgccggtggc	Protospacer
***** *** *********

40. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 443396-443414, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cggcggcggggacggtggc	Protospacer
** ******** *******

41. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 546738-546756, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgacggccgggccggtggc	Protospacer
** **** ***********

42. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 623946-623964, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgacggcggcgccggtggc	Protospacer
** ****** *********

43. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 624168-624186, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggtgccggcggc	Protospacer
********* *****.***

44. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 673903-673921, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

45. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 840180-840198, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggcgggcggc	Protospacer
************ **.***

46. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 1090954-1090972, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

47. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 1091602-1091620, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggaggggccggcggc	Protospacer
****** ********.***

48. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 1095641-1095659, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggtgccggcggc	Protospacer
********* *****.***

49. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 1212961-1212979, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggtggggccggaggc	Protospacer
******.******** ***

50. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 1213351-1213369, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cggcggcggggccggcggc	Protospacer
** ************.***

51. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 1217994-1218012, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

52. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 1489127-1489145, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggtgccggcggc	Protospacer
********* *****.***

53. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 1618579-1618597, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

54. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 1619032-1619050, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggtggagccggtggc	Protospacer
******.**.*********

55. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 1635954-1635972, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggtggcgccggtggc	Protospacer
******.** *********

56. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 1635963-1635981, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgcgggcggcgccggtggc	Protospacer
*** ***** *********

57. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 1864242-1864260, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgctggcggggccggcggc	Protospacer
***.***********.***

58. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 1864770-1864788, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgctggcggggccggcggc	Protospacer
***.***********.***

59. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 1990025-1990043, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

60. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 2001405-2001423, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgtcggcggtgccggtggc	Protospacer
**.****** *********

61. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 2088745-2088763, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgcgggcggggccggcggc	Protospacer
*** ***********.***

62. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 2303443-2303461, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccgtcggc	Protospacer
************** .***

63. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 2356895-2356913, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggccgccggc	Protospacer
************** .***

64. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 2419571-2419589, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggggtcgatggc	Protospacer
***********.**.****

65. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 2423640-2423658, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcgcggccggcggc	Protospacer
******** ******.***

66. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 2569134-2569152, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgcgggcggcgccggtggc	Protospacer
*** ***** *********

67. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 2693449-2693467, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

68. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 2795355-2795373, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgcaggcggtgccggtggc	Protospacer
*** ***** *********

69. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 2795937-2795955, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcgggaccggcggc	Protospacer
**********.****.***

70. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 3054545-3054563, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgcgggcggggccggcggc	Protospacer
*** ***********.***

71. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 3054644-3054662, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggtgccggcggc	Protospacer
********* *****.***

72. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 3705452-3705470, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccgtcgggcccggtggc	Protospacer
***** **** ********

73. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 3737411-3737429, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

74. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 3738035-3738053, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgcaggtggc	Protospacer
********* ** ******

75. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 3738278-3738296, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggtggtgccggtggc	Protospacer
******.** *********

76. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 3738411-3738429, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcgcggccggcggc	Protospacer
******** ******.***

77. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 3802298-3802316, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgacggcggggccggcggc	Protospacer
** ************.***

78. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 3802481-3802499, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgcgggcggcgccggtggc	Protospacer
*** ***** *********

79. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 3802649-3802667, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggtgccggcggc	Protospacer
********* *****.***

80. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 3930436-3930454, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccagcggggccggcggc	Protospacer
****.**********.***

81. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 3932166-3932184, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgctggcggggccggcggc	Protospacer
***.***********.***

82. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 3940673-3940691, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcgggcacggtggc	Protospacer
**********  *******

83. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 3948668-3948686, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcgggaccggcggc	Protospacer
**********.****.***

84. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 4031634-4031652, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggtgccggcggc	Protospacer
********* *****.***

85. spacer 8.13|1212589|19|CP025594|CRISPRCasFinder matches to position: 4094169-4094187, mismatch: 2, identity: 0.895

cgccggcggggccggtggc	CRISPR spacer
cgccggcggcgccggcggc	Protospacer
********* *****.***

86. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to position: 37040-37061, mismatch: 2, identity: 0.909

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcggccgcggtgtc	Protospacer
*********** * ********

87. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to position: 132094-132115, mismatch: 2, identity: 0.909

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcatgggcggtgtc	Protospacer
**********.* *********

88. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to position: 2922260-2922281, mismatch: 2, identity: 0.909

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgccggcggcgtc	Protospacer
***********.******.***

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 MN369739 Mycobacterium phage Kenuha5, complete genome 19928-19949 0 1.0
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 MK359343 Mycobacterium phage Pollywog, complete genome 21007-21028 0 1.0
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 MG925354 Mycobacterium phage Ogopogo, complete genome 20062-20083 0 1.0
CP025594_8 8.7|1212289|22|CP025594|CRISPRCasFinder 1212289-1212310 22 NZ_CP013855 Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence 136890-136911 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 416474-416495 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 390612-390633 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 278335-278356 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 393915-393936 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 454191-454212 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 278384-278405 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 46005-46026 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 303540-303561 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 278344-278365 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 396001-396022 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1389176-1389197 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 395176-395197 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 406649-406670 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 391952-391973 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 288051-288072 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 391041-391062 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 407896-407917 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 392179-392200 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 395194-395215 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 407896-407917 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 407895-407916 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 454218-454239 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 301210-301231 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 407896-407917 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 407896-407917 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 407896-407917 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 406631-406652 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 406589-406610 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 398795-398816 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 398407-398428 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 407896-407917 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 407891-407912 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 407896-407917 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 407896-407917 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 407896-407917 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 MT522000 Mycobacterium phage Soul22, complete genome 19553-19574 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NC_042030 Mycobacterium phage Yoshi, complete sequence 19554-19575 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NC_048729 Mycobacterium phage Renaud18, complete genome 20226-20247 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NC_026585 Mycobacteriophage Estave1, complete genome 19919-19940 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 DQ398049 Mycobacterium phage Pipefish, complete genome 12255-12276 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 MH077585 Mycobacterium phage TChen, complete genome 20330-20351 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NC_048788 Mycobacterium phage ThetaBob, complete genome 20144-20165 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 234037-234058 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 1717083-1717104 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NC_014753 Oceanithermus profundus DSM 14977 plasmid pOCEPR01, complete sequence 39925-39946 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NC_021056 Streptomyces sp. PAMC 26508 plasmid pSP01, complete sequence 29437-29458 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NZ_LR134465 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence 402457-402478 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1717218-1717239 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1597522-1597543 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 1716747-1716768 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 687815-687836 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 1716693-1716714 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 1709586-1709607 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 1648874-1648895 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 1702711-1702732 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 1684773-1684794 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 1684773-1684794 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 MN369761 Mycobacterium phage Malthus, complete genome 23155-23176 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 KJ944841 Mycobacterium phage Cheetobro, complete genome 23239-23260 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 AP018469 Mycobacterium phage Y10 DNA, complete genome, note: sample1 23231-23252 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 KY087992 Mycobacterium phage Mitti, complete genome 23155-23176 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 MF140402 Mycobacterium phage Chancellor, complete genome 23242-23263 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 AP018470 Mycobacterium phage Y2 DNA, complete genome 23231-23252 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 KT361920 Mycobacterium phage Slarp, complete genome 23242-23263 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 MH926058 Mycobacterium phage Reptar3000, complete genome 22972-22993 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 MT310882 Mycobacterium phage JF1, complete genome 23231-23252 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 AP018471 Mycobacterium phage Y10 DNA, complete genome, note: sample2 23231-23252 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 MF140435 Mycobacterium phage Wintermute, complete genome 23231-23252 1 0.955
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NC_027365 Mycobacterium virus Fionnbarth, complete genome 23232-23253 1 0.955
CP025594_9 9.4|1572320|22|CP025594|CRISPRCasFinder 1572320-1572341 22 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1975819-1975840 1 0.955
CP025594_9 9.4|1572320|22|CP025594|CRISPRCasFinder 1572320-1572341 22 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1109892-1109913 1 0.955
CP025594_9 9.4|1572320|22|CP025594|CRISPRCasFinder 1572320-1572341 22 NZ_CP016457 Sphingobium sp. RAC03 plasmid pBSY17_2, complete sequence 87869-87890 1 0.955
CP025594_9 9.15|1573139|22|CP025594|CRISPRCasFinder 1573139-1573160 22 NZ_CP054617 Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence 362668-362689 1 0.955
CP025594_9 9.15|1573139|22|CP025594|CRISPRCasFinder 1573139-1573160 22 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2289382-2289403 1 0.955
CP025594_9 9.15|1573139|22|CP025594|CRISPRCasFinder 1573139-1573160 22 NZ_CP020899 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence 81656-81677 1 0.955
CP025594_9 9.15|1573139|22|CP025594|CRISPRCasFinder 1573139-1573160 22 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 56160-56181 1 0.955
CP025594_1 1.7|335793|24|CP025594|CRT 335793-335816 24 NC_011368 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence 297225-297248 2 0.917
CP025594_1 1.7|335793|24|CP025594|CRT 335793-335816 24 NZ_CP025513 Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence 1001256-1001279 2 0.917
CP025594_8 8.7|1212289|22|CP025594|CRISPRCasFinder 1212289-1212310 22 NZ_CP049249 Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence 794580-794601 2 0.909
CP025594_8 8.7|1212289|22|CP025594|CRISPRCasFinder 1212289-1212310 22 NC_015314 Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence 75477-75498 2 0.909
CP025594_8 8.7|1212289|22|CP025594|CRISPRCasFinder 1212289-1212310 22 NZ_CP030772 Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence 713470-713491 2 0.909
CP025594_8 8.7|1212289|22|CP025594|CRISPRCasFinder 1212289-1212310 22 NC_021056 Streptomyces sp. PAMC 26508 plasmid pSP01, complete sequence 29437-29458 2 0.909
CP025594_8 8.7|1212289|22|CP025594|CRISPRCasFinder 1212289-1212310 22 NZ_CP045122 Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence 56975-56996 2 0.909
CP025594_8 8.7|1212289|22|CP025594|CRISPRCasFinder 1212289-1212310 22 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 458462-458483 2 0.909
CP025594_8 8.7|1212289|22|CP025594|CRISPRCasFinder 1212289-1212310 22 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1354617-1354638 2 0.909
CP025594_8 8.7|1212289|22|CP025594|CRISPRCasFinder 1212289-1212310 22 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 881389-881410 2 0.909
CP025594_8 8.7|1212289|22|CP025594|CRISPRCasFinder 1212289-1212310 22 NC_047977 Microbacterium phage Hendrix, complete genome 3065-3086 2 0.909
CP025594_8 8.15|1212673|22|CP025594|CRISPRCasFinder 1212673-1212694 22 NZ_CP017077 Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence 917429-917450 2 0.909
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NZ_CP010410 Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence 228896-228917 2 0.909
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NC_008271 Rhodococcus jostii RHA1 plasmid pRHL3, complete sequence 300498-300519 2 0.909
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NZ_CP029830 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence 26788-26809 2 0.909
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NZ_CP029357 Azospirillum sp. CFH 70021 plasmid unnamed2 317913-317934 2 0.909
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 126254-126275 2 0.909
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 924997-925018 2 0.909
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NC_041989 Mycobacterium phage Shauna1, complete genome 19840-19861 2 0.909
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 MT889380 Mycobacterium phage Coco12, complete genome 20185-20206 2 0.909
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 KY702574 Mycobacterium phage Kingsley, complete genome 19643-19664 2 0.909
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 MT114167 Mycobacterium phage Phanphagia, complete genome 19840-19861 2 0.909
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 1322901-1322922 2 0.909
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NZ_CP015530 Rhodococcus sp. WB1 plasmid pWB1, complete sequence 35802-35823 2 0.909
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 1512534-1512555 2 0.909
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NZ_CP016560 Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence 581887-581908 2 0.909
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NZ_CP034156 Rhodococcus sp. NJ-530 plasmid unnamed4, complete sequence 323191-323212 2 0.909
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 MF541410 Streptomyces phage Ozzie, complete genome 44361-44382 2 0.909
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 MF541403 Streptomyces phage BeardedLady, complete genome 44355-44376 2 0.909
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 NC_028892 Streptomyces phage Caliburn, complete genome 44361-44382 2 0.909
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 MF541409 Streptomyces phage Oliynyk, complete genome 44470-44491 2 0.909
CP025594_8 8.17|1212763|22|CP025594|CRISPRCasFinder 1212763-1212784 22 KT124229 Streptomyces phage Hydra, complete genome 45163-45184 2 0.909
CP025594_9 9.2|1572212|22|CP025594|CRISPRCasFinder 1572212-1572233 22 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 881140-881161 2 0.909
CP025594_9 9.2|1572212|22|CP025594|CRISPRCasFinder 1572212-1572233 22 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 225972-225993 2 0.909
CP025594_9 9.2|1572212|22|CP025594|CRISPRCasFinder 1572212-1572233 22 NZ_CP032341 Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence 451168-451189 2 0.909
CP025594_9 9.2|1572212|22|CP025594|CRISPRCasFinder 1572212-1572233 22 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 234992-235013 2 0.909
CP025594_9 9.2|1572212|22|CP025594|CRISPRCasFinder 1572212-1572233 22 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 597449-597470 2 0.909
CP025594_9 9.3|1572266|22|CP025594|CRISPRCasFinder 1572266-1572287 22 NZ_CP025510 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvD, complete sequence 117076-117097 2 0.909
CP025594_9 9.4|1572320|22|CP025594|CRISPRCasFinder 1572320-1572341 22 NZ_CP021032 Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence 448838-448859 2 0.909
CP025594_9 9.4|1572320|22|CP025594|CRISPRCasFinder 1572320-1572341 22 NC_007765 Rhizobium etli CFN 42 plasmid p42e, complete sequence 160471-160492 2 0.909
CP025594_9 9.4|1572320|22|CP025594|CRISPRCasFinder 1572320-1572341 22 NZ_CP021028 Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence 175264-175285 2 0.909
CP025594_9 9.4|1572320|22|CP025594|CRISPRCasFinder 1572320-1572341 22 NZ_CP013634 Rhizobium sp. N324 plasmid pRspN324d, complete sequence 457593-457614 2 0.909
CP025594_9 9.4|1572320|22|CP025594|CRISPRCasFinder 1572320-1572341 22 NZ_CP013503 Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence 166709-166730 2 0.909
CP025594_9 9.4|1572320|22|CP025594|CRISPRCasFinder 1572320-1572341 22 NZ_CP013509 Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence 166709-166730 2 0.909
CP025594_9 9.4|1572320|22|CP025594|CRISPRCasFinder 1572320-1572341 22 NZ_CP013520 Rhizobium sp. N113 plasmid pRspN113c, complete sequence 166709-166730 2 0.909
CP025594_9 9.4|1572320|22|CP025594|CRISPRCasFinder 1572320-1572341 22 NZ_CP013493 Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence 166709-166730 2 0.909
CP025594_9 9.4|1572320|22|CP025594|CRISPRCasFinder 1572320-1572341 22 NZ_CP013516 Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence 164465-164486 2 0.909
CP025594_9 9.4|1572320|22|CP025594|CRISPRCasFinder 1572320-1572341 22 NZ_CP054616 Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence 97458-97479 2 0.909
CP025594_9 9.4|1572320|22|CP025594|CRISPRCasFinder 1572320-1572341 22 NZ_CP012698 Microbacterium sp. No. 7 plasmid A, complete sequence 53118-53139 2 0.909
CP025594_9 9.4|1572320|22|CP025594|CRISPRCasFinder 1572320-1572341 22 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 100830-100851 2 0.909
CP025594_9 9.4|1572320|22|CP025594|CRISPRCasFinder 1572320-1572341 22 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 307854-307875 2 0.909
CP025594_9 9.4|1572320|22|CP025594|CRISPRCasFinder 1572320-1572341 22 NZ_CP032325 Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence 23841-23862 2 0.909
CP025594_9 9.4|1572320|22|CP025594|CRISPRCasFinder 1572320-1572341 22 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 279961-279982 2 0.909
CP025594_9 9.4|1572320|22|CP025594|CRISPRCasFinder 1572320-1572341 22 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 359201-359222 2 0.909
CP025594_9 9.4|1572320|22|CP025594|CRISPRCasFinder 1572320-1572341 22 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 606826-606847 2 0.909
CP025594_9 9.4|1572320|22|CP025594|CRISPRCasFinder 1572320-1572341 22 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 411558-411579 2 0.909
CP025594_9 9.4|1572320|22|CP025594|CRISPRCasFinder 1572320-1572341 22 NZ_CP054029 Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence 300111-300132 2 0.909
CP025594_9 9.4|1572320|22|CP025594|CRISPRCasFinder 1572320-1572341 22 NZ_CP032342 Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence 483830-483851 2 0.909
CP025594_9 9.4|1572320|22|CP025594|CRISPRCasFinder 1572320-1572341 22 NZ_CP024312 Rhizobium sp. NXC24 plasmid pRspNXC24a, complete sequence 68146-68167 2 0.909
CP025594_9 9.4|1572320|22|CP025594|CRISPRCasFinder 1572320-1572341 22 CP042595 Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence 175112-175133 2 0.909
CP025594_9 9.4|1572320|22|CP025594|CRISPRCasFinder 1572320-1572341 22 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 314082-314103 2 0.909
CP025594_9 9.5|1572374|25|CP025594|CRISPRCasFinder 1572374-1572398 25 NZ_CP032342 Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence 402883-402907 2 0.92
CP025594_9 9.5|1572374|25|CP025594|CRISPRCasFinder 1572374-1572398 25 NZ_CP033321 Azospirillum brasilense strain Cd plasmid p3, complete sequence 416172-416196 2 0.92
CP025594_9 9.5|1572374|25|CP025594|CRISPRCasFinder 1572374-1572398 25 NZ_CP033315 Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence 472935-472959 2 0.92
CP025594_1 1.7|335793|24|CP025594|CRT 335793-335816 24 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2294259-2294282 3 0.875
CP025594_1 1.7|335793|24|CP025594|CRT 335793-335816 24 MN010758 Gordonia phage Dardanus, complete genome 17671-17694 3 0.875
CP025594_1 1.7|335793|24|CP025594|CRT 335793-335816 24 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1150737-1150760 3 0.875
CP025594_1 1.7|335793|24|CP025594|CRT 335793-335816 24 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 1078865-1078888 3 0.875
CP025594_1 1.7|335793|24|CP025594|CRT 335793-335816 24 NZ_CP044330 Methylocystis rosea strain BRCS1 plasmid unnamed2, complete sequence 185601-185624 3 0.875
CP025594_1 1.7|335793|24|CP025594|CRT 335793-335816 24 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 986912-986935 3 0.875
CP025594_1 1.7|335793|24|CP025594|CRT 335793-335816 24 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 1156661-1156684 3 0.875
CP025594_1 1.7|335793|24|CP025594|CRT 335793-335816 24 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 1153402-1153425 3 0.875
CP025594_1 1.7|335793|24|CP025594|CRT 335793-335816 24 MT740732 Ralstonia phage Darius, complete genome 41818-41841 3 0.875
CP025594_1 1.7|335793|24|CP025594|CRT 335793-335816 24 MH638294 Ralstonia phage GP4, complete genome 1904-1927 3 0.875
CP025594_1 1.7|335793|24|CP025594|CRT 335793-335816 24 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 836023-836046 3 0.875
CP025594_1 1.7|335793|24|CP025594|CRT 335793-335816 24 NZ_CP025550 Mycobacterium paragordonae strain 49061 plasmid unnamed4, complete sequence 12981-13004 3 0.875
CP025594_1 1.7|335793|24|CP025594|CRT 335793-335816 24 NZ_CP034088 Methylocystis rosea strain GW6 plasmid pGW6_2, complete sequence 207718-207741 3 0.875
CP025594_1 1.7|335793|24|CP025594|CRT 335793-335816 24 MT740740 Ralstonia phage Gervaise, complete genome 7571-7594 3 0.875
CP025594_6 6.16|927325|24|CP025594|CRT 927325-927348 24 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4024254-4024277 3 0.875
CP025594_6 6.16|927325|24|CP025594|CRT 927325-927348 24 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4460576-4460599 3 0.875
CP025594_6 6.16|927325|24|CP025594|CRT 927325-927348 24 NZ_CP034768 Enterobacter sp. N18-03635 plasmid pFRI-6, complete sequence 122201-122224 3 0.875
CP025594_6 6.16|927325|24|CP025594|CRT 927325-927348 24 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 37773-37796 3 0.875
CP025594_6 6.16|927325|24|CP025594|CRT 927325-927348 24 NZ_AP019631 Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence 116652-116675 3 0.875
CP025594_6 6.16|927325|24|CP025594|CRT 927325-927348 24 NZ_AP019631 Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence 72348-72371 3 0.875
CP025594_6 6.16|927325|24|CP025594|CRT 927325-927348 24 KU716094 Mycobacterium phage Eidsmoe, complete genome 5649-5672 3 0.875
CP025594_6 6.16|927325|24|CP025594|CRT 927325-927348 24 MH371122 Mycobacterium phage Priya, complete genome 5650-5673 3 0.875
CP025594_6 6.16|927325|24|CP025594|CRT 927325-927348 24 MK016502 Mycobacterium phage Pat3, complete genome 22827-22850 3 0.875
CP025594_6 6.16|927325|24|CP025594|CRT 927325-927348 24 MK937593 Mycobacterium phage Flypotenuse, complete genome 23717-23740 3 0.875
CP025594_6 6.16|927325|24|CP025594|CRT 927325-927348 24 MG872835 Mycobacterium phage Conquerage, complete genome 5649-5672 3 0.875
CP025594_6 6.16|927325|24|CP025594|CRT 927325-927348 24 MH536820 Mycobacterium phage Glexan, complete genome 23717-23740 3 0.875
CP025594_6 6.16|927325|24|CP025594|CRT 927325-927348 24 NC_010510 Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence 91001-91024 3 0.875
CP025594_6 6.16|927325|24|CP025594|CRT 927325-927348 24 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 44795-44818 3 0.875
CP025594_6 6.16|927325|24|CP025594|CRT 927325-927348 24 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1701753-1701776 3 0.875
CP025594_6 6.16|927325|24|CP025594|CRT 927325-927348 24 MH271298 Microbacterium phage Floof, complete genome 37939-37962 3 0.875
CP025594_8 8.4|1212127|25|CP025594|CRISPRCasFinder 1212127-1212151 25 MN703413 Arthrobacter phage Powerpuff, complete genome 38834-38858 3 0.88
CP025594_8 8.4|1212127|25|CP025594|CRISPRCasFinder 1212127-1212151 25 MT024871 Arthrobacter phage YesChef, complete genome 37693-37717 3 0.88
CP025594_8 8.7|1212289|22|CP025594|CRISPRCasFinder 1212289-1212310 22 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 355111-355132 3 0.864
CP025594_8 8.7|1212289|22|CP025594|CRISPRCasFinder 1212289-1212310 22 NZ_CP040721 Rhodococcus pyridinivorans strain YF3 plasmid unnamed2, complete sequence 58695-58716 3 0.864
CP025594_8 8.7|1212289|22|CP025594|CRISPRCasFinder 1212289-1212310 22 NZ_CP040721 Rhodococcus pyridinivorans strain YF3 plasmid unnamed2, complete sequence 90623-90644 3 0.864
CP025594_8 8.7|1212289|22|CP025594|CRISPRCasFinder 1212289-1212310 22 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1457966-1457987 3 0.864
CP025594_8 8.7|1212289|22|CP025594|CRISPRCasFinder 1212289-1212310 22 NZ_CP021082 Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence 422944-422965 3 0.864
CP025594_8 8.7|1212289|22|CP025594|CRISPRCasFinder 1212289-1212310 22 KT381864 Thiobacimonas phage vB_ThpS-P1, complete genome 3900-3921 3 0.864
CP025594_8 8.11|1212472|22|CP025594|CRISPRCasFinder 1212472-1212493 22 NZ_CP048287 Paenibacillus sp. 14171R-81 plasmid unnamed1, complete sequence 4076-4097 3 0.864
CP025594_9 9.4|1572320|22|CP025594|CRISPRCasFinder 1572320-1572341 22 NZ_KY349138 Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence 9264-9285 3 0.864
CP025594_9 9.4|1572320|22|CP025594|CRISPRCasFinder 1572320-1572341 22 NZ_CP021649 Acidovorax sp. T1 plasmid p1-T1, complete sequence 13233-13254 3 0.864
CP025594_9 9.5|1572374|25|CP025594|CRISPRCasFinder 1572374-1572398 25 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 937294-937318 3 0.88
CP025594_9 9.5|1572374|25|CP025594|CRISPRCasFinder 1572374-1572398 25 NZ_CP022999 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence 1470762-1470786 3 0.88
CP025594_9 9.5|1572374|25|CP025594|CRISPRCasFinder 1572374-1572398 25 MN586053 Arthrobacter phage BeatusComedenti, complete genome 26689-26713 3 0.88
CP025594_9 9.5|1572374|25|CP025594|CRISPRCasFinder 1572374-1572398 25 NC_031254 Arthrobacter phage Kitkat, complete genome 26809-26833 3 0.88
CP025594_9 9.5|1572374|25|CP025594|CRISPRCasFinder 1572374-1572398 25 NC_031231 Arthrobacter phage KellEzio, complete genome 26691-26715 3 0.88
CP025594_9 9.5|1572374|25|CP025594|CRISPRCasFinder 1572374-1572398 25 NC_021289 Burkholderia insecticola plasmid p1, complete sequence 633177-633201 3 0.88
CP025594_9 9.5|1572374|25|CP025594|CRISPRCasFinder 1572374-1572398 25 NZ_CP030129 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed3, complete sequence 74124-74148 3 0.88
CP025594_9 9.15|1573139|22|CP025594|CRISPRCasFinder 1573139-1573160 22 NC_008270 Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence 380879-380900 3 0.864
CP025594_10 10.5|2088445|24|CP025594|CRT 2088445-2088468 24 NZ_CP049158 Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence 1555522-1555545 3 0.875
CP025594_10 10.5|2088445|24|CP025594|CRT 2088445-2088468 24 NZ_CP049318 Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence 1560190-1560213 3 0.875
CP025594_1 1.7|335793|24|CP025594|CRT 335793-335816 24 NZ_CP021813 Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence 1018619-1018642 4 0.833
CP025594_1 1.7|335793|24|CP025594|CRT 335793-335816 24 NZ_CP040937 Hymenobacter sp. DG01 plasmid unnamed, complete sequence 138246-138269 4 0.833
CP025594_3 3.1|366483|27|CP025594|CRISPRCasFinder 366483-366509 27 NC_023591 Mycobacterium phage Adler, complete genome 61249-61275 4 0.852
CP025594_3 3.1|366483|27|CP025594|CRISPRCasFinder 366483-366509 27 KF981876 UNVERIFIED: Mycobacterium phage ADLER F1725, complete genome 61247-61273 4 0.852
CP025594_3 3.7|366879|27|CP025594|CRISPRCasFinder 366879-366905 27 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 10066-10092 4 0.852
CP025594_3 3.10|367089|27|CP025594|CRISPRCasFinder 367089-367115 27 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 460464-460490 4 0.852
CP025594_3 3.10|367089|27|CP025594|CRISPRCasFinder 367089-367115 27 NC_016652 Rhodococcus phage REQ2, complete genome 36035-36061 4 0.852
CP025594_4 4.2|631299|30|CP025594|CRT 631299-631328 30 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 603744-603773 4 0.867
CP025594_6 6.6|926884|27|CP025594|CRT 926884-926910 27 NZ_CP010326 Pantoea sp. PSNIH1 plasmid pPSP-3a9, complete sequence 242875-242901 4 0.852
CP025594_6 6.6|926884|27|CP025594|CRT 926884-926910 27 NZ_CP021045 Phaeobacter gallaeciensis strain P129 plasmid pP129_e, complete sequence 30409-30435 4 0.852
CP025594_6 6.6|926884|27|CP025594|CRT 926884-926910 27 NZ_CP010678 Phaeobacter gallaeciensis strain P75 plasmid pP75_e, complete sequence 30478-30504 4 0.852
CP025594_6 6.6|926884|27|CP025594|CRT 926884-926910 27 NC_023142 Phaeobacter gallaeciensis DSM 26640 plasmid pGal_F69, complete sequence 30507-30533 4 0.852
CP025594_6 6.6|926884|27|CP025594|CRT 926884-926910 27 NZ_CP010789 Phaeobacter gallaeciensis strain P63 plasmid pP63_e, complete sequence 30472-30498 4 0.852
CP025594_6 6.6|926884|27|CP025594|CRT 926884-926910 27 NZ_CP010642 Phaeobacter gallaeciensis strain P73 plasmid pP73_f, complete sequence 30478-30504 4 0.852
CP025594_6 6.6|926884|27|CP025594|CRT 926884-926910 27 NZ_CP010593 Phaeobacter gallaeciensis strain P11 plasmid pP11_e, complete sequence 30504-30530 4 0.852
CP025594_6 6.6|926884|27|CP025594|CRT 926884-926910 27 AM419438 Archaeal BJ1 virus complete genome 36975-37001 4 0.852
CP025594_6 6.6|926884|27|CP025594|CRT 926884-926910 27 NC_008695 Archaeal BJ1 virus, complete genome 36975-37001 4 0.852
CP025594_6 6.10|927040|27|CP025594|CRT 927040-927066 27 KY945355 Mycobacterium phage Shandong1, complete genome 25634-25660 4 0.852
CP025594_6 6.10|927040|27|CP025594|CRT 927040-927066 27 NZ_CP015095 Pelagibaca abyssi strain JLT2014 plasmid pPABY4, complete sequence 106725-106751 4 0.852
CP025594_6 6.10|927040|27|CP025594|CRT 927040-927066 27 NC_041888 Mycobacterium phage Tortellini, complete genome 37216-37242 4 0.852
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 1096460-1096489 4 0.867
CP025594_6 6.16|927325|24|CP025594|CRT 927325-927348 24 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1898211-1898234 4 0.833
CP025594_6 6.16|927325|24|CP025594|CRT 927325-927348 24 NZ_CP025431 Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence 261506-261529 4 0.833
CP025594_6 6.16|927325|24|CP025594|CRT 927325-927348 24 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 673134-673157 4 0.833
CP025594_6 6.16|927325|24|CP025594|CRT 927325-927348 24 NZ_CP016822 Rhodococcus sp. p52 plasmid pDF03, complete sequence 60076-60099 4 0.833
CP025594_6 6.16|927325|24|CP025594|CRT 927325-927348 24 MN582086 Siphoviridae sp. ctdEk19, complete genome 33324-33347 4 0.833
CP025594_6 6.16|927325|24|CP025594|CRT 927325-927348 24 MF919502 Mycobacterium phage Demsculpinboyz, complete genome 21980-22003 4 0.833
CP025594_6 6.16|927325|24|CP025594|CRT 927325-927348 24 MT889380 Mycobacterium phage Coco12, complete genome 22623-22646 4 0.833
CP025594_6 6.16|927325|24|CP025594|CRT 927325-927348 24 NC_023698 Mycobacterium phage Avani, complete genome 21987-22010 4 0.833
CP025594_6 6.16|927325|24|CP025594|CRT 927325-927348 24 MT114167 Mycobacterium phage Phanphagia, complete genome 22278-22301 4 0.833
CP025594_6 6.16|927325|24|CP025594|CRT 927325-927348 24 NZ_CP050953 Rhodococcus sp. DMU1 plasmid unnamed 558871-558894 4 0.833
CP025594_6 6.16|927325|24|CP025594|CRT 927325-927348 24 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 1500559-1500582 4 0.833
CP025594_6 6.16|927325|24|CP025594|CRT 927325-927348 24 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 295932-295955 4 0.833
CP025594_6 6.16|927325|24|CP025594|CRT 927325-927348 24 NC_015583 Novosphingobium sp. PP1Y plasmid Mpl, complete sequence 1116335-1116358 4 0.833
CP025594_6 6.16|927325|24|CP025594|CRT 927325-927348 24 MN096355 Mycobacterium phage Purky, complete genome 48975-48998 4 0.833
CP025594_6 6.16|927325|24|CP025594|CRT 927325-927348 24 MK279853 Gordonia phage Gray, complete genome 68404-68427 4 0.833
CP025594_8 8.4|1212127|25|CP025594|CRISPRCasFinder 1212127-1212151 25 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 9745-9769 4 0.84
CP025594_8 8.4|1212127|25|CP025594|CRISPRCasFinder 1212127-1212151 25 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1906386-1906410 4 0.84
CP025594_8 8.4|1212127|25|CP025594|CRISPRCasFinder 1212127-1212151 25 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 794756-794780 4 0.84
CP025594_8 8.4|1212127|25|CP025594|CRISPRCasFinder 1212127-1212151 25 CP003956 Rhodococcus opacus PD630 plasmid 7, complete sequence 34847-34871 4 0.84
CP025594_8 8.4|1212127|25|CP025594|CRISPRCasFinder 1212127-1212151 25 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 1665271-1665295 4 0.84
CP025594_8 8.4|1212127|25|CP025594|CRISPRCasFinder 1212127-1212151 25 NC_012723 Burkholderia glumae BGR1 plasmid bglu_1p, complete sequence 15832-15856 4 0.84
CP025594_8 8.4|1212127|25|CP025594|CRISPRCasFinder 1212127-1212151 25 NZ_CP032828 Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence 348896-348920 4 0.84
CP025594_8 8.4|1212127|25|CP025594|CRISPRCasFinder 1212127-1212151 25 NZ_CP028348 Novosphingobium sp. THN1 plasmid pTHN, complete sequence 406425-406449 4 0.84
CP025594_8 8.4|1212127|25|CP025594|CRISPRCasFinder 1212127-1212151 25 CP054917 Streptomyces sp. NA02950 plasmid unnamed, complete sequence 26065-26089 4 0.84
CP025594_8 8.4|1212127|25|CP025594|CRISPRCasFinder 1212127-1212151 25 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 450297-450321 4 0.84
CP025594_8 8.4|1212127|25|CP025594|CRISPRCasFinder 1212127-1212151 25 NC_022437 Pseudomonas fluorescens R124 plasmid pMP-R124, complete sequence 16147-16171 4 0.84
CP025594_8 8.4|1212127|25|CP025594|CRISPRCasFinder 1212127-1212151 25 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1382131-1382155 4 0.84
CP025594_8 8.4|1212127|25|CP025594|CRISPRCasFinder 1212127-1212151 25 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 1418915-1418939 4 0.84
CP025594_8 8.4|1212127|25|CP025594|CRISPRCasFinder 1212127-1212151 25 NZ_CP051294 Mesorhizobium sp. NZP2077 plasmid pMSNZP2077A, complete sequence 118938-118962 4 0.84
CP025594_8 8.4|1212127|25|CP025594|CRISPRCasFinder 1212127-1212151 25 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 1711697-1711721 4 0.84
CP025594_8 8.4|1212127|25|CP025594|CRISPRCasFinder 1212127-1212151 25 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 722328-722352 4 0.84
CP025594_8 8.4|1212127|25|CP025594|CRISPRCasFinder 1212127-1212151 25 NZ_CP010858 Marinovum algicola DG 898 plasmid pMaD3 67000-67024 4 0.84
CP025594_8 8.4|1212127|25|CP025594|CRISPRCasFinder 1212127-1212151 25 NZ_CP033363 Mesorhizobium sp. NZP2077 plasmid pMSNZP2077NSa, complete sequence 118938-118962 4 0.84
CP025594_8 8.4|1212127|25|CP025594|CRISPRCasFinder 1212127-1212151 25 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 1149411-1149435 4 0.84
CP025594_8 8.4|1212127|25|CP025594|CRISPRCasFinder 1212127-1212151 25 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 438623-438647 4 0.84
CP025594_8 8.4|1212127|25|CP025594|CRISPRCasFinder 1212127-1212151 25 NZ_CP014580 Burkholderia sp. OLGA172 plasmid pOLGA1, complete sequence 243636-243660 4 0.84
CP025594_8 8.4|1212127|25|CP025594|CRISPRCasFinder 1212127-1212151 25 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 1410063-1410087 4 0.84
CP025594_9 9.1|1572152|28|CP025594|CRISPRCasFinder 1572152-1572179 28 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 818773-818800 4 0.857
CP025594_9 9.1|1572152|28|CP025594|CRISPRCasFinder 1572152-1572179 28 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 420542-420569 4 0.857
CP025594_9 9.1|1572152|28|CP025594|CRISPRCasFinder 1572152-1572179 28 NZ_CP016560 Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence 77799-77826 4 0.857
CP025594_9 9.5|1572374|25|CP025594|CRISPRCasFinder 1572374-1572398 25 NZ_CP021372 Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence 176640-176664 4 0.84
CP025594_9 9.5|1572374|25|CP025594|CRISPRCasFinder 1572374-1572398 25 LR134127 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7 29428-29452 4 0.84
CP025594_9 9.5|1572374|25|CP025594|CRISPRCasFinder 1572374-1572398 25 LR134127 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7 38191-38215 4 0.84
CP025594_9 9.5|1572374|25|CP025594|CRISPRCasFinder 1572374-1572398 25 MT553342 Microbacterium phage Kelcole, complete genome 51573-51597 4 0.84
CP025594_9 9.5|1572374|25|CP025594|CRISPRCasFinder 1572374-1572398 25 NC_048068 Microbacterium phage OneinaGillian, complete genome 50894-50918 4 0.84
CP025594_9 9.5|1572374|25|CP025594|CRISPRCasFinder 1572374-1572398 25 MT310894 Microbacterium phage Tempo, complete genome 51697-51721 4 0.84
CP025594_9 9.5|1572374|25|CP025594|CRISPRCasFinder 1572374-1572398 25 NZ_CP047175 Rathayibacter sp. VKM Ac-2760 plasmid unnamed2, complete sequence 42080-42104 4 0.84
CP025594_9 9.5|1572374|25|CP025594|CRISPRCasFinder 1572374-1572398 25 NZ_CP013631 Rhizobium sp. N324 plasmid pRspN324a, complete sequence 67777-67801 4 0.84
CP025594_9 9.5|1572374|25|CP025594|CRISPRCasFinder 1572374-1572398 25 MN034284 Leviviridae sp. isolate H2_Rhizo_Litter_49_scaffold_25938 sequence 624-648 4 0.84
CP025594_9 9.14|1573082|25|CP025594|CRISPRCasFinder 1573082-1573106 25 MN582064 Podoviridae sp. ctka020, complete genome 29274-29298 4 0.84
CP025594_10 10.5|2088445|24|CP025594|CRT 2088445-2088468 24 NZ_CP028348 Novosphingobium sp. THN1 plasmid pTHN, complete sequence 680430-680453 4 0.833
CP025594_10 10.5|2088445|24|CP025594|CRT 2088445-2088468 24 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5913119-5913142 4 0.833
CP025594_10 10.5|2088445|24|CP025594|CRT 2088445-2088468 24 NZ_CP015007 Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence 143186-143209 4 0.833
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 NZ_HG938354 Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence 214915-214947 5 0.848
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 NZ_HG938356 Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence 206654-206686 5 0.848
CP025594_3 3.1|366483|27|CP025594|CRISPRCasFinder 366483-366509 27 LR794124 Vibrio phage vB_Vc_SrVc9 genome assembly, chromosome: 1 34861-34887 5 0.815
CP025594_3 3.1|366483|27|CP025594|CRISPRCasFinder 366483-366509 27 NC_012662 Vibrio phage VP93, complete genome 35301-35327 5 0.815
CP025594_3 3.7|366879|27|CP025594|CRISPRCasFinder 366879-366905 27 NZ_CP016084 Streptomyces sp. SAT1 plasmid unnamed4, complete sequence 2189-2215 5 0.815
CP025594_3 3.7|366879|27|CP025594|CRISPRCasFinder 366879-366905 27 MN693945 Marine virus AFVG_250M952, complete genome 34909-34935 5 0.815
CP025594_3 3.10|367089|27|CP025594|CRISPRCasFinder 367089-367115 27 NZ_CP020899 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence 369429-369455 5 0.815
CP025594_3 3.10|367089|27|CP025594|CRISPRCasFinder 367089-367115 27 NZ_CP013525 Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence 338832-338858 5 0.815
CP025594_3 3.10|367089|27|CP025594|CRISPRCasFinder 367089-367115 27 NZ_CP013554 Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence 363377-363403 5 0.815
CP025594_3 3.10|367089|27|CP025594|CRISPRCasFinder 367089-367115 27 NZ_CP015368 Methylobacterium phyllosphaerae strain CBMB27 plasmid CBMB27-p1, complete sequence 104717-104743 5 0.815
CP025594_3 3.10|367089|27|CP025594|CRISPRCasFinder 367089-367115 27 NZ_CP013588 Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence 338543-338569 5 0.815
CP025594_3 3.10|367089|27|CP025594|CRISPRCasFinder 367089-367115 27 NZ_CP013560 Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence 340811-340837 5 0.815
CP025594_3 3.10|367089|27|CP025594|CRISPRCasFinder 367089-367115 27 NZ_CP013577 Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence 342690-342716 5 0.815
CP025594_3 3.10|367089|27|CP025594|CRISPRCasFinder 367089-367115 27 NZ_CP013549 Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence 343060-343086 5 0.815
CP025594_3 3.10|367089|27|CP025594|CRISPRCasFinder 367089-367115 27 NZ_CP013529 Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence 355714-355740 5 0.815
CP025594_3 3.10|367089|27|CP025594|CRISPRCasFinder 367089-367115 27 NZ_CP013534 Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence 343060-343086 5 0.815
CP025594_3 3.10|367089|27|CP025594|CRISPRCasFinder 367089-367115 27 NZ_CP013539 Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence 348335-348361 5 0.815
CP025594_3 3.10|367089|27|CP025594|CRISPRCasFinder 367089-367115 27 NZ_CP013545 Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence 343052-343078 5 0.815
CP025594_3 3.10|367089|27|CP025594|CRISPRCasFinder 367089-367115 27 NZ_CP020444 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed4, complete sequence 69464-69490 5 0.815
CP025594_3 3.10|367089|27|CP025594|CRISPRCasFinder 367089-367115 27 NZ_CP013565 Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence 363377-363403 5 0.815
CP025594_3 3.10|367089|27|CP025594|CRISPRCasFinder 367089-367115 27 NZ_CP013582 Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence 355714-355740 5 0.815
CP025594_3 3.10|367089|27|CP025594|CRISPRCasFinder 367089-367115 27 NZ_CP013571 Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence 342690-342716 5 0.815
CP025594_3 3.10|367089|27|CP025594|CRISPRCasFinder 367089-367115 27 NZ_CP044078 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence 10340-10366 5 0.815
CP025594_3 3.10|367089|27|CP025594|CRISPRCasFinder 367089-367115 27 NZ_CP031081 Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence 19365-19391 5 0.815
CP025594_3 3.10|367089|27|CP025594|CRISPRCasFinder 367089-367115 27 MN586031 Gordonia phage Gambino, complete genome 3053-3079 5 0.815
CP025594_3 3.10|367089|27|CP025594|CRISPRCasFinder 367089-367115 27 KU998236 Gordonia phage Blueberry, complete genome 3053-3079 5 0.815
CP025594_3 3.10|367089|27|CP025594|CRISPRCasFinder 367089-367115 27 MN062704 Gordonia phage JuJu, complete genome 3063-3089 5 0.815
CP025594_3 3.10|367089|27|CP025594|CRISPRCasFinder 367089-367115 27 MK501729 Gordonia phage Walrus, complete genome 3053-3079 5 0.815
CP025594_3 3.10|367089|27|CP025594|CRISPRCasFinder 367089-367115 27 NC_031226 Gordonia phage BaxterFox, complete genome 2982-3008 5 0.815
CP025594_3 3.10|367089|27|CP025594|CRISPRCasFinder 367089-367115 27 MK967393 Rhodococcus phage Whack, complete genome 3063-3089 5 0.815
CP025594_3 3.10|367089|27|CP025594|CRISPRCasFinder 367089-367115 27 MT723935 Gordonia phage Azula, complete genome 3053-3079 5 0.815
CP025594_3 3.10|367089|27|CP025594|CRISPRCasFinder 367089-367115 27 KU963249 Gordonia phage Yeezy, complete genome 2982-3008 5 0.815
CP025594_3 3.10|367089|27|CP025594|CRISPRCasFinder 367089-367115 27 MH153808 Gordonia phage Petra, complete genome 3053-3079 5 0.815
CP025594_3 3.10|367089|27|CP025594|CRISPRCasFinder 367089-367115 27 MT639650 Gordonia phage Ohgeesy, complete genome 2982-3008 5 0.815
CP025594_3 3.10|367089|27|CP025594|CRISPRCasFinder 367089-367115 27 MH536818 Gordonia phage Frokostdame, complete genome 3055-3081 5 0.815
CP025594_3 3.10|367089|27|CP025594|CRISPRCasFinder 367089-367115 27 KX557275 Gordonia phage CarolAnn, complete genome 3052-3078 5 0.815
CP025594_6 6.6|926884|27|CP025594|CRT 926884-926910 27 CP009871 Pantoea sp. PSNIH2 plasmid pPSP-cd6, complete sequence 29372-29398 5 0.815
CP025594_6 6.6|926884|27|CP025594|CRT 926884-926910 27 NZ_CP030354 Novosphingobium sp. P6W plasmid pP6W1, complete sequence 406756-406782 5 0.815
CP025594_6 6.6|926884|27|CP025594|CRT 926884-926910 27 NZ_CP045223 Achromobacter xylosoxidans strain DN002 plasmid unnamed 110954-110980 5 0.815
CP025594_6 6.6|926884|27|CP025594|CRT 926884-926910 27 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 274700-274726 5 0.815
CP025594_6 6.6|926884|27|CP025594|CRT 926884-926910 27 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 1370465-1370491 5 0.815
CP025594_6 6.6|926884|27|CP025594|CRT 926884-926910 27 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 761910-761936 5 0.815
CP025594_6 6.6|926884|27|CP025594|CRT 926884-926910 27 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1027970-1027996 5 0.815
CP025594_6 6.10|927040|27|CP025594|CRT 927040-927066 27 NZ_CP022264 Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence 1800-1826 5 0.815
CP025594_6 6.10|927040|27|CP025594|CRT 927040-927066 27 NZ_CP022264 Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence 136919-136945 5 0.815
CP025594_6 6.10|927040|27|CP025594|CRT 927040-927066 27 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 658056-658082 5 0.815
CP025594_6 6.10|927040|27|CP025594|CRT 927040-927066 27 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 1514868-1514894 5 0.815
CP025594_6 6.10|927040|27|CP025594|CRT 927040-927066 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5852040-5852066 5 0.815
CP025594_6 6.10|927040|27|CP025594|CRT 927040-927066 27 NZ_CP049908 Hymenobacter sp. HDW8 plasmid p_unnamed1, complete sequence 235006-235032 5 0.815
CP025594_6 6.10|927040|27|CP025594|CRT 927040-927066 27 NZ_CP049700 Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2a, complete sequence 263243-263269 5 0.815
CP025594_6 6.10|927040|27|CP025594|CRT 927040-927066 27 MH576962 Streptomyces phage Satis, complete genome 95306-95332 5 0.815
CP025594_6 6.10|927040|27|CP025594|CRT 927040-927066 27 MK620894 Streptomyces phage Kradal, complete genome 95310-95336 5 0.815
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1068923-1068952 5 0.833
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP024314 Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence 1739900-1739929 5 0.833
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP013631 Rhizobium sp. N324 plasmid pRspN324a, complete sequence 233389-233418 5 0.833
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP031193 Humibacter sp. BT305 plasmid unnamed1 44938-44967 5 0.833
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP050092 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence 137673-137702 5 0.833
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 984252-984281 5 0.833
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1598936-1598965 5 0.833
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP013631 Rhizobium sp. N324 plasmid pRspN324a, complete sequence 233398-233427 5 0.833
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP046705 Nostoc sp. ATCC 53789 plasmid pNsp_b, complete sequence 292905-292934 5 0.833
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 AY950802 Haloarcula phage SH1, complete genome 16104-16133 5 0.833
CP025594_6 6.16|927325|24|CP025594|CRT 927325-927348 24 NC_006911 Streptomyces sp. F11 plasmid pFP11, complete sequence 11649-11672 5 0.792
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 MG925349 Mycobacterium phage Mendokysei, complete genome 21052-21085 5 0.853
CP025594_8 8.4|1212127|25|CP025594|CRISPRCasFinder 1212127-1212151 25 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3841167-3841191 5 0.8
CP025594_8 8.4|1212127|25|CP025594|CRISPRCasFinder 1212127-1212151 25 NC_015178 Acidiphilium multivorum AIU301 plasmid pACMV1, complete sequence 157500-157524 5 0.8
CP025594_8 8.4|1212127|25|CP025594|CRISPRCasFinder 1212127-1212151 25 NZ_CP035002 Rhizobium acidisoli strain FH23 plasmid pRapFH23d, complete sequence 179155-179179 5 0.8
CP025594_8 8.4|1212127|25|CP025594|CRISPRCasFinder 1212127-1212151 25 NC_009469 Acidiphilium cryptum JF-5 plasmid pACRY03, complete sequence 67026-67050 5 0.8
CP025594_9 9.1|1572152|28|CP025594|CRISPRCasFinder 1572152-1572179 28 NZ_LN907828 Erwinia gerundensis isolate E_g_EM595 plasmid pEM01, complete sequence 94483-94510 5 0.821
CP025594_9 9.1|1572152|28|CP025594|CRISPRCasFinder 1572152-1572179 28 KU728633 Mycobacterium phage Bipper, complete genome 41992-42019 5 0.821
CP025594_9 9.1|1572152|28|CP025594|CRISPRCasFinder 1572152-1572179 28 MK977701 Mycobacterium phage Cracklewink, complete genome 41985-42012 5 0.821
CP025594_9 9.1|1572152|28|CP025594|CRISPRCasFinder 1572152-1572179 28 NZ_CP016354 Prauserella marina strain DSM 45268 plasmid pPmarDSM45268, complete sequence 100320-100347 5 0.821
CP025594_9 9.5|1572374|25|CP025594|CRISPRCasFinder 1572374-1572398 25 NZ_CP025013 Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence 614111-614135 5 0.8
CP025594_9 9.5|1572374|25|CP025594|CRISPRCasFinder 1572374-1572398 25 NZ_CP020331 Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence 92705-92729 5 0.8
CP025594_9 9.10|1572767|31|CP025594|CRISPRCasFinder 1572767-1572797 31 NC_018746 Pseudomonas putida ND6 plasmid pND6-2, complete sequence 45440-45470 5 0.839
CP025594_9 9.10|1572767|31|CP025594|CRISPRCasFinder 1572767-1572797 31 MN961671 Pseudomonas aeruginosa strain 201330 plasmid p201330-IMP, complete sequence 123562-123592 5 0.839
CP025594_9 9.10|1572767|31|CP025594|CRISPRCasFinder 1572767-1572797 31 MN961672 Pseudomonas aeruginosa strain PA15W plasmid pPA15W-NR, complete sequence 72551-72581 5 0.839
CP025594_9 9.13|1573016|34|CP025594|CRISPRCasFinder 1573016-1573049 34 NC_006362 Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence 89410-89443 5 0.853
CP025594_14 14.7|3741111|31|CP025594|CRT 3741111-3741141 31 NC_010850 Rhodococcus sp. NS1 plasmid pNSL1, complete sequence 92901-92931 5 0.839
CP025594_1 1.6|335742|30|CP025594|CRT 335742-335771 30 NZ_CP049317 Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence 1092456-1092485 6 0.8
CP025594_1 1.6|335742|30|CP025594|CRT 335742-335771 30 NZ_CP049157 Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence 550210-550239 6 0.8
CP025594_1 1.6|335742|30|CP025594|CRT 335742-335771 30 KC292025 Halovirus HHTV-1, complete genome 36019-36048 6 0.8
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 NC_018022 Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence 449569-449601 6 0.818
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 19750-19782 6 0.818
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 NZ_CP049158 Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence 1238001-1238033 6 0.818
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 NZ_CP049318 Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence 1242682-1242714 6 0.818
CP025594_3 3.1|366483|27|CP025594|CRISPRCasFinder 366483-366509 27 NZ_CP045917 Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence 207335-207361 6 0.778
CP025594_3 3.6|366813|33|CP025594|CRISPRCasFinder 366813-366845 33 NZ_CP010410 Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence 435770-435802 6 0.818
CP025594_3 3.7|366879|27|CP025594|CRISPRCasFinder 366879-366905 27 NZ_CP022542 Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence 32942-32968 6 0.778
CP025594_3 3.9|367029|27|CP025594|CRISPRCasFinder 367029-367055 27 NC_009959 Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI05, complete sequence 50750-50776 6 0.778
CP025594_3 3.10|367089|27|CP025594|CRISPRCasFinder 367089-367115 27 NZ_CP009112 Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence 179708-179734 6 0.778
CP025594_3 3.10|367089|27|CP025594|CRISPRCasFinder 367089-367115 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4846911-4846937 6 0.778
CP025594_3 3.10|367089|27|CP025594|CRISPRCasFinder 367089-367115 27 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 78863-78889 6 0.778
CP025594_3 3.10|367089|27|CP025594|CRISPRCasFinder 367089-367115 27 MK494099 Mycobacterium phage Typha, complete genome 33831-33857 6 0.778
CP025594_4 4.2|631299|30|CP025594|CRT 631299-631328 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1565268-1565297 6 0.8
CP025594_4 4.2|631299|30|CP025594|CRT 631299-631328 30 KX620751 Propionibacterium phage Doucette, complete genome 8876-8905 6 0.8
CP025594_4 4.2|631299|30|CP025594|CRT 631299-631328 30 NC_041891 Propionibacterium phage B22, complete genome 8817-8846 6 0.8
CP025594_4 4.2|631299|30|CP025594|CRT 631299-631328 30 NC_041894 Propionibacterium phage E6, complete genome 8927-8956 6 0.8
CP025594_4 4.2|631299|30|CP025594|CRT 631299-631328 30 KX620754 Propionibacterium phage G4, complete genome 8865-8894 6 0.8
CP025594_4 4.2|631299|30|CP025594|CRT 631299-631328 30 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 575683-575712 6 0.8
CP025594_4 4.2|631299|30|CP025594|CRT 631299-631328 30 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 1829167-1829196 6 0.8
CP025594_4 4.2|631299|30|CP025594|CRT 631299-631328 30 MT818419 Mycobacterium phage Lolalove, complete genome 27446-27475 6 0.8
CP025594_4 4.2|631299|30|CP025594|CRT 631299-631328 30 MN428050 Mycobacterium phage Apex, complete genome 27615-27644 6 0.8
CP025594_4 4.2|631299|30|CP025594|CRT 631299-631328 30 MN234171 Mycobacterium phage Magpie, complete genome 27275-27304 6 0.8
CP025594_4 4.2|631299|30|CP025594|CRT 631299-631328 30 KX589269 Mycobacterium phage Fortunato, complete genome 27431-27460 6 0.8
CP025594_4 4.2|631299|30|CP025594|CRT 631299-631328 30 NC_042035 Mycobacterium phage Zemanar, complete sequence 27435-27464 6 0.8
CP025594_4 4.2|631299|30|CP025594|CRT 631299-631328 30 NC_022331 Mycobacterium phage Bane1, complete genome 27108-27137 6 0.8
CP025594_4 4.2|631299|30|CP025594|CRT 631299-631328 30 KF279413 Mycobacterium phage Bane2, complete genome 27087-27116 6 0.8
CP025594_4 4.2|631299|30|CP025594|CRT 631299-631328 30 MT310870 Mycobacterium phage RawrgerThat, complete genome 27434-27463 6 0.8
CP025594_5 5.1|692011|31|CP025594|CRISPRCasFinder 692011-692041 31 GQ141189 Bifidobacterium phage Bbif-1, complete sequence 38062-38092 6 0.806
CP025594_6 6.6|926884|27|CP025594|CRT 926884-926910 27 NZ_LN907829 Erwinia gerundensis isolate E_g_EM595 plasmid pEM02, complete sequence 65197-65223 6 0.778
CP025594_6 6.6|926884|27|CP025594|CRT 926884-926910 27 NZ_CP041653 Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence 99569-99595 6 0.778
CP025594_6 6.6|926884|27|CP025594|CRT 926884-926910 27 NZ_CP010826 Thermus aquaticus Y51MC23 plasmid pTA78, complete sequence 43689-43715 6 0.778
CP025594_6 6.6|926884|27|CP025594|CRT 926884-926910 27 NZ_CP054620 Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence 122394-122420 6 0.778
CP025594_6 6.10|927040|27|CP025594|CRT 927040-927066 27 NZ_AP021845 Azospira sp. I09 plasmid pAZI09, complete sequence 147990-148016 6 0.778
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP040820 Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence 508-537 6 0.8
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP040820 Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence 280809-280838 6 0.8
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 561652-561681 6 0.8
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP050083 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence 554428-554457 6 0.8
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP049733 Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence 542116-542145 6 0.8
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 610786-610815 6 0.8
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP053207 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence 571170-571199 6 0.8
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 1563589-1563618 6 0.8
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 421135-421164 6 0.8
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1217050-1217079 6 0.8
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1265979-1266008 6 0.8
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1135414-1135443 6 0.8
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP037868 Hydrogenophaga pseudoflava strain DSM 1084 plasmid pDSM1084, complete sequence 5790-5819 6 0.8
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1195134-1195163 6 0.8
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 1134511-1134540 6 0.8
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP023549 Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence 762260-762289 6 0.8
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 1168711-1168740 6 0.8
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 1168700-1168729 6 0.8
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 1135406-1135435 6 0.8
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 1134762-1134791 6 0.8
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 1135397-1135426 6 0.8
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1217165-1217194 6 0.8
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1217149-1217178 6 0.8
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1217142-1217171 6 0.8
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NC_019408 Caulobacter phage CcrRogue, complete genome 180466-180495 6 0.8
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 174181-174210 6 0.8
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP017941 Phyllobacterium zundukense strain Tri-48 plasmid unnamed1, complete sequence 270228-270257 6 0.8
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 MK937608 Microbacterium phage Cressida, complete genome 54022-54051 6 0.8
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP050083 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence 554437-554466 6 0.8
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP049733 Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence 542125-542154 6 0.8
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP017592 Pantoea stewartii subsp. stewartii DC283 plasmid ppDSJ01, complete sequence 7337-7366 6 0.8
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP008898 Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pENT-576, complete sequence 43955-43984 6 0.8
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP023489 Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_02, complete sequence 73653-73682 6 0.8
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP043515 Enterobacter kobei strain EB_P8_L5_01.19 plasmid unnamed4, complete sequence 36331-36360 6 0.8
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP053207 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence 571179-571208 6 0.8
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_LT984809 Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence 317155-317184 6 0.8
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP026371 Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence 116386-116415 6 0.8
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP050069 Klebsiella aerogenes strain 035 plasmid p035_A-VIM-1, complete sequence 79588-79617 6 0.8
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP039425 Citricoccus sp. SGAir0253 plasmid unnamed1, complete sequence 132572-132601 6 0.8
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP009856 UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-784, complete sequence 26128-26157 6 0.8
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP039430 Citricoccus sp. SGAir0453 plasmid unnamed1, complete sequence 132570-132599 6 0.8
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP040937 Hymenobacter sp. DG01 plasmid unnamed, complete sequence 32030-32059 6 0.8
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP024310 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence 14031-14060 6 0.8
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP023064 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence 17715-17744 6 0.8
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP006588 Hymenobacter sp. APR13 plasmid pHA, complete sequence 19031-19060 6 0.8
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1930897-1930926 6 0.8
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_AP022333 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence 190353-190382 6 0.8
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 MH029534 Myoviridae environmental samples clone NHS-Seq2, complete sequence 34123-34152 6 0.8
CP025594_6 6.17|927367|36|CP025594|CRT 927367-927402 36 MT723940 Mycobacterium phage Ellie, complete genome 24126-24161 6 0.833
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3466597-3466630 6 0.824
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2210883-2210916 6 0.824
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NC_019957 Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence 283764-283797 6 0.824
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 445248-445281 6 0.824
CP025594_9 9.1|1572152|28|CP025594|CRISPRCasFinder 1572152-1572179 28 NZ_AP022571 Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence 39276-39303 6 0.786
CP025594_9 9.1|1572152|28|CP025594|CRISPRCasFinder 1572152-1572179 28 NC_008703 Mycobacterium sp. KMS plasmid pMKMS01, complete sequence 76834-76861 6 0.786
CP025594_9 9.1|1572152|28|CP025594|CRISPRCasFinder 1572152-1572179 28 NZ_LR594663 Variovorax sp. RA8 plasmid 2 131793-131820 6 0.786
CP025594_9 9.10|1572767|31|CP025594|CRISPRCasFinder 1572767-1572797 31 NZ_LR594669 Variovorax sp. SRS16 plasmid 4 27764-27794 6 0.806
CP025594_9 9.10|1572767|31|CP025594|CRISPRCasFinder 1572767-1572797 31 NZ_LR594673 Variovorax sp. PBL-E5 plasmid 3 438646-438676 6 0.806
CP025594_9 9.13|1573016|34|CP025594|CRISPRCasFinder 1573016-1573049 34 NZ_CP044425 Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence 28989-29022 6 0.824
CP025594_14 14.7|3741111|31|CP025594|CRT 3741111-3741141 31 NC_009478 Clavibacter michiganensis subsp. michiganensis NCPPB 382 plasmid pCM1, complete sequence 8328-8358 6 0.806
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 1247285-1247317 7 0.788
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 NZ_CP035092 Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence 646877-646909 7 0.788
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 NC_008688 Paracoccus denitrificans PD1222 plasmid 1, complete sequence 240410-240442 7 0.788
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 NZ_CP030264 Ensifer adhaerens strain Corn53 plasmid AB, complete sequence 382783-382815 7 0.788
CP025594_3 3.4|366678|27|CP025594|CRISPRCasFinder 366678-366704 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 48081-48107 7 0.741
CP025594_4 4.2|631299|30|CP025594|CRT 631299-631328 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2600082-2600111 7 0.767
CP025594_4 4.2|631299|30|CP025594|CRT 631299-631328 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2593965-2593994 7 0.767
CP025594_4 4.2|631299|30|CP025594|CRT 631299-631328 30 LR134127 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7 110413-110442 7 0.767
CP025594_4 4.2|631299|30|CP025594|CRT 631299-631328 30 NC_005241 Cupriavidus necator H16 megaplasmid pHG1, complete sequence 444400-444429 7 0.767
CP025594_4 4.2|631299|30|CP025594|CRT 631299-631328 30 NZ_CP012477 Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence 741115-741144 7 0.767
CP025594_4 4.2|631299|30|CP025594|CRT 631299-631328 30 NZ_CP012478 Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed1, complete sequence 144936-144965 7 0.767
CP025594_4 4.2|631299|30|CP025594|CRT 631299-631328 30 NZ_CP039289 Cupriavidus necator H16 plasmid pHG1, complete sequence 444383-444412 7 0.767
CP025594_4 4.2|631299|30|CP025594|CRT 631299-631328 30 NZ_CP014600 Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence 66483-66512 7 0.767
CP025594_4 4.2|631299|30|CP025594|CRT 631299-631328 30 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 320484-320513 7 0.767
CP025594_4 4.2|631299|30|CP025594|CRT 631299-631328 30 NC_042034 Mycobacterium phage ChrisnMich, complete sequence 26400-26429 7 0.767
CP025594_5 5.1|692011|31|CP025594|CRISPRCasFinder 692011-692041 31 MK977708 Mycobacterium phage Fulbright, complete genome 10281-10311 7 0.774
CP025594_5 5.1|692011|31|CP025594|CRISPRCasFinder 692011-692041 31 MG099948 Mycobacterium phage Philonius, complete genome 10281-10311 7 0.774
CP025594_5 5.1|692011|31|CP025594|CRISPRCasFinder 692011-692041 31 MH926055 Mycobacterium phage Chewbacca, complete genome 10281-10311 7 0.774
CP025594_5 5.1|692011|31|CP025594|CRISPRCasFinder 692011-692041 31 MT723932 Mycobacterium phage Schnauzer, complete genome 10281-10311 7 0.774
CP025594_5 5.1|692011|31|CP025594|CRISPRCasFinder 692011-692041 31 KU935726 Mycobacterium phage Xerxes, complete genome 10281-10311 7 0.774
CP025594_5 5.1|692011|31|CP025594|CRISPRCasFinder 692011-692041 31 KU935730 Mycobacterium phage Pipsqueaks, complete genome 10281-10311 7 0.774
CP025594_5 5.1|692011|31|CP025594|CRISPRCasFinder 692011-692041 31 MH316570 Mycobacterium phage Silvafighter, complete genome 10281-10311 7 0.774
CP025594_5 5.1|692011|31|CP025594|CRISPRCasFinder 692011-692041 31 MK524518 Mycobacterium phage Smurph, complete genome 10281-10311 7 0.774
CP025594_5 5.1|692011|31|CP025594|CRISPRCasFinder 692011-692041 31 MK524515 Mycobacterium phage Parmesanjohn, complete genome 10281-10311 7 0.774
CP025594_5 5.1|692011|31|CP025594|CRISPRCasFinder 692011-692041 31 MH697585 Mycobacterium phage Gex, complete genome 10280-10310 7 0.774
CP025594_5 5.1|692011|31|CP025594|CRISPRCasFinder 692011-692041 31 KM588359 Mycobacterium phage Carcharodon, complete genome 10281-10311 7 0.774
CP025594_5 5.1|692011|31|CP025594|CRISPRCasFinder 692011-692041 31 MH697576 Mycobacterium phage Aggie, complete genome 10282-10312 7 0.774
CP025594_5 5.1|692011|31|CP025594|CRISPRCasFinder 692011-692041 31 MH697593 Mycobacterium phage Tapioca, complete genome 10281-10311 7 0.774
CP025594_5 5.1|692011|31|CP025594|CRISPRCasFinder 692011-692041 31 MG099936 Mycobacterium phage Andies, complete genome 10281-10311 7 0.774
CP025594_5 5.1|692011|31|CP025594|CRISPRCasFinder 692011-692041 31 NC_031243 Mycobacterium phage Xeno, complete genome 10281-10311 7 0.774
CP025594_5 5.1|692011|31|CP025594|CRISPRCasFinder 692011-692041 31 JN256079 Mycobacterium phage Charlie, complete genome 10281-10311 7 0.774
CP025594_6 6.6|926884|27|CP025594|CRT 926884-926910 27 NZ_CP010614 Phaeobacter inhibens strain P92 plasmid pP92_d, complete sequence 8847-8873 7 0.741
CP025594_6 6.6|926884|27|CP025594|CRT 926884-926910 27 NZ_CP010626 Phaeobacter inhibens strain P51 plasmid pP51_c, complete sequence 8847-8873 7 0.741
CP025594_6 6.6|926884|27|CP025594|CRT 926884-926910 27 NZ_CP010671 Phaeobacter inhibens strain P57 plasmid pP57_c, complete sequence 8847-8873 7 0.741
CP025594_6 6.6|926884|27|CP025594|CRT 926884-926910 27 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 191833-191859 7 0.741
CP025594_6 6.6|926884|27|CP025594|CRT 926884-926910 27 NZ_CP010598 Phaeobacter inhibens strain P10 plasmid pP10_c, complete sequence 8865-8891 7 0.741
CP025594_6 6.6|926884|27|CP025594|CRT 926884-926910 27 NC_018288 Phaeobacter inhibens DSM 17395 plasmid pPGA1_65, complete sequence 57481-57507 7 0.741
CP025594_6 6.6|926884|27|CP025594|CRT 926884-926910 27 NZ_CP031955 Phaeobacter inhibens strain 2.10 plasmid unnamed3, complete sequence 62982-63008 7 0.741
CP025594_6 6.6|926884|27|CP025594|CRT 926884-926910 27 NZ_CP016368 Phaeobacter porticola strain P97 plasmid pP97_d, complete sequence 8876-8902 7 0.741
CP025594_6 6.6|926884|27|CP025594|CRT 926884-926910 27 NC_018422 Phaeobacter inhibens 2.10 plasmid pPGA2_71, complete sequence 62746-62772 7 0.741
CP025594_6 6.6|926884|27|CP025594|CRT 926884-926910 27 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 195710-195736 7 0.741
CP025594_6 6.6|926884|27|CP025594|CRT 926884-926910 27 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 195702-195728 7 0.741
CP025594_6 6.6|926884|27|CP025594|CRT 926884-926910 27 NZ_CP010605 Phaeobacter inhibens strain P83 plasmid pP83_f, complete sequence 8848-8874 7 0.741
CP025594_6 6.6|926884|27|CP025594|CRT 926884-926910 27 NZ_CP010744 Phaeobacter inhibens strain P59 plasmid pP59_c, complete sequence 8847-8873 7 0.741
CP025594_6 6.6|926884|27|CP025594|CRT 926884-926910 27 NZ_CP010622 Phaeobacter inhibens strain P30 isolate M4-3.1A plasmid pP30_e, complete sequence 8847-8873 7 0.741
CP025594_6 6.6|926884|27|CP025594|CRT 926884-926910 27 NZ_CP010732 Phaeobacter inhibens strain P88 plasmid pP88_g, complete sequence 8836-8862 7 0.741
CP025594_6 6.6|926884|27|CP025594|CRT 926884-926910 27 NZ_CP010655 Phaeobacter inhibens strain P54 plasmid pP54_e, complete sequence 8835-8861 7 0.741
CP025594_6 6.6|926884|27|CP025594|CRT 926884-926910 27 NZ_CP010711 Phaeobacter inhibens strain P66 plasmid pP66_f, complete sequence 8848-8874 7 0.741
CP025594_6 6.6|926884|27|CP025594|CRT 926884-926910 27 NZ_CP010702 Phaeobacter inhibens strain P24 plasmid pP24_f, complete sequence 8847-8873 7 0.741
CP025594_6 6.6|926884|27|CP025594|CRT 926884-926910 27 NZ_CP010748 Phaeobacter inhibens strain P48 isolate M21-2.3 plasmid pP48_c, complete sequence 8847-8873 7 0.741
CP025594_6 6.6|926884|27|CP025594|CRT 926884-926910 27 NZ_CP010739 Phaeobacter inhibens strain P72 plasmid pP72_d, complete sequence 8824-8850 7 0.741
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 943873-943902 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 392100-392129 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 1838430-1838459 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 616186-616215 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 397449-397478 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 1703655-1703684 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 212329-212358 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 679499-679528 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1744018-1744047 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1760732-1760761 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 178925-178954 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 75369-75398 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 153012-153041 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 589998-590027 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP010410 Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence 81538-81567 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 845884-845913 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 258296-258325 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1723933-1723962 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 1859622-1859651 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 1841724-1841753 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 1841724-1841753 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 137321-137350 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 258496-258525 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 257917-257946 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 234345-234374 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 461507-461536 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 254201-254230 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 236985-237014 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 298368-298397 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 258487-258516 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 461579-461608 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 390422-390451 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1964821-1964850 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 461516-461545 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 237930-237959 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 849014-849043 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1227007-1227036 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 238244-238273 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 245279-245308 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 235437-235466 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 126762-126791 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 234570-234599 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 251053-251082 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 258309-258338 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 231309-231338 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 235690-235719 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 238261-238290 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 251053-251082 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 252665-252694 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 236955-236984 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 251052-251081 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 298440-298469 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 230351-230380 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 252665-252694 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 236955-236984 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 461938-461967 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 251053-251082 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 252665-252694 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 438995-439024 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 230352-230381 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 252665-252694 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 236955-236984 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 236955-236984 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 236955-236984 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 251053-251082 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 251053-251082 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 230352-230381 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 245262-245291 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 245236-245265 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 241864-241893 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 240004-240033 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 235466-235495 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 251053-251082 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 230352-230381 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 252665-252694 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 280525-280554 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 251050-251079 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 230352-230381 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 230352-230381 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 251053-251082 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 236955-236984 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 251053-251082 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 251053-251082 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 HM560026 Uncultured bacterium plasmid pTRACA45, complete sequence 1764-1793 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NC_010867 Neisseria lactamica plasmid pNL3.1, complete sequence 3216-3245 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP020471 Rhodobacter blasticus strain 28/5 plasmid pRsa, complete sequence 121720-121749 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 535160-535189 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 326858-326887 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP035710 Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence 121664-121693 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 KT997827 Uncultured Mediterranean phage uvDeep-CGR0-KM15-C219, complete genome 28429-28458 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 AP021850 Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome 235977-236006 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 1424992-1425021 7 0.767
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 KT997829 Uncultured Mediterranean phage uvDeep-CGR0-KM22-C158, complete genome 24686-24715 7 0.767
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP013634 Rhizobium sp. N324 plasmid pRspN324d, complete sequence 278785-278814 7 0.767
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP035001 Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence 113824-113853 7 0.767
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP040820 Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence 158849-158878 7 0.767
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NC_007765 Rhizobium etli CFN 42 plasmid p42e, complete sequence 384914-384943 7 0.767
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP006989 Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence 317121-317150 7 0.767
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP020909 Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence 385410-385439 7 0.767
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP024423 Paracoccus yeei strain TT13 plasmid pTT13-1, complete sequence 260932-260961 7 0.767
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP020951 Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence 329309-329338 7 0.767
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NC_021908 Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence 391416-391445 7 0.767
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP020441 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed1, complete sequence 243975-244004 7 0.767
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 CP007642 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence 301676-301705 7 0.767
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP044080 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence 201076-201105 7 0.767
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 635292-635321 7 0.767
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 422833-422862 7 0.767
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 494408-494437 7 0.767
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 MN582086 Siphoviridae sp. ctdEk19, complete genome 33318-33347 7 0.767
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 864583-864612 7 0.767
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP022700 Acetobacter tropicalis strain BDGP1 plasmid pAtBDGP1A, complete sequence 61493-61522 7 0.767
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 1238691-1238720 7 0.767
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 1484042-1484071 7 0.767
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 1466967-1466996 7 0.767
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP031082 Paracoccus yeei strain CCUG 32053 plasmid pYEE4, complete sequence 119508-119537 7 0.767
CP025594_6 6.17|927367|36|CP025594|CRT 927367-927402 36 NC_022087 Mycobacterium phage AnnaL29, complete genome 5558-5593 7 0.806
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2210628-2210661 7 0.794
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2209827-2209860 7 0.794
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP025548 Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence 24930-24963 7 0.794
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2133215-2133248 7 0.794
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 MT889380 Mycobacterium phage Coco12, complete genome 22836-22869 7 0.794
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 MT114167 Mycobacterium phage Phanphagia, complete genome 22491-22524 7 0.794
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP020331 Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence 531146-531179 7 0.794
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP039644 Azospirillum sp. TSA2s plasmid p2, complete sequence 117310-117343 7 0.794
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 254574-254607 7 0.794
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP039641 Azospirillum sp. TSH100 plasmid p2, complete sequence 30914-30947 7 0.794
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 MH697583 Mycobacterium phage EricMillard, complete genome 32257-32290 7 0.794
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 MH727551 Mycobacterium phage Kalah2, complete genome 32307-32340 7 0.794
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 MH077579 Mycobacterium phage Halley, complete genome 31970-32003 7 0.794
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 MH669017 Mycobacterium phage Zelink, complete genome 33051-33084 7 0.794
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 MN062701 Mycobacterium phage Dallas, complete genome 31496-31529 7 0.794
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 MK524527 Mycobacterium phage ThreeRngTarjay, complete genome 32107-32140 7 0.794
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 MK524529 Mycobacterium phage Phoebus, complete genome 32257-32290 7 0.794
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 MF919512 Mycobacterium phage Klein, complete genome 31531-31564 7 0.794
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 KF114875 Mycobacterium phage Redno2, complete genome 31720-31753 7 0.794
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 MK967379 Mycobacterium phage HokkenD, complete genome 31519-31552 7 0.794
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP025513 Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence 307986-308019 7 0.794
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_LR134450 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence 178492-178525 7 0.794
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NC_005241 Cupriavidus necator H16 megaplasmid pHG1, complete sequence 275379-275412 7 0.794
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 445383-445416 7 0.794
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP039289 Cupriavidus necator H16 plasmid pHG1, complete sequence 275378-275411 7 0.794
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 MN813686 Mycobacterium phage BirdsNest, complete genome 30327-30360 7 0.794
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NC_042035 Mycobacterium phage Zemanar, complete sequence 31516-31549 7 0.794
CP025594_8 8.9|1212373|37|CP025594|CRISPRCasFinder 1212373-1212409 37 NZ_CP013855 Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence 136890-136926 7 0.811
CP025594_9 9.1|1572152|28|CP025594|CRISPRCasFinder 1572152-1572179 28 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 259627-259654 7 0.75
CP025594_9 9.10|1572767|31|CP025594|CRISPRCasFinder 1572767-1572797 31 NZ_CP041045 Paracoccus sp. AK26 plasmid pAK1, complete sequence 281800-281830 7 0.774
CP025594_9 9.10|1572767|31|CP025594|CRISPRCasFinder 1572767-1572797 31 CP017041 Propionibacterium sp. oral taxon 193 strain F0672 plasmid unnamed1, complete sequence 68407-68437 7 0.774
CP025594_10 10.3|2088355|30|CP025594|CRT 2088355-2088384 30 NZ_CP015065 Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence 52187-52216 7 0.767
CP025594_10 10.3|2088355|30|CP025594|CRT 2088355-2088384 30 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 75140-75169 7 0.767
CP025594_10 10.3|2088355|30|CP025594|CRT 2088355-2088384 30 NC_014918 Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence 376489-376518 7 0.767
CP025594_14 14.7|3741111|31|CP025594|CRT 3741111-3741141 31 NZ_CP010990 Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence 147567-147597 7 0.774
CP025594_14 14.7|3741111|31|CP025594|CRT 3741111-3741141 31 NZ_CP012186 Pseudonocardia sp. EC080619-01 plasmid pBCI1-1, complete sequence 36995-37025 7 0.774
CP025594_14 14.7|3741111|31|CP025594|CRT 3741111-3741141 31 NZ_CP042263 Litoreibacter sp. LN3S51 plasmid unnamed2, complete sequence 372247-372277 7 0.774
CP025594_1 1.4|335607|36|CP025594|CRT 335607-335642 36 NZ_CP015744 Shinella sp. HZN7 plasmid pShin-08, complete sequence 117629-117664 8 0.778
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 MG925349 Mycobacterium phage Mendokysei, complete genome 21043-21075 8 0.758
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 117028-117060 8 0.758
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 NZ_LR594669 Variovorax sp. SRS16 plasmid 4 178231-178263 8 0.758
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 117028-117060 8 0.758
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 36596-36628 8 0.758
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 NZ_LR594673 Variovorax sp. PBL-E5 plasmid 3 177107-177139 8 0.758
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 NZ_CP029830 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence 383420-383452 8 0.758
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 NZ_CP029833 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence 313182-313214 8 0.758
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 997279-997311 8 0.758
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 NC_019957 Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence 268642-268674 8 0.758
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 NZ_CP054617 Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence 464957-464989 8 0.758
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 NZ_CP054620 Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence 65849-65881 8 0.758
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 KY555145 Caulobacter phage Ccr29, complete genome 44715-44747 8 0.758
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 KY555143 Caulobacter phage Ccr2, complete genome 42548-42580 8 0.758
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 AY369265 Burkholderia cenocepacia phage Bcep1, complete genome 23297-23329 8 0.758
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 MK524485 Mycobacterium phage MissDaisy, complete genome 6563-6595 8 0.758
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 MH926058 Mycobacterium phage Reptar3000, complete genome 6538-6570 8 0.758
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 MK524488 Mycobacterium phage Patt, complete genome 6539-6571 8 0.758
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 NC_005263 Burkholderia phage Bcep1, complete genome 23297-23329 8 0.758
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 KY555142 Caulobacter phage Ccr10, complete genome 42073-42105 8 0.758
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 NZ_LR134450 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence 178483-178515 8 0.758
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 NZ_CP026546 Cupriavidus metallidurans strain Ni-2 plasmid unnamed2 154233-154265 8 0.758
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 117070-117102 8 0.758
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 MH271296 Gordonia phage Emperor, complete genome 13014-13046 8 0.758
CP025594_3 3.6|366813|33|CP025594|CRISPRCasFinder 366813-366845 33 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 1386736-1386768 8 0.758
CP025594_3 3.6|366813|33|CP025594|CRISPRCasFinder 366813-366845 33 NC_016624 Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence 35126-35158 8 0.758
CP025594_3 3.6|366813|33|CP025594|CRISPRCasFinder 366813-366845 33 NZ_CP039965 Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence 1241611-1241643 8 0.758
CP025594_3 3.6|366813|33|CP025594|CRISPRCasFinder 366813-366845 33 CP007644 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence 275839-275871 8 0.758
CP025594_3 3.6|366813|33|CP025594|CRISPRCasFinder 366813-366845 33 NZ_CP029834 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence 310597-310629 8 0.758
CP025594_4 4.2|631299|30|CP025594|CRT 631299-631328 30 NZ_CP045074 Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence 437642-437671 8 0.733
CP025594_4 4.2|631299|30|CP025594|CRT 631299-631328 30 NZ_CP015269 Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 2, complete sequence 9052-9081 8 0.733
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2714450-2714479 8 0.733
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 837910-837939 8 0.733
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 424702-424731 8 0.733
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 975216-975245 8 0.733
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 1013021-1013050 8 0.733
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_KY126370 Enterobacter cloacae subsp. cloacae strain MN201516 plasmid pOP-I, complete sequence 93253-93282 8 0.733
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP054625 Cupriavidus gilardii strain FDAARGOS_639 plasmid unnamed1, complete sequence 22400-22429 8 0.733
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 1889334-1889363 8 0.733
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_LT960615 Hartmannibacter diazotrophicus strain E19T plasmid HDIAp1, complete sequence 21202-21231 8 0.733
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP046347 Citrobacter portucalensis strain FDAARGOS_738 plasmid unnamed1, complete sequence 30108-30137 8 0.733
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP044100 Citrobacter werkmanii strain FDAARGOS_616 plasmid unnamed1, complete sequence 32856-32885 8 0.733
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP032156 Mycobacterium sp. ELW1 plasmid pELW1-1, complete sequence 111116-111145 8 0.733
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 KY555144 Caulobacter phage Ccr5, complete genome 178242-178271 8 0.733
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_KP873172 Pseudomonas aeruginosa PAO1 plasmid pAMBL1, complete sequence 21059-21088 8 0.733
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP045203 Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence 159096-159125 8 0.733
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NC_021492 Enterobacter sp. R4-368 plasmid pENT01, complete sequence 50097-50126 8 0.733
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP022156 Escherichia coli strain ABWA45 plasmid pABWA45_2, complete sequence 15249-15278 8 0.733
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP024682 Citrobacter freundii strain UMH14 plasmid pUMH14_2, complete sequence 41943-41972 8 0.733
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 242723-242752 8 0.733
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 28649-28678 8 0.733
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP020899 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence 310870-310899 8 0.733
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 462801-462830 8 0.733
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP013525 Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence 292109-292138 8 0.733
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP013588 Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence 287383-287412 8 0.733
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP013577 Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence 292305-292334 8 0.733
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP013549 Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence 292675-292704 8 0.733
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP013529 Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence 306458-306487 8 0.733
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP013534 Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence 292675-292704 8 0.733
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP013539 Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence 295900-295929 8 0.733
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP013545 Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence 292670-292699 8 0.733
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP013582 Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence 306458-306487 8 0.733
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP013571 Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence 292305-292334 8 0.733
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NC_010998 Rhizobium etli CIAT 652 plasmid pA, complete sequence 298287-298316 8 0.733
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1682210-1682239 8 0.733
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 294530-294559 8 0.733
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_LR134452 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence 375826-375855 8 0.733
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_AP014706 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence 112972-113001 8 0.733
CP025594_6 6.17|927367|36|CP025594|CRT 927367-927402 36 MG770216 Mycobacterium phage Rem711, complete genome 26292-26327 8 0.778
CP025594_6 6.17|927367|36|CP025594|CRT 927367-927402 36 KY087993 Mycobacterium phage Hammy, complete genome 24359-24394 8 0.778
CP025594_6 6.17|927367|36|CP025594|CRT 927367-927402 36 MF140406 Mycobacterium phage DarthP, complete genome 24368-24403 8 0.778
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3466471-3466504 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 350662-350695 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 350530-350563 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 3051061-3051094 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 36586-36619 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NC_047958 Burkholderia phage vB_BmuP_KL4, complete genome 28566-28599 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 117037-117070 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 928385-928418 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 131278-131311 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 117079-117112 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 117037-117070 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 670302-670335 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1123064-1123097 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 530145-530178 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP016560 Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence 187401-187434 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 MN234223 Mycobacterium phage Philly, complete genome 30948-30981 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 KJ194581 Mycobacterium phage Audrey, complete genome 31094-31127 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 MH051265 Mycobacterium phage Yahalom, complete genome 31107-31140 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 MH316565 Mycobacterium phage Mortcellus, complete genome 31732-31765 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 MT310871 Mycobacterium phage Jackstina, complete genome 31017-31050 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 EU816589 Mycobacterium phage Phaedrus, complete genome 31013-31046 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 MT952851 Mycobacterium phage Gervas, complete genome 31075-31108 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 MG920059 Mycobacterium phage Baloo, complete genome 31097-31130 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NC_023686 Mycobacterium phage Gadjet, complete genome 31104-31137 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NC_041965 Mycobacterium phage Athena, complete genome 31845-31878 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 DQ398049 Mycobacterium phage Pipefish, complete genome 32489-32522 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 MT310892 Mycobacterium phage Compostia, complete genome 31524-31557 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 JN699018 Mycobacterium phage Kamiyu, complete genome 31063-31096 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 687345-687378 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP010410 Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence 118498-118531 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP033582 Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence 539300-539333 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 MK814754 Mycobacterium phage Sumter, complete genome 28141-28174 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 MK814754 Mycobacterium phage Sumter, complete genome 28639-28672 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 MN369739 Mycobacterium phage Kenuha5, complete genome 22588-22621 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 MK967397 Mycobacterium phage Mahavrat, complete genome 24814-24847 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 MT522000 Mycobacterium phage Soul22, complete genome 22192-22225 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 KY348865 Mycobacterium phage Bubbles123, complete genome 25540-25573 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 MN428047 Mycobacterium phage Doomphist, complete genome 24962-24995 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 MF919502 Mycobacterium phage Demsculpinboyz, complete genome 22190-22223 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 AY129336 Mycobacteriophage Che9d, complete genome 22205-22238 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 MT771340 Mycobacterium phage Jorgensen, complete genome 28476-28509 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 MK359343 Mycobacterium phage Pollywog, complete genome 23655-23688 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NC_042030 Mycobacterium phage Yoshi, complete sequence 22193-22226 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NC_048729 Mycobacterium phage Renaud18, complete genome 22865-22898 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NC_026585 Mycobacteriophage Estave1, complete genome 22558-22591 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 MK305886 Mycobacterium phage Poenanya, complete genome 24962-24995 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 JN859129 Mycobacterium virus DotProduct, complete genome 24829-24862 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 MG925354 Mycobacterium phage Ogopogo, complete genome 22785-22818 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 JN698995 Mycobacterium phage Dori, complete genome 28163-28196 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NC_023698 Mycobacterium phage Avani, complete genome 22197-22230 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NC_011054 Mycobacterium phage Boomer, complete genome 24637-24670 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 MN234184 Mycobacterium phage IdentityCrisis, complete genome 19984-20017 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 MH077585 Mycobacterium phage TChen, complete genome 22970-23003 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NC_048788 Mycobacterium phage ThetaBob, complete genome 22783-22816 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP039965 Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence 125963-125996 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP015733 Arthrobacter sp. U41 plasmid unnamed1, complete sequence 138036-138069 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 MN096355 Mycobacterium phage Purky, complete genome 13505-13538 8 0.765
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 MN234183 Mycobacterium phage Antsirabe, complete genome 23060-23093 8 0.765
CP025594_8 8.9|1212373|37|CP025594|CRISPRCasFinder 1212373-1212409 37 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 683728-683764 8 0.784
CP025594_9 9.10|1572767|31|CP025594|CRISPRCasFinder 1572767-1572797 31 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 349053-349083 8 0.742
CP025594_9 9.10|1572767|31|CP025594|CRISPRCasFinder 1572767-1572797 31 NZ_CP039899 Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877a, complete sequence 336247-336277 8 0.742
CP025594_9 9.10|1572767|31|CP025594|CRISPRCasFinder 1572767-1572797 31 NZ_CP039913 Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625b, complete sequence 262996-263026 8 0.742
CP025594_9 9.10|1572767|31|CP025594|CRISPRCasFinder 1572767-1572797 31 NZ_CP039890 Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499a, complete sequence 336247-336277 8 0.742
CP025594_9 9.10|1572767|31|CP025594|CRISPRCasFinder 1572767-1572797 31 NZ_CP018001 Rhizobium sp. Y9 plasmid pY9, complete sequence 264529-264559 8 0.742
CP025594_9 9.10|1572767|31|CP025594|CRISPRCasFinder 1572767-1572797 31 NC_022536 Rhizobium sp. IRBG74 plasmid IRBL74_p, complete sequence 458177-458207 8 0.742
CP025594_9 9.10|1572767|31|CP025594|CRISPRCasFinder 1572767-1572797 31 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 311056-311086 8 0.742
CP025594_9 9.10|1572767|31|CP025594|CRISPRCasFinder 1572767-1572797 31 NZ_CP018075 Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence 88587-88617 8 0.742
CP025594_9 9.10|1572767|31|CP025594|CRISPRCasFinder 1572767-1572797 31 CP036360 Agrobacterium sp. 33MFTa1.1 plasmid p_JBx_073812, complete sequence 284157-284187 8 0.742
CP025594_9 9.10|1572767|31|CP025594|CRISPRCasFinder 1572767-1572797 31 NZ_CP021914 Sagittula sp. P11 plasmid unnamed1, complete sequence 300067-300097 8 0.742
CP025594_9 9.10|1572767|31|CP025594|CRISPRCasFinder 1572767-1572797 31 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 1510497-1510527 8 0.742
CP025594_10 10.3|2088355|30|CP025594|CRT 2088355-2088384 30 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 9194-9223 8 0.733
CP025594_10 10.3|2088355|30|CP025594|CRT 2088355-2088384 30 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 983284-983313 8 0.733
CP025594_14 14.7|3741111|31|CP025594|CRT 3741111-3741141 31 CP033373 Lactobacillus fermentum strain DR9 plasmid unnamed2, complete sequence 12237-12267 8 0.742
CP025594_14 14.7|3741111|31|CP025594|CRT 3741111-3741141 31 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 1260343-1260373 8 0.742
CP025594_14 14.7|3741111|31|CP025594|CRT 3741111-3741141 31 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 1009358-1009388 8 0.742
CP025594_14 14.7|3741111|31|CP025594|CRT 3741111-3741141 31 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1260501-1260531 8 0.742
CP025594_14 14.7|3741111|31|CP025594|CRT 3741111-3741141 31 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 1009351-1009381 8 0.742
CP025594_14 14.7|3741111|31|CP025594|CRT 3741111-3741141 31 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 756669-756699 8 0.742
CP025594_14 14.7|3741111|31|CP025594|CRT 3741111-3741141 31 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1137767-1137797 8 0.742
CP025594_14 14.7|3741111|31|CP025594|CRT 3741111-3741141 31 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 1009365-1009395 8 0.742
CP025594_14 14.7|3741111|31|CP025594|CRT 3741111-3741141 31 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 1260057-1260087 8 0.742
CP025594_14 14.7|3741111|31|CP025594|CRT 3741111-3741141 31 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 1260001-1260031 8 0.742
CP025594_14 14.7|3741111|31|CP025594|CRT 3741111-3741141 31 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 981946-981976 8 0.742
CP025594_14 14.7|3741111|31|CP025594|CRT 3741111-3741141 31 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 938267-938297 8 0.742
CP025594_14 14.7|3741111|31|CP025594|CRT 3741111-3741141 31 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 748414-748444 8 0.742
CP025594_14 14.7|3741111|31|CP025594|CRT 3741111-3741141 31 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 896022-896052 8 0.742
CP025594_14 14.7|3741111|31|CP025594|CRT 3741111-3741141 31 NZ_CP027299 Streptomyces sp. SGAir0924 plasmid unnamed_5 215713-215743 8 0.742
CP025594_14 14.7|3741111|31|CP025594|CRT 3741111-3741141 31 NC_014213 Meiothermus silvanus DSM 9946 plasmid pMESIL01, complete sequence 111748-111778 8 0.742
CP025594_1 1.4|335607|36|CP025594|CRT 335607-335642 36 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 350909-350944 9 0.75
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1945948-1945980 9 0.727
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 NC_010399 Clavibacter michiganensis subsp. sepedonicus plasmid pCS1, complete sequence 30939-30971 9 0.727
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 1848043-1848075 9 0.727
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 1848045-1848077 9 0.727
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 MN369761 Mycobacterium phage Malthus, complete genome 6607-6639 9 0.727
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 MK224497 Mycobacterium phage Henu3, complete genome 52357-52389 9 0.727
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 KJ944841 Mycobacterium phage Cheetobro, complete genome 6617-6649 9 0.727
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 AP018469 Mycobacterium phage Y10 DNA, complete genome, note: sample1 6607-6639 9 0.727
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 KY087992 Mycobacterium phage Mitti, complete genome 6620-6652 9 0.727
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 EF602154 Burkholderia phage BcepNY3, complete genome 21515-21547 9 0.727
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 MF140402 Mycobacterium phage Chancellor, complete genome 6617-6649 9 0.727
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 AP018470 Mycobacterium phage Y2 DNA, complete genome 6607-6639 9 0.727
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 KT361920 Mycobacterium phage Slarp, complete genome 6617-6649 9 0.727
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 MT310882 Mycobacterium phage JF1, complete genome 6607-6639 9 0.727
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 AP018471 Mycobacterium phage Y10 DNA, complete genome, note: sample2 6607-6639 9 0.727
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 KX621007 Mycobacterium phage Taquito, complete genome 6218-6250 9 0.727
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 MH051258 Mycobacterium phage SamScheppers, complete genome 6214-6246 9 0.727
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 NZ_CP036221 Mycobacterium avium subsp. hominissuis strain mc2 2500 plasmid unnamed1, complete sequence 13425-13457 9 0.727
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 NZ_CP040251 Mycobacterium avium subsp. hominissuis strain 101115 plasmid unnamed1 19841-19873 9 0.727
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 NZ_CP040252 Mycobacterium avium subsp. hominissuis strain 101115 plasmid unnamed2 9841-9873 9 0.727
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 NC_008269 Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence 989188-989220 9 0.727
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 NZ_CP029334 Mycobacterium avium subsp. hominissuis strain MAC109 plasmid pMAC109b, complete sequence 8781-8813 9 0.727
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 KY555147 Caulobacter phage Ccr34, complete genome 42046-42078 9 0.727
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 KY555146 Caulobacter phage Ccr32, complete genome 42080-42112 9 0.727
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 NC_047975 Microbacterium phage Squash, complete genome 20717-20749 9 0.727
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 JX163858 Caulobacter phage phiCbK, complete genome 165745-165777 9 0.727
CP025594_3 3.6|366813|33|CP025594|CRISPRCasFinder 366813-366845 33 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 91175-91207 9 0.727
CP025594_3 3.6|366813|33|CP025594|CRISPRCasFinder 366813-366845 33 NZ_CP016287 Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence 668963-668995 9 0.727
CP025594_3 3.6|366813|33|CP025594|CRISPRCasFinder 366813-366845 33 NZ_CP022565 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence 789706-789738 9 0.727
CP025594_3 3.6|366813|33|CP025594|CRISPRCasFinder 366813-366845 33 NZ_CP048281 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence 625853-625885 9 0.727
CP025594_4 4.2|631299|30|CP025594|CRT 631299-631328 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1695112-1695141 9 0.7
CP025594_5 5.1|692011|31|CP025594|CRISPRCasFinder 692011-692041 31 NZ_CP014964 Geobacter anodireducens strain SD-1 plasmid pSD, complete sequence 13698-13728 9 0.71
CP025594_5 5.1|692011|31|CP025594|CRISPRCasFinder 692011-692041 31 NC_015974 Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence 20960-20990 9 0.71
CP025594_5 5.1|692011|31|CP025594|CRISPRCasFinder 692011-692041 31 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 15390-15420 9 0.71
CP025594_6 6.13|927181|30|CP025594|CRT 927181-927210 30 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5046041-5046070 9 0.7
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NC_005241 Cupriavidus necator H16 megaplasmid pHG1, complete sequence 65937-65966 9 0.7
CP025594_6 6.15|927277|30|CP025594|CRT 927277-927306 30 NZ_CP039289 Cupriavidus necator H16 plasmid pHG1, complete sequence 65937-65966 9 0.7
CP025594_6 6.17|927367|36|CP025594|CRT 927367-927402 36 MF140398 Mycobacterium phage Amohnition, complete genome 24446-24481 9 0.75
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 350101-350134 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2210928-2210961 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 231456-231489 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 306612-306645 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NC_019957 Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence 283233-283266 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 EF602154 Burkholderia phage BcepNY3, complete genome 21505-21538 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 AY369265 Burkholderia cenocepacia phage Bcep1, complete genome 23287-23320 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NC_005263 Burkholderia phage Bcep1, complete genome 23287-23320 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP050083 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence 307143-307176 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP049733 Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence 298112-298145 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 723127-723160 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP053906 Hymenobacter sp. BRD67 plasmid unnamed2, complete sequence 19270-19303 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 KC170279 Uncultured bacterium plasmid pMBUI8, complete sequence 15929-15962 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 652970-653003 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP015867 Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence 490801-490834 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 637964-637997 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 235008-235041 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 646029-646062 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 635838-635871 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 684904-684937 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 1303766-1303799 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 897262-897295 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 233325-233358 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 560015-560048 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 1424629-1424662 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 796570-796603 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 659643-659676 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 1083784-1083817 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 1052610-1052643 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 1150006-1150039 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 654523-654556 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 771404-771437 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 290861-290894 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 371773-371806 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 1224363-1224396 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 997046-997079 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 1083789-1083822 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 MH001451 Mycobacterium phage Nairb, complete genome 21242-21275 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 MF155936 Mycobacterium phage ZenTime222, complete genome 21242-21275 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 MH588544 Caulobacter phage CcrBL10, complete genome 39042-39075 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 MK494089 Mycobacterium phage Ibrahim, complete genome 21242-21275 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NC_024135 Mycobacterium phage Bernal13, complete genome 21242-21275 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 KM591905 Mycobacterium phage RonRayGun, complete genome 21242-21275 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 MN735432 Mycobacteriophage Whitty, complete genome 21242-21275 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_KX443399 Rhodococcus hoagii strain PAM1354 plasmid pVAPA1354, complete sequence 82507-82540 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_KX443400 Rhodococcus hoagii strain PAM1557 plasmid pVAPN1557, complete sequence 82532-82565 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_KX443398 Rhodococcus hoagii strain PAM1204 plasmid pVAPN1204, complete sequence 82528-82561 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 CP054922 Streptomyces sp. NA03103 plasmid unnamed2, complete sequence 90688-90721 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_KP851975 Rhodococcus hoagii strain PAM2012 plasmid pVAPN2012, complete sequence 82645-82678 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NC_015314 Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence 55533-55566 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 318448-318481 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_KF439868 Rhodococcus hoagii strain PAM1571 plasmid pVAPN1571, complete sequence 81659-81692 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_LR134452 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence 84861-84894 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP021025 Rhizobium sp. TAL182 plasmid pRetTAL182a, complete sequence 135548-135581 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 498515-498548 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 927230-927263 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP013600 Rhizobium sp. N741 plasmid pRspN741e, complete sequence 241368-241401 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NC_019789 Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence 455289-455322 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP013504 Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence 241368-241401 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP013510 Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence 239809-239842 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP013521 Rhizobium sp. N113 plasmid pRspN113d, complete sequence 244056-244089 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP013494 Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence 238174-238207 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP013512 Rhizobium sp. N1314 plasmid pRspN1314a, complete sequence 131481-131514 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP013594 Rhizobium sp. N871 plasmid pRspN871d, complete sequence 241368-241401 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 747004-747037 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 KC736071 Mycobacterium phage WIVsmall, complete genome 29683-29716 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 171949-171982 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_LR134446 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 4, complete sequence 52095-52128 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP041653 Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence 129601-129634 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP032341 Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence 301604-301637 9 0.735
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 779027-779060 9 0.735
CP025594_8 8.9|1212373|37|CP025594|CRISPRCasFinder 1212373-1212409 37 NC_017966 Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence 686592-686628 9 0.757
CP025594_9 9.10|1572767|31|CP025594|CRISPRCasFinder 1572767-1572797 31 NZ_CP039697 Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence 345043-345073 9 0.71
CP025594_9 9.10|1572767|31|CP025594|CRISPRCasFinder 1572767-1572797 31 NZ_CP049244 Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence 245050-245080 9 0.71
CP025594_9 9.10|1572767|31|CP025594|CRISPRCasFinder 1572767-1572797 31 NC_022049 Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence 194387-194417 9 0.71
CP025594_9 9.10|1572767|31|CP025594|CRISPRCasFinder 1572767-1572797 31 MN234199 Mycobacterium phage Ekdilam, complete genome 24235-24265 9 0.71
CP025594_9 9.10|1572767|31|CP025594|CRISPRCasFinder 1572767-1572797 31 NZ_CP023000 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence 1145162-1145192 9 0.71
CP025594_9 9.10|1572767|31|CP025594|CRISPRCasFinder 1572767-1572797 31 NZ_CP015737 Shinella sp. HZN7 plasmid pShin-01, complete sequence 453136-453166 9 0.71
CP025594_9 9.10|1572767|31|CP025594|CRISPRCasFinder 1572767-1572797 31 NZ_CP013740 Streptomyces globisporus C-1027 plasmid pSGL1, complete sequence 2806-2836 9 0.71
CP025594_9 9.10|1572767|31|CP025594|CRISPRCasFinder 1572767-1572797 31 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 1908459-1908489 9 0.71
CP025594_14 14.5|3740970|34|CP025594|CRT 3740970-3741003 34 NZ_CP021805 Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence 922290-922323 9 0.735
CP025594_14 14.5|3740970|34|CP025594|CRT 3740970-3741003 34 MG812496 Gordonia phage SallySpecial, complete genome 7675-7708 9 0.735
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 NZ_CP015867 Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence 576171-576203 10 0.697
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 NZ_CP018080 Sulfitobacter sp. AM1-D1 plasmid unnamed4, complete sequence 103033-103065 10 0.697
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 MH371116 Mycobacterium phage DMoney, complete genome 6588-6620 10 0.697
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 MH045569 Mycobacterium phage Schiebel, complete genome 6588-6620 10 0.697
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 MH371119 Mycobacterium phage OctaviousRex, complete genome 6588-6620 10 0.697
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 MF919497 Mycobacterium phage Chance64, complete genome 6588-6620 10 0.697
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 MH001456 Mycobacterium phage CLED96, complete genome 6588-6620 10 0.697
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 GQ303261 Mycobacterium phage Hope, complete genome 6588-6620 10 0.697
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 MG099946 Mycobacterium phage LouisV14, complete genome 6588-6620 10 0.697
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 KC787112 Mycobacterium phage Clark, partial genome 6593-6625 10 0.697
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 MH779513 Mycobacterium phage Olga, complete genome 6588-6620 10 0.697
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 MK919475 Mycobacterium phage Camri, complete genome 6588-6620 10 0.697
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 MK310146 Mycobacterium phage Crespo, complete genome 6589-6621 10 0.697
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 MK524493 Mycobacterium phage Darionha, complete genome 6588-6620 10 0.697
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 MH779505 Mycobacterium phage Grizzly, complete genome 6588-6620 10 0.697
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 EU568876 Mycobacterium phage BPs, complete genome 6588-6620 10 0.697
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 KC787107 Mycobacterium phage Bo4, complete genome 32703-32735 10 0.697
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 MF668268 Mycobacterium phage Aroostook, complete genome 6588-6620 10 0.697
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 MK524494 Mycobacterium phage Rabbs, complete genome 6589-6621 10 0.697
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 KX588251 Mycobacterium phage Jane, complete genome 6588-6620 10 0.697
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 KC787103 Mycobacterium phage Chy2, partial genome 5353-5385 10 0.697
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 MH001455 Mycobacterium phage Remy19, complete genome 6588-6620 10 0.697
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 KT355472 Mycobacterium phage Cedasite, complete genome 6588-6620 10 0.697
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 KX664455 Mycobacterium phage Zombie, complete genome 6588-6620 10 0.697
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 MH077584 Mycobacterium phage Phish, complete genome 6588-6620 10 0.697
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 KC787108 Mycobacterium phage DNAIII, complete genome 6597-6629 10 0.697
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 MN444875 Mycobacterium phage Jonghyun, complete genome 6588-6620 10 0.697
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 MK433279 Mycobacterium phage Kareem, complete genome 6588-6620 10 0.697
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 KJ725374 Mycobacterium phage Guo1, complete genome 27230-27262 10 0.697
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 NC_031102 Mycobacterium phage Sneeze, complete genome 6588-6620 10 0.697
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 MT818422 Mycobacterium phage Periodt, complete genome 6588-6620 10 0.697
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 MK305884 Mycobacterium phage BQuat, complete genome 6588-6620 10 0.697
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 MF668272 Mycobacterium phage Gideon, complete genome 6588-6620 10 0.697
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 KC787111 Mycobacterium phage Sedge, partial genome 6528-6560 10 0.697
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 KC787104 Mycobacterium phage Chy3, partial genome 6968-7000 10 0.697
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 NC_012788 Mycobacterium phage Angel, complete genome 6588-6620 10 0.697
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 KX443326 Mycobacterium phage BruceB, complete genome 6588-6620 10 0.697
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 MK433277 Mycobacterium phage Renaissance, complete genome 6588-6620 10 0.697
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 MH590605 Mycobacterium phage Cherrybomb426, complete genome 6588-6620 10 0.697
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 MH779509 Mycobacterium phage Kasen3, complete genome 6589-6621 10 0.697
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 JN699002 Mycobacterium phage Avrafan, complete genome 6588-6620 10 0.697
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 MH779507 Mycobacterium phage Hotshotbaby7, complete genome 6588-6620 10 0.697
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 KT355474 Mycobacterium phage Frosty24, complete genome 6588-6620 10 0.697
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 KC787109 Mycobacterium phage Legendre, partial genome 34119-34151 10 0.697
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 JN412593 Mycobacterium phage Liefie, complete genome 6587-6619 10 0.697
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 MH479920 Mycobacterium phage Mowgli, complete genome 6588-6620 10 0.697
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 KM923970 Mycobacterium phage Gomashi, complete genome 6589-6621 10 0.697
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 MH450127 Mycobacterium phage Plagueis, complete genome 6588-6620 10 0.697
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 KT347314 Mycobacterium phage Phreak, complete genome 6588-6620 10 0.697
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 KT365399 Mycobacterium phage Annihilator, complete genome 6588-6620 10 0.697
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 KC787110 Mycobacterium phage Leo, complete genome 6605-6637 10 0.697
CP025594_3 3.6|366813|33|CP025594|CRISPRCasFinder 366813-366845 33 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 91179-91211 10 0.697
CP025594_3 3.6|366813|33|CP025594|CRISPRCasFinder 366813-366845 33 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 90245-90277 10 0.697
CP025594_3 3.6|366813|33|CP025594|CRISPRCasFinder 366813-366845 33 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 99166-99198 10 0.697
CP025594_6 6.2|926677|39|CP025594|CRT 926677-926715 39 NZ_CP044080 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence 107058-107096 10 0.744
CP025594_6 6.5|926830|36|CP025594|CRT 926830-926865 36 KX683875 Mycobacterium phage Baehexic, complete genome 12172-12207 10 0.722
CP025594_6 6.5|926830|36|CP025594|CRT 926830-926865 36 KM197169 Mycobacterium phage Piro94, complete genome 12169-12204 10 0.722
CP025594_6 6.5|926830|36|CP025594|CRT 926830-926865 36 MF668269 Mycobacterium phage Drake55, complete genome 12168-12203 10 0.722
CP025594_6 6.5|926830|36|CP025594|CRT 926830-926865 36 MK284522 Mycobacterium phage Malec, complete genome 11941-11976 10 0.722
CP025594_6 6.5|926830|36|CP025594|CRT 926830-926865 36 KM677210 Mycobacterium phage Larenn, complete genome 11936-11971 10 0.722
CP025594_6 6.17|927367|36|CP025594|CRT 927367-927402 36 MN369764 Mycobacterium phage Rahalelujah, complete genome 24340-24375 10 0.722
CP025594_6 6.17|927367|36|CP025594|CRT 927367-927402 36 NZ_CP025548 Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence 25147-25182 10 0.722
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2210946-2210979 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 1732364-1732397 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP034352 Streptomyces sp. W1SF4 plasmid p2, complete sequence 21676-21709 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 CP000620 Burkholderia vietnamiensis G4 plasmid pBVIE04, complete sequence 96060-96093 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP020810 Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed1, complete sequence 93944-93977 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NC_016588 Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence 98684-98717 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 MK524490 Mycobacterium phage Donny, complete genome 33811-33844 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 MK494095 Mycobacterium phage Daegal, complete genome 5959-5992 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 JN699007 Mycobacterium phage Acadian, complete genome 33806-33839 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 MT889381 Mycobacterium phage Suigeneris, complete genome 33811-33844 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP015373 Pandoraea pnomenusa strain MCB032 plasmid unnamed 2, complete sequence 47518-47551 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 AP018709 Uncultured bacterium plasmid pSN1104-59 DNA, complete sequence 27460-27493 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP013744 Streptomyces sp. CdTB01 plasmid unnamed, complete sequence 194712-194745 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NC_016623 Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence 362178-362211 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NC_008766 Acidovorax sp. JS42 plasmid pAOVO02, complete sequence 10252-10285 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 677361-677394 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP019238 Rhodoferax koreense strain DCY-110 plasmid unnamed2 8446-8479 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP019238 Rhodoferax koreense strain DCY-110 plasmid unnamed2 65893-65926 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP054616 Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence 640930-640963 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NC_021077 Comamonas sp. 7D-2 plasmid pBHB, complete sequence 104485-104518 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NC_024998 Acidovorax avenae subsp. avenae plasmid pAAA83 DNA, complete sequence, strain: 83 31366-31399 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NC_008385 Burkholderia ambifaria AMMD plasmid unnamed1, complete sequence 29995-30028 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP018471 Xanthomonas vesicatoria strain LM159 plasmid pLM159.2, complete sequence 16577-16610 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_KJ588780 Achromobacter xylosoxidans strain A22732 plasmid pA22732-IMP, complete sequence 15929-15962 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_MN366359 Bacterium plasmid pALTS31, complete sequence 15929-15962 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP027024 Streptomyces sp. WAC00288 plasmid p2, complete sequence 100724-100757 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NC_001735 Enterobacter aerogenes plasmid R751, complete sequence 31148-31181 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 AGRM01000006 Salmonella enterica subsp. houtenae str. ATCC BAA-1581 plasmid pSEHO0A1, complete sequence, whole genome shotgun sequence 12357-12390 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 AJ863570 Uncultured bacterium IncP-1beta multiresistance plasmid pB8 25168-25201 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP034651 Xanthomonas vasicola strain NCPPB 1060 plasmid pXVH45, complete sequence 17683-17716 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 1350942-1350975 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 136497-136530 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NC_021492 Enterobacter sp. R4-368 plasmid pENT01, complete sequence 46815-46848 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 JX469828 Uncultured bacterium plasmid pRSB223, complete sequence 25131-25164 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 JX469829 Uncultured bacterium plasmid pB1, complete sequence 16215-16248 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 JX469831 Uncultured bacterium plasmid pKSP212, complete sequence 15929-15962 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 JN106172 Uncultured bacterium plasmid pAKD29, complete sequence 15931-15964 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 JN106173 Uncultured bacterium plasmid pAKD31, complete sequence 15929-15962 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 JN106174 Uncultured bacterium plasmid pAKD33, complete sequence 15932-15965 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 JN106164 Uncultured bacterium plasmid pAKD1, complete sequence 15939-15972 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 JN106165 Uncultured bacterium plasmid pAKD14, complete sequence 15929-15962 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 JN106166 Uncultured bacterium plasmid pAKD15, complete sequence 15929-15962 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 JN106168 Uncultured bacterium plasmid pAKD17, complete sequence 15929-15962 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 JN106169 Uncultured bacterium plasmid pAKD18, complete sequence 15929-15962 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 MN386974 Pseudomonas aeruginosa strain 1943 plasmid pPaeBURNS1, complete sequence 16066-16099 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NC_001381 Mycobacterium fortuitum plasmid pAL5000, complete sequence 2682-2715 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 MG879028 Uncultured bacterium plasmid pEG1-1, complete sequence 31441-31474 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP021650 Acidovorax sp. T1 plasmid p2-T1, complete sequence 40579-40612 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 JX486125 Uncultured bacterium plasmid pRWC72a, complete sequence 15940-15973 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP038640 Cupriavidus oxalaticus strain X32 plasmid unnamed5, complete sequence 50284-50317 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 AJ639924 Uncultured bacterium plasmid pB3 complete genome 17431-17464 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 KU356987 Variovorax paradoxus plasmid pBS64, complete sequence 15928-15961 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 KU356988 Variovorax paradoxus plasmid pHB44, complete sequence 15930-15963 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 CP042595 Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence 155712-155745 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP009797 Burkholderia ambifaria AMMD plasmid pBII_1, complete sequence 16433-16466 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NC_013176 Pseudomonas putida plasmid pW2, complete sequence 10533-10566 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NC_019320 Variovorax sp. DB1 plasmid pDB1, complete sequence 49358-49391 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP017455 Dickeya solani strain PPO 9019 plasmid unnamed, complete sequence 23524-23557 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NC_007337 Cupriavidus pinatubonensis JMP134 plasmid 1, complete sequence 71777-71810 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_MN366358 Bacterium plasmid pALTS29, complete sequence 15940-15973 10 0.706
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 MN234219 Mycobacterium phage Mercurio, complete genome 23308-23341 10 0.706
CP025594_8 8.9|1212373|37|CP025594|CRISPRCasFinder 1212373-1212409 37 NZ_CP012182 Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence 331923-331959 10 0.73
CP025594_8 8.9|1212373|37|CP025594|CRISPRCasFinder 1212373-1212409 37 NZ_CP012185 Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence 716620-716656 10 0.73
CP025594_9 9.10|1572767|31|CP025594|CRISPRCasFinder 1572767-1572797 31 NC_017273 Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence 425898-425928 10 0.677
CP025594_9 9.10|1572767|31|CP025594|CRISPRCasFinder 1572767-1572797 31 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 344090-344120 10 0.677
CP025594_9 9.10|1572767|31|CP025594|CRISPRCasFinder 1572767-1572797 31 NC_008269 Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence 68383-68413 10 0.677
CP025594_9 9.10|1572767|31|CP025594|CRISPRCasFinder 1572767-1572797 31 NC_017590 Thermus thermophilus JL-18 plasmid pTTJL1802, complete sequence 16322-16352 10 0.677
CP025594_9 9.10|1572767|31|CP025594|CRISPRCasFinder 1572767-1572797 31 NZ_AP014581 Burkholderia sp. RPE67 plasmid p3, complete sequence 131907-131937 10 0.677
CP025594_9 9.13|1573016|34|CP025594|CRISPRCasFinder 1573016-1573049 34 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 1081518-1081551 10 0.706
CP025594_12 12.9|3119764|35|CP025594|PILER-CR,CRISPRCasFinder,CRT 3119764-3119798 35 NZ_AP022607 Mycobacterium branderi strain JCM 12687 plasmid pJCM12687 414652-414686 10 0.714
CP025594_13 13.20|3123236|34|CP025594|CRISPRCasFinder,CRT,PILER-CR 3123236-3123269 34 NZ_AP022335 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence 171698-171731 10 0.706
CP025594_14 14.5|3740970|34|CP025594|CRT 3740970-3741003 34 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 470079-470112 10 0.706
CP025594_14 14.5|3740970|34|CP025594|CRT 3740970-3741003 34 NZ_CP024986 Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence 68774-68807 10 0.706
CP025594_14 14.5|3740970|34|CP025594|CRT 3740970-3741003 34 NC_024970 Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence 172270-172303 10 0.706
CP025594_14 14.5|3740970|34|CP025594|CRT 3740970-3741003 34 NZ_KJ396772 Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence 172270-172303 10 0.706
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 NZ_CP032676 Rhodococcus rhodochrous strain ATCC BAA870 plasmid pNit, complete sequence 384747-384779 11 0.667
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 350092-350125 11 0.676
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP041045 Paracoccus sp. AK26 plasmid pAK1, complete sequence 239254-239287 11 0.676
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 MH051334 Escherichia phage vB_EcoS-Ro145c2YLVW, complete genome 23136-23169 11 0.676
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 MG852086 Escherichia phage vB_EcoS-Ro145clw, complete genome 41310-41343 11 0.676
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP025547 Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence 261086-261119 11 0.676
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 584732-584765 11 0.676
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP020372 Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence 70292-70325 11 0.676
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP054616 Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence 507461-507494 11 0.676
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 ASHF01000034 Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence 155836-155869 11 0.676
CP025594_14 14.5|3740970|34|CP025594|CRT 3740970-3741003 34 NZ_CP029831 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence 326578-326611 11 0.676
CP025594_1 1.8|335838|33|CP025594|CRT 335838-335870 33 NC_023285 Streptomyces sp. F8 plasmid pFRL5, complete sequence 324416-324448 12 0.636
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_AP022333 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence 190139-190172 12 0.647
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_CP026703 Serratia marcescens strain AR_0027 plasmid unitig_1_pilon, complete sequence 14966-14999 12 0.647
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_LR594669 Variovorax sp. SRS16 plasmid 4 302491-302524 14 0.588
CP025594_8 8.3|1212070|34|CP025594|CRISPRCasFinder 1212070-1212103 34 NZ_LR594673 Variovorax sp. PBL-E5 plasmid 3 282346-282379 15 0.559

1. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to MN369739 (Mycobacterium phage Kenuha5, complete genome) position: , mismatch: 0, identity: 1.0

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggtgtc	Protospacer
**********************

2. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to MK359343 (Mycobacterium phage Pollywog, complete genome) position: , mismatch: 0, identity: 1.0

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggtgtc	Protospacer
**********************

3. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to MG925354 (Mycobacterium phage Ogopogo, complete genome) position: , mismatch: 0, identity: 1.0

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggtgtc	Protospacer
**********************

4. spacer 8.7|1212289|22|CP025594|CRISPRCasFinder matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 1, identity: 0.955

tgtcggcggtgccggcggtgtc	CRISPR spacer
tgtcggcggtgccggcggtgcc	Protospacer
********************.*

5. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

6. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

7. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

8. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

9. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

10. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

11. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

12. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

13. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

14. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

15. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

16. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

17. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

18. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

19. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

20. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

21. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

22. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

23. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

24. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

25. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

26. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

27. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

28. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

29. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

30. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

31. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

32. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

33. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

34. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

35. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

36. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

37. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

38. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

39. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

40. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to MT522000 (Mycobacterium phage Soul22, complete genome) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggcgtc	Protospacer
******************.***

41. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NC_042030 (Mycobacterium phage Yoshi, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggcgtc	Protospacer
******************.***

42. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NC_048729 (Mycobacterium phage Renaud18, complete genome) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggcgtc	Protospacer
******************.***

43. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NC_026585 (Mycobacteriophage Estave1, complete genome) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggcgtc	Protospacer
******************.***

44. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to DQ398049 (Mycobacterium phage Pipefish, complete genome) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cggcggcggcgtcggcggtgtc	Protospacer
** *******************

45. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to MH077585 (Mycobacterium phage TChen, complete genome) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggcgtc	Protospacer
******************.***

46. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NC_048788 (Mycobacterium phage ThetaBob, complete genome) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggcgtc	Protospacer
******************.***

47. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

48. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

49. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NC_014753 (Oceanithermus profundus DSM 14977 plasmid pOCEPR01, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggcgtc	Protospacer
******************.***

50. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NC_021056 (Streptomyces sp. PAMC 26508 plasmid pSP01, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggtgtcggcggtgtc	Protospacer
*********.************

51. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcgccggtgtc	Protospacer
************** *******

52. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

53. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

54. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

55. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

56. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

57. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

58. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

59. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

60. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

61. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcctcggcggtgtc	Protospacer
********** ***********

62. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to MN369761 (Mycobacterium phage Malthus, complete genome) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggcgtc	Protospacer
******************.***

63. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to KJ944841 (Mycobacterium phage Cheetobro, complete genome) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggcgtc	Protospacer
******************.***

64. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to AP018469 (Mycobacterium phage Y10 DNA, complete genome, note: sample1) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggcgtc	Protospacer
******************.***

65. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to KY087992 (Mycobacterium phage Mitti, complete genome) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggcgtc	Protospacer
******************.***

66. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to MF140402 (Mycobacterium phage Chancellor, complete genome) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggcgtc	Protospacer
******************.***

67. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to AP018470 (Mycobacterium phage Y2 DNA, complete genome) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggcgtc	Protospacer
******************.***

68. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to KT361920 (Mycobacterium phage Slarp, complete genome) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggcgtc	Protospacer
******************.***

69. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to MH926058 (Mycobacterium phage Reptar3000, complete genome) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggcgtc	Protospacer
******************.***

70. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to MT310882 (Mycobacterium phage JF1, complete genome) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggcgtc	Protospacer
******************.***

71. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to AP018471 (Mycobacterium phage Y10 DNA, complete genome, note: sample2) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggcgtc	Protospacer
******************.***

72. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to MF140435 (Mycobacterium phage Wintermute, complete genome) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggcgtc	Protospacer
******************.***

73. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NC_027365 (Mycobacterium virus Fionnbarth, complete genome) position: , mismatch: 1, identity: 0.955

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggcgtc	Protospacer
******************.***

74. spacer 9.4|1572320|22|CP025594|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 1, identity: 0.955

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccggcggcc	Protospacer
********************* 

75. spacer 9.4|1572320|22|CP025594|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccggcggcc	Protospacer
********************* 

76. spacer 9.4|1572320|22|CP025594|CRISPRCasFinder matches to NZ_CP016457 (Sphingobium sp. RAC03 plasmid pBSY17_2, complete sequence) position: , mismatch: 1, identity: 0.955

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcgggccggcggca	Protospacer
**********.***********

77. spacer 9.15|1573139|22|CP025594|CRISPRCasFinder matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.955

caatccggcggcgccgccggca	CRISPR spacer
caattcggcggcgccgccggca	Protospacer
****.*****************

78. spacer 9.15|1573139|22|CP025594|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

caatccggcggcgccgccggca	CRISPR spacer
caattcggcggcgccgccggca	Protospacer
****.*****************

79. spacer 9.15|1573139|22|CP025594|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 1, identity: 0.955

caatccggcggcgccgccggca	CRISPR spacer
caattcggcggcgccgccggca	Protospacer
****.*****************

80. spacer 9.15|1573139|22|CP025594|CRISPRCasFinder matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 1, identity: 0.955

caatccggcggcgccgccggca	CRISPR spacer
caattcggcggcgccgccggca	Protospacer
****.*****************

81. spacer 1.7|335793|24|CP025594|CRT matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 2, identity: 0.917

atgagcccgccggcgccgccgttg	CRISPR spacer
aagagcacgccggcgccgccgttg	Protospacer
* **** *****************

82. spacer 1.7|335793|24|CP025594|CRT matches to NZ_CP025513 (Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.917

atgagcccgccggcgccgccgttg	CRISPR spacer
atgaggacgccggcgccgccgttg	Protospacer
*****  *****************

83. spacer 8.7|1212289|22|CP025594|CRISPRCasFinder matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
tgtcggcggtgccggcggtggg	Protospacer
********************  

84. spacer 8.7|1212289|22|CP025594|CRISPRCasFinder matches to NC_015314 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
agtcggcggtgccgacggtgtc	Protospacer
 *************.*******

85. spacer 8.7|1212289|22|CP025594|CRISPRCasFinder matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
cgtcggcggtgccggcggcgtc	Protospacer
.*****************.***

86. spacer 8.7|1212289|22|CP025594|CRISPRCasFinder matches to NC_021056 (Streptomyces sp. PAMC 26508 plasmid pSP01, complete sequence) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
cgtcggcggtgtcggcggtgtc	Protospacer
.**********.**********

87. spacer 8.7|1212289|22|CP025594|CRISPRCasFinder matches to NZ_CP045122 (Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
ggtcggcggtgccggcggcgtc	Protospacer
 *****************.***

88. spacer 8.7|1212289|22|CP025594|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
tgtcggcggtgccggccgtgta	Protospacer
**************** **** 

89. spacer 8.7|1212289|22|CP025594|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
tgtcggcggtgccggccgtgta	Protospacer
**************** **** 

90. spacer 8.7|1212289|22|CP025594|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
ggtcggcggtgccggccgtgtc	Protospacer
 *************** *****

91. spacer 8.7|1212289|22|CP025594|CRISPRCasFinder matches to NC_047977 (Microbacterium phage Hendrix, complete genome) position: , mismatch: 2, identity: 0.909

tgtcggcggtgccggcggtgtc	CRISPR spacer
tgacggcggtgccggcggtgtg	Protospacer
** ****************** 

92. spacer 8.15|1212673|22|CP025594|CRISPRCasFinder matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 2, identity: 0.909

ggacggtggtaccggcggtcag	CRISPR spacer
tgacggtggtgccggcggtcag	Protospacer
 *********.***********

93. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909

cgtcggcggcgtcggcggtgtc	CRISPR spacer
ggtcggcggcgtcggcggtgta	Protospacer
 ******************** 

94. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NC_008271 (Rhodococcus jostii RHA1 plasmid pRHL3, complete sequence) position: , mismatch: 2, identity: 0.909

cgtcggcggcgtcggcggtgtc	CRISPR spacer
tgtcggcggcgtcgacggtgtc	Protospacer
.*************.*******

95. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909

cgtcggcggcgtcggcggtgtc	CRISPR spacer
ggtcggcggcgtcggcggtgcc	Protospacer
 *******************.*

96. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 2, identity: 0.909

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggcgtg	Protospacer
******************.** 

97. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 2, identity: 0.909

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggcgtt	Protospacer
******************.**.

98. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 2, identity: 0.909

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggcgtt	Protospacer
******************.**.

99. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NC_041989 (Mycobacterium phage Shauna1, complete genome) position: , mismatch: 2, identity: 0.909

cgtcggcggcgtcggcggtgtc	CRISPR spacer
ggtcggcggcgtcggcggcgtc	Protospacer
 *****************.***

100. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to MT889380 (Mycobacterium phage Coco12, complete genome) position: , mismatch: 2, identity: 0.909

cgtcggcggcgtcggcggtgtc	CRISPR spacer
ggtcggcggcgtcggcggcgtc	Protospacer
 *****************.***

101. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to KY702574 (Mycobacterium phage Kingsley, complete genome) position: , mismatch: 2, identity: 0.909

cgtcggcggcgtcggcggtgtc	CRISPR spacer
ggtcggcggcgtcggcggcgtc	Protospacer
 *****************.***

102. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 2, identity: 0.909

cgtcggcggcgtcggcggtgtc	CRISPR spacer
ggtcggcggcgtcggcggcgtc	Protospacer
 *****************.***

103. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 2, identity: 0.909

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggcgtt	Protospacer
******************.**.

104. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NZ_CP015530 (Rhodococcus sp. WB1 plasmid pWB1, complete sequence) position: , mismatch: 2, identity: 0.909

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcgccggtgtg	Protospacer
************** ****** 

105. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 2, identity: 0.909

cgtcggcggcgtcggcggtgtc	CRISPR spacer
tgtcggcggcggcggcggtgtc	Protospacer
.********** **********

106. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 2, identity: 0.909

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcggcggcgtt	Protospacer
******************.**.

107. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NZ_CP034156 (Rhodococcus sp. NJ-530 plasmid unnamed4, complete sequence) position: , mismatch: 2, identity: 0.909

cgtcggcggcgtcggcggtgtc	CRISPR spacer
cgtcggcggcgtcgtcggtgtg	Protospacer
************** ****** 

108. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to MF541410 (Streptomyces phage Ozzie, complete genome) position: , mismatch: 2, identity: 0.909

cgtcggcggcgtcggcggtgtc	CRISPR spacer
ggttggcggcgtcggcggtgtc	Protospacer
 **.******************

109. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to MF541403 (Streptomyces phage BeardedLady, complete genome) position: , mismatch: 2, identity: 0.909

cgtcggcggcgtcggcggtgtc	CRISPR spacer
ggttggcggcgtcggcggtgtc	Protospacer
 **.******************

110. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to NC_028892 (Streptomyces phage Caliburn, complete genome) position: , mismatch: 2, identity: 0.909

cgtcggcggcgtcggcggtgtc	CRISPR spacer
ggttggcggcgtcggcggtgtc	Protospacer
 **.******************

111. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to MF541409 (Streptomyces phage Oliynyk, complete genome) position: , mismatch: 2, identity: 0.909

cgtcggcggcgtcggcggtgtc	CRISPR spacer
ggttggcggcgtcggcggtgtc	Protospacer
 **.******************

112. spacer 8.17|1212763|22|CP025594|CRISPRCasFinder matches to KT124229 (Streptomyces phage Hydra, complete genome) position: , mismatch: 2, identity: 0.909

cgtcggcggcgtcggcggtgtc	CRISPR spacer
ggttggcggcgtcggcggtgtc	Protospacer
 **.******************

113. spacer 9.2|1572212|22|CP025594|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909

gttgccgattaggacggcggcc	CRISPR spacer
cttgccgatcaggacggcggcc	Protospacer
 ********.************

114. spacer 9.2|1572212|22|CP025594|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 2, identity: 0.909

gttgccgattaggacggcggcc	CRISPR spacer
cttgccgatcaggacggcggcc	Protospacer
 ********.************

115. spacer 9.2|1572212|22|CP025594|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909

gttgccgattaggacggcggcc	CRISPR spacer
cttgccgatcaggacggcggcc	Protospacer
 ********.************

116. spacer 9.2|1572212|22|CP025594|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909

gttgccgattaggacggcggcc	CRISPR spacer
cttgccgatcaggacggcggcc	Protospacer
 ********.************

117. spacer 9.2|1572212|22|CP025594|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 2, identity: 0.909

gttgccgattaggacggcggcc	CRISPR spacer
cttgccgatcaggacggcggcc	Protospacer
 ********.************

118. spacer 9.3|1572266|22|CP025594|CRISPRCasFinder matches to NZ_CP025510 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvD, complete sequence) position: , mismatch: 2, identity: 0.909

ggtaccgtcctcgccggcggtg	CRISPR spacer
ggcaccgtcctcgccggcggtt	Protospacer
**.****************** 

119. spacer 9.4|1572320|22|CP025594|CRISPRCasFinder matches to NZ_CP021032 (Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcc	Protospacer
.******************** 

120. spacer 9.4|1572320|22|CP025594|CRISPRCasFinder matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

121. spacer 9.4|1572320|22|CP025594|CRISPRCasFinder matches to NZ_CP021028 (Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

122. spacer 9.4|1572320|22|CP025594|CRISPRCasFinder matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcc	Protospacer
.******************** 

123. spacer 9.4|1572320|22|CP025594|CRISPRCasFinder matches to NZ_CP013503 (Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

124. spacer 9.4|1572320|22|CP025594|CRISPRCasFinder matches to NZ_CP013509 (Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

125. spacer 9.4|1572320|22|CP025594|CRISPRCasFinder matches to NZ_CP013520 (Rhizobium sp. N113 plasmid pRspN113c, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

126. spacer 9.4|1572320|22|CP025594|CRISPRCasFinder matches to NZ_CP013493 (Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

127. spacer 9.4|1572320|22|CP025594|CRISPRCasFinder matches to NZ_CP013516 (Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

128. spacer 9.4|1572320|22|CP025594|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccggcgggg	Protospacer
******************** .

129. spacer 9.4|1572320|22|CP025594|CRISPRCasFinder matches to NZ_CP012698 (Microbacterium sp. No. 7 plasmid A, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
accgccgatcaggccggcggca	Protospacer
..********************

130. spacer 9.4|1572320|22|CP025594|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
ctcggcgatcaggccggcggca	Protospacer
 *** *****************

131. spacer 9.4|1572320|22|CP025594|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatccggccggcggct	Protospacer
********** ********** 

132. spacer 9.4|1572320|22|CP025594|CRISPRCasFinder matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccgggggcc	Protospacer
***************** *** 

133. spacer 9.4|1572320|22|CP025594|CRISPRCasFinder matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccgggggcc	Protospacer
***************** *** 

134. spacer 9.4|1572320|22|CP025594|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatccggccggcggct	Protospacer
********** ********** 

135. spacer 9.4|1572320|22|CP025594|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccgggggcg	Protospacer
***************** ***.

136. spacer 9.4|1572320|22|CP025594|CRISPRCasFinder matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
ggcgccgatcaggccggcggcc	Protospacer
* ******************* 

137. spacer 9.4|1572320|22|CP025594|CRISPRCasFinder matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggcctgcggcg	Protospacer
*************** *****.

138. spacer 9.4|1572320|22|CP025594|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatccggccggcggct	Protospacer
********** ********** 

139. spacer 9.4|1572320|22|CP025594|CRISPRCasFinder matches to NZ_CP024312 (Rhizobium sp. NXC24 plasmid pRspNXC24a, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccggcgccg	Protospacer
******************* *.

140. spacer 9.4|1572320|22|CP025594|CRISPRCasFinder matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgagcaggccggcggcc	Protospacer
******** ************ 

141. spacer 9.4|1572320|22|CP025594|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccgggggcc	Protospacer
***************** *** 

142. spacer 9.5|1572374|25|CP025594|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92

cttgccgaacacgccgaagccgtcg	CRISPR spacer
cttgccgaacccgccgaacccgtcg	Protospacer
********** ******* ******

143. spacer 9.5|1572374|25|CP025594|CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92

cttgccgaacacgccgaagccgtcg	CRISPR spacer
cttgccgaacccgccgaacccgtcg	Protospacer
********** ******* ******

144. spacer 9.5|1572374|25|CP025594|CRISPRCasFinder matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92

cttgccgaacacgccgaagccgtcg	CRISPR spacer
cttgccgaacccgccgaacccgtcg	Protospacer
********** ******* ******

145. spacer 1.7|335793|24|CP025594|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

atgagcccgccggcgccgccgttg	CRISPR spacer
ttgagccagccggcgccgccgttc	Protospacer
 ****** *************** 

146. spacer 1.7|335793|24|CP025594|CRT matches to MN010758 (Gordonia phage Dardanus, complete genome) position: , mismatch: 3, identity: 0.875

atgagcccgccggcgccgccgttg	CRISPR spacer
gtgaacccgccggcgccgccgttc	Protospacer
.***.****************** 

147. spacer 1.7|335793|24|CP025594|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

atgagcccgccggcgccgccgttg	CRISPR spacer
gtcagcgcgccggcgccgccgttg	Protospacer
.* *** *****************

148. spacer 1.7|335793|24|CP025594|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

atgagcccgccggcgccgccgttg	CRISPR spacer
gtcagcgcgccggcgccgccgttg	Protospacer
.* *** *****************

149. spacer 1.7|335793|24|CP025594|CRT matches to NZ_CP044330 (Methylocystis rosea strain BRCS1 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.875

atgagcccgccggcgccgccgttg	CRISPR spacer
ctgacgccgccggcgccgccgttg	Protospacer
 ***  ******************

150. spacer 1.7|335793|24|CP025594|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 3, identity: 0.875

atgagcccgccggcgccgccgttg	CRISPR spacer
atcagcccgccggcgccgccgaag	Protospacer
** ******************  *

151. spacer 1.7|335793|24|CP025594|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

atgagcccgccggcgccgccgttg	CRISPR spacer
gtcagcgcgccggcgccgccgttg	Protospacer
.* *** *****************

152. spacer 1.7|335793|24|CP025594|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

atgagcccgccggcgccgccgttg	CRISPR spacer
gtcagcgcgccggcgccgccgttg	Protospacer
.* *** *****************

153. spacer 1.7|335793|24|CP025594|CRT matches to MT740732 (Ralstonia phage Darius, complete genome) position: , mismatch: 3, identity: 0.875

atgagcccgccggcgccgccgttg	CRISPR spacer
ctgagcccgccggcgccgccatag	Protospacer
 *******************.* *

154. spacer 1.7|335793|24|CP025594|CRT matches to MH638294 (Ralstonia phage GP4, complete genome) position: , mismatch: 3, identity: 0.875

atgagcccgccggcgccgccgttg	CRISPR spacer
ctgagcccgccggcgccgccatag	Protospacer
 *******************.* *

155. spacer 1.7|335793|24|CP025594|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875

atgagcccgccggcgccgccgttg	CRISPR spacer
gtcagcgcgccggcgccgccgttg	Protospacer
.* *** *****************

156. spacer 1.7|335793|24|CP025594|CRT matches to NZ_CP025550 (Mycobacterium paragordonae strain 49061 plasmid unnamed4, complete sequence) position: , mismatch: 3, identity: 0.875

atgagcccgccggcgccgccgttg	CRISPR spacer
atgagcccgccagcgccgccgcgg	Protospacer
***********.*********. *

157. spacer 1.7|335793|24|CP025594|CRT matches to NZ_CP034088 (Methylocystis rosea strain GW6 plasmid pGW6_2, complete sequence) position: , mismatch: 3, identity: 0.875

atgagcccgccggcgccgccgttg	CRISPR spacer
ctgacgccgccggcgccgccgttg	Protospacer
 ***  ******************

158. spacer 1.7|335793|24|CP025594|CRT matches to MT740740 (Ralstonia phage Gervaise, complete genome) position: , mismatch: 3, identity: 0.875

atgagcccgccggcgccgccgttg	CRISPR spacer
ctgagcccgccggcgccgccatag	Protospacer
 *******************.* *

159. spacer 6.16|927325|24|CP025594|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
gaccgacctcggcggcgcgggcga	Protospacer
.***************** ****.

160. spacer 6.16|927325|24|CP025594|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
caccggcctgggcggcgctggcgg	Protospacer
 ****.*** **************

161. spacer 6.16|927325|24|CP025594|CRT matches to NZ_CP034768 (Enterobacter sp. N18-03635 plasmid pFRI-6, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
taacgtcctcggcggcgctggcgg	Protospacer
 * ** ******************

162. spacer 6.16|927325|24|CP025594|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
agccgacctcggcggcgatggcgc	Protospacer
*.*************** ***** 

163. spacer 6.16|927325|24|CP025594|CRT matches to NZ_AP019631 (Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
taacgtcctcggcggcgctggcgg	Protospacer
 * ** ******************

164. spacer 6.16|927325|24|CP025594|CRT matches to NZ_AP019631 (Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
taacgtcctcggcggcgctggcgg	Protospacer
 * ** ******************

165. spacer 6.16|927325|24|CP025594|CRT matches to KU716094 (Mycobacterium phage Eidsmoe, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
gaccgcgctcggcggcgctggcgg	Protospacer
.****  *****************

166. spacer 6.16|927325|24|CP025594|CRT matches to MH371122 (Mycobacterium phage Priya, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
gaccgcgctcggcggcgctggcgg	Protospacer
.****  *****************

167. spacer 6.16|927325|24|CP025594|CRT matches to MK016502 (Mycobacterium phage Pat3, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
catcggcctcggcggcgctggcgg	Protospacer
 *.**.******************

168. spacer 6.16|927325|24|CP025594|CRT matches to MK937593 (Mycobacterium phage Flypotenuse, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
catcggcctcggcggcgctggcgg	Protospacer
 *.**.******************

169. spacer 6.16|927325|24|CP025594|CRT matches to MG872835 (Mycobacterium phage Conquerage, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
gaccgcgctcggcggcgctggcgg	Protospacer
.****  *****************

170. spacer 6.16|927325|24|CP025594|CRT matches to MH536820 (Mycobacterium phage Glexan, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
catcggcctcggcggcgctggcgg	Protospacer
 *.**.******************

171. spacer 6.16|927325|24|CP025594|CRT matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
aaccggcctcggcggcgctgccgc	Protospacer
*****.************** ** 

172. spacer 6.16|927325|24|CP025594|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
caccgagctcggcggcgctgccgg	Protospacer
 ***** ************* ***

173. spacer 6.16|927325|24|CP025594|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
caccggcctcggcggcgcgggcgg	Protospacer
 ****.************ *****

174. spacer 6.16|927325|24|CP025594|CRT matches to MH271298 (Microbacterium phage Floof, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
aacccacctcggcggcgatggcgc	Protospacer
**** ************ ***** 

175. spacer 8.4|1212127|25|CP025594|CRISPRCasFinder matches to MN703413 (Arthrobacter phage Powerpuff, complete genome) position: , mismatch: 3, identity: 0.88

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgcgggcggcctcggcgtagcgctt	Protospacer
*** *******************..

176. spacer 8.4|1212127|25|CP025594|CRISPRCasFinder matches to MT024871 (Arthrobacter phage YesChef, complete genome) position: , mismatch: 3, identity: 0.88

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgcgggcggcctcggcgtagcgctt	Protospacer
*** *******************..

177. spacer 8.7|1212289|22|CP025594|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 3, identity: 0.864

tgtcggcggtgccggcggtgtc	CRISPR spacer
cgtcggcggtgccggcggtgag	Protospacer
.*******************  

178. spacer 8.7|1212289|22|CP025594|CRISPRCasFinder matches to NZ_CP040721 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.864

tgtcggcggtgccggcggtgtc	CRISPR spacer
gtgcggcggtgccggcggtgtc	Protospacer
   *******************

179. spacer 8.7|1212289|22|CP025594|CRISPRCasFinder matches to NZ_CP040721 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.864

tgtcggcggtgccggcggtgtc	CRISPR spacer
gtgcggcggtgccggcggtgtc	Protospacer
   *******************

180. spacer 8.7|1212289|22|CP025594|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 3, identity: 0.864

tgtcggcggtgccggcggtgtc	CRISPR spacer
cgtcggcggtgccggcggtgag	Protospacer
.*******************  

181. spacer 8.7|1212289|22|CP025594|CRISPRCasFinder matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 3, identity: 0.864

tgtcggcggtgccggcggtgtc	CRISPR spacer
cgtcggcggtgccggcggtggt	Protospacer
.******************* .

182. spacer 8.7|1212289|22|CP025594|CRISPRCasFinder matches to KT381864 (Thiobacimonas phage vB_ThpS-P1, complete genome) position: , mismatch: 3, identity: 0.864

tgtcggcggtgccggcggtgtc	CRISPR spacer
catcggcggtgccggcggtgtg	Protospacer
..******************* 

183. spacer 8.11|1212472|22|CP025594|CRISPRCasFinder matches to NZ_CP048287 (Paenibacillus sp. 14171R-81 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.864

gctgtggggcggcggtggtgcc	CRISPR spacer
cgtgtggggcggcggtggtgca	Protospacer
  ******************* 

184. spacer 9.4|1572320|22|CP025594|CRISPRCasFinder matches to NZ_KY349138 (Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence) position: , mismatch: 3, identity: 0.864

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccggcgcgg	Protospacer
*******************  .

185. spacer 9.4|1572320|22|CP025594|CRISPRCasFinder matches to NZ_CP021649 (Acidovorax sp. T1 plasmid p1-T1, complete sequence) position: , mismatch: 3, identity: 0.864

gtcgccgatcaggccggcggca	CRISPR spacer
ttcgccgatcaggccggcggtg	Protospacer
 *******************..

186. spacer 9.5|1572374|25|CP025594|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
ctcgccgaacacgcggaagccgtct	Protospacer
**.*********** ********* 

187. spacer 9.5|1572374|25|CP025594|CRISPRCasFinder matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
attgtcgaacacgcggaagccgtcg	Protospacer
 ***.********* **********

188. spacer 9.5|1572374|25|CP025594|CRISPRCasFinder matches to MN586053 (Arthrobacter phage BeatusComedenti, complete genome) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gttgccgaactcgccgaagccgttg	Protospacer
 ********* ************.*

189. spacer 9.5|1572374|25|CP025594|CRISPRCasFinder matches to NC_031254 (Arthrobacter phage Kitkat, complete genome) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gttgccgaactcgccgaagccgttg	Protospacer
 ********* ************.*

190. spacer 9.5|1572374|25|CP025594|CRISPRCasFinder matches to NC_031231 (Arthrobacter phage KellEzio, complete genome) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gttgccgaactcgccgaagccgttg	Protospacer
 ********* ************.*

191. spacer 9.5|1572374|25|CP025594|CRISPRCasFinder matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
catgcggaacacgccgaatccgtcg	Protospacer
* *** ************ ******

192. spacer 9.5|1572374|25|CP025594|CRISPRCasFinder matches to NZ_CP030129 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
cttgccgatcacgccgtagccgttg	Protospacer
******** ******* ******.*

193. spacer 9.15|1573139|22|CP025594|CRISPRCasFinder matches to NC_008270 (Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence) position: , mismatch: 3, identity: 0.864

caatccggcggcgccgccggca	CRISPR spacer
gaatccggcggcgccgccgggc	Protospacer
 *******************  

194. spacer 10.5|2088445|24|CP025594|CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 3, identity: 0.875

atcgaagaagctgaacccgccgtt	CRISPR spacer
cgcgaagaagctgaagccgccgtt	Protospacer
  ************* ********

195. spacer 10.5|2088445|24|CP025594|CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 3, identity: 0.875

atcgaagaagctgaacccgccgtt	CRISPR spacer
cgcgaagaagctgaagccgccgtt	Protospacer
  ************* ********

196. spacer 1.7|335793|24|CP025594|CRT matches to NZ_CP021813 (Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence) position: , mismatch: 4, identity: 0.833

atgagcccgccggcgccgccgttg	CRISPR spacer
tcgagcccgccggcgccgccattc	Protospacer
 .******************.** 

197. spacer 1.7|335793|24|CP025594|CRT matches to NZ_CP040937 (Hymenobacter sp. DG01 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.833

atgagcccgccggcgccgccgttg	CRISPR spacer
tccagcccgccggcgccggcgttg	Protospacer
 . *************** *****

198. spacer 3.1|366483|27|CP025594|CRISPRCasFinder matches to NC_023591 (Mycobacterium phage Adler, complete genome) position: , mismatch: 4, identity: 0.852

-aacgcaccggtgtccacatcgcccgtg	CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg	Protospacer
 *..** ********* ***********

199. spacer 3.1|366483|27|CP025594|CRISPRCasFinder matches to KF981876 (UNVERIFIED: Mycobacterium phage ADLER F1725, complete genome) position: , mismatch: 4, identity: 0.852

-aacgcaccggtgtccacatcgcccgtg	CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg	Protospacer
 *..** ********* ***********

200. spacer 3.7|366879|27|CP025594|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 4, identity: 0.852

gcgaagccgatgttgtagctgccggtg	CRISPR spacer
ccgaagccgatgtcgtagcggccggcg	Protospacer
 ************.***** *****.*

201. spacer 3.10|367089|27|CP025594|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgaaggtgaggtcgccgggg	Protospacer
.* ********* ***********.**

202. spacer 3.10|367089|27|CP025594|CRISPRCasFinder matches to NC_016652 (Rhodococcus phage REQ2, complete genome) position: , mismatch: 4, identity: 0.852

accccgccgaagttgaggtcgccgagg	CRISPR spacer
acggcgccgaagttgaggccgccgacg	Protospacer
**  **************.****** *

203. spacer 4.2|631299|30|CP025594|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 4, identity: 0.867

accacgccggtgaccacgccg-ccaacgacg	CRISPR spacer
accacgccggtggccacgccgaccagcggc-	Protospacer
************.******** ***.**.* 

204. spacer 6.6|926884|27|CP025594|CRT matches to NZ_CP010326 (Pantoea sp. PSNIH1 plasmid pPSP-3a9, complete sequence) position: , mismatch: 4, identity: 0.852

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgtcagcggctgggctggcggggatat	Protospacer
********** ************* . 

205. spacer 6.6|926884|27|CP025594|CRT matches to NZ_CP021045 (Phaeobacter gallaeciensis strain P129 plasmid pP129_e, complete sequence) position: , mismatch: 4, identity: 0.852

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgacagcggcggggctggcggcgacag	Protospacer
** ****************** ** .*

206. spacer 6.6|926884|27|CP025594|CRT matches to NZ_CP010678 (Phaeobacter gallaeciensis strain P75 plasmid pP75_e, complete sequence) position: , mismatch: 4, identity: 0.852

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgacagcggcggggctggcggcgacag	Protospacer
** ****************** ** .*

207. spacer 6.6|926884|27|CP025594|CRT matches to NC_023142 (Phaeobacter gallaeciensis DSM 26640 plasmid pGal_F69, complete sequence) position: , mismatch: 4, identity: 0.852

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgacagcggcggggctggcggcgacag	Protospacer
** ****************** ** .*

208. spacer 6.6|926884|27|CP025594|CRT matches to NZ_CP010789 (Phaeobacter gallaeciensis strain P63 plasmid pP63_e, complete sequence) position: , mismatch: 4, identity: 0.852

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgacagcggcggggctggcggcgacag	Protospacer
** ****************** ** .*

209. spacer 6.6|926884|27|CP025594|CRT matches to NZ_CP010642 (Phaeobacter gallaeciensis strain P73 plasmid pP73_f, complete sequence) position: , mismatch: 4, identity: 0.852

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgacagcggcggggctggcggcgacag	Protospacer
** ****************** ** .*

210. spacer 6.6|926884|27|CP025594|CRT matches to NZ_CP010593 (Phaeobacter gallaeciensis strain P11 plasmid pP11_e, complete sequence) position: , mismatch: 4, identity: 0.852

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgacagcggcggggctggcggcgacag	Protospacer
** ****************** ** .*

211. spacer 6.6|926884|27|CP025594|CRT matches to AM419438 (Archaeal BJ1 virus complete genome) position: , mismatch: 4, identity: 0.852

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgtcggcggcgggggtggcgggggcgg	Protospacer
****.********* ********. **

212. spacer 6.6|926884|27|CP025594|CRT matches to NC_008695 (Archaeal BJ1 virus, complete genome) position: , mismatch: 4, identity: 0.852

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgtcggcggcgggggtggcgggggcgg	Protospacer
****.********* ********. **

213. spacer 6.10|927040|27|CP025594|CRT matches to KY945355 (Mycobacterium phage Shandong1, complete genome) position: , mismatch: 4, identity: 0.852

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cgcatccggcggcggcggttgcgttct	Protospacer
** **************** ***** .

214. spacer 6.10|927040|27|CP025594|CRT matches to NZ_CP015095 (Pelagibaca abyssi strain JLT2014 plasmid pPABY4, complete sequence) position: , mismatch: 4, identity: 0.852

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cggcctcggcggcggcggtggcgttgc	Protospacer
*** ..*************.*******

215. spacer 6.10|927040|27|CP025594|CRT matches to NC_041888 (Mycobacterium phage Tortellini, complete genome) position: , mismatch: 4, identity: 0.852

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cggccgcggcggcggcggtagcggtgc	Protospacer
*** . ***************** ***

216. spacer 6.15|927277|30|CP025594|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 4, identity: 0.867

cctgctgttcggctccggcggcgctggcgg-	CRISPR spacer
gctgctgttcggcgccggcggcg-tggtggc	Protospacer
 ************ ********* ***.** 

217. spacer 6.16|927325|24|CP025594|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ctacgaccacggcggcgctggcgg	Protospacer
   ***** ***************

218. spacer 6.16|927325|24|CP025594|CRT matches to NZ_CP025431 (Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
gcccgatctcggcggcgctggcgt	Protospacer
. ****.**************** 

219. spacer 6.16|927325|24|CP025594|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
tcccgacctcggcggtgctggcgc	Protospacer
  *************.******* 

220. spacer 6.16|927325|24|CP025594|CRT matches to NZ_CP016822 (Rhodococcus sp. p52 plasmid pDF03, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
cgtcgacgtcggcggcgctggcgg	Protospacer
 ..**** ****************

221. spacer 6.16|927325|24|CP025594|CRT matches to MN582086 (Siphoviridae sp. ctdEk19, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
cttcgacttcggcggcgctggcgg	Protospacer
  .****.****************

222. spacer 6.16|927325|24|CP025594|CRT matches to MF919502 (Mycobacterium phage Demsculpinboyz, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ccgcggcctcggcggcgctggcgg	Protospacer
   **.******************

223. spacer 6.16|927325|24|CP025594|CRT matches to MT889380 (Mycobacterium phage Coco12, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ccgcggcctcggcggcgctggcgg	Protospacer
   **.******************

224. spacer 6.16|927325|24|CP025594|CRT matches to NC_023698 (Mycobacterium phage Avani, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ccgcggcctcggcggcgctggcgg	Protospacer
   **.******************

225. spacer 6.16|927325|24|CP025594|CRT matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ccgcggcctcggcggcgctggcgg	Protospacer
   **.******************

226. spacer 6.16|927325|24|CP025594|CRT matches to NZ_CP050953 (Rhodococcus sp. DMU1 plasmid unnamed) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
cgccgacctcggcggcggtggcga	Protospacer
 .*************** *****.

227. spacer 6.16|927325|24|CP025594|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
tcccgacctcggcggtgctggcgc	Protospacer
  *************.******* 

228. spacer 6.16|927325|24|CP025594|CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ctacgaccacggcggcgctggcgg	Protospacer
   ***** ***************

229. spacer 6.16|927325|24|CP025594|CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
tctcgacctcggcggcgatggcgg	Protospacer
  .************** ******

230. spacer 6.16|927325|24|CP025594|CRT matches to MN096355 (Mycobacterium phage Purky, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
tgccgacctcggctgcgctggcgc	Protospacer
 .*********** ********* 

231. spacer 6.16|927325|24|CP025594|CRT matches to MK279853 (Gordonia phage Gray, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ggtcgacctcgacggcgctggcgg	Protospacer
...********.************

232. spacer 8.4|1212127|25|CP025594|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
ggccggcggcctcggcggagcgctg	Protospacer
 **************** *****. 

233. spacer 8.4|1212127|25|CP025594|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
ggccggcggcctcggcggagcgctg	Protospacer
 **************** *****. 

234. spacer 8.4|1212127|25|CP025594|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgtcggcggcctcgccgtagcgctt	Protospacer
**.*********** ********..

235. spacer 8.4|1212127|25|CP025594|CRISPRCasFinder matches to CP003956 (Rhodococcus opacus PD630 plasmid 7, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
gtccggcggccttggcgtagcgcct	Protospacer
  **********.***********.

236. spacer 8.4|1212127|25|CP025594|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgtcggcggcctcgccgtagcgctt	Protospacer
**.*********** ********..

237. spacer 8.4|1212127|25|CP025594|CRISPRCasFinder matches to NC_012723 (Burkholderia glumae BGR1 plasmid bglu_1p, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgccggcggccccggcgtcgcgcga	Protospacer
***********.****** ****  

238. spacer 8.4|1212127|25|CP025594|CRISPRCasFinder matches to NZ_CP032828 (Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgccggcggcctcggcgtaatggtc	Protospacer
*******************..* .*

239. spacer 8.4|1212127|25|CP025594|CRISPRCasFinder matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
cgccggcggcatcggcgtagcggcg	Protospacer
.********* *********** * 

240. spacer 8.4|1212127|25|CP025594|CRISPRCasFinder matches to CP054917 (Streptomyces sp. NA02950 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
cgccggcggcctccgcgtcgcgcct	Protospacer
.************ **** *****.

241. spacer 8.4|1212127|25|CP025594|CRISPRCasFinder matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
cgtcggcggcctcggcgtagcgggc	Protospacer
.*.*******************  *

242. spacer 8.4|1212127|25|CP025594|CRISPRCasFinder matches to NC_022437 (Pseudomonas fluorescens R124 plasmid pMP-R124, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
cgccggcggccgcgtcgtagcgcca	Protospacer
.********** ** ********* 

243. spacer 8.4|1212127|25|CP025594|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgtcggcggcctcgccgtagcgctt	Protospacer
**.*********** ********..

244. spacer 8.4|1212127|25|CP025594|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgccggtgtcctcggcgtagcgcga	Protospacer
******.* **************  

245. spacer 8.4|1212127|25|CP025594|CRISPRCasFinder matches to NZ_CP051294 (Mesorhizobium sp. NZP2077 plasmid pMSNZP2077A, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgccggcggcctccgcgaagcgctt	Protospacer
************* *** *****..

246. spacer 8.4|1212127|25|CP025594|CRISPRCasFinder matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
ggccggctgcctcggcatagcgccg	Protospacer
 ****** ********.******* 

247. spacer 8.4|1212127|25|CP025594|CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgtcggcggcctcgccgtagcgctt	Protospacer
**.*********** ********..

248. spacer 8.4|1212127|25|CP025594|CRISPRCasFinder matches to NZ_CP010858 (Marinovum algicola DG 898 plasmid pMaD3) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
cgccggtggcctcggcgtagccccg	Protospacer
.*****.************** ** 

249. spacer 8.4|1212127|25|CP025594|CRISPRCasFinder matches to NZ_CP033363 (Mesorhizobium sp. NZP2077 plasmid pMSNZP2077NSa, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgccggcggcctccgcgaagcgctt	Protospacer
************* *** *****..

250. spacer 8.4|1212127|25|CP025594|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tggcggcggcctcgccgtagcgctt	Protospacer
** *********** ********..

251. spacer 8.4|1212127|25|CP025594|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
cgtcggcggcctcggcgtagcggac	Protospacer
.*.*******************  *

252. spacer 8.4|1212127|25|CP025594|CRISPRCasFinder matches to NZ_CP014580 (Burkholderia sp. OLGA172 plasmid pOLGA1, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
agccggcggcctcggcctcgcgccg	Protospacer
 *************** * ***** 

253. spacer 8.4|1212127|25|CP025594|CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 4, identity: 0.84

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgtcggcggcctcgccgtagcgctt	Protospacer
**.*********** ********..

254. spacer 9.1|1572152|28|CP025594|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 4, identity: 0.857

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gccgccgggggtgccctcgttgccgggc	Protospacer
*..************ ********** *

255. spacer 9.1|1572152|28|CP025594|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 4, identity: 0.857

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gccgccgggggtgccctcgttgccgggc	Protospacer
*..************ ********** *

256. spacer 9.1|1572152|28|CP025594|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 4, identity: 0.857

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gccgccgggggtgccctcgttgccgggc	Protospacer
*..************ ********** *

257. spacer 9.5|1572374|25|CP025594|CRISPRCasFinder matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
tccgccgaacgcgccgaagccgtcg	Protospacer
...*******.**************

258. spacer 9.5|1572374|25|CP025594|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gctgccgaacacgccgatgccgacg	Protospacer
 .*************** **** **

259. spacer 9.5|1572374|25|CP025594|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gctgccgaacacgccgatgccgacg	Protospacer
 .*************** **** **

260. spacer 9.5|1572374|25|CP025594|CRISPRCasFinder matches to MT553342 (Microbacterium phage Kelcole, complete genome) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gatgctgatcacgccgaagccgtcg	Protospacer
  ***.** ****************

261. spacer 9.5|1572374|25|CP025594|CRISPRCasFinder matches to NC_048068 (Microbacterium phage OneinaGillian, complete genome) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gatgctgatcacgccgaagccgtcg	Protospacer
  ***.** ****************

262. spacer 9.5|1572374|25|CP025594|CRISPRCasFinder matches to MT310894 (Microbacterium phage Tempo, complete genome) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gatgctgatcacgccgaagccgtcg	Protospacer
  ***.** ****************

263. spacer 9.5|1572374|25|CP025594|CRISPRCasFinder matches to NZ_CP047175 (Rathayibacter sp. VKM Ac-2760 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
cttgccgaacacgccgatgccctgc	Protospacer
***************** *** *  

264. spacer 9.5|1572374|25|CP025594|CRISPRCasFinder matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
aatgccgaattcgccgaagccgtcg	Protospacer
  *******. **************

265. spacer 9.5|1572374|25|CP025594|CRISPRCasFinder matches to MN034284 (Leviviridae sp. isolate H2_Rhizo_Litter_49_scaffold_25938 sequence) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
cccgtagaacacgccgaagccgtcg	Protospacer
*..*. *******************

266. spacer 9.14|1573082|25|CP025594|CRISPRCasFinder matches to MN582064 (Podoviridae sp. ctka020, complete genome) position: , mismatch: 4, identity: 0.84

cttgccgccaccgacccccccttgc	CRISPR spacer
ttttccgacaccgacccccccttga	Protospacer
.** *** **************** 

267. spacer 10.5|2088445|24|CP025594|CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.833

atcgaagaagctgaacccgccgtt	CRISPR spacer
atcgaagaagctgaacacgcccgc	Protospacer
**************** ****  .

268. spacer 10.5|2088445|24|CP025594|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.833

atcgaagaagctgaacccgccgtt	CRISPR spacer
gtcgatgaagctgaacccgccgaa	Protospacer
.**** ****************  

269. spacer 10.5|2088445|24|CP025594|CRT matches to NZ_CP015007 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence) position: , mismatch: 4, identity: 0.833

atcgaagaagctgaacccgccgtt	CRISPR spacer
atcggagaagctgaacccgcccgg	Protospacer
****.****************   

270. spacer 1.8|335838|33|CP025594|CRT matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 5, identity: 0.848

-ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gtcggcg-tgccgatgacgccggccgggccggat	Protospacer
 .***** .**** ************ *******

271. spacer 1.8|335838|33|CP025594|CRT matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 5, identity: 0.848

-ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gtcggcg-tgccgatgacgccggccgggccggat	Protospacer
 .***** .**** ************ *******

272. spacer 3.1|366483|27|CP025594|CRISPRCasFinder matches to LR794124 (Vibrio phage vB_Vc_SrVc9 genome assembly, chromosome: 1) position: , mismatch: 5, identity: 0.815

aacgcaccggtgtccacatcgcccgtg	CRISPR spacer
aacgcaccgttgtccacatcaccaatc	Protospacer
********* **********.** .* 

273. spacer 3.1|366483|27|CP025594|CRISPRCasFinder matches to NC_012662 (Vibrio phage VP93, complete genome) position: , mismatch: 5, identity: 0.815

aacgcaccggtgtccacatcgcccgtg	CRISPR spacer
aacgcaccgttgtccacatcaccaatc	Protospacer
********* **********.** .* 

274. spacer 3.7|366879|27|CP025594|CRISPRCasFinder matches to NZ_CP016084 (Streptomyces sp. SAT1 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815

gcgaagccgatgttgtagctgccggtg	CRISPR spacer
gcgaagccgaagttgtagctgcgctcg	Protospacer
********** ***********   .*

275. spacer 3.7|366879|27|CP025594|CRISPRCasFinder matches to MN693945 (Marine virus AFVG_250M952, complete genome) position: , mismatch: 5, identity: 0.815

gcgaagccgatgttgtagctgccggtg	CRISPR spacer
atgaagccgatgttgtcgctaccgggg	Protospacer
..************** ***.**** *

276. spacer 3.10|367089|27|CP025594|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

277. spacer 3.10|367089|27|CP025594|CRISPRCasFinder matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

278. spacer 3.10|367089|27|CP025594|CRISPRCasFinder matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

279. spacer 3.10|367089|27|CP025594|CRISPRCasFinder matches to NZ_CP015368 (Methylobacterium phyllosphaerae strain CBMB27 plasmid CBMB27-p1, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tccccgcggaagttgaggtcgcgggtg	Protospacer
 ****** ************** *. *

280. spacer 3.10|367089|27|CP025594|CRISPRCasFinder matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

281. spacer 3.10|367089|27|CP025594|CRISPRCasFinder matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

282. spacer 3.10|367089|27|CP025594|CRISPRCasFinder matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

283. spacer 3.10|367089|27|CP025594|CRISPRCasFinder matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

284. spacer 3.10|367089|27|CP025594|CRISPRCasFinder matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

285. spacer 3.10|367089|27|CP025594|CRISPRCasFinder matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

286. spacer 3.10|367089|27|CP025594|CRISPRCasFinder matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

287. spacer 3.10|367089|27|CP025594|CRISPRCasFinder matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

288. spacer 3.10|367089|27|CP025594|CRISPRCasFinder matches to NZ_CP020444 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcaccgccgaagttgaagtggccgagc	Protospacer
 * *************.** ****** 

289. spacer 3.10|367089|27|CP025594|CRISPRCasFinder matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

290. spacer 3.10|367089|27|CP025594|CRISPRCasFinder matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

291. spacer 3.10|367089|27|CP025594|CRISPRCasFinder matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

292. spacer 3.10|367089|27|CP025594|CRISPRCasFinder matches to NZ_CP044078 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcaccgccgaagttgaagtggccgagc	Protospacer
 * *************.** ****** 

293. spacer 3.10|367089|27|CP025594|CRISPRCasFinder matches to NZ_CP031081 (Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcaccgccgaagttgaagtggccgagc	Protospacer
 * *************.** ****** 

294. spacer 3.10|367089|27|CP025594|CRISPRCasFinder matches to MN586031 (Gordonia phage Gambino, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

295. spacer 3.10|367089|27|CP025594|CRISPRCasFinder matches to KU998236 (Gordonia phage Blueberry, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

296. spacer 3.10|367089|27|CP025594|CRISPRCasFinder matches to MN062704 (Gordonia phage JuJu, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

297. spacer 3.10|367089|27|CP025594|CRISPRCasFinder matches to MK501729 (Gordonia phage Walrus, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

298. spacer 3.10|367089|27|CP025594|CRISPRCasFinder matches to NC_031226 (Gordonia phage BaxterFox, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

299. spacer 3.10|367089|27|CP025594|CRISPRCasFinder matches to MK967393 (Rhodococcus phage Whack, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tccttaccgaagttgaggtcgacgagg	Protospacer
 **...*************** *****

300. spacer 3.10|367089|27|CP025594|CRISPRCasFinder matches to MT723935 (Gordonia phage Azula, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

301. spacer 3.10|367089|27|CP025594|CRISPRCasFinder matches to KU963249 (Gordonia phage Yeezy, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

302. spacer 3.10|367089|27|CP025594|CRISPRCasFinder matches to MH153808 (Gordonia phage Petra, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

303. spacer 3.10|367089|27|CP025594|CRISPRCasFinder matches to MT639650 (Gordonia phage Ohgeesy, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

304. spacer 3.10|367089|27|CP025594|CRISPRCasFinder matches to MH536818 (Gordonia phage Frokostdame, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

305. spacer 3.10|367089|27|CP025594|CRISPRCasFinder matches to KX557275 (Gordonia phage CarolAnn, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

306. spacer 6.6|926884|27|CP025594|CRT matches to CP009871 (Pantoea sp. PSNIH2 plasmid pPSP-cd6, complete sequence) position: , mismatch: 5, identity: 0.815

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgtcagcggctgggcaggcggggatat	Protospacer
********** **** ******** . 

307. spacer 6.6|926884|27|CP025594|CRT matches to NZ_CP030354 (Novosphingobium sp. P6W plasmid pP6W1, complete sequence) position: , mismatch: 5, identity: 0.815

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgtcaccggcggggctggcggcatcgg	Protospacer
***** *************** .  **

308. spacer 6.6|926884|27|CP025594|CRT matches to NZ_CP045223 (Achromobacter xylosoxidans strain DN002 plasmid unnamed) position: , mismatch: 5, identity: 0.815

cgtcagcggcggggctggcggggaggg	CRISPR spacer
ccaaagcggcgagactggcggggaggg	Protospacer
*   *******.*.*************

309. spacer 6.6|926884|27|CP025594|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 5, identity: 0.815

cgtcagcggcggggctggcggggaggg	CRISPR spacer
tgttcacggcggggctggcggggacgg	Protospacer
.**. .****************** **

310. spacer 6.6|926884|27|CP025594|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.815

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cggcagcggcggggctggcggagccgc	Protospacer
** ******************.*  * 

311. spacer 6.6|926884|27|CP025594|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 5, identity: 0.815

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cggcagcggcggggctggcggagccgc	Protospacer
** ******************.*  * 

312. spacer 6.6|926884|27|CP025594|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

cgtcagcggcggggctggcggggaggg	CRISPR spacer
actcgccggcgcggctggcggggaggg	Protospacer
  **. ***** ***************

313. spacer 6.10|927040|27|CP025594|CRT matches to NZ_CP022264 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
ggcaggcggcggcggcggtagcgttgg	Protospacer
 * *  ******************** 

314. spacer 6.10|927040|27|CP025594|CRT matches to NZ_CP022264 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
ggcaggcggcggcggcggtagcgttgg	Protospacer
 * *  ******************** 

315. spacer 6.10|927040|27|CP025594|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
aggatccggccgcggcggtagcgctcg	Protospacer
 ********* ************.*  

316. spacer 6.10|927040|27|CP025594|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
aggatccggccgcggcggtagcgctcg	Protospacer
 ********* ************.*  

317. spacer 6.10|927040|27|CP025594|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cgggtccggcggcggcggtggcggttt	Protospacer
***.***************.*** * .

318. spacer 6.10|927040|27|CP025594|CRT matches to NZ_CP049908 (Hymenobacter sp. HDW8 plasmid p_unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cgactccggcggcgggggtagcgttcg	Protospacer
**. *********** *********  

319. spacer 6.10|927040|27|CP025594|CRT matches to NZ_CP049700 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2a, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cgccgccggcggcggcggtggcgttgg	Protospacer
**   **************.****** 

320. spacer 6.10|927040|27|CP025594|CRT matches to MH576962 (Streptomyces phage Satis, complete genome) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
tgactccggcggcggccgtggcgttgc	Protospacer
.*. ************ **.*******

321. spacer 6.10|927040|27|CP025594|CRT matches to MK620894 (Streptomyces phage Kradal, complete genome) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
tgactccggcggcggccgtggcgttgc	Protospacer
.*. ************ **.*******

322. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 5, identity: 0.833

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgaggccggcctgctggtcgtctccgggct	Protospacer
*** **************** ******   

323. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 5, identity: 0.833

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
agattccggcctgttcgtcggctccggcgg	Protospacer
 **. ********.* **************

324. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 5, identity: 0.833

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgccatcggcctgctgctcggcaccggcgg	Protospacer
** *..********** ***** *******

325. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP031193 (Humibacter sp. BT305 plasmid unnamed1) position: , mismatch: 5, identity: 0.833

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgccgccggcctgctggtcggcgcggcggg	Protospacer
** ******************* * *  **

326. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 5, identity: 0.833

cgacgccggcctgctggtcggc-tccggcgg	CRISPR spacer
cgacgccggcatgccggtcggcttcctgct-	Protospacer
********** ***.******* *** **  

327. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.833

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
attgctgttcggctgcggcggcgcgggcgc	Protospacer
 .************ ********* **** 

328. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
attgctgttcggctgcggcggcgcgggcgc	Protospacer
 .************ ********* **** 

329. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 5, identity: 0.833

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgctcggcaccggcggcgcactcgg	Protospacer
*******.***** **********   ***

330. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP046705 (Nostoc sp. ATCC 53789 plasmid pNsp_b, complete sequence) position: , mismatch: 5, identity: 0.833

cctgctg--ttcggctccggcggcgctggcgg	CRISPR spacer
--tactgattacggctccggcggtgctggcgg	Protospacer
  *.***  * ************.********

331. spacer 6.15|927277|30|CP025594|CRT matches to AY950802 (Haloarcula phage SH1, complete genome) position: , mismatch: 5, identity: 0.833

--cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ggcctac--ttcggctccggcggctccggcgg	Protospacer
  ***.*  *************** *.*****

332. spacer 6.16|927325|24|CP025594|CRT matches to NC_006911 (Streptomyces sp. F11 plasmid pFP11, complete sequence) position: , mismatch: 5, identity: 0.792

aaccgacctcggcggcgctggcgg	CRISPR spacer
gggcgacctcggcggcgctggcct	Protospacer
.. *******************  

333. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to MG925349 (Mycobacterium phage Mendokysei, complete genome) position: , mismatch: 5, identity: 0.853

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcggcaacggcggcgacggcgggttcccc	Protospacer
******************** ********  *. 

334. spacer 8.4|1212127|25|CP025594|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.8

tgccggcggcctcggcgtagcgccc	CRISPR spacer
gcgcggcggcctcggcgtagagccg	Protospacer
   ***************** *** 

335. spacer 8.4|1212127|25|CP025594|CRISPRCasFinder matches to NC_015178 (Acidiphilium multivorum AIU301 plasmid pACMV1, complete sequence) position: , mismatch: 5, identity: 0.8

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgccggcggcctcggcgtggccgag	Protospacer
******************.**    

336. spacer 8.4|1212127|25|CP025594|CRISPRCasFinder matches to NZ_CP035002 (Rhizobium acidisoli strain FH23 plasmid pRapFH23d, complete sequence) position: , mismatch: 5, identity: 0.8

tgccggcggcctcggcgtagcgccc	CRISPR spacer
caccggcggcctcggcgtagcttgc	Protospacer
..******************* . *

337. spacer 8.4|1212127|25|CP025594|CRISPRCasFinder matches to NC_009469 (Acidiphilium cryptum JF-5 plasmid pACRY03, complete sequence) position: , mismatch: 5, identity: 0.8

tgccggcggcctcggcgtagcgccc	CRISPR spacer
tgccggcggcctcggcgtggccgag	Protospacer
******************.**    

338. spacer 9.1|1572152|28|CP025594|CRISPRCasFinder matches to NZ_LN907828 (Erwinia gerundensis isolate E_g_EM595 plasmid pEM01, complete sequence) position: , mismatch: 5, identity: 0.821

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gctgccgtgggtgccatcgttgccgagt	Protospacer
*.***** *****************. .

339. spacer 9.1|1572152|28|CP025594|CRISPRCasFinder matches to KU728633 (Mycobacterium phage Bipper, complete genome) position: , mismatch: 5, identity: 0.821

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gcgtccgggggtgccgtcgttgccgtcc	Protospacer
*.  ***********.********* **

340. spacer 9.1|1572152|28|CP025594|CRISPRCasFinder matches to MK977701 (Mycobacterium phage Cracklewink, complete genome) position: , mismatch: 5, identity: 0.821

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gcgtccgggggtgccgtcgttgccgtcc	Protospacer
*.  ***********.********* **

341. spacer 9.1|1572152|28|CP025594|CRISPRCasFinder matches to NZ_CP016354 (Prauserella marina strain DSM 45268 plasmid pPmarDSM45268, complete sequence) position: , mismatch: 5, identity: 0.821

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gttgccgcgggtgccctcgttgcggacg	Protospacer
******* ******* ******* *.* 

342. spacer 9.5|1572374|25|CP025594|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 5, identity: 0.8

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gccgccgaacacgccgaagccgttt	Protospacer
 ..********************. 

343. spacer 9.5|1572374|25|CP025594|CRISPRCasFinder matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 5, identity: 0.8

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gttgccgaacacgccgacgccgcgc	Protospacer
 **************** ****.  

344. spacer 9.10|1572767|31|CP025594|CRISPRCasFinder matches to NC_018746 (Pseudomonas putida ND6 plasmid pND6-2, complete sequence) position: , mismatch: 5, identity: 0.839

aattg--cgccttgcccgccgttgccgccggca	CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca	Protospacer
  ***  *.****** **** ************

345. spacer 9.10|1572767|31|CP025594|CRISPRCasFinder matches to MN961671 (Pseudomonas aeruginosa strain 201330 plasmid p201330-IMP, complete sequence) position: , mismatch: 5, identity: 0.839

aattg--cgccttgcccgccgttgccgccggca	CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca	Protospacer
  ***  *.****** **** ************

346. spacer 9.10|1572767|31|CP025594|CRISPRCasFinder matches to MN961672 (Pseudomonas aeruginosa strain PA15W plasmid pPA15W-NR, complete sequence) position: , mismatch: 5, identity: 0.839

aattg--cgccttgcccgccgttgccgccggca	CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca	Protospacer
  ***  *.****** **** ************

347. spacer 9.13|1573016|34|CP025594|CRISPRCasFinder matches to NC_006362 (Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence) position: , mismatch: 5, identity: 0.853

gtcgccgtgcagccagccaccaccgcca-ccggcg	CRISPR spacer
ttcgccgtgcagccggccaccacctccagcctgc-	Protospacer
 *************.********* *** ** ** 

348. spacer 14.7|3741111|31|CP025594|CRT matches to NC_010850 (Rhodococcus sp. NS1 plasmid pNSL1, complete sequence) position: , mismatch: 5, identity: 0.839

aacgccc-acttcaccgccgttgccgccgtca	CRISPR spacer
-acacccgacttcaccgccgctgccgccgaga	Protospacer
 **.*** ************.********  *

349. spacer 1.6|335742|30|CP025594|CRT matches to NZ_CP049317 (Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence) position: , mismatch: 6, identity: 0.8

ccgatcccactgctggcgaccccgccagcg	CRISPR spacer
ccggcgccactgctggcgtccacgccagcc	Protospacer
***.. ************ ** ******* 

350. spacer 1.6|335742|30|CP025594|CRT matches to NZ_CP049157 (Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence) position: , mismatch: 6, identity: 0.8

ccgatcccactgctggcgaccccgccagcg	CRISPR spacer
ccggcgccactgctggcgtccacgccagcc	Protospacer
***.. ************ ** ******* 

351. spacer 1.6|335742|30|CP025594|CRT matches to KC292025 (Halovirus HHTV-1, complete genome) position: , mismatch: 6, identity: 0.8

ccgatcccactgctggcgaccccgccagcg--	CRISPR spacer
tcgatcccactgctggccaccctg--aacggc	Protospacer
.**************** ****.*  *.**  

352. spacer 1.8|335838|33|CP025594|CRT matches to NC_018022 (Mycolicibacterium chubuense NBB4 plasmid pMYCCH.01, complete sequence) position: , mismatch: 6, identity: 0.818

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gcgatgccgccgttgccgccggccccgccgggt	Protospacer
 **..********** ******** ******.*

353. spacer 1.8|335838|33|CP025594|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 6, identity: 0.818

ccggcgccgccgttgacgccggccgcg--ccggat	CRISPR spacer
tccgcgccgccgtcgacgcccgccgcgacccgg--	Protospacer
.* **********.****** ******  ****  

354. spacer 1.8|335838|33|CP025594|CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 6, identity: 0.818

-ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gcaggcg-tgccgttgacgccggtcgcgcaggaa	Protospacer
 * **** .**************.***** *** 

355. spacer 1.8|335838|33|CP025594|CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 6, identity: 0.818

-ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gcaggcg-tgccgttgacgccggtcgcgcaggaa	Protospacer
 * **** .**************.***** *** 

356. spacer 3.1|366483|27|CP025594|CRISPRCasFinder matches to NZ_CP045917 (Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence) position: , mismatch: 6, identity: 0.778

aacgcaccggtgtccacatcgcccgtg	CRISPR spacer
agttcactggtgtccacatcgcccgaa	Protospacer
*.. ***.***************** .

357. spacer 3.6|366813|33|CP025594|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
agcaggtcgatcacgatctggccgttgccggcg	Protospacer
**   *.***** ******************.*

358. spacer 3.7|366879|27|CP025594|CRISPRCasFinder matches to NZ_CP022542 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence) position: , mismatch: 6, identity: 0.778

gcgaagccgatgttgtagctgccggtg	CRISPR spacer
ggataggcgatgttgtagctgccggaa	Protospacer
* . ** ****************** .

359. spacer 3.9|367029|27|CP025594|CRISPRCasFinder matches to NC_009959 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI05, complete sequence) position: , mismatch: 6, identity: 0.778

gccaagccgatatcgaagatcccggtg	CRISPR spacer
accatgccgatatcgacgatcccgtcc	Protospacer
.*** *********** ******* . 

360. spacer 3.10|367089|27|CP025594|CRISPRCasFinder matches to NZ_CP009112 (Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence) position: , mismatch: 6, identity: 0.778

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tagacgccgaagtcgaggtcggcgagg	Protospacer
    *********.******* *****

361. spacer 3.10|367089|27|CP025594|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778

accccgccgaagttgaggtcgccgagg	CRISPR spacer
ctcccgccgaagttgagggtgccgaac	Protospacer
 .**************** .*****. 

362. spacer 3.10|367089|27|CP025594|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 6, identity: 0.778

accccgccgaagttgaggtcgccgagg	CRISPR spacer
aagaagccgaagttgaggtcgccgtag	Protospacer
*    ******************* .*

363. spacer 3.10|367089|27|CP025594|CRISPRCasFinder matches to MK494099 (Mycobacterium phage Typha, complete genome) position: , mismatch: 6, identity: 0.778

accccgccgaagttgaggtcgccgagg	CRISPR spacer
cggtcgccgaggtcgaggtcgccgagg	Protospacer
   .******.**.*************

364. spacer 4.2|631299|30|CP025594|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
gcgccgccggtgactacgccgccagcgaca	Protospacer
.*  **********.*********.****.

365. spacer 4.2|631299|30|CP025594|CRT matches to KX620751 (Propionibacterium phage Doucette, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
gagactccggtgaccacgccgccatcgatg	Protospacer
.  ** ****************** ***.*

366. spacer 4.2|631299|30|CP025594|CRT matches to NC_041891 (Propionibacterium phage B22, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
gagactccggtgaccacgccgccatcgatg	Protospacer
.  ** ****************** ***.*

367. spacer 4.2|631299|30|CP025594|CRT matches to NC_041894 (Propionibacterium phage E6, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
gagactccggtgaccacgccgccatcgatg	Protospacer
.  ** ****************** ***.*

368. spacer 4.2|631299|30|CP025594|CRT matches to KX620754 (Propionibacterium phage G4, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
gagactccggtgaccacgccgccatcgatg	Protospacer
.  ** ****************** ***.*

369. spacer 4.2|631299|30|CP025594|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
tccacgccggtgaccacgccgaccaccttg	Protospacer
 ******************** * **  .*

370. spacer 4.2|631299|30|CP025594|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
aagaggccggcgagcacgccgccaacgaag	Protospacer
*  * *****.** ************** *

371. spacer 4.2|631299|30|CP025594|CRT matches to MT818419 (Mycobacterium phage Lolalove, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg	Protospacer
*.*. * ****************. *****

372. spacer 4.2|631299|30|CP025594|CRT matches to MN428050 (Mycobacterium phage Apex, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg	Protospacer
*.*. * ****************. *****

373. spacer 4.2|631299|30|CP025594|CRT matches to MN234171 (Mycobacterium phage Magpie, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg	Protospacer
*.*. * ****************. *****

374. spacer 4.2|631299|30|CP025594|CRT matches to KX589269 (Mycobacterium phage Fortunato, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg	Protospacer
*.*. * ****************. *****

375. spacer 4.2|631299|30|CP025594|CRT matches to NC_042035 (Mycobacterium phage Zemanar, complete sequence) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg	Protospacer
*.*. * ****************. *****

376. spacer 4.2|631299|30|CP025594|CRT matches to NC_022331 (Mycobacterium phage Bane1, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg	Protospacer
*.*. * ****************. *****

377. spacer 4.2|631299|30|CP025594|CRT matches to KF279413 (Mycobacterium phage Bane2, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg	Protospacer
*.*. * ****************. *****

378. spacer 4.2|631299|30|CP025594|CRT matches to MT310870 (Mycobacterium phage RawrgerThat, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg	Protospacer
*.*. * ****************. *****

379. spacer 5.1|692011|31|CP025594|CRISPRCasFinder matches to GQ141189 (Bifidobacterium phage Bbif-1, complete sequence) position: , mismatch: 6, identity: 0.806

agcgcgaacggcaagccgaac----cgttggaccc	CRISPR spacer
agcgcgaacggccagccgaaccatgcgctgg----	Protospacer
************ ********    **.***    

380. spacer 6.6|926884|27|CP025594|CRT matches to NZ_LN907829 (Erwinia gerundensis isolate E_g_EM595 plasmid pEM02, complete sequence) position: , mismatch: 6, identity: 0.778

cgtcagcggcggggctggcggggaggg	CRISPR spacer
tgtaagcggctgggctggcggggatat	Protospacer
.** ****** ************* . 

381. spacer 6.6|926884|27|CP025594|CRT matches to NZ_CP041653 (Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence) position: , mismatch: 6, identity: 0.778

cgtcagcggcggggctggcggggaggg	CRISPR spacer
tgtcagcggcggggctggcgttcatcg	Protospacer
.*******************   *  *

382. spacer 6.6|926884|27|CP025594|CRT matches to NZ_CP010826 (Thermus aquaticus Y51MC23 plasmid pTA78, complete sequence) position: , mismatch: 6, identity: 0.778

cgtcagcggcggggctggcggggaggg	CRISPR spacer
tagaagcggcggggctggtggagaggg	Protospacer
..  **************.**.*****

383. spacer 6.6|926884|27|CP025594|CRT matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 6, identity: 0.778

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gcgcaccggcggggctggcggggcggc	Protospacer
   ** ***************** ** 

384. spacer 6.10|927040|27|CP025594|CRT matches to NZ_AP021845 (Azospira sp. I09 plasmid pAZI09, complete sequence) position: , mismatch: 6, identity: 0.778

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cggatcctgcggcggcggtagaaagcc	Protospacer
******* ************* .   *

385. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gagcgtcggcctgctggtcggcttcggcgc	Protospacer
 ..**.*****************.***** 

386. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gagcgtcggcctgctggtcggcttcggcgc	Protospacer
 ..**.*****************.***** 

387. spacer 6.13|927181|30|CP025594|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgacgacggcctggtggtcggctacctcga	Protospacer
***** ******* ********* *  **.

388. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg	Protospacer
**  ..********** ***** *******

389. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg	Protospacer
**  ..********** ***** *******

390. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgcgcgcggcgtgccggtcggctccggcgg	Protospacer
**    **** ***.***************

391. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg	Protospacer
**  ..********** ***** *******

392. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgcgcgcggcgtgccggtcggctccggcgg	Protospacer
**    **** ***.***************

393. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgcggcgggcctgctggtcggcttcggcac	Protospacer
**  ** ****************.****. 

394. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

395. spacer 6.13|927181|30|CP025594|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

396. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

397. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP037868 (Hydrogenophaga pseudoflava strain DSM 1084 plasmid pDSM1084, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcg----gctccggcgg	CRISPR spacer
cgacgccggccggctggtcggagagctgcg----	Protospacer
*********** ********    *** **    

398. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

399. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

400. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgtcgccggcctgctgatcggcttcttctg	Protospacer
** *************.******.*  * *

401. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

402. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

403. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

404. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

405. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

406. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

407. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

408. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

409. spacer 6.13|927181|30|CP025594|CRT matches to NC_019408 (Caulobacter phage CcrRogue, complete genome) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgtcatcggcctgctggtcgtcgccggcgc	Protospacer
** *..************** * ****** 

410. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgacgccgacctgctggtcggggcggactg	Protospacer
********.************  * *.* *

411. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP017941 (Phyllobacterium zundukense strain Tri-48 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
caagctggtcggccccggcggcgctggcaa	Protospacer
*  **** *****.**************..

412. spacer 6.15|927277|30|CP025594|CRT matches to MK937608 (Microbacterium phage Cressida, complete genome) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tcacctgtccggctccggcggcggtggcga	Protospacer
.*  ****.************** *****.

413. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg	Protospacer
*******.***** **********   .**

414. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg	Protospacer
*******.***** **********   .**

415. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP017592 (Pantoea stewartii subsp. stewartii DC283 plasmid ppDSJ01, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg--	CRISPR spacer
tctgctgttcggctgcggcggcg--agcagcg	Protospacer
.************* ********  .**.*  

416. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP008898 (Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pENT-576, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgttcggcgccgccggcgctattgg	Protospacer
 ************ *** *******. .**

417. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP023489 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_02, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgttcggcgccgccggcgctattgg	Protospacer
 ************ *** *******. .**

418. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP043515 (Enterobacter kobei strain EB_P8_L5_01.19 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgttcggcgccgccggcgctattgg	Protospacer
 ************ *** *******. .**

419. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg	Protospacer
*******.***** **********   .**

420. spacer 6.15|927277|30|CP025594|CRT matches to NZ_LT984809 (Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
catcgcgctcggcttcggcggcgctggcgg	Protospacer
* *  .*.******.***************

421. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP026371 (Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgttcggcgccgccggcgctattgg	Protospacer
 ************ *** *******. .**

422. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP050069 (Klebsiella aerogenes strain 035 plasmid p035_A-VIM-1, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgttcggcgccgccggcgctattgg	Protospacer
 ************ *** *******. .**

423. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP039425 (Citricoccus sp. SGAir0253 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgttcggcaccgacggcgccctccg	Protospacer
************* ***.******.  * *

424. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP009856 (UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-784, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgttcggcgccgccggcgctattgg	Protospacer
 ************ *** *******. .**

425. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP039430 (Citricoccus sp. SGAir0453 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgttcggcaccgacggcgccctccg	Protospacer
************* ***.******.  * *

426. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP040937 (Hymenobacter sp. DG01 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgt-tcggctccggcggcgctggcgg	CRISPR spacer
-ccgccgcgccggctccggccgcgctggcgg	Protospacer
 *.**.*. .********** **********

427. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cgtccagctcggcgccggcggcgctggcgt	Protospacer
* * * *.***** *************** 

428. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cgtccagctcggcgccggcggcgctggcgt	Protospacer
* * * *.***** *************** 

429. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP006588 (Hymenobacter sp. APR13 plasmid pHA, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgt-tcggctccggcggcgctggcgg	CRISPR spacer
-ccgccgcgccggctccggccgcgctggcgg	Protospacer
 *.**.*. .********** **********

430. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgtt--cggctccggcggcgctggcgg	CRISPR spacer
--cgccgctggcggcgccggcggcgctggcgg	Protospacer
  .**.*.*  **** ****************

431. spacer 6.15|927277|30|CP025594|CRT matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgtt----cggctccggcggcgctggcgg	CRISPR spacer
----cagttggggcggctccggcggcgcgggcgg	Protospacer
    * ***    *************** *****

432. spacer 6.15|927277|30|CP025594|CRT matches to MH029534 (Myoviridae environmental samples clone NHS-Seq2, complete sequence) position: , mismatch: 6, identity: 0.8

-cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
atttggt-ttcggcgctggcggcgctggcgg	Protospacer
 ..** * ****** *.**************

433. spacer 6.17|927367|36|CP025594|CRT matches to MT723940 (Mycobacterium phage Ellie, complete genome) position: , mismatch: 6, identity: 0.833

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
cgttgtcggcaacggcggtaacggcgggggtggcgg	Protospacer
  * .************************ .*****

434. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.824

ggccggcggcaacggcggcgccggcg--ggtggcta	CRISPR spacer
ggccggcggcaagggcggcgacggcggcgccggc--	Protospacer
************ ******* *****  * .***  

435. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.824

ggccggcggcaacggcggcgccggcgggt--ggcta	CRISPR spacer
caccggcggcaacggcggcggcggcggcttcggc--	Protospacer
 .****************** ****** *  ***  

436. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 6, identity: 0.824

ggccggcggcaacggcggcgccggcgg-gtggcta	CRISPR spacer
caccggcggcagcggcggcgccggcggcacggct-	Protospacer
 .*********.*************** ..**** 

437. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 6, identity: 0.824

ggccggcggcaacggcggcgccggcgggtggcta-	CRISPR spacer
cggcggcggcaacggcggcgctggt-ggtggcaac	Protospacer
 * ******************.**. ****** * 

438. spacer 9.1|1572152|28|CP025594|CRISPRCasFinder matches to NZ_AP022571 (Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence) position: , mismatch: 6, identity: 0.786

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
ggtgccgggggtggcaccgttgccgcgg	Protospacer
* *********** **.********   

439. spacer 9.1|1572152|28|CP025594|CRISPRCasFinder matches to NC_008703 (Mycobacterium sp. KMS plasmid pMKMS01, complete sequence) position: , mismatch: 6, identity: 0.786

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
ggtgccgggggtggcaccgttgccgcgg	Protospacer
* *********** **.********   

440. spacer 9.1|1572152|28|CP025594|CRISPRCasFinder matches to NZ_LR594663 (Variovorax sp. RA8 plasmid 2) position: , mismatch: 6, identity: 0.786

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
ggtgccggcggtgccatcggtgccgagg	Protospacer
* ****** ********** *****.  

441. spacer 9.10|1572767|31|CP025594|CRISPRCasFinder matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 6, identity: 0.806

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ccttgcgccttgcccgccgctgccgcagggc	Protospacer
  *****************.****** **  

442. spacer 9.10|1572767|31|CP025594|CRISPRCasFinder matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 6, identity: 0.806

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ccttgcgccttgcccgccgctgccgcagggc	Protospacer
  *****************.****** **  

443. spacer 9.13|1573016|34|CP025594|CRISPRCasFinder matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 6, identity: 0.824

--gtcgccgtgcagccagccaccaccgccaccggcg	CRISPR spacer
ctgtcgtc--gcagcgcgccaccaccgccaccggca	Protospacer
  ****.*  *****  ******************.

444. spacer 14.7|3741111|31|CP025594|CRT matches to NC_009478 (Clavibacter michiganensis subsp. michiganensis NCPPB 382 plasmid pCM1, complete sequence) position: , mismatch: 6, identity: 0.806

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgaccacttcaccgccgtcgccgccggcg	Protospacer
. ** ***************.******* *.

445. spacer 1.8|335838|33|CP025594|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 7, identity: 0.788

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
cgggcgccgccgatgacgccggccgcgtggagc	Protospacer
* ********** **************. *...

446. spacer 1.8|335838|33|CP025594|CRT matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ttgacgccgccgttgccgccgcccgcgccgctt	Protospacer
..*.*********** ***** ********  *

447. spacer 1.8|335838|33|CP025594|CRT matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.788

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ttgacgccgccgttgccgccgcccgcgccgctt	Protospacer
..*.*********** ***** ********  *

448. spacer 1.8|335838|33|CP025594|CRT matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 7, identity: 0.788

ccggc--gccgccgttgacgccggccgcgccggat	CRISPR spacer
--ggttggccgccgctgccgccggccgcgccgcct	Protospacer
  **.  *******.** **************  *

449. spacer 3.4|366678|27|CP025594|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.741

aagccgcccgagttcgcgagaccgaag	CRISPR spacer
tgaccgcccgagttcgcgagacgttgg	Protospacer
 ..*******************   .*

450. spacer 4.2|631299|30|CP025594|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
taggcgccggtgaccccgccgccgacgatg	Protospacer
   .*********** *******.****.*

451. spacer 4.2|631299|30|CP025594|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
tgcgtggcggtgaccacgccgccaatggcg	Protospacer
  *..* ******************.*.**

452. spacer 4.2|631299|30|CP025594|CRT matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atagcgccggtcaccgcgccgccaacgata	Protospacer
*. .******* ***.************..

453. spacer 4.2|631299|30|CP025594|CRT matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
acctcgtcggtgaccacgccgccgtgcagg	Protospacer
*** **.****************.   * *

454. spacer 4.2|631299|30|CP025594|CRT matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
accacgccggtgacctcaccgcccgctgtg	Protospacer
*************** *.***** .* ..*

455. spacer 4.2|631299|30|CP025594|CRT matches to NZ_CP012478 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
accacgccggtgacctcaccgcccgctgtg	Protospacer
*************** *.***** .* ..*

456. spacer 4.2|631299|30|CP025594|CRT matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
acctcgtcggtgaccacgccgccgtgcagg	Protospacer
*** **.****************.   * *

457. spacer 4.2|631299|30|CP025594|CRT matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
ccggcgccggtgaccgcgccgccaaggcag	Protospacer
 * .***********.********* *  *

458. spacer 4.2|631299|30|CP025594|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
ggcccgccgatggccacgccgccaacggca	Protospacer
. * *****.**.**************.*.

459. spacer 4.2|631299|30|CP025594|CRT matches to NC_042034 (Mycobacterium phage ChrisnMich, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
gtcgaggcggtgaccacgccgccgccgacg	Protospacer
..*. * ****************. *****

460. spacer 5.1|692011|31|CP025594|CRISPRCasFinder matches to MK977708 (Mycobacterium phage Fulbright, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

461. spacer 5.1|692011|31|CP025594|CRISPRCasFinder matches to MG099948 (Mycobacterium phage Philonius, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

462. spacer 5.1|692011|31|CP025594|CRISPRCasFinder matches to MH926055 (Mycobacterium phage Chewbacca, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

463. spacer 5.1|692011|31|CP025594|CRISPRCasFinder matches to MT723932 (Mycobacterium phage Schnauzer, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

464. spacer 5.1|692011|31|CP025594|CRISPRCasFinder matches to KU935726 (Mycobacterium phage Xerxes, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

465. spacer 5.1|692011|31|CP025594|CRISPRCasFinder matches to KU935730 (Mycobacterium phage Pipsqueaks, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

466. spacer 5.1|692011|31|CP025594|CRISPRCasFinder matches to MH316570 (Mycobacterium phage Silvafighter, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

467. spacer 5.1|692011|31|CP025594|CRISPRCasFinder matches to MK524518 (Mycobacterium phage Smurph, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

468. spacer 5.1|692011|31|CP025594|CRISPRCasFinder matches to MK524515 (Mycobacterium phage Parmesanjohn, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

469. spacer 5.1|692011|31|CP025594|CRISPRCasFinder matches to MH697585 (Mycobacterium phage Gex, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

470. spacer 5.1|692011|31|CP025594|CRISPRCasFinder matches to KM588359 (Mycobacterium phage Carcharodon, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

471. spacer 5.1|692011|31|CP025594|CRISPRCasFinder matches to MH697576 (Mycobacterium phage Aggie, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

472. spacer 5.1|692011|31|CP025594|CRISPRCasFinder matches to MH697593 (Mycobacterium phage Tapioca, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

473. spacer 5.1|692011|31|CP025594|CRISPRCasFinder matches to MG099936 (Mycobacterium phage Andies, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

474. spacer 5.1|692011|31|CP025594|CRISPRCasFinder matches to NC_031243 (Mycobacterium phage Xeno, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

475. spacer 5.1|692011|31|CP025594|CRISPRCasFinder matches to JN256079 (Mycobacterium phage Charlie, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

476. spacer 6.6|926884|27|CP025594|CRT matches to NZ_CP010614 (Phaeobacter inhibens strain P92 plasmid pP92_d, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

477. spacer 6.6|926884|27|CP025594|CRT matches to NZ_CP010626 (Phaeobacter inhibens strain P51 plasmid pP51_c, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

478. spacer 6.6|926884|27|CP025594|CRT matches to NZ_CP010671 (Phaeobacter inhibens strain P57 plasmid pP57_c, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

479. spacer 6.6|926884|27|CP025594|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgtcagcggcgggggtggcggcacacc	Protospacer
************** ****** . .  

480. spacer 6.6|926884|27|CP025594|CRT matches to NZ_CP010598 (Phaeobacter inhibens strain P10 plasmid pP10_c, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

481. spacer 6.6|926884|27|CP025594|CRT matches to NC_018288 (Phaeobacter inhibens DSM 17395 plasmid pPGA1_65, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

482. spacer 6.6|926884|27|CP025594|CRT matches to NZ_CP031955 (Phaeobacter inhibens strain 2.10 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

483. spacer 6.6|926884|27|CP025594|CRT matches to NZ_CP016368 (Phaeobacter porticola strain P97 plasmid pP97_d, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattggcggcggggctggcggggatct	Protospacer
 .*..*******************   

484. spacer 6.6|926884|27|CP025594|CRT matches to NC_018422 (Phaeobacter inhibens 2.10 plasmid pPGA2_71, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

485. spacer 6.6|926884|27|CP025594|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgtcagcggcgggggtggcggcacacc	Protospacer
************** ****** . .  

486. spacer 6.6|926884|27|CP025594|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
cgtcagcggcgggggtggcggcacacc	Protospacer
************** ****** . .  

487. spacer 6.6|926884|27|CP025594|CRT matches to NZ_CP010605 (Phaeobacter inhibens strain P83 plasmid pP83_f, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

488. spacer 6.6|926884|27|CP025594|CRT matches to NZ_CP010744 (Phaeobacter inhibens strain P59 plasmid pP59_c, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

489. spacer 6.6|926884|27|CP025594|CRT matches to NZ_CP010622 (Phaeobacter inhibens strain P30 isolate M4-3.1A plasmid pP30_e, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

490. spacer 6.6|926884|27|CP025594|CRT matches to NZ_CP010732 (Phaeobacter inhibens strain P88 plasmid pP88_g, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

491. spacer 6.6|926884|27|CP025594|CRT matches to NZ_CP010655 (Phaeobacter inhibens strain P54 plasmid pP54_e, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

492. spacer 6.6|926884|27|CP025594|CRT matches to NZ_CP010711 (Phaeobacter inhibens strain P66 plasmid pP66_f, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

493. spacer 6.6|926884|27|CP025594|CRT matches to NZ_CP010702 (Phaeobacter inhibens strain P24 plasmid pP24_f, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

494. spacer 6.6|926884|27|CP025594|CRT matches to NZ_CP010748 (Phaeobacter inhibens strain P48 isolate M21-2.3 plasmid pP48_c, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

495. spacer 6.6|926884|27|CP025594|CRT matches to NZ_CP010739 (Phaeobacter inhibens strain P72 plasmid pP72_d, complete sequence) position: , mismatch: 7, identity: 0.741

cgtcagcggcggggctggcggggaggg	CRISPR spacer
gattcgcggcggggctggcggggatct	Protospacer
 .*. *******************   

496. spacer 6.13|927181|30|CP025594|CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggtcgccggcctgctggtcgggttcggatc	Protospacer
 * ****************** *.***   

497. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

498. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

499. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ctgctgcagcctgctggtcagctccggcgc	Protospacer
* .*  *.***********.********* 

500. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

501. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

502. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ctgctgcagcctgctggtcagctccggcgc	Protospacer
* .*  *.***********.********* 

503. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

504. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

505. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

506. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

507. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

508. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

509. spacer 6.13|927181|30|CP025594|CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgggaccggcccgctggtcggccccggctt	Protospacer
**. .******.**********.*****  

510. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gctgggcggcctgctggtcggctggggcgg	Protospacer
    * *****************  *****

511. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

512. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

513. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

514. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

515. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

516. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

517. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgcaggtcggcttcacctt	Protospacer
 ************* ********.*. *  

518. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

519. spacer 6.13|927181|30|CP025594|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

520. spacer 6.13|927181|30|CP025594|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

521. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

522. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

523. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

524. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

525. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

526. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

527. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

528. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

529. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

530. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

531. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

532. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

533. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

534. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

535. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

536. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

537. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

538. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

539. spacer 6.13|927181|30|CP025594|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

540. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

541. spacer 6.13|927181|30|CP025594|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

542. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

543. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

544. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

545. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

546. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

547. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

548. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

549. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

550. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

551. spacer 6.13|927181|30|CP025594|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

552. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

553. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

554. spacer 6.13|927181|30|CP025594|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

555. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

556. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

557. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

558. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

559. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

560. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

561. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

562. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

563. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

564. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

565. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

566. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

567. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

568. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

569. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

570. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

571. spacer 6.13|927181|30|CP025594|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

572. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

573. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

574. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

575. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

576. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

577. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

578. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

579. spacer 6.13|927181|30|CP025594|CRT matches to HM560026 (Uncultured bacterium plasmid pTRACA45, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
acacgccgccctgctggtcggcttaggtcg	Protospacer
  ****** **************. **. *

580. spacer 6.13|927181|30|CP025594|CRT matches to NC_010867 (Neisseria lactamica plasmid pNL3.1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gaacgccgccctgctggtcggcttagtcgc	Protospacer
 .****** **************. * ** 

581. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP020471 (Rhodobacter blasticus strain 28/5 plasmid pRsa, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
agacgccggcctgctgttcggcctcgaccc	Protospacer
 *************** *****..**.*  

582. spacer 6.13|927181|30|CP025594|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgggctcggcctgctgctcggcttcggcga	Protospacer
**.  .********** ******.*****.

583. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggc-tccggcgg	CRISPR spacer
gtcggccggcctgctggtcggcgcccggct-	Protospacer
    ****************** .*****  

584. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP035710 (Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgacgacggcctgctggtcgacttcatccc	Protospacer
***** **************.**.*. *  

585. spacer 6.13|927181|30|CP025594|CRT matches to KT997827 (Uncultured Mediterranean phage uvDeep-CGR0-KM15-C219, complete genome) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gttcgccggcctgctggaccgctccgtggg	Protospacer
   ************** * ******  **

586. spacer 6.13|927181|30|CP025594|CRT matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgtgtccggcctgctggtcgggttcggcac	Protospacer
**   **************** *.****. 

587. spacer 6.13|927181|30|CP025594|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
tgacgccgccctgctggtcggcaaagtcga	Protospacer
.******* *************   * **.

588. spacer 6.13|927181|30|CP025594|CRT matches to KT997829 (Uncultured Mediterranean phage uvDeep-CGR0-KM22-C158, complete genome) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gttcgccggcctgctggaccgctccgtggg	Protospacer
   ************** * ******  **

589. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttcggggtcggctccggcggcgctggcga	Protospacer
..*   * *********************.

590. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttcggggtcggctccggcggcgctggcga	Protospacer
..*   * *********************.

591. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctccgcgctcggctccggcggcggtggcgg	Protospacer
*..  .*.*************** ******

592. spacer 6.15|927277|30|CP025594|CRT matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttccggctcggcgccggcggcgctggcga	Protospacer
..* * *.***** ***************.

593. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP006989 (Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttccggctcggcgccggcggcgctggcga	Protospacer
..* * *.***** ***************.

594. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP020909 (Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttccggctcggcgccggcggcgctggcga	Protospacer
..* * *.***** ***************.

595. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP024423 (Paracoccus yeei strain TT13 plasmid pTT13-1, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tctcgggctcggccccggcggcgctggcgc	Protospacer
.**   *.*****.*************** 

596. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttccggctcggcgccggcggcgctggcga	Protospacer
..* * *.***** ***************.

597. spacer 6.15|927277|30|CP025594|CRT matches to NC_021908 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttccggctcggcgccggcggcgctggcga	Protospacer
..* * *.***** ***************.

598. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP020441 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tctcgggctcggccccggcggcgctggcgc	Protospacer
.**   *.*****.*************** 

599. spacer 6.15|927277|30|CP025594|CRT matches to CP007642 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttccggctcggcgccggcggcgctggcga	Protospacer
..* * *.***** ***************.

600. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tctcgggctcggccccggcggcgctggcgc	Protospacer
.**   *.*****.*************** 

601. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg	Protospacer
*.  *** ***************** *. *

602. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg	Protospacer
*.  *** ***************** *. *

603. spacer 6.15|927277|30|CP025594|CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg-	CRISPR spacer
actgctgtccggctccggcggca-tgatgtc	Protospacer
 *******.*************. **..*  

604. spacer 6.15|927277|30|CP025594|CRT matches to MN582086 (Siphoviridae sp. ctdEk19, complete genome) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gccggccttcgacttcggcggcgctggcgg	Protospacer
 *.* . ****.**.***************

605. spacer 6.15|927277|30|CP025594|CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg	Protospacer
*.  *** ***************** *. *

606. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP022700 (Acetobacter tropicalis strain BDGP1 plasmid pAtBDGP1A, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gttcctccacggttccggcggcgctggcgg	Protospacer
 .* ** . ***.*****************

607. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg	Protospacer
*.  *** ***************** *. *

608. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg	Protospacer
*.  *** ***************** *. *

609. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg	Protospacer
*.  *** ***************** *. *

610. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP031082 (Paracoccus yeei strain CCUG 32053 plasmid pYEE4, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tctcgggctcggccccggcggcgctggcgc	Protospacer
.**   *.*****.*************** 

611. spacer 6.17|927367|36|CP025594|CRT matches to NC_022087 (Mycobacterium phage AnnaL29, complete genome) position: , mismatch: 7, identity: 0.806

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
cgtgatcggcaacggcggaaacggcgggagctgggg	Protospacer
  **************** *********. * * **

612. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg-gtggcta	CRISPR spacer
ggccggaggcaccggcggcgccggcggcacgggc-	Protospacer
****** **** *************** ..** . 

613. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcggg--tggcta	CRISPR spacer
gaccggcggcagcggcggcgcgggcggagccggc--	Protospacer
*.*********.********* *****.  .***  

614. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP025548 (Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg-gtggcta	CRISPR spacer
cgcaggcggcaacggcggccccggcggcgccgcc-	Protospacer
 ** *************** ******* *. **. 

615. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgggtggcta----	CRISPR spacer
ggccgggggcaacggcggcgacggc----gtctacgac	Protospacer
****** ************* ****    * ***    

616. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to MT889380 (Mycobacterium phage Coco12, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
tgccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 ******************. ******  *..**  

617. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
tgccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 ******************. ******  *..**  

618. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcggg--tggcta	CRISPR spacer
tgtcggcggcagcggcggcggcggcggggccggc--	Protospacer
 *.********.******** *******  .***  

619. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP039644 (Azospirillum sp. TSA2s plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgggt--ggcta	CRISPR spacer
ggccggcggcatcggcgacgccggctgcttcagc--	Protospacer
*********** *****.******* * *  .**  

620. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgggtggcta-	CRISPR spacer
caccggcggccacggcggcaccggc-ggcggcgat	Protospacer
 .******** ********.***** **.*** * 

621. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP039641 (Azospirillum sp. TSH100 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg-gtggcta	CRISPR spacer
agacggcggcaccggcggcggcggcggtgaggcc-	Protospacer
.* ******** ******** ****** * ***. 

622. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to MH697583 (Mycobacterium phage EricMillard, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

623. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to MH727551 (Mycobacterium phage Kalah2, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

624. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to MH077579 (Mycobacterium phage Halley, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

625. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to MH669017 (Mycobacterium phage Zelink, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

626. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to MN062701 (Mycobacterium phage Dallas, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

627. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to MK524527 (Mycobacterium phage ThreeRngTarjay, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

628. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to MK524529 (Mycobacterium phage Phoebus, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

629. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to MF919512 (Mycobacterium phage Klein, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

630. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to KF114875 (Mycobacterium phage Redno2, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

631. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to MK967379 (Mycobacterium phage HokkenD, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg---gtggcta	CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg---	Protospacer
. *************** * *******   ****   

632. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP025513 (Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgg-gtggcta	CRISPR spacer
agacggtggcagcggcggcgccggcggcggtgct-	Protospacer
.* ***.****.*************** *  *** 

633. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_LR134450 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcggg-tggcta	CRISPR spacer
ggtcggcgccaacggcggcgccggtgaactgggt-	Protospacer
**.***** ***************.*.. *** * 

634. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggc--gggtggcta	CRISPR spacer
cgctggcggcaacgtcggcgccggccatggcggc--	Protospacer
 **.********** **********   **.***  

635. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgggtggcta-	CRISPR spacer
tggcggcggcaacggcggcggtggc-ggtggcggt	Protospacer
 * ***************** .*** ****** . 

636. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggc--gggtggcta	CRISPR spacer
cgctggcggcaacgtcggcgccggccatggcggc--	Protospacer
 **.********** **********   **.***  

637. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to MN813686 (Mycobacterium phage BirdsNest, complete genome) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcg--ggtggcta	CRISPR spacer
tgctggcggcaacggcggcgtcggcatcgctggc--	Protospacer
 **.****************.****.  * ****  

638. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NC_042035 (Mycobacterium phage Zemanar, complete sequence) position: , mismatch: 7, identity: 0.794

ggccggcggcaacggcggcgccggcgggtggcta-	CRISPR spacer
cgacggcggcaacggcggcggtggc-ggtggtcac	Protospacer
 * ***************** .*** *****..* 

639. spacer 8.9|1212373|37|CP025594|CRISPRCasFinder matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 7, identity: 0.811

tgtcggcggtgccggcggcaccggcgggttaggcaac	CRISPR spacer
tgtcggcggtgccggcggtgccggcggtgccggcgac	Protospacer
******************..*******  . ***.**

640. spacer 9.1|1572152|28|CP025594|CRISPRCasFinder matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 7, identity: 0.75

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
agcacccggggtgccgtcgttgccggcg	Protospacer
. ..** ********.*********** 

641. spacer 9.10|1572767|31|CP025594|CRISPRCasFinder matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 7, identity: 0.774

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
gttgccgccatgcccgccgctgccgccggcc	Protospacer
. *  **** *********.********** 

642. spacer 9.10|1572767|31|CP025594|CRISPRCasFinder matches to CP017041 (Propionibacterium sp. oral taxon 193 strain F0672 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
aacggcgtcttgcccgccgtggccgccaccg	Protospacer
**. ***.************ ******. *.

643. spacer 10.3|2088355|30|CP025594|CRT matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 7, identity: 0.767

tcggagaaagccgtcggtttgcacgctgtt	CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac	Protospacer
*. *. ************ ********* .

644. spacer 10.3|2088355|30|CP025594|CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.767

tcggagaaagccgtcggtttgcacgctgtt	CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac	Protospacer
*. *. ************ ********* .

645. spacer 10.3|2088355|30|CP025594|CRT matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 7, identity: 0.767

tcggagaaagccgtcggtttgcacgctgtt	CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac	Protospacer
*. *. ************ ********* .

646. spacer 14.7|3741111|31|CP025594|CRT matches to NZ_CP010990 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence) position: , mismatch: 7, identity: 0.774

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
cccacccacttcaccgacgtcgccgccgacg	Protospacer
  *.************ ***.******* *.

647. spacer 14.7|3741111|31|CP025594|CRT matches to NZ_CP012186 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-1, complete sequence) position: , mismatch: 7, identity: 0.774

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
cccacccacttcaccgacgtcgccgccgacg	Protospacer
  *.************ ***.******* *.

648. spacer 14.7|3741111|31|CP025594|CRT matches to NZ_CP042263 (Litoreibacter sp. LN3S51 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.774

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
atccgccatttcaccgccgttgccgacgccg	Protospacer
* *  ***.**************** **.*.

649. spacer 1.4|335607|36|CP025594|CRT matches to NZ_CP015744 (Shinella sp. HZN7 plasmid pShin-08, complete sequence) position: , mismatch: 8, identity: 0.778

gcggcg-ccgaagagcaggccggcgttgccgccagcc	CRISPR spacer
-cgtcgcccgaagagcaggccggcatggccgcctcgg	Protospacer
 ** ** *****************.* ******    

650. spacer 1.8|335838|33|CP025594|CRT matches to MG925349 (Mycobacterium phage Mendokysei, complete genome) position: , mismatch: 8, identity: 0.758

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ccgtcgccgccgttgccgccggccgcgatcacc	Protospacer
*** *********** *********** . . .

651. spacer 1.8|335838|33|CP025594|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ccggcgccgacgttgccgccggcccaggcgtta	Protospacer
********* ***** ********  * **   

652. spacer 1.8|335838|33|CP025594|CRT matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 8, identity: 0.758

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
caggcgccgccgtcgacgccggccgccatcgcc	Protospacer
* ***********.************  . * .

653. spacer 1.8|335838|33|CP025594|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ccggcgccgacgttgccgccggcccaggcgtta	Protospacer
********* ***** ********  * **   

654. spacer 1.8|335838|33|CP025594|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ccggcgccgacgttgccgccggcccaggcgtta	Protospacer
********* ***** ********  * **   

655. spacer 1.8|335838|33|CP025594|CRT matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 8, identity: 0.758

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
caggcgccgccgtcgacgccggccgccatcgcc	Protospacer
* ***********.************  . * .

656. spacer 1.8|335838|33|CP025594|CRT matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
caggcgccgtcgttgacgccggacgcgttgccg	Protospacer
* *******.************ ****..*   

657. spacer 1.8|335838|33|CP025594|CRT matches to NZ_CP029833 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.758

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
acgaagccgccgttgccgccggccgcaccgccg	Protospacer
 **. ********** **********.***   

658. spacer 1.8|335838|33|CP025594|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.758

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ggggagccgccgttgccgccggccgccgccgac	Protospacer
  ** ********** **********  * **.

659. spacer 1.8|335838|33|CP025594|CRT matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 8, identity: 0.758

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ccacccccgccgttggcgccgcccgcgccgccg	Protospacer
**. * *********.***** ********   

660. spacer 1.8|335838|33|CP025594|CRT matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.758

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
acgaagccgccgtcgccgccggccgcgccgccg	Protospacer
 **. ********.* **************   

661. spacer 1.8|335838|33|CP025594|CRT matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.758

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
tgatcgccgccgtcgacgccgcccgcgccatat	Protospacer
. . *********.******* *******. **

662. spacer 1.8|335838|33|CP025594|CRT matches to KY555145 (Caulobacter phage Ccr29, complete genome) position: , mismatch: 8, identity: 0.758

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ccactgccggcgttgacgccgcccgcgccgccc	Protospacer
**. .**** *********** ********  .

663. spacer 1.8|335838|33|CP025594|CRT matches to KY555143 (Caulobacter phage Ccr2, complete genome) position: , mismatch: 8, identity: 0.758

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ccactgccggcgttgacgccgcccgcgccgccc	Protospacer
**. .**** *********** ********  .

664. spacer 1.8|335838|33|CP025594|CRT matches to AY369265 (Burkholderia cenocepacia phage Bcep1, complete genome) position: , mismatch: 8, identity: 0.758

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ccggcaccgccgttgccgccggccgtataggcc	Protospacer
*****.********* *********... ** .

665. spacer 1.8|335838|33|CP025594|CRT matches to MK524485 (Mycobacterium phage MissDaisy, complete genome) position: , mismatch: 8, identity: 0.758

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ctcgcgccgccggtgacgcgggccgcgctgccg	Protospacer
*. ********* ****** ********.*   

666. spacer 1.8|335838|33|CP025594|CRT matches to MH926058 (Mycobacterium phage Reptar3000, complete genome) position: , mismatch: 8, identity: 0.758

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ctcgcgccgccggtgacgcgggccgcgctgccg	Protospacer
*. ********* ****** ********.*   

667. spacer 1.8|335838|33|CP025594|CRT matches to MK524488 (Mycobacterium phage Patt, complete genome) position: , mismatch: 8, identity: 0.758

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ctcgcgccgccggtgacgcgggccgcgctgccg	Protospacer
*. ********* ****** ********.*   

668. spacer 1.8|335838|33|CP025594|CRT matches to NC_005263 (Burkholderia phage Bcep1, complete genome) position: , mismatch: 8, identity: 0.758

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ccggcaccgccgttgccgccggccgtataggcc	Protospacer
*****.********* *********... ** .

669. spacer 1.8|335838|33|CP025594|CRT matches to KY555142 (Caulobacter phage Ccr10, complete genome) position: , mismatch: 8, identity: 0.758

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ccactgccggcgttgacgccgcccgcgccgccc	Protospacer
**. .**** *********** ********  .

670. spacer 1.8|335838|33|CP025594|CRT matches to NZ_LR134450 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence) position: , mismatch: 8, identity: 0.758

ccggcgccgccgttgacgccggccgcgccggat----	CRISPR spacer
ccggcgccgccgttggcgccgac----ccgaactaca	Protospacer
***************.*****.*    ***.*.    

671. spacer 1.8|335838|33|CP025594|CRT matches to NZ_CP026546 (Cupriavidus metallidurans strain Ni-2 plasmid unnamed2) position: , mismatch: 8, identity: 0.758

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gcggagccgccgttgccgccggccgaacctcgt	Protospacer
 *** ********** ********* .**  .*

672. spacer 1.8|335838|33|CP025594|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.758

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ccggcgccgacgttgccgccggcccaggcgtta	Protospacer
********* ***** ********  * **   

673. spacer 1.8|335838|33|CP025594|CRT matches to MH271296 (Gordonia phage Emperor, complete genome) position: , mismatch: 8, identity: 0.758

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
cccttgtcgcctttggcgccggccgcgccggtg	Protospacer
**  .*.**** ***.***************  

674. spacer 3.6|366813|33|CP025594|CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 8, identity: 0.758

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
ttggtgtcgatctcgatctggccgttgcccgca	Protospacer
  * **.*****.**************** *..

675. spacer 3.6|366813|33|CP025594|CRISPRCasFinder matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 8, identity: 0.758

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
agctggttgatgccgatctggccgctgccggtc	Protospacer
** . *..*** ************.******* 

676. spacer 3.6|366813|33|CP025594|CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
atgctgccgaccccgatctggtcgttttcgact	Protospacer
* ********.**********.**** .**.. 

677. spacer 3.6|366813|33|CP025594|CRISPRCasFinder matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 8, identity: 0.758

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
cggctgccgatcccgatcaggacgtcgaccttc	Protospacer
 ***************** ** ***.* *  * 

678. spacer 3.6|366813|33|CP025594|CRISPRCasFinder matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.758

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
agctggttgatgccgatctggccgctgccggtc	Protospacer
** . *..*** ************.******* 

679. spacer 4.2|631299|30|CP025594|CRT matches to NZ_CP045074 (Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
cagacctcggtgaccacgccggcaacgatc	Protospacer
   ** .************** ******. 

680. spacer 4.2|631299|30|CP025594|CRT matches to NZ_CP015269 (Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 2, complete sequence) position: , mismatch: 8, identity: 0.733

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
ggttggccggtgaccactccgccagcgatg	Protospacer
. .  ************ ******.***.*

681. spacer 6.13|927181|30|CP025594|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgacgccggcctgctggtcgggctgacctc	Protospacer
********************* .. . *  

682. spacer 6.13|927181|30|CP025594|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ccgcaaactcctgctggtcggcgccggcgg	Protospacer
* .*.    ************* *******

683. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgatgccggcctgctggtcggggttcccag	Protospacer
***.*****************  ..  *.*

684. spacer 6.13|927181|30|CP025594|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ccgcaaactcctgctggtcggcgccggcgg	Protospacer
* .*.    ************* *******

685. spacer 6.13|927181|30|CP025594|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ccttcagggcgtgctggtcggctccggcgc	Protospacer
*  .   *** ****************** 

686. spacer 6.13|927181|30|CP025594|CRT matches to NZ_KY126370 (Enterobacter cloacae subsp. cloacae strain MN201516 plasmid pOP-I, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

687. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP054625 (Cupriavidus gilardii strain FDAARGOS_639 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggccgccggcctgctgtgcggctccgcgct	Protospacer
 * *************  ********    

688. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgatgccggcctgctggtcggggttcccag	Protospacer
***.*****************  ..  *.*

689. spacer 6.13|927181|30|CP025594|CRT matches to NZ_LT960615 (Hartmannibacter diazotrophicus strain E19T plasmid HDIAp1, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gttcaccgccctgctgatcggctccggcat	Protospacer
   *.*** *******.***********. 

690. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP046347 (Citrobacter portucalensis strain FDAARGOS_738 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

691. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP044100 (Citrobacter werkmanii strain FDAARGOS_616 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

692. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP032156 (Mycobacterium sp. ELW1 plasmid pELW1-1, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
aatcgccggcctgctggtcggtgccgcggt	Protospacer
 . ******************. ***  * 

693. spacer 6.13|927181|30|CP025594|CRT matches to KY555144 (Caulobacter phage Ccr5, complete genome) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggtgatcggcctgctggtcgtcgccggcgc	Protospacer
 *  ..************** * ****** 

694. spacer 6.13|927181|30|CP025594|CRT matches to NZ_KP873172 (Pseudomonas aeruginosa PAO1 plasmid pAMBL1, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

695. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP045203 (Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

696. spacer 6.13|927181|30|CP025594|CRT matches to NC_021492 (Enterobacter sp. R4-368 plasmid pENT01, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

697. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP022156 (Escherichia coli strain ABWA45 plasmid pABWA45_2, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

698. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP024682 (Citrobacter freundii strain UMH14 plasmid pUMH14_2, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

699. spacer 6.13|927181|30|CP025594|CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgatgccggcctgctggtcggggttcccag	Protospacer
***.*****************  ..  *.*

700. spacer 6.15|927277|30|CP025594|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cgaccatctcggctccgacggcgctggcgc	Protospacer
*   *  .*********.*********** 

701. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

702. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gccaccccgcggctccggaggcgctggcgg	Protospacer
 *..*. . ********* ***********

703. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcaccggcggcgctggcga	Protospacer
. *   *.***** ***************.

704. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcaccggcggcgctggcga	Protospacer
. *   *.***** ***************.

705. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

706. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

707. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

708. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

709. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

710. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

711. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

712. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

713. spacer 6.15|927277|30|CP025594|CRT matches to NC_010998 (Rhizobium etli CIAT 652 plasmid pA, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcaccggcggcgctggcga	Protospacer
. *   *.***** ***************.

714. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgatcggctccggcgccggcttctc	Protospacer
******* ************ ** .  *  

715. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgtgcggctccggcggcaaccccga	Protospacer
 ******* *************. .  **.

716. spacer 6.15|927277|30|CP025594|CRT matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgatgttcgactccggcggcgacgcacc	Protospacer
**** ******.*********** .*    

717. spacer 6.15|927277|30|CP025594|CRT matches to NZ_AP014706 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gcaccgcgccggctccggcggcggtggcgg	Protospacer
 *  *   .************** ******

718. spacer 6.17|927367|36|CP025594|CRT matches to MG770216 (Mycobacterium phage Rem711, complete genome) position: , mismatch: 8, identity: 0.778

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
attcggcggcaacggcggcaacggcgcggccggcgc	Protospacer
..* . ************.******* ******** 

719. spacer 6.17|927367|36|CP025594|CRT matches to KY087993 (Mycobacterium phage Hammy, complete genome) position: , mismatch: 8, identity: 0.778

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
gcagatcggcaccggcggtaacggcggcggtgcagc	Protospacer
** ******** *************** * .*  * 

720. spacer 6.17|927367|36|CP025594|CRT matches to MF140406 (Mycobacterium phage DarthP, complete genome) position: , mismatch: 8, identity: 0.778

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
gcagatcggcaccggcggtaacggcggcggtgcagc	Protospacer
** ******** *************** * .*  * 

721. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
caacggcggcaacggcggcgacggcggtcgcggt--	Protospacer
 . ***************** ******  *.**.  

722. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ccccggcggcaacggcggcaacggcggcaatgcc--	Protospacer
  *****************. ******  .** *  

723. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
cgccggcggcagcgccggcgccggcagtatcggc--	Protospacer
 **********.** **********.*   .***  

724. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta--	CRISPR spacer
tgtcggcggtaacggcggcgtcggcgg--agccagc	Protospacer
 *.******.**********.******  .**.*  

725. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt	Protospacer
************** *********.     **.*     

726. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NC_047958 (Burkholderia phage vB_BmuP_KL4, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
tgccggccgcaacgacggcgccggcggccggtgc	Protospacer
 ****** ******.************ .**.  

727. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt	Protospacer
************** *********.     **.*     

728. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta--	CRISPR spacer
ctccggcggcaacggcggtgccgccgg--gaccact	Protospacer
  ****************.**** ***  *.*.*  

729. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcgggaagggcggcgccggcggcggtctg	Protospacer
  ******* ** **************  * **.

730. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt	Protospacer
************** *********.     **.*     

731. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt	Protospacer
************** *********.     **.*     

732. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cgccggcggaaacggtggcgccggcggcacggtg	Protospacer
 ******** *****.***********   * *.

733. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg-gtggcta	CRISPR spacer
taccggcggcaatggaggcgccggcggcatcgcc-	Protospacer
 .**********.** *********** .* **. 

734. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta--	CRISPR spacer
ctccggcggcaacggcggtgccgccgg--gaccact	Protospacer
  ****************.**** ***  *.*.*  

735. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta--	CRISPR spacer
ctccggcggcaacggcggtgccgccgg--gaccact	Protospacer
  ****************.**** ***  *.*.*  

736. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to MN234223 (Mycobacterium phage Philly, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

737. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to KJ194581 (Mycobacterium phage Audrey, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

738. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to MH051265 (Mycobacterium phage Yahalom, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

739. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to MH316565 (Mycobacterium phage Mortcellus, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

740. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to MT310871 (Mycobacterium phage Jackstina, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

741. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to EU816589 (Mycobacterium phage Phaedrus, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

742. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to MT952851 (Mycobacterium phage Gervas, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

743. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to MG920059 (Mycobacterium phage Baloo, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

744. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NC_023686 (Mycobacterium phage Gadjet, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

745. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NC_041965 (Mycobacterium phage Athena, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

746. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to DQ398049 (Mycobacterium phage Pipefish, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

747. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to MT310892 (Mycobacterium phage Compostia, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

748. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to JN699018 (Mycobacterium phage Kamiyu, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac	Protospacer
* ******************* **** .  **  

749. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg----gtggcta	CRISPR spacer
cggcggcggcaccggcggcaccggcggtgccgtg----	Protospacer
 * ******** *******.*******    ***    

750. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta--	CRISPR spacer
ggccggcggcaacgggagcgccggc--ctcgccgcc	Protospacer
*************** .********   * **..  

751. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcg-gcaacggcggcgccggcgggtggcta	CRISPR spacer
-ccgagcgcgccacggcggctccggcgggtggccc	Protospacer
  * .*** ** ******** ************. 

752. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to MK814754 (Mycobacterium phage Sumter, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

753. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to MK814754 (Mycobacterium phage Sumter, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

754. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to MN369739 (Mycobacterium phage Kenuha5, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

755. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to MK967397 (Mycobacterium phage Mahavrat, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

756. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to MT522000 (Mycobacterium phage Soul22, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

757. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to KY348865 (Mycobacterium phage Bubbles123, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

758. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to MN428047 (Mycobacterium phage Doomphist, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

759. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to MF919502 (Mycobacterium phage Demsculpinboyz, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

760. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to AY129336 (Mycobacteriophage Che9d, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

761. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to MT771340 (Mycobacterium phage Jorgensen, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

762. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to MK359343 (Mycobacterium phage Pollywog, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

763. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NC_042030 (Mycobacterium phage Yoshi, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

764. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NC_048729 (Mycobacterium phage Renaud18, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

765. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NC_026585 (Mycobacteriophage Estave1, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

766. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to MK305886 (Mycobacterium phage Poenanya, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

767. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to JN859129 (Mycobacterium virus DotProduct, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

768. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to MG925354 (Mycobacterium phage Ogopogo, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

769. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to JN698995 (Mycobacterium phage Dori, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaacggcggccctggcggctcggtg	Protospacer
 .***************** *.***** * * *.

770. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NC_023698 (Mycobacterium phage Avani, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

771. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NC_011054 (Mycobacterium phage Boomer, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc--	Protospacer
 .*****************. ******  *..**  

772. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to MN234184 (Mycobacterium phage IdentityCrisis, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
caccggcggcagcggcggcgcaggcggaaacggc--	Protospacer
 .*********.********* *****  ..***  

773. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to MH077585 (Mycobacterium phage TChen, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

774. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NC_048788 (Mycobacterium phage ThetaBob, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc--	Protospacer
  *****************. ******  *..**  

775. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgg-gtggcta	CRISPR spacer
tctcggcggcgacggcggcgacggcggtgttgat-	Protospacer
  .*******.********* ****** ** * * 

776. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP015733 (Arthrobacter sp. U41 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcaacggcggccgcggctgccagcca	Protospacer
.******************  **** * ..**.*

777. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to MN096355 (Mycobacterium phage Purky, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta-	CRISPR spacer
gcgcggcggcaccggcggcaccggc-ggcggtcat	Protospacer
*  ******** *******.***** **.**..* 

778. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to MN234183 (Mycobacterium phage Antsirabe, complete genome) position: , mismatch: 8, identity: 0.765

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cgtcggcggcagcggcggcggcggcggacgtcca	Protospacer
 *.********.******** ******..* *.*

779. spacer 8.9|1212373|37|CP025594|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 8, identity: 0.784

tgtcggcggtgccggcggcaccggcgggttaggcaac	CRISPR spacer
agtcggcggcggcggcggcaccggcgggaccggcggc	Protospacer
 ********.* **************** . ***..*

780. spacer 9.10|1572767|31|CP025594|CRISPRCasFinder matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
gcgggcgccttgtccgccgctgccgccgggc	Protospacer
.   ********.******.*********  

781. spacer 9.10|1572767|31|CP025594|CRISPRCasFinder matches to NZ_CP039899 (Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877a, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

782. spacer 9.10|1572767|31|CP025594|CRISPRCasFinder matches to NZ_CP039913 (Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625b, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

783. spacer 9.10|1572767|31|CP025594|CRISPRCasFinder matches to NZ_CP039890 (Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499a, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

784. spacer 9.10|1572767|31|CP025594|CRISPRCasFinder matches to NZ_CP018001 (Rhizobium sp. Y9 plasmid pY9, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

785. spacer 9.10|1572767|31|CP025594|CRISPRCasFinder matches to NC_022536 (Rhizobium sp. IRBG74 plasmid IRBL74_p, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

786. spacer 9.10|1572767|31|CP025594|CRISPRCasFinder matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

787. spacer 9.10|1572767|31|CP025594|CRISPRCasFinder matches to NZ_CP018075 (Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
gcgagcgccttgcccgccgtggtcgccgccc	Protospacer
.   **************** *.***** * 

788. spacer 9.10|1572767|31|CP025594|CRISPRCasFinder matches to CP036360 (Agrobacterium sp. 33MFTa1.1 plasmid p_JBx_073812, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

789. spacer 9.10|1572767|31|CP025594|CRISPRCasFinder matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

aattgc--gccttgcccgccgttgccgccggca	CRISPR spacer
--ccgctggccttgcccggggttgccgccgggg	Protospacer
  ..**  **********  *********** .

790. spacer 9.10|1572767|31|CP025594|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
attgccgccctggccgccgttgccgccgatc	Protospacer
* *  ****.** ***************.. 

791. spacer 10.3|2088355|30|CP025594|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733

tcggagaaagccgtcggtttgcacgctgtt	CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc	Protospacer
.** ... **************.******.

792. spacer 10.3|2088355|30|CP025594|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733

tcggagaaagccgtcggtttgcacgctgtt	CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc	Protospacer
.** ... **************.******.

793. spacer 14.7|3741111|31|CP025594|CRT matches to CP033373 (Lactobacillus fermentum strain DR9 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
ttagcccacttcacggccgttgccgacgcgg	Protospacer
   *********** ********** **. .

794. spacer 14.7|3741111|31|CP025594|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

795. spacer 14.7|3741111|31|CP025594|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

796. spacer 14.7|3741111|31|CP025594|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

797. spacer 14.7|3741111|31|CP025594|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

798. spacer 14.7|3741111|31|CP025594|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

799. spacer 14.7|3741111|31|CP025594|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

800. spacer 14.7|3741111|31|CP025594|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

801. spacer 14.7|3741111|31|CP025594|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

802. spacer 14.7|3741111|31|CP025594|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

803. spacer 14.7|3741111|31|CP025594|CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
cgcaactccttcaccgccgctgccgccgtct	Protospacer
 .*. *. ***********.********** 

804. spacer 14.7|3741111|31|CP025594|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

805. spacer 14.7|3741111|31|CP025594|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

806. spacer 14.7|3741111|31|CP025594|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

807. spacer 14.7|3741111|31|CP025594|CRT matches to NZ_CP027299 (Streptomyces sp. SGAir0924 plasmid unnamed_5) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
ctcggtggcttcgccgccgtcgccgccgtca	Protospacer
  ** . .****.*******.**********

808. spacer 14.7|3741111|31|CP025594|CRT matches to NC_014213 (Meiothermus silvanus DSM 9946 plasmid pMESIL01, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
atcgcccacttcaccggcgtttccgaccctt	Protospacer
* ************** **** *** * .. 

809. spacer 1.4|335607|36|CP025594|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.75

gcggcgccgaagagcaggccggcgttgccgccagcc	CRISPR spacer
ccgttgccgatgagcagtccggcgttgccgccgttg	Protospacer
 ** .***** ****** **************. . 

810. spacer 1.8|335838|33|CP025594|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 9, identity: 0.727

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
agcgcgccgccgatgacgccggccacggtggcg	Protospacer
   ********* ***********.** .**  

811. spacer 1.8|335838|33|CP025594|CRT matches to NC_010399 (Clavibacter michiganensis subsp. sepedonicus plasmid pCS1, complete sequence) position: , mismatch: 9, identity: 0.727

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gctccgccgccgcagacgccggccgcgccatgc	Protospacer
 *  ********. ***************. ..

812. spacer 1.8|335838|33|CP025594|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
agcgcgccgccgatgacgccggccacggtggcg	Protospacer
   ********* ***********.** .**  

813. spacer 1.8|335838|33|CP025594|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
agcgcgccgccgatgacgccggccacggtggcg	Protospacer
   ********* ***********.** .**  

814. spacer 1.8|335838|33|CP025594|CRT matches to MN369761 (Mycobacterium phage Malthus, complete genome) position: , mismatch: 9, identity: 0.727

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg	Protospacer
.. ********* ****** ********.*   

815. spacer 1.8|335838|33|CP025594|CRT matches to MK224497 (Mycobacterium phage Henu3, complete genome) position: , mismatch: 9, identity: 0.727

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg	Protospacer
.. ********* ****** ********.*   

816. spacer 1.8|335838|33|CP025594|CRT matches to KJ944841 (Mycobacterium phage Cheetobro, complete genome) position: , mismatch: 9, identity: 0.727

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg	Protospacer
.. ********* ****** ********.*   

817. spacer 1.8|335838|33|CP025594|CRT matches to AP018469 (Mycobacterium phage Y10 DNA, complete genome, note: sample1) position: , mismatch: 9, identity: 0.727

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg	Protospacer
.. ********* ****** ********.*   

818. spacer 1.8|335838|33|CP025594|CRT matches to KY087992 (Mycobacterium phage Mitti, complete genome) position: , mismatch: 9, identity: 0.727

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg	Protospacer
.. ********* ****** ********.*   

819. spacer 1.8|335838|33|CP025594|CRT matches to EF602154 (Burkholderia phage BcepNY3, complete genome) position: , mismatch: 9, identity: 0.727

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ccggcaccgccgttgccgccggccgtatagacc	Protospacer
*****.********* *********... *. .

820. spacer 1.8|335838|33|CP025594|CRT matches to MF140402 (Mycobacterium phage Chancellor, complete genome) position: , mismatch: 9, identity: 0.727

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg	Protospacer
.. ********* ****** ********.*   

821. spacer 1.8|335838|33|CP025594|CRT matches to AP018470 (Mycobacterium phage Y2 DNA, complete genome) position: , mismatch: 9, identity: 0.727

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg	Protospacer
.. ********* ****** ********.*   

822. spacer 1.8|335838|33|CP025594|CRT matches to KT361920 (Mycobacterium phage Slarp, complete genome) position: , mismatch: 9, identity: 0.727

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg	Protospacer
.. ********* ****** ********.*   

823. spacer 1.8|335838|33|CP025594|CRT matches to MT310882 (Mycobacterium phage JF1, complete genome) position: , mismatch: 9, identity: 0.727

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg	Protospacer
.. ********* ****** ********.*   

824. spacer 1.8|335838|33|CP025594|CRT matches to AP018471 (Mycobacterium phage Y10 DNA, complete genome, note: sample2) position: , mismatch: 9, identity: 0.727

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg	Protospacer
.. ********* ****** ********.*   

825. spacer 1.8|335838|33|CP025594|CRT matches to KX621007 (Mycobacterium phage Taquito, complete genome) position: , mismatch: 9, identity: 0.727

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg	Protospacer
.. ********* ****** ********.*   

826. spacer 1.8|335838|33|CP025594|CRT matches to MH051258 (Mycobacterium phage SamScheppers, complete genome) position: , mismatch: 9, identity: 0.727

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ttcgcgccgccggtgacgcgggccgcgctgccg	Protospacer
.. ********* ****** ********.*   

827. spacer 1.8|335838|33|CP025594|CRT matches to NZ_CP036221 (Mycobacterium avium subsp. hominissuis strain mc2 2500 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ggggttccgccggtgacgccggcggcgccgatg	Protospacer
  **. ****** ********** ******.  

828. spacer 1.8|335838|33|CP025594|CRT matches to NZ_CP040251 (Mycobacterium avium subsp. hominissuis strain 101115 plasmid unnamed1) position: , mismatch: 9, identity: 0.727

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ggggttccgccggtgacgccggcggcgccgatg	Protospacer
  **. ****** ********** ******.  

829. spacer 1.8|335838|33|CP025594|CRT matches to NZ_CP040252 (Mycobacterium avium subsp. hominissuis strain 101115 plasmid unnamed2) position: , mismatch: 9, identity: 0.727

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ggggttccgccggtgacgccggcggcgccgatg	Protospacer
  **. ****** ********** ******.  

830. spacer 1.8|335838|33|CP025594|CRT matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 9, identity: 0.727

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
agggcgccgccgctgccgccggccgcctccggg	Protospacer
  **********.** ********** .* *. 

831. spacer 1.8|335838|33|CP025594|CRT matches to NZ_CP029334 (Mycobacterium avium subsp. hominissuis strain MAC109 plasmid pMAC109b, complete sequence) position: , mismatch: 9, identity: 0.727

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ggggttccgccggtgacgccggcggcgccgatg	Protospacer
  **. ****** ********** ******.  

832. spacer 1.8|335838|33|CP025594|CRT matches to KY555147 (Caulobacter phage Ccr34, complete genome) position: , mismatch: 9, identity: 0.727

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ccactaccggcgttgacgccgcccgcgccgccc	Protospacer
**. ..*** *********** ********  .

833. spacer 1.8|335838|33|CP025594|CRT matches to KY555146 (Caulobacter phage Ccr32, complete genome) position: , mismatch: 9, identity: 0.727

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ccactaccggcgttgacgccgcccgcgccgccc	Protospacer
**. ..*** *********** ********  .

834. spacer 1.8|335838|33|CP025594|CRT matches to NC_047975 (Microbacterium phage Squash, complete genome) position: , mismatch: 9, identity: 0.727

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
aggacgccgccggagacgccggccgcgcggtcc	Protospacer
  *.********  ************** *  .

835. spacer 1.8|335838|33|CP025594|CRT matches to JX163858 (Caulobacter phage phiCbK, complete genome) position: , mismatch: 9, identity: 0.727

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
ccactaccggcgttgacgccgcccgcgccgccc	Protospacer
**. ..*** *********** ********  .

836. spacer 3.6|366813|33|CP025594|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 9, identity: 0.727

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
ttgtattcgatcccgatctggccgtcgccggcc	Protospacer
  *.  .******************.*****. 

837. spacer 3.6|366813|33|CP025594|CRISPRCasFinder matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc	Protospacer
 ***************** ** ***.  *  * 

838. spacer 3.6|366813|33|CP025594|CRISPRCasFinder matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 9, identity: 0.727

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc	Protospacer
 ***************** ** ***.  *  * 

839. spacer 3.6|366813|33|CP025594|CRISPRCasFinder matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 9, identity: 0.727

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc	Protospacer
 ***************** ** ***.  *  * 

840. spacer 4.2|631299|30|CP025594|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
cccacgccggtcaccacgccgctgcccggc	Protospacer
 ********** **********.. * .  

841. spacer 5.1|692011|31|CP025594|CRISPRCasFinder matches to NZ_CP014964 (Geobacter anodireducens strain SD-1 plasmid pSD, complete sequence) position: , mismatch: 9, identity: 0.71

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
ggaacgaacggcaagccgaaatgttggtgga	Protospacer
.* .**************** .*****    

842. spacer 5.1|692011|31|CP025594|CRISPRCasFinder matches to NC_015974 (Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence) position: , mismatch: 9, identity: 0.71

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg	Protospacer
 . ********.***********.**.. * 

843. spacer 5.1|692011|31|CP025594|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.71

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg	Protospacer
 . ********.***********.**.. * 

844. spacer 6.13|927181|30|CP025594|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.7

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggcgccggcctgctggtcggactgctcac	Protospacer
**.****************** ..   *. 

845. spacer 6.15|927277|30|CP025594|CRT matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 9, identity: 0.7

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gaccacgttcggctccggccgcgctcgcgt	Protospacer
  .  .************* ***** *** 

846. spacer 6.15|927277|30|CP025594|CRT matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 9, identity: 0.7

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gaccacgttcggctccggccgcgctcgcgt	Protospacer
  .  .************* ***** *** 

847. spacer 6.17|927367|36|CP025594|CRT matches to MF140398 (Mycobacterium phage Amohnition, complete genome) position: , mismatch: 9, identity: 0.75

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
gcagatcggcaccggcggtaacggcggcggtacggc	Protospacer
** ******** *************** * ..  * 

848. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgg--gtggcta	CRISPR spacer
caacggcggcaacggcggcaacggcggcaacggc--	Protospacer
 . ****************. ******  ..***  

849. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcg--ggtggcta	CRISPR spacer
cagcggcggcaacggcggccgcggcggcgacggc--	Protospacer
 . ****************  *****  *..***  

850. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cgccggcggcaactgcggcgccggcgcccaccgc	Protospacer
 ************ ************  .. *  

851. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcg--ggtggcta	CRISPR spacer
cagcggcagcaatggcggcgccggcggcgccggc--	Protospacer
 . ****.****.*************  * .***  

852. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cggcggcgggaccggcggcgccggcggcagtatc	Protospacer
 * ****** * ***************  *  * 

853. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to EF602154 (Burkholderia phage BcepNY3, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcggcaacggcggtgccggtgcgccagcc	Protospacer
******************.*****.* *. . . 

854. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to AY369265 (Burkholderia cenocepacia phage Bcep1, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcggcaacggcggtgccggtgcgccagcc	Protospacer
******************.*****.* *. . . 

855. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NC_005263 (Burkholderia phage Bcep1, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcggcaacggcggtgccggtgcgccagcc	Protospacer
******************.*****.* *. . . 

856. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcggcattttc	Protospacer
.**********  **************    .* 

857. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcggcattttc	Protospacer
.**********  **************    .* 

858. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cgtcggcggccacggcggcgtcggcggtcaggaa	Protospacer
 *.******* *********.****** ..*  *

859. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP053906 (Hymenobacter sp. BRD67 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaccggcggcggcggcgggggcacc	Protospacer
 .********* ******** ******* *  . 

860. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to KC170279 (Uncultured bacterium plasmid pMBUI8, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggcgccggcgtctaccag	Protospacer
  ********** *************  *. * .

861. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

862. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gaccggcggcaccggcggcgccgccggccatcat	Protospacer
*.********* *********** *** .. *  

863. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

864. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

865. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

866. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

867. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cggcggcggcaatggcggcaccggcggcacggtc	Protospacer
 * *********.******.*******   * * 

868. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

869. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

870. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ctccggcggcaacggcggcggcagcggtggtgga	Protospacer
  ****************** *.****  *   *

871. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

872. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

873. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

874. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

875. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

876. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

877. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

878. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

879. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

880. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

881. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

882. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

883. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

884. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc	Protospacer
 .****.*****.**************  .* * 

885. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to MH001451 (Mycobacterium phage Nairb, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc	Protospacer
 .*****************. ****** *. *. 

886. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to MF155936 (Mycobacterium phage ZenTime222, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc	Protospacer
 .*****************. ****** *. *. 

887. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to MH588544 (Caulobacter phage CcrBL10, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gaccggcggcaacggcggcggcggtggctcctcg	Protospacer
*.****************** ***.** *  ...

888. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to MK494089 (Mycobacterium phage Ibrahim, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc	Protospacer
 .*****************. ****** *. *. 

889. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NC_024135 (Mycobacterium phage Bernal13, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc	Protospacer
 .*****************. ****** *. *. 

890. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to KM591905 (Mycobacterium phage RonRayGun, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc	Protospacer
 .*****************. ****** *. *. 

891. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to MN735432 (Mycobacteriophage Whitty, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc	Protospacer
 .*****************. ****** *. *. 

892. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_KX443399 (Rhodococcus hoagii strain PAM1354 plasmid pVAPA1354, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga	Protospacer
*************** ** *****     .**.*     

893. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_KX443400 (Rhodococcus hoagii strain PAM1557 plasmid pVAPN1557, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga	Protospacer
*************** ** *****     .**.*     

894. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_KX443398 (Rhodococcus hoagii strain PAM1204 plasmid pVAPN1204, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga	Protospacer
*************** ** *****     .**.*     

895. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to CP054922 (Streptomyces sp. NA03103 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
tgccggcggccccggcggcgccggccagctgcac	Protospacer
 *********  ************* .*. **  

896. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_KP851975 (Rhodococcus hoagii strain PAM2012 plasmid pVAPN2012, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga	Protospacer
*************** ** *****     .**.*     

897. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NC_015314 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcg--ggtggcta	CRISPR spacer
ctgcggcggcgacggcggcaccggcggaggcagc--	Protospacer
   *******.********.******  **..**  

898. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gttcggcggcgagggcggcgccggcggcaagcgt	Protospacer
* .*******.* **************  .**  

899. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_KF439868 (Rhodococcus hoagii strain PAM1571 plasmid pVAPN1571, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta-----	CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga	Protospacer
*************** ** *****     .**.*     

900. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cgacggcggcaacggcggccgcggcggctccgtg	Protospacer
 * ****************  ****** *   *.

901. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP021025 (Rhizobium sp. TAL182 plasmid pRetTAL182a, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc	Protospacer
.**********  ************.*    ** 

902. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gcgcggcggcgccggcggcgccggcggcgaggga	Protospacer
*  *******. ***************  .*  *

903. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat	Protospacer
********.* *************.* *.  *  

904. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP013600 (Rhizobium sp. N741 plasmid pRspN741e, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc	Protospacer
.**********  ************.*    ** 

905. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NC_019789 (Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcg--ggtggcta	CRISPR spacer
caccggcggcaacggcggcaccgccgacaacggc--	Protospacer
 .*****************.*** **  ...***  

906. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP013504 (Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc	Protospacer
.**********  ************.*    ** 

907. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP013510 (Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc	Protospacer
.**********  ************.*    ** 

908. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP013521 (Rhizobium sp. N113 plasmid pRspN113d, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc	Protospacer
.**********  ************.*    ** 

909. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP013494 (Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc	Protospacer
.**********  ************.*    ** 

910. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP013512 (Rhizobium sp. N1314 plasmid pRspN1314a, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc	Protospacer
.**********  ************.*    ** 

911. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP013594 (Rhizobium sp. N871 plasmid pRspN871d, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc	Protospacer
.**********  ************.*    ** 

912. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat	Protospacer
********.* *************.* *.  *  

913. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to KC736071 (Mycobacterium phage WIVsmall, complete genome) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcg--ggtggcta	CRISPR spacer
caacggcggcaacggcggcaacggcggcggcagc--	Protospacer
 . ****************. *****  **..**  

914. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat	Protospacer
********.* *************.* *.  *  

915. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_LR134446 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 4, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gagcggcggcaacggcggcaacggcggcttcccc	Protospacer
*. ****************. ****** *  *. 

916. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP041653 (Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cgacggccgcaacggcggctccggcggcgggaac	Protospacer
 * **** *********** *******  **   

917. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat	Protospacer
********.* *************.* *.  *  

918. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat	Protospacer
********.* *************.* *.  *  

919. spacer 8.9|1212373|37|CP025594|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 9, identity: 0.757

tgtcggcggtgccggcggcaccggcgggttaggcaac	CRISPR spacer
ggtgggcggtgccggcggcagcggcggcatggccttc	Protospacer
 ** **************** ******  *.* *  *

920. spacer 9.10|1572767|31|CP025594|CRISPRCasFinder matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcctcgccctgcccgccgttgccgcccacg	Protospacer
.... ****.***************** .*.

921. spacer 9.10|1572767|31|CP025594|CRISPRCasFinder matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
tggcccgccttgccctccattgccgccggac	Protospacer
 . . ********** **.**********  

922. spacer 9.10|1572767|31|CP025594|CRISPRCasFinder matches to NC_022049 (Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
atccttgccttgaccgccgttgccgccgctg	Protospacer
* .. .****** *************** ..

923. spacer 9.10|1572767|31|CP025594|CRISPRCasFinder matches to MN234199 (Mycobacterium phage Ekdilam, complete genome) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
accccagccctgcccgccgttgccgccgctc	Protospacer
* ..  ***.****************** . 

924. spacer 9.10|1572767|31|CP025594|CRISPRCasFinder matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
gcttgcgcctggcccgccgtagccggacacc	Protospacer
. ******** ********* ****   .* 

925. spacer 9.10|1572767|31|CP025594|CRISPRCasFinder matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
accggcaccttgcccgccattgccgccatgt	Protospacer
* . **.***********.********.   

926. spacer 9.10|1572767|31|CP025594|CRISPRCasFinder matches to NZ_CP013740 (Streptomyces globisporus C-1027 plasmid pSGL1, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
cgggccgccttgtccgccgtggccgccgacc	Protospacer
 .   *******.******* *******.* 

927. spacer 9.10|1572767|31|CP025594|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
agcgtggccttggccgccgttgccggcggtc	Protospacer
*..   ****** ************ ***. 

928. spacer 14.5|3740970|34|CP025594|CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.735

gttttctcccgcgacggtgggggtggcgccggca	CRISPR spacer
attgagatccgcgacgatgggtgtggcgccggcg	Protospacer
.**    .********.**** ***********.

929. spacer 14.5|3740970|34|CP025594|CRT matches to MG812496 (Gordonia phage SallySpecial, complete genome) position: , mismatch: 9, identity: 0.735

gttttctcccgcgacggtgggggtggcgccggca	CRISPR spacer
gcgcaccaccgcggcggtgcgggtggcgccggcg	Protospacer
*. . *. *****.***** *************.

930. spacer 1.8|335838|33|CP025594|CRT matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
tgctcgccgccgatgacgccggccgtgcgcagt	Protospacer
.   ******** ************.**  ..*

931. spacer 1.8|335838|33|CP025594|CRT matches to NZ_CP018080 (Sulfitobacter sp. AM1-D1 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
agggcgccgccgatgacggcggccgcggtcagg	Protospacer
  ********** ***** ******** . .. 

932. spacer 1.8|335838|33|CP025594|CRT matches to MH371116 (Mycobacterium phage DMoney, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

933. spacer 1.8|335838|33|CP025594|CRT matches to MH045569 (Mycobacterium phage Schiebel, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

934. spacer 1.8|335838|33|CP025594|CRT matches to MH371119 (Mycobacterium phage OctaviousRex, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

935. spacer 1.8|335838|33|CP025594|CRT matches to MF919497 (Mycobacterium phage Chance64, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

936. spacer 1.8|335838|33|CP025594|CRT matches to MH001456 (Mycobacterium phage CLED96, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

937. spacer 1.8|335838|33|CP025594|CRT matches to GQ303261 (Mycobacterium phage Hope, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

938. spacer 1.8|335838|33|CP025594|CRT matches to MG099946 (Mycobacterium phage LouisV14, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

939. spacer 1.8|335838|33|CP025594|CRT matches to KC787112 (Mycobacterium phage Clark, partial genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

940. spacer 1.8|335838|33|CP025594|CRT matches to MH779513 (Mycobacterium phage Olga, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

941. spacer 1.8|335838|33|CP025594|CRT matches to MK919475 (Mycobacterium phage Camri, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

942. spacer 1.8|335838|33|CP025594|CRT matches to MK310146 (Mycobacterium phage Crespo, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

943. spacer 1.8|335838|33|CP025594|CRT matches to MK524493 (Mycobacterium phage Darionha, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

944. spacer 1.8|335838|33|CP025594|CRT matches to MH779505 (Mycobacterium phage Grizzly, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

945. spacer 1.8|335838|33|CP025594|CRT matches to EU568876 (Mycobacterium phage BPs, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

946. spacer 1.8|335838|33|CP025594|CRT matches to KC787107 (Mycobacterium phage Bo4, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

947. spacer 1.8|335838|33|CP025594|CRT matches to MF668268 (Mycobacterium phage Aroostook, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

948. spacer 1.8|335838|33|CP025594|CRT matches to MK524494 (Mycobacterium phage Rabbs, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

949. spacer 1.8|335838|33|CP025594|CRT matches to KX588251 (Mycobacterium phage Jane, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

950. spacer 1.8|335838|33|CP025594|CRT matches to KC787103 (Mycobacterium phage Chy2, partial genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

951. spacer 1.8|335838|33|CP025594|CRT matches to MH001455 (Mycobacterium phage Remy19, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

952. spacer 1.8|335838|33|CP025594|CRT matches to KT355472 (Mycobacterium phage Cedasite, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

953. spacer 1.8|335838|33|CP025594|CRT matches to KX664455 (Mycobacterium phage Zombie, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

954. spacer 1.8|335838|33|CP025594|CRT matches to MH077584 (Mycobacterium phage Phish, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

955. spacer 1.8|335838|33|CP025594|CRT matches to KC787108 (Mycobacterium phage DNAIII, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

956. spacer 1.8|335838|33|CP025594|CRT matches to MN444875 (Mycobacterium phage Jonghyun, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

957. spacer 1.8|335838|33|CP025594|CRT matches to MK433279 (Mycobacterium phage Kareem, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

958. spacer 1.8|335838|33|CP025594|CRT matches to KJ725374 (Mycobacterium phage Guo1, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

959. spacer 1.8|335838|33|CP025594|CRT matches to NC_031102 (Mycobacterium phage Sneeze, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

960. spacer 1.8|335838|33|CP025594|CRT matches to MT818422 (Mycobacterium phage Periodt, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

961. spacer 1.8|335838|33|CP025594|CRT matches to MK305884 (Mycobacterium phage BQuat, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

962. spacer 1.8|335838|33|CP025594|CRT matches to MF668272 (Mycobacterium phage Gideon, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

963. spacer 1.8|335838|33|CP025594|CRT matches to KC787111 (Mycobacterium phage Sedge, partial genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

964. spacer 1.8|335838|33|CP025594|CRT matches to KC787104 (Mycobacterium phage Chy3, partial genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

965. spacer 1.8|335838|33|CP025594|CRT matches to NC_012788 (Mycobacterium phage Angel, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

966. spacer 1.8|335838|33|CP025594|CRT matches to KX443326 (Mycobacterium phage BruceB, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

967. spacer 1.8|335838|33|CP025594|CRT matches to MK433277 (Mycobacterium phage Renaissance, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

968. spacer 1.8|335838|33|CP025594|CRT matches to MH590605 (Mycobacterium phage Cherrybomb426, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

969. spacer 1.8|335838|33|CP025594|CRT matches to MH779509 (Mycobacterium phage Kasen3, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

970. spacer 1.8|335838|33|CP025594|CRT matches to JN699002 (Mycobacterium phage Avrafan, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

971. spacer 1.8|335838|33|CP025594|CRT matches to MH779507 (Mycobacterium phage Hotshotbaby7, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

972. spacer 1.8|335838|33|CP025594|CRT matches to KT355474 (Mycobacterium phage Frosty24, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

973. spacer 1.8|335838|33|CP025594|CRT matches to KC787109 (Mycobacterium phage Legendre, partial genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

974. spacer 1.8|335838|33|CP025594|CRT matches to JN412593 (Mycobacterium phage Liefie, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

975. spacer 1.8|335838|33|CP025594|CRT matches to MH479920 (Mycobacterium phage Mowgli, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

976. spacer 1.8|335838|33|CP025594|CRT matches to KM923970 (Mycobacterium phage Gomashi, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

977. spacer 1.8|335838|33|CP025594|CRT matches to MH450127 (Mycobacterium phage Plagueis, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

978. spacer 1.8|335838|33|CP025594|CRT matches to KT347314 (Mycobacterium phage Phreak, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

979. spacer 1.8|335838|33|CP025594|CRT matches to KT365399 (Mycobacterium phage Annihilator, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

980. spacer 1.8|335838|33|CP025594|CRT matches to KC787110 (Mycobacterium phage Leo, complete genome) position: , mismatch: 10, identity: 0.697

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gaatcgccgccgttcccgccggccgcgccctgg	Protospacer
  . **********  *************  . 

981. spacer 3.6|366813|33|CP025594|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc	Protospacer
  *.  .**** *************.*****. 

982. spacer 3.6|366813|33|CP025594|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc	Protospacer
  *.  .**** *************.*****. 

983. spacer 3.6|366813|33|CP025594|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 10, identity: 0.697

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
ttgtattcgatgccgatctggccgtcgccggcc	Protospacer
  *.  .**** *************.*****. 

984. spacer 6.2|926677|39|CP025594|CRT matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.744

cggcgcgggcggggccgtcacgggaaccggcgccaccgg	CRISPR spacer
cacgggggccggggccgccacgggaaccggcgccccgcc	Protospacer
*.  * ** ********.**************** *   

985. spacer 6.5|926830|36|CP025594|CRT matches to KX683875 (Mycobacterium phage Baehexic, complete genome) position: , mismatch: 10, identity: 0.722

aggggccggtgggctgttcaacggcggcggggccgg	CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct	Protospacer
    ****************.****** ** * *  

986. spacer 6.5|926830|36|CP025594|CRT matches to KM197169 (Mycobacterium phage Piro94, complete genome) position: , mismatch: 10, identity: 0.722

aggggccggtgggctgttcaacggcggcggggccgg	CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct	Protospacer
    ****************.****** ** * *  

987. spacer 6.5|926830|36|CP025594|CRT matches to MF668269 (Mycobacterium phage Drake55, complete genome) position: , mismatch: 10, identity: 0.722

aggggccggtgggctgttcaacggcggcggggccgg	CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct	Protospacer
    ****************.****** ** * *  

988. spacer 6.5|926830|36|CP025594|CRT matches to MK284522 (Mycobacterium phage Malec, complete genome) position: , mismatch: 10, identity: 0.722

aggggccggtgggctgttcaacggcggcggggccgg	CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct	Protospacer
    ****************.****** ** * *  

989. spacer 6.5|926830|36|CP025594|CRT matches to KM677210 (Mycobacterium phage Larenn, complete genome) position: , mismatch: 10, identity: 0.722

aggggccggtgggctgttcaacggcggcggggccgg	CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct	Protospacer
    ****************.****** ** * *  

990. spacer 6.17|927367|36|CP025594|CRT matches to MN369764 (Mycobacterium phage Rahalelujah, complete genome) position: , mismatch: 10, identity: 0.722

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
atctggaggcaacggcggtaacggcggggccagcac	Protospacer
... .  ************************.**. 

991. spacer 6.17|927367|36|CP025594|CRT matches to NZ_CP025548 (Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.722

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
gaccggcggcaacggcggaaacggcggcgccgcagc	Protospacer
* . . ************ ******** ****  * 

992. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcg-----ggtggcta	CRISPR spacer
ccgcggcggcgacggcggcgcgggcggcaccggt-----	Protospacer
   *******.********** ****     ***     

993. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gagcggcggcaacggcggtaccggcggtgacgtc	Protospacer
*. ***************..*******  .  * 

994. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP034352 (Streptomyces sp. W1SF4 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
acccggcggcaccggcggcgcgggcggtccggcc	Protospacer
. ********* ********* ***** . * . 

995. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to CP000620 (Burkholderia vietnamiensis G4 plasmid pBVIE04, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
tgccggcggcatcggcgccgccggcgcggcatcg	Protospacer
 ********** ***** ******** *  ....

996. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP020810 (Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ctccggcggcaccggaggcgccggcggaggcacc	Protospacer
  ********* *** ***********. *  . 

997. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NC_016588 (Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
atccggcggcgccggcggcgccggcggcggaact	Protospacer
. ********. ***************  *. . 

998. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to MK524490 (Mycobacterium phage Donny, complete genome) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ctccggcggcaacggcggcaacggcggctccacg	Protospacer
  *****************. ****** *   ..

999. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to MK494095 (Mycobacterium phage Daegal, complete genome) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggcaccggcggcaccggcggcaccgga	Protospacer
 .********* *******.*******      *

1000. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to JN699007 (Mycobacterium phage Acadian, complete genome) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ctccggcggcaacggcggcaacggcggctccacg	Protospacer
  *****************. ****** *   ..

1001. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to MT889381 (Mycobacterium phage Suigeneris, complete genome) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ctccggcggcaacggcggcaacggcggctccacg	Protospacer
  *****************. ****** *   ..

1002. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP015373 (Pandoraea pnomenusa strain MCB032 plasmid unnamed 2, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1003. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to AP018709 (Uncultured bacterium plasmid pSN1104-59 DNA, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1004. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP013744 (Streptomyces sp. CdTB01 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta-------	CRISPR spacer
ggccgacggcaagggcggcgcc-------ggttacgcctcc	Protospacer
*****.****** *********       **.**       

1005. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcatcggcggcgcgggcgaggcccag	Protospacer
  ********* ********* ****.*   * .

1006. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NC_008766 (Acidovorax sp. JS42 plasmid pAOVO02, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1007. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
tgacggcggcaacagcggcaccggcggagcgaag	Protospacer
 * **********.*****.*******.  *  .

1008. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP019238 (Rhodoferax koreense strain DCY-110 plasmid unnamed2) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1009. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP019238 (Rhodoferax koreense strain DCY-110 plasmid unnamed2) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1010. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcatcggcggcgcgggcgaggcccag	Protospacer
  ********* ********* ****.*   * .

1011. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NC_021077 (Comamonas sp. 7D-2 plasmid pBHB, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1012. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NC_024998 (Acidovorax avenae subsp. avenae plasmid pAAA83 DNA, complete sequence, strain: 83) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1013. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NC_008385 (Burkholderia ambifaria AMMD plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1014. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP018471 (Xanthomonas vesicatoria strain LM159 plasmid pLM159.2, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1015. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_KJ588780 (Achromobacter xylosoxidans strain A22732 plasmid pA22732-IMP, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1016. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_MN366359 (Bacterium plasmid pALTS31, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1017. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP027024 (Streptomyces sp. WAC00288 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcaacaacggcggcgccggcgccttcttc	Protospacer
 .*****..*****************  *  .* 

1018. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NC_001735 (Enterobacter aerogenes plasmid R751, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1019. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to AGRM01000006 (Salmonella enterica subsp. houtenae str. ATCC BAA-1581 plasmid pSEHO0A1, complete sequence, whole genome shotgun sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1020. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to AJ863570 (Uncultured bacterium IncP-1beta multiresistance plasmid pB8) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1021. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP034651 (Xanthomonas vasicola strain NCPPB 1060 plasmid pXVH45, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1022. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gcgtctgggccacggcggcgctggcgggtgggtg	Protospacer
*  .   *** **********.********* *.

1023. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gcgtctgggccacggcggcgctggcgggtgggtg	Protospacer
*  .   *** **********.********* *.

1024. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NC_021492 (Enterobacter sp. R4-368 plasmid pENT01, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1025. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to JX469828 (Uncultured bacterium plasmid pRSB223, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
tcccggcggcaagggcggtgccggcgtctatcag	Protospacer
  ********** *****.*******  *. * .

1026. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to JX469829 (Uncultured bacterium plasmid pB1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
tcccggcggcaagggcggtgccggcgtctatcag	Protospacer
  ********** *****.*******  *. * .

1027. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to JX469831 (Uncultured bacterium plasmid pKSP212, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1028. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to JN106172 (Uncultured bacterium plasmid pAKD29, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1029. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to JN106173 (Uncultured bacterium plasmid pAKD31, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1030. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to JN106174 (Uncultured bacterium plasmid pAKD33, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1031. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to JN106164 (Uncultured bacterium plasmid pAKD1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1032. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to JN106165 (Uncultured bacterium plasmid pAKD14, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1033. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to JN106166 (Uncultured bacterium plasmid pAKD15, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1034. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to JN106168 (Uncultured bacterium plasmid pAKD17, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1035. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to JN106169 (Uncultured bacterium plasmid pAKD18, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1036. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to MN386974 (Pseudomonas aeruginosa strain 1943 plasmid pPaeBURNS1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1037. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NC_001381 (Mycobacterium fortuitum plasmid pAL5000, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
gcgcggcggcagcggcggcgctggcggcggcacg	Protospacer
*  ********.*********.*****  *  ..

1038. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to MG879028 (Uncultured bacterium plasmid pEG1-1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1039. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP021650 (Acidovorax sp. T1 plasmid p2-T1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1040. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to JX486125 (Uncultured bacterium plasmid pRWC72a, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1041. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP038640 (Cupriavidus oxalaticus strain X32 plasmid unnamed5, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1042. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to AJ639924 (Uncultured bacterium plasmid pB3 complete genome) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1043. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to KU356987 (Variovorax paradoxus plasmid pBS64, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1044. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to KU356988 (Variovorax paradoxus plasmid pHB44, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1045. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcgacggcggcgacggcgccccgcgc	Protospacer
  ********.********* *****  . **  

1046. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP009797 (Burkholderia ambifaria AMMD plasmid pBII_1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1047. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NC_013176 (Pseudomonas putida plasmid pW2, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1048. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NC_019320 (Variovorax sp. DB1 plasmid pDB1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1049. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP017455 (Dickeya solani strain PPO 9019 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1050. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NC_007337 (Cupriavidus pinatubonensis JMP134 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1051. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_MN366358 (Bacterium plasmid pALTS29, complete sequence) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag	Protospacer
  ********** *****.*******  *. * .

1052. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to MN234219 (Mycobacterium phage Mercurio, complete genome) position: , mismatch: 10, identity: 0.706

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cgacgtcggcaccggcggcgccggcggcgcgaag	Protospacer
 * ** ***** ***************   *  .

1053. spacer 8.9|1212373|37|CP025594|CRISPRCasFinder matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 10, identity: 0.73

tgtcggcggtgccggcggcaccggcgggttaggcaac	CRISPR spacer
cctcgacggtgccggcggcatcggcgggcgctggacc	Protospacer
. ***.**************.*******.   * * *

1054. spacer 8.9|1212373|37|CP025594|CRISPRCasFinder matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 10, identity: 0.73

tgtcggcggtgccggcggcaccggcgggttaggcaac	CRISPR spacer
cctcgacggtgccggcggcatcggcgggcgctggacc	Protospacer
. ***.**************.*******.   * * *

1055. spacer 9.10|1572767|31|CP025594|CRISPRCasFinder matches to NC_017273 (Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence) position: , mismatch: 10, identity: 0.677

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
gggctcgcctcgcccgccgttcccgccgctc	Protospacer
.. . *****.********** ****** . 

1056. spacer 9.10|1572767|31|CP025594|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.677

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ttcctcgccttccccgccgctgccgccgcgg	Protospacer
  .. ****** *******.********  .

1057. spacer 9.10|1572767|31|CP025594|CRISPRCasFinder matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 10, identity: 0.677

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggccagaacttccccgctgttgccgccggca	Protospacer
..... . *** *****.*************

1058. spacer 9.10|1572767|31|CP025594|CRISPRCasFinder matches to NC_017590 (Thermus thermophilus JL-18 plasmid pTTJL1802, complete sequence) position: , mismatch: 10, identity: 0.677

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
gggctcgcctcgcccgccgttcccgccgctc	Protospacer
.. . *****.********** ****** . 

1059. spacer 9.10|1572767|31|CP025594|CRISPRCasFinder matches to NZ_AP014581 (Burkholderia sp. RPE67 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.677

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcgtggccttggccgccgttgccggcggtc	Protospacer
...   ****** ************ ***. 

1060. spacer 9.13|1573016|34|CP025594|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 10, identity: 0.706

gtcgccgtgcagccagccaccaccgccaccggcg	CRISPR spacer
ccgatgatgcagccggccaccaccgccaccagca	Protospacer
 . .. .*******.***************.**.

1061. spacer 12.9|3119764|35|CP025594|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 10, identity: 0.714

acttgcgcgcacaacgcatccgccatccacggggc	CRISPR spacer
gtcaccgcgcacaacacattcgccatccacacggt	Protospacer
...  **********.***.**********. **.

1062. spacer 13.20|3123236|34|CP025594|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022335 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence) position: , mismatch: 10, identity: 0.706

tagaaggcgatcactggaagcacggcgcttgcga	CRISPR spacer
ggcaaggcgatcagtggaagctcggcggcggcac	Protospacer
 . ********** ******* ***** . **. 

1063. spacer 14.5|3740970|34|CP025594|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 10, identity: 0.706

gttttctcccgcgacggtgggggtggcgccggca	CRISPR spacer
cagcgcggccgcgtcggtgggggtggcgcccgcc	Protospacer
   . *  ***** **************** ** 

1064. spacer 14.5|3740970|34|CP025594|CRT matches to NZ_CP024986 (Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706

gttttctcccgcgacggtgggggtggcgccggca	CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc	Protospacer
*   .* *******.** *************.  

1065. spacer 14.5|3740970|34|CP025594|CRT matches to NC_024970 (Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706

gttttctcccgcgacggtgggggtggcgccggca	CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc	Protospacer
*   .* *******.** *************.  

1066. spacer 14.5|3740970|34|CP025594|CRT matches to NZ_KJ396772 (Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706

gttttctcccgcgacggtgggggtggcgccggca	CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc	Protospacer
*   .* *******.** *************.  

1067. spacer 1.8|335838|33|CP025594|CRT matches to NZ_CP032676 (Rhodococcus rhodochrous strain ATCC BAA870 plasmid pNit, complete sequence) position: , mismatch: 11, identity: 0.667

ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
gacaggccgccgtcgacgccggccgcaccccgc	Protospacer
   . ********.************.**  ..

1068. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caacggcggcaacggcggcaacggcggcacgtcg	Protospacer
 . ****************. ******   *...

1069. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
tttcggcggcagcggcggcggcggcggaaccccg	Protospacer
  .********.******** ******.   *..

1070. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to MH051334 (Escherichia phage vB_EcoS-Ro145c2YLVW, complete genome) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggcggctacggcggcggcggcggcaattgg	Protospacer
 .******** ********* ******  . . .

1071. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to MG852086 (Escherichia phage vB_EcoS-Ro145clw, complete genome) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
taccggcggctacggcggcggcggcggcaattgg	Protospacer
 .******** ********* ******  . . .

1072. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caccggcggccacggcggggccggcggcgacgcg	Protospacer
 .******** ******* ********  .  ..

1073. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
tttcggcggcaagggcggcgccgccggcgatcag	Protospacer
  .********* ********** ***  . * .

1074. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP020372 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
caggggcggcaacggcggccccggcaggacggcg	Protospacer
 .  *************** *****.**  * ..

1075. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
cataggcggcgatggcggcgccggcgggatggcg	Protospacer
 .. ******.*.***************  * ..

1076. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to ASHF01000034 (Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence) position: , mismatch: 11, identity: 0.676

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
ggccgacggcaagggcggcgccggatacgccccc	Protospacer
*****.****** ***********  .    *. 

1077. spacer 14.5|3740970|34|CP025594|CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 11, identity: 0.676

gttttctcccgcgacggtgggggtggcgccggca	CRISPR spacer
cgcccccggcgtgacggtggaggtggcgccggcc	Protospacer
  ...*.  **.********.************ 

1078. spacer 1.8|335838|33|CP025594|CRT matches to NC_023285 (Streptomyces sp. F8 plasmid pFRL5, complete sequence) position: , mismatch: 12, identity: 0.636

--ccggcgccgccgttgacgccggccgcgccggat	CRISPR spacer
acagcgcgccgccggcgtccacggcggcgccgt--	Protospacer
     ********* .* *  **** ******   

1079. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 12, identity: 0.647

ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
aaccggcggcgacggcgtcgccggcgccaattcg	Protospacer
..********.****** ********   . ...

1080. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_CP026703 (Serratia marcescens strain AR_0027 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 12, identity: 0.647

ggccggcggcaacggcggcgc-----cggcgggtggcta	CRISPR spacer
-gccggaaacgccggcgccgctgttgcggccggtg----	Protospacer
 ***** ..*. ***** ***     **** ****    

1081. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 14, identity: 0.588

-----ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
acggcggccgccggcgccggcgtttccgccgaga-----	Protospacer
     ***** ****. ***** . *** **.*      

1082. spacer 8.3|1212070|34|CP025594|CRISPRCasFinder matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 15, identity: 0.559

-----ggccggcggcaacggcggcgccggcgggtggcta	CRISPR spacer
acggcggccgccggcgccgacgtttccgccgaga-----	Protospacer
     ***** ****. **.** . *** **.*      

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 889035 : 947608 59 Burkholderia_virus(16.67%) bacteriocin,tRNA,transposase,protease NA
DBSCAN-SWA_2 1125415 : 1177216 54 Klosneuvirus(20.0%) integrase,tRNA,transposase,protease attL 1133238:1133254|attR 1182296:1182312
DBSCAN-SWA_3 2941139 : 2976505 42 Tupanvirus(11.11%) transposase,terminase,capsid,protease,integrase,head,tRNA attL 2969940:2969967|attR 2980922:2980949
DBSCAN-SWA_4 3710370 : 3796308 57 Burkholderia_virus(28.57%) tRNA,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage