Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP025612 Niveispirillum cyanobacteriorum strain TH16 chromosome eg_2, complete sequence 1 crisprs csa3,cas2,cas1,cas4,cas7,cas8c,cas5,cas3 1 7 1 0
CP025611 Niveispirillum cyanobacteriorum strain TH16 chromosome eg_1, complete sequence 0 crisprs csa3,WYL,cas3,DinG,DEDDh 0 0 1 0
CP025614 Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed2, complete sequence 0 crisprs NA 0 0 0 0
CP025613 Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence 0 crisprs WYL,DEDDh,csa3 0 0 0 0
CP025615 Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed3, complete sequence 0 crisprs NA 0 0 9 0

Results visualization

1. CP025612
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025612_2 1095835-1097897 TypeI I-C
31 spacers
cas2,cas1,cas4,cas7,cas8c,cas5,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP025612_2 2.15|1096790|34|CP025612|CRISPRCasFinder,CRT,PILER-CR 1096790-1096823 34 CP025612.1 37650-37683 0 1.0

1. spacer 2.15|1096790|34|CP025612|CRISPRCasFinder,CRT,PILER-CR matches to position: 37650-37683, mismatch: 0, identity: 1.0

gatagcctcttgcagttgatcggcgcgcaacgat	CRISPR spacer
gatagcctcttgcagttgatcggcgcgcaacgat	Protospacer
**********************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP025612_2 2.4|1096061|34|CP025612|CRISPRCasFinder,CRT,PILER-CR 1096061-1096094 34 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1079505-1079538 6 0.824
CP025612_2 2.4|1096061|34|CP025612|CRISPRCasFinder,CRT,PILER-CR 1096061-1096094 34 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 985272-985305 6 0.824
CP025612_2 2.4|1096061|34|CP025612|CRISPRCasFinder,CRT,PILER-CR 1096061-1096094 34 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 984369-984402 6 0.824
CP025612_2 2.4|1096061|34|CP025612|CRISPRCasFinder,CRT,PILER-CR 1096061-1096094 34 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 985264-985297 6 0.824
CP025612_2 2.4|1096061|34|CP025612|CRISPRCasFinder,CRT,PILER-CR 1096061-1096094 34 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 984620-984653 6 0.824
CP025612_2 2.4|1096061|34|CP025612|CRISPRCasFinder,CRT,PILER-CR 1096061-1096094 34 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 985255-985288 6 0.824
CP025612_2 2.4|1096061|34|CP025612|CRISPRCasFinder,CRT,PILER-CR 1096061-1096094 34 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1079604-1079637 6 0.824
CP025612_2 2.4|1096061|34|CP025612|CRISPRCasFinder,CRT,PILER-CR 1096061-1096094 34 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1079599-1079632 6 0.824
CP025612_2 2.4|1096061|34|CP025612|CRISPRCasFinder,CRT,PILER-CR 1096061-1096094 34 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1079583-1079616 6 0.824
CP025612_1 1.1|41671|30|CP025612|PILER-CR 41671-41700 30 NZ_CP039697 Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence 255868-255897 7 0.767
CP025612_1 1.1|41671|30|CP025612|PILER-CR 41671-41700 30 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 400895-400924 7 0.767
CP025612_1 1.1|41671|30|CP025612|PILER-CR 41671-41700 30 MH045568 Microbacterium phage Kieran, complete genome 23833-23862 7 0.767
CP025612_1 1.1|41671|30|CP025612|PILER-CR 41671-41700 30 MT110073 Stenotrophomonas phage vB_SmaS_DLP_3, complete genome 47047-47076 7 0.767
CP025612_1 1.1|41671|30|CP025612|PILER-CR 41671-41700 30 NC_042099 Microbacterium phage Dismas, complete genome 23824-23853 7 0.767
CP025612_1 1.1|41671|30|CP025612|PILER-CR 41671-41700 30 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 1412175-1412204 7 0.767
CP025612_2 2.9|1096391|35|CP025612|CRISPRCasFinder,CRT,PILER-CR 1096391-1096425 35 DQ115821 Cyanobacteria phage AS-1 contig_14 genomic sequence 846-880 7 0.8
CP025612_2 2.15|1096790|34|CP025612|CRISPRCasFinder,CRT,PILER-CR 1096790-1096823 34 NZ_CP013553 Rhizobium phaseoli strain N931 plasmid pRphaN931a, complete sequence 301225-301258 7 0.794
CP025612_2 2.15|1096790|34|CP025612|CRISPRCasFinder,CRT,PILER-CR 1096790-1096823 34 NZ_CP013586 Rhizobium phaseoli strain N161 plasmid pRphaN161a, complete sequence 315604-315637 7 0.794
CP025612_2 2.15|1096790|34|CP025612|CRISPRCasFinder,CRT,PILER-CR 1096790-1096823 34 NZ_CP013559 Rhizobium phaseoli strain N841 plasmid pRphaN841b, complete sequence 312273-312306 7 0.794
CP025612_2 2.15|1096790|34|CP025612|CRISPRCasFinder,CRT,PILER-CR 1096790-1096823 34 NZ_CP013564 Rhizobium phaseoli strain N831 plasmid pRphaN831a, complete sequence 301225-301258 7 0.794
CP025612_1 1.1|41671|30|CP025612|PILER-CR 41671-41700 30 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 91185-91214 8 0.733
CP025612_2 2.2|1095930|35|CP025612|CRISPRCasFinder,CRT,PILER-CR 1095930-1095964 35 AP014720 Arthrobacter sp. Hiyo8 plasmid pHiyo8-1 DNA, complete genome, strain: Hiyo8 162474-162508 8 0.771
CP025612_2 2.4|1096061|34|CP025612|CRISPRCasFinder,CRT,PILER-CR 1096061-1096094 34 NZ_KT033469 Aeromonas salmonicida subsp. salmonicida strain 01-B522 plasmid pAsa4b, complete sequence 152805-152838 8 0.765
CP025612_2 2.4|1096061|34|CP025612|CRISPRCasFinder,CRT,PILER-CR 1096061-1096094 34 NZ_KT033470 Aeromonas salmonicida subsp. salmonicida strain JF2267 plasmid pAsa4c, complete sequence 135108-135141 8 0.765
CP025612_2 2.4|1096061|34|CP025612|CRISPRCasFinder,CRT,PILER-CR 1096061-1096094 34 NC_009349 Aeromonas salmonicida subsp. salmonicida A449 plasmid 4, complete sequence 73060-73093 8 0.765
CP025612_2 2.24|1097379|33|CP025612|CRISPRCasFinder,CRT,PILER-CR 1097379-1097411 33 NZ_CP032344 Azospirillum brasilense strain MTCC4038 plasmid p5, complete sequence 30400-30432 8 0.758
CP025612_2 2.24|1097379|33|CP025612|CRISPRCasFinder,CRT,PILER-CR 1097379-1097411 33 NZ_CP033317 Azospirillum brasilense strain Sp 7 plasmid p5, complete sequence 102660-102692 8 0.758
CP025612_2 2.24|1097379|33|CP025612|CRISPRCasFinder,CRT,PILER-CR 1097379-1097411 33 NZ_CP033323 Azospirillum brasilense strain Cd plasmid p5, complete sequence 228896-228928 8 0.758
CP025612_2 2.24|1097379|33|CP025612|CRISPRCasFinder,CRT,PILER-CR 1097379-1097411 33 NZ_CP012919 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p5, complete sequence 4353-4385 8 0.758
CP025612_2 2.24|1097379|33|CP025612|CRISPRCasFinder,CRT,PILER-CR 1097379-1097411 33 NZ_CP012919 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p5, complete sequence 153042-153074 8 0.758
CP025612_2 2.24|1097379|33|CP025612|CRISPRCasFinder,CRT,PILER-CR 1097379-1097411 33 NZ_CP018222 Tardibacter chloracetimidivorans strain JJ-A5 plasmid pHSL1, complete sequence 84442-84474 8 0.758
CP025612_2 2.4|1096061|34|CP025612|CRISPRCasFinder,CRT,PILER-CR 1096061-1096094 34 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 518523-518556 9 0.735
CP025612_2 2.21|1097182|34|CP025612|CRISPRCasFinder,CRT,PILER-CR 1097182-1097215 34 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 756415-756448 9 0.735
CP025612_2 2.21|1097182|34|CP025612|CRISPRCasFinder,CRT,PILER-CR 1097182-1097215 34 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1056708-1056741 9 0.735
CP025612_2 2.4|1096061|34|CP025612|CRISPRCasFinder,CRT,PILER-CR 1096061-1096094 34 CP007643 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803b, complete sequence 25701-25734 10 0.706
CP025612_2 2.4|1096061|34|CP025612|CRISPRCasFinder,CRT,PILER-CR 1096061-1096094 34 NZ_CP042515 Serratia marcescens strain E28 plasmid pE28_003 17940-17973 11 0.676

1. spacer 2.4|1096061|34|CP025612|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.824

--tgcaaccagcatcccgcgccgcctgctccgatct	CRISPR spacer
tcttcaat--gcatcccgcgccgtctgctccggtct	Protospacer
  * ***.  *************.********.***

2. spacer 2.4|1096061|34|CP025612|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.824

--tgcaaccagcatcccgcgccgcctgctccgatct	CRISPR spacer
tcttcaat--gcatcccgcgccgtctgctccggtct	Protospacer
  * ***.  *************.********.***

3. spacer 2.4|1096061|34|CP025612|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 6, identity: 0.824

--tgcaaccagcatcccgcgccgcctgctccgatct	CRISPR spacer
tcttcaat--gcatcccgcgccgtctgctccggtct	Protospacer
  * ***.  *************.********.***

4. spacer 2.4|1096061|34|CP025612|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.824

--tgcaaccagcatcccgcgccgcctgctccgatct	CRISPR spacer
tcttcaat--gcatcccgcgccgtctgctccggtct	Protospacer
  * ***.  *************.********.***

5. spacer 2.4|1096061|34|CP025612|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.824

--tgcaaccagcatcccgcgccgcctgctccgatct	CRISPR spacer
tcttcaat--gcatcccgcgccgtctgctccggtct	Protospacer
  * ***.  *************.********.***

6. spacer 2.4|1096061|34|CP025612|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.824

--tgcaaccagcatcccgcgccgcctgctccgatct	CRISPR spacer
tcttcaat--gcatcccgcgccgtctgctccggtct	Protospacer
  * ***.  *************.********.***

7. spacer 2.4|1096061|34|CP025612|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.824

--tgcaaccagcatcccgcgccgcctgctccgatct	CRISPR spacer
tcttcaat--gcatcccgcgccgtctgctccggtct	Protospacer
  * ***.  *************.********.***

8. spacer 2.4|1096061|34|CP025612|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.824

--tgcaaccagcatcccgcgccgcctgctccgatct	CRISPR spacer
tcttcaat--gcatcccgcgccgtctgctccggtct	Protospacer
  * ***.  *************.********.***

9. spacer 2.4|1096061|34|CP025612|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.824

--tgcaaccagcatcccgcgccgcctgctccgatct	CRISPR spacer
tcttcaat--gcatcccgcgccgtctgctccggtct	Protospacer
  * ***.  *************.********.***

10. spacer 1.1|41671|30|CP025612|PILER-CR matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 7, identity: 0.767

aactgaatttccgcctcggcggcgccctgt	CRISPR spacer
cgcgcaatttccgcctcggcgccggcctga	Protospacer
 .*  **************** ** **** 

11. spacer 1.1|41671|30|CP025612|PILER-CR matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 7, identity: 0.767

aactgaatttccgcctcggcggcgccctgt	CRISPR spacer
acctccgcctcggcctcggcggcgccctgt	Protospacer
* **  ...** ******************

12. spacer 1.1|41671|30|CP025612|PILER-CR matches to MH045568 (Microbacterium phage Kieran, complete genome) position: , mismatch: 7, identity: 0.767

aactgaatttccgcctcggcggcgccctgt	CRISPR spacer
gcctgaacttccgcctcggcggcaaccact	Protospacer
. *****.***************. **  *

13. spacer 1.1|41671|30|CP025612|PILER-CR matches to MT110073 (Stenotrophomonas phage vB_SmaS_DLP_3, complete genome) position: , mismatch: 7, identity: 0.767

aactga--atttccgcctcggcggcgccctgt	CRISPR spacer
--tcgattacttccgcctcggcggcgtcctga	Protospacer
  ..**  *.****************.**** 

14. spacer 1.1|41671|30|CP025612|PILER-CR matches to NC_042099 (Microbacterium phage Dismas, complete genome) position: , mismatch: 7, identity: 0.767

aactgaatttccgcctcggcggcgccctgt	CRISPR spacer
gcctgaacttccgcctcggcggcaaccact	Protospacer
. *****.***************. **  *

15. spacer 1.1|41671|30|CP025612|PILER-CR matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 7, identity: 0.767

aactgaatttccgcctcggcggcgccctgt	CRISPR spacer
acctccgcctcggcctcggcggcgccctgt	Protospacer
* **  ...** ******************

16. spacer 2.9|1096391|35|CP025612|CRISPRCasFinder,CRT,PILER-CR matches to DQ115821 (Cyanobacteria phage AS-1 contig_14 genomic sequence) position: , mismatch: 7, identity: 0.8

tcgttcttgacgttgtccagcggca-ttgacgccac	CRISPR spacer
tcgatcttgaccttgtccagcggcagttcgcgcag-	Protospacer
*** ******* ************* ** .*** . 

17. spacer 2.15|1096790|34|CP025612|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013553 (Rhizobium phaseoli strain N931 plasmid pRphaN931a, complete sequence) position: , mismatch: 7, identity: 0.794

gatagcctcttgcagttgatcggc--gcgcaacgat	CRISPR spacer
gatcgcctcatgcagttgatcggctttcgggacg--	Protospacer
*** ***** **************   ** .***  

18. spacer 2.15|1096790|34|CP025612|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013586 (Rhizobium phaseoli strain N161 plasmid pRphaN161a, complete sequence) position: , mismatch: 7, identity: 0.794

gatagcctcttgcagttgatcggc--gcgcaacgat	CRISPR spacer
gatcgcctcatgcagttgatcggctttcgggacg--	Protospacer
*** ***** **************   ** .***  

19. spacer 2.15|1096790|34|CP025612|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013559 (Rhizobium phaseoli strain N841 plasmid pRphaN841b, complete sequence) position: , mismatch: 7, identity: 0.794

gatagcctcttgcagttgatcggc--gcgcaacgat	CRISPR spacer
gatcgcctcatgcagttgatcggctttcgggacg--	Protospacer
*** ***** **************   ** .***  

20. spacer 2.15|1096790|34|CP025612|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013564 (Rhizobium phaseoli strain N831 plasmid pRphaN831a, complete sequence) position: , mismatch: 7, identity: 0.794

gatagcctcttgcagttgatcggc--gcgcaacgat	CRISPR spacer
gatcgcctcatgcagttgatcggctttcgggacg--	Protospacer
*** ***** **************   ** .***  

21. spacer 1.1|41671|30|CP025612|PILER-CR matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.733

aactgaatttccgcctcggcggcgccctgt	CRISPR spacer
gcgagcatttccgcctcgccggcaccctgc	Protospacer
.   * ************ ****.*****.

22. spacer 2.2|1095930|35|CP025612|CRISPRCasFinder,CRT,PILER-CR matches to AP014720 (Arthrobacter sp. Hiyo8 plasmid pHiyo8-1 DNA, complete genome, strain: Hiyo8) position: , mismatch: 8, identity: 0.771

ctgccgtgacgctggcgcaggccaaggcagaaatc	CRISPR spacer
tgggcaagccgctcgcggaggccaaggcagaaatc	Protospacer
. * *. * **** *** *****************

23. spacer 2.4|1096061|34|CP025612|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KT033469 (Aeromonas salmonicida subsp. salmonicida strain 01-B522 plasmid pAsa4b, complete sequence) position: , mismatch: 8, identity: 0.765

tgca-accagcatcccgcgccgcctgctccgatct	CRISPR spacer
-gcactccagcatcccgcgccgcctccaccatcat	Protospacer
 ***  ******************* * **. . *

24. spacer 2.4|1096061|34|CP025612|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KT033470 (Aeromonas salmonicida subsp. salmonicida strain JF2267 plasmid pAsa4c, complete sequence) position: , mismatch: 8, identity: 0.765

tgca-accagcatcccgcgccgcctgctccgatct	CRISPR spacer
-gcactccagcatcccgcgccgcctccaccatcat	Protospacer
 ***  ******************* * **. . *

25. spacer 2.4|1096061|34|CP025612|CRISPRCasFinder,CRT,PILER-CR matches to NC_009349 (Aeromonas salmonicida subsp. salmonicida A449 plasmid 4, complete sequence) position: , mismatch: 8, identity: 0.765

tgca-accagcatcccgcgccgcctgctccgatct	CRISPR spacer
-gcactccagcatcccgcgccgcctccaccatcat	Protospacer
 ***  ******************* * **. . *

26. spacer 2.24|1097379|33|CP025612|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032344 (Azospirillum brasilense strain MTCC4038 plasmid p5, complete sequence) position: , mismatch: 8, identity: 0.758

cgtgtccagactgcgcagcccctcgatcacgct	CRISPR spacer
cacgtccaggccgcgcagcccctcgatcagcag	Protospacer
*..******.*.*****************    

27. spacer 2.24|1097379|33|CP025612|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033317 (Azospirillum brasilense strain Sp 7 plasmid p5, complete sequence) position: , mismatch: 8, identity: 0.758

cgtgtccagactgcgcagcccctcgatcacgct	CRISPR spacer
cacgtccaggccgcgcagcccctcgatcagcag	Protospacer
*..******.*.*****************    

28. spacer 2.24|1097379|33|CP025612|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033323 (Azospirillum brasilense strain Cd plasmid p5, complete sequence) position: , mismatch: 8, identity: 0.758

cgtgtccagactgcgcagcccctcgatcacgct	CRISPR spacer
cacgtccaggccgcgcagcccctcgatcagcag	Protospacer
*..******.*.*****************    

29. spacer 2.24|1097379|33|CP025612|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012919 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p5, complete sequence) position: , mismatch: 8, identity: 0.758

cgtgtccagactgcgcagcccctcgatcacgct	CRISPR spacer
cacgtccaggccgcgcagcccctcgatcagcag	Protospacer
*..******.*.*****************    

30. spacer 2.24|1097379|33|CP025612|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012919 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p5, complete sequence) position: , mismatch: 8, identity: 0.758

cgtgtccagactgcgcagcccctcgatcacgct	CRISPR spacer
cacgtccaggccgcgcagcccctcgatcagcag	Protospacer
*..******.*.*****************    

31. spacer 2.24|1097379|33|CP025612|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018222 (Tardibacter chloracetimidivorans strain JJ-A5 plasmid pHSL1, complete sequence) position: , mismatch: 8, identity: 0.758

cgtgtccagactgcgcagcccctcgatcacgct	CRISPR spacer
gtaggccagattgcgcggcccctcgatcacacc	Protospacer
   * *****.*****.*************.*.

32. spacer 2.4|1096061|34|CP025612|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 9, identity: 0.735

tgcaaccagcatcccgcgccgcctgctccgatct	CRISPR spacer
cggcgccaacatcccgcgccgcctcctccaaccg	Protospacer
.*  .***.*************** ****.*.* 

33. spacer 2.21|1097182|34|CP025612|CRISPRCasFinder,CRT,PILER-CR matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 9, identity: 0.735

tgtagttcggcggcacgcggccagcgtccaccgt	CRISPR spacer
agtgcggcagcgggacgcggccggcgtccaccga	Protospacer
 **.   *.**** ********.********** 

34. spacer 2.21|1097182|34|CP025612|CRISPRCasFinder,CRT,PILER-CR matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 9, identity: 0.735

tgtagttcggcggcacgcggccagcgtccaccgt	CRISPR spacer
agtgcggcagcgggacgcggccggcgtccaccga	Protospacer
 **.   *.**** ********.********** 

35. spacer 2.4|1096061|34|CP025612|CRISPRCasFinder,CRT,PILER-CR matches to CP007643 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803b, complete sequence) position: , mismatch: 10, identity: 0.706

tgcaaccagcatcccgcgccgcctgctccgatct	CRISPR spacer
tgcaaccagcatcccgcgttgcctcgcctattgg	Protospacer
******************..****  .*.. *  

36. spacer 2.4|1096061|34|CP025612|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP042515 (Serratia marcescens strain E28 plasmid pE28_003) position: , mismatch: 11, identity: 0.676

tgcaaccagcatcccgcgccgcctgctccgatct	CRISPR spacer
cgcaaccggcatccagcgccgcctggccgcgctc	Protospacer
.******.****** ********** .*  ....

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 44891 : 59268 20 Rhodobacter_phage(18.18%) capsid,portal,terminase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP025611
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2736888 : 2792770 51 Stx2-converting_phage(28.57%) protease,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. CP025615
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 17619 16 Leptospira_phage(40.0%) transposase NA
DBSCAN-SWA_2 47517 : 48408 1 Microbacterium_phage(100.0%) tail NA
DBSCAN-SWA_3 67610 : 71372 4 Paramecium_bursaria_Chlorella_virus(33.33%) NA NA
DBSCAN-SWA_4 78007 : 95491 14 Tupanvirus(25.0%) NA NA
DBSCAN-SWA_5 111490 : 119478 6 Leptospira_phage(25.0%) NA NA
DBSCAN-SWA_6 124071 : 126039 2 Stx2-converting_phage(100.0%) transposase NA
DBSCAN-SWA_7 135023 : 140662 3 Paenibacillus_phage(33.33%) transposase NA
DBSCAN-SWA_8 146768 : 148417 2 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_9 153182 : 154475 1 Synechococcus_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage