Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP025588 Lactobacillus plantarum strain KC3 plasmid unnamed2, complete sequence 0 crisprs NA 0 0 0 0
CP025589 Lactobacillus plantarum strain KC3 plasmid unnamed3, complete sequence 0 crisprs NA 0 0 0 0
CP025586 Lactobacillus plantarum strain KC3 chromosome, complete genome 1 crisprs NA 0 2 0 0
CP025587 Lactobacillus plantarum strain KC3 plasmid unnamed1, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. CP025586
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025586_1 1079474-1079700 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP025586_1 1.1|1079494|25|CP025586|CRT 1079494-1079518 25 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 1431117-1431141 3 0.88
CP025586_1 1.1|1079494|25|CP025586|CRT 1079494-1079518 25 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1431262-1431286 3 0.88
CP025586_1 1.1|1079494|25|CP025586|CRT 1079494-1079518 25 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 927425-927449 3 0.88
CP025586_1 1.1|1079494|25|CP025586|CRT 1079494-1079518 25 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 1430840-1430864 3 0.88
CP025586_1 1.1|1079494|25|CP025586|CRT 1079494-1079518 25 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 1430784-1430808 3 0.88
CP025586_1 1.1|1079494|25|CP025586|CRT 1079494-1079518 25 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 918402-918426 3 0.88
CP025586_1 1.1|1079494|25|CP025586|CRT 1079494-1079518 25 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 915557-915581 3 0.88
CP025586_1 1.3|1079593|25|CP025586|CRT 1079593-1079617 25 NZ_CP038867 Vagococcus sp. CF-49 plasmid punnamed2, complete sequence 24133-24157 3 0.88
CP025586_1 1.1|1079494|25|CP025586|CRT 1079494-1079518 25 NZ_CP016082 Streptomyces sp. SAT1 plasmid unnamed2, complete sequence 204374-204398 4 0.84
CP025586_1 1.1|1079494|25|CP025586|CRT 1079494-1079518 25 NZ_CP049158 Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence 646182-646206 4 0.84
CP025586_1 1.1|1079494|25|CP025586|CRT 1079494-1079518 25 NZ_CP049318 Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence 645393-645417 4 0.84
CP025586_1 1.3|1079593|25|CP025586|CRT 1079593-1079617 25 NZ_CP016082 Streptomyces sp. SAT1 plasmid unnamed2, complete sequence 204374-204398 4 0.84

1. spacer 1.1|1079494|25|CP025586|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88

cggttcactcggttcactcggctca	CRISPR spacer
cgcgtcactcgattcactcggctca	Protospacer
**  *******.*************

2. spacer 1.1|1079494|25|CP025586|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88

cggttcactcggttcactcggctca	CRISPR spacer
cgcgtcactcgattcactcggctca	Protospacer
**  *******.*************

3. spacer 1.1|1079494|25|CP025586|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88

cggttcactcggttcactcggctca	CRISPR spacer
cgcgtcactcgattcactcggctca	Protospacer
**  *******.*************

4. spacer 1.1|1079494|25|CP025586|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 3, identity: 0.88

cggttcactcggttcactcggctca	CRISPR spacer
cgcgtcactcgattcactcggctca	Protospacer
**  *******.*************

5. spacer 1.1|1079494|25|CP025586|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88

cggttcactcggttcactcggctca	CRISPR spacer
cgcgtcactcgattcactcggctca	Protospacer
**  *******.*************

6. spacer 1.1|1079494|25|CP025586|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 3, identity: 0.88

cggttcactcggttcactcggctca	CRISPR spacer
cgcgtcactcgattcactcggctca	Protospacer
**  *******.*************

7. spacer 1.1|1079494|25|CP025586|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88

cggttcactcggttcactcggctca	CRISPR spacer
cgcgtcactcgattcactcggctca	Protospacer
**  *******.*************

8. spacer 1.3|1079593|25|CP025586|CRT matches to NZ_CP038867 (Vagococcus sp. CF-49 plasmid punnamed2, complete sequence) position: , mismatch: 3, identity: 0.88

cggttcgcttggttcactcggctca	CRISPR spacer
tggttcgcttggttcacttggttca	Protospacer
.*****************.**.***

9. spacer 1.1|1079494|25|CP025586|CRT matches to NZ_CP016082 (Streptomyces sp. SAT1 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.84

cggttcactcggttcactcggctca	CRISPR spacer
tggttcacttggttcactcggctgg	Protospacer
.********.************* .

10. spacer 1.1|1079494|25|CP025586|CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 4, identity: 0.84

cggttcactcggttcactcggctca	CRISPR spacer
gagttcaatcggttcactcggttca	Protospacer
 .***** *************.***

11. spacer 1.1|1079494|25|CP025586|CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 4, identity: 0.84

cggttcactcggttcactcggctca	CRISPR spacer
gagttcaatcggttcactcggttca	Protospacer
 .***** *************.***

12. spacer 1.3|1079593|25|CP025586|CRT matches to NZ_CP016082 (Streptomyces sp. SAT1 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.84

cggttcgcttggttcactcggctca	CRISPR spacer
tggttcacttggttcactcggctgg	Protospacer
.*****.**************** .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage