1. spacer 5.1|3093744|32|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP014707 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_3p, complete sequence) position: , mismatch: 4, identity: 0.875
cattcacgatctccacggccttcgcca-gtcgc CRISPR spacer
cggtcacgctctccacggccttcgccatgtcg- Protospacer
*. ***** ****************** ****
2. spacer 5.3|3093866|32|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054602 (Sulfitobacter pseudonitzschiae strain H46 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.844
tcggcgc--acgcacaggcgcacgcgctgttgaa CRISPR spacer
--agcgccgacgcacaggcgaacgcgcttttgaa Protospacer
.**** *********** ******* *****
3. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP031159 (Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdA, complete sequence) position: , mismatch: 5, identity: 0.844
-gcagcgagctggtcggccaccgccttgtgctg-- CRISPR spacer
tgca-cgagctggtcggccgctgcct--tgctggc Protospacer
*** **************.*.**** *****
4. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.844
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tgaccggcgccgcgttcgaggcgctggacgac Protospacer
.**.****** *******************
5. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.844
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tgaccggcgccgcgttcgaggcgctggacgac Protospacer
.**.****** *******************
6. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.848
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gtgaccggcgccgcgttcgaggcgctggacgac Protospacer
*.**.****** *******************
7. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.848
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gtgaccggcgccgcgttcgaggcgctggacgac Protospacer
*.**.****** *******************
8. spacer 2.3|379985|33|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021071 (Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence) position: , mismatch: 6, identity: 0.818
gcagcgacacgatcaagctcacgcgcatgatcg CRISPR spacer
ccggcgacacgatcgaactcacgcgcatgacct Protospacer
*.***********.*.*************.*
9. spacer 2.3|379985|33|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 6, identity: 0.818
gcagcgacacgatcaagctcacgcgcatgatcg CRISPR spacer
ccggcgacacgatcgaactcacgcgcatgacct Protospacer
*.***********.*.*************.*
10. spacer 2.3|379985|33|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 6, identity: 0.818
gcagcgacacgatcaagctcacgcgcatgatcg CRISPR spacer
ccggcgacacgatcgaactcacgcgcatgacct Protospacer
*.***********.*.*************.*
11. spacer 2.3|379985|33|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 6, identity: 0.818
gcagcgacacgatcaagctcacgcgcatgatcg CRISPR spacer
ccggcgacacgatcgaactcacgcgcatgacct Protospacer
*.***********.*.*************.*
12. spacer 2.7|380269|33|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 6, identity: 0.818
ataccatcttcgagaacgcccagcgggtgttgg CRISPR spacer
aggccatcatcgagaacgcccggcgggtgttcc Protospacer
* .***** ************.*********
13. spacer 2.15|380828|33|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR594667 (Variovorax sp. SRS16 plasmid 2) position: , mismatch: 6, identity: 0.818
cgaccccgacaccggcaagcgcgtgccggtcga CRISPR spacer
attcaccgacaccggcaagcgcgtgccagtcgg Protospacer
* **********************.****.
14. spacer 2.15|380828|33|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR594690 (Variovorax sp. WDL1 plasmid 2) position: , mismatch: 6, identity: 0.818
cgaccccgacaccggcaagcgcgtgccggtcga CRISPR spacer
attcaccgacaccggcaagcgcgtgccagtcgg Protospacer
* **********************.****.
15. spacer 2.15|380828|33|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR594672 (Variovorax sp. PBL-E5 plasmid 2) position: , mismatch: 6, identity: 0.818
cgaccccgacaccggcaagcgcgtgccggtcga CRISPR spacer
attcaccgacaccggcaagcgcgtgccagtcgg Protospacer
* **********************.****.
16. spacer 2.15|380828|33|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR594660 (Variovorax sp. PBL-H6 plasmid 2) position: , mismatch: 6, identity: 0.818
cgaccccgacaccggcaagcgcgtgccggtcga CRISPR spacer
attcaccgacaccggcaagcgcgtgccagtcgg Protospacer
* **********************.****.
17. spacer 2.15|380828|33|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013108 (Sinorhizobium americanum strain CFNEI 73 plasmid A, complete sequence) position: , mismatch: 6, identity: 0.818
cgaccccgacaccggcaagcgcgtgccggtcga CRISPR spacer
ctccaccgacaccggcaagcgcgtggcgctcgc Protospacer
* * ******************** ** ***
18. spacer 2.15|380828|33|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.818
cgaccccgacaccggcaagcgcgtgccggtcga-- CRISPR spacer
agaccccgacactggcaagcgcgtgtc--tcggct Protospacer
***********.************.* ***.
19. spacer 3.1|975528|28|CP020026|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 6, identity: 0.786
aaaggtctgccgatgcgctacaacgcta CRISPR spacer
ttcggcctgccgatgcgctacaccgcga Protospacer
**.**************** *** *
20. spacer 4.14|1868311|34|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP051543 (Paracoccus sanguinis strain OM2164 plasmid pPspOM122, complete sequence) position: , mismatch: 6, identity: 0.824
gatcgcatggcgcgcatcgctctcac-cgagtgcc CRISPR spacer
gatcgcatggctcgcatcgctctgacgctggcgc- Protospacer
*********** *********** ** * .*.**
21. spacer 5.8|3094172|32|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034815 (Paracoccus sp. Arc7-R13 plasmid unnamed5, complete sequence) position: , mismatch: 6, identity: 0.812
cgtttgcg-gctgcatggccacgatgcgcaaca CRISPR spacer
-gatcgcgctctccaaggccacgatgcgcaaca Protospacer
* *.*** ** ** *****************
22. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.812
gcagcga-gctggtcggccaccgccttgtgctg CRISPR spacer
-cgctgatgctggtcggcgaccgccttgggctg Protospacer
*. .** ********** ********* ****
23. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP013415 (Burkholderia ubonensis strain MSMB2035 plasmid pMSMB2035, complete sequence) position: , mismatch: 6, identity: 0.812
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
cgctcggcgcggcgttcgatgcgcttcgcggg Protospacer
** **************** ***** .** *
24. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812
-cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
acggt-ggcgcggcgtttgaggcgctggatcgg Protospacer
**.* ***********.***********. *
25. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP021033 (Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence) position: , mismatch: 6, identity: 0.812
cgatcggcgcggcgttcgaggcgctg-gacgtg CRISPR spacer
cgatcggcacggcgttcgatgcgccgcgatat- Protospacer
********.********** ****.* **..*
26. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 6, identity: 0.812
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
cgatcggcgcgctgttcgaggcgcggacggtg Protospacer
*********** .*********** *. ***
27. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP020952 (Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence) position: , mismatch: 6, identity: 0.812
cgatcggcgcggcgttcgaggcgctg-gacgtg CRISPR spacer
cgatcggcacggcgttcgatgcgccgcgatat- Protospacer
********.********** ****.* **..*
28. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP013415 (Burkholderia ubonensis strain MSMB2035 plasmid pMSMB2035, complete sequence) position: , mismatch: 6, identity: 0.812
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
cgctcggcgcggcgttcgatgcgcttcgcggg Protospacer
** **************** ***** .** *
29. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812
-cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
acggt-ggcgcggcgtttgaggcgctggatcgg Protospacer
**.* ***********.***********. *
30. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP021033 (Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence) position: , mismatch: 6, identity: 0.812
cgatcggcgcggcgttcgaggcgctg-gacgtg CRISPR spacer
cgatcggcacggcgttcgatgcgccgcgatat- Protospacer
********.********** ****.* **..*
31. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 6, identity: 0.812
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
cgatcggcgcgctgttcgaggcgcggacggtg Protospacer
*********** .*********** *. ***
32. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP020952 (Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence) position: , mismatch: 6, identity: 0.812
cgatcggcgcggcgttcgaggcgctg-gacgtg CRISPR spacer
cgatcggcacggcgttcgatgcgccgcgatat- Protospacer
********.********** ****.* **..*
33. spacer 5.29|3095461|31|CP020026|CRISPRCasFinder,CRT matches to NC_011960 (Rhodobacter sphaeroides KD131 plasmid pRSKD131B, complete sequence) position: , mismatch: 6, identity: 0.806
acttcggcatggaggctgagcgcgccgacca CRISPR spacer
accgcggcatcgaggctgcgcgcgccgagcg Protospacer
**. ****** ******* ********* *.
34. spacer 5.29|3095461|31|CP020026|CRISPRCasFinder,CRT matches to NC_009040 (Rhodobacter sphaeroides ATCC 17029 plasmid pRSPH01, complete sequence) position: , mismatch: 6, identity: 0.806
acttcggcatggaggctgagcgcgccgacca CRISPR spacer
accgcggcatcgaggctgcgcgcgccgagcg Protospacer
**. ****** ******* ********* *.
35. spacer 5.33|3095705|33|CP020026|CRISPRCasFinder,CRT matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 6, identity: 0.818
ccgagcgca-cctcagcggcgagtacgtggcgct CRISPR spacer
-cgactccatcctcagcgtcgagttcgtggcgct Protospacer
*** . ** ******** ***** *********
36. spacer 5.44|3096380|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 6, identity: 0.812
ttggcgatgagcgccacggtcttggcggtctc CRISPR spacer
cgctcgatgagcgccacggtcttgccggcctc Protospacer
. ******************** ***.***
37. spacer 5.44|3096380|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 6, identity: 0.812
ttggcgatgagcgccacggtcttggcggtctc CRISPR spacer
cgctcgatgagcgccacggtcttgccggcctc Protospacer
. ******************** ***.***
38. spacer 5.44|3096380|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP013053 (Sinorhizobium americanum CCGM7 plasmid B, complete sequence) position: , mismatch: 6, identity: 0.812
ttggcgatgagcgccacggtcttggcggtctc--- CRISPR spacer
ttggcgatgaccgcctcggtcttgtc---ctcgat Protospacer
********** **** ******** * ***
39. spacer 5.68|3096379|33|CP020026|PILER-CR matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 6, identity: 0.818
gttggcgatgagcgccacggtcttggcggtctc CRISPR spacer
gcgctcgatgagcgccacggtcttgccggcctc Protospacer
*. ******************** ***.***
40. spacer 5.68|3096379|33|CP020026|PILER-CR matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 6, identity: 0.818
gttggcgatgagcgccacggtcttggcggtctc CRISPR spacer
gcgctcgatgagcgccacggtcttgccggcctc Protospacer
*. ******************** ***.***
41. spacer 2.3|379985|33|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 7, identity: 0.788
gcagcgacacgatcaagctcacgcgcatgatcg CRISPR spacer
ccggagacacgatcgaactcacgcgcatgacct Protospacer
*.* *********.*.*************.*
42. spacer 2.15|380828|33|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LN832560 (Paracoccus aminovorans isolate JCM7685 plasmid II, complete sequence) position: , mismatch: 7, identity: 0.788
cgaccccgacaccggcaagcgcgtgccggtcga CRISPR spacer
cgaccccgccaccggcaagcgcctgcgcccgga Protospacer
******** ************* *** . **
43. spacer 4.17|1868525|33|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to KF147891 (Pseudomonas phage PaBG, complete genome) position: , mismatch: 7, identity: 0.788
ggcgct-cccgccccaggctctaccaactgagct CRISPR spacer
-gcgttaaaagcgccatgctctaccaactgagct Protospacer
***.* ** *** *****************
44. spacer 4.17|1868525|33|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NC_024792 (Bacillus phage Bobb, complete genome) position: , mismatch: 7, identity: 0.788
ggcgctcccgccccaggctctaccaactgagct CRISPR spacer
ggattttcagccccctgctctaccaactgagct Protospacer
** .*.* ***** *****************
45. spacer 4.24|1869017|35|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to MG873442 (Salmonella phage SE131, complete genome) position: , mismatch: 7, identity: 0.8
ttaatcttgttgttaattgcttcaa---agaatttttc CRISPR spacer
ttaatcttcttgttaatagcttcaattgggaactt--- Protospacer
******** ******** ******* .***.**
46. spacer 4.24|1869017|35|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NC_015938 (Salmonella phage 7-11, complete genome) position: , mismatch: 7, identity: 0.8
ttaatcttgttgttaattgcttcaa---agaatttttc CRISPR spacer
ttaatcttcttgttaatagcttcaattgggaactt--- Protospacer
******** ******** ******* .***.**
47. spacer 5.1|3093744|32|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NC_006569 (Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.781
cattcacgatctccacggccttcgccagtcgc-- CRISPR spacer
aggtcacgatctccacggcctttgcc--tcgtca Protospacer
. *******************.*** ***.
48. spacer 5.1|3093744|32|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to MN703407 (Microbacterium phage Leaf, complete genome) position: , mismatch: 7, identity: 0.781
cattcacgatctccacggccttcgccagtcgc- CRISPR spacer
gcttcacggtctccacggccgtcg-cgatcgcg Protospacer
******.*********** *** *..****
49. spacer 5.1|3093744|32|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to MN703414 (Microbacterium phage Dewdrop, complete genome) position: , mismatch: 7, identity: 0.781
cattcacgatctccacggccttcgccagtcgc- CRISPR spacer
gcttcacggtctccacggccgtcg-cgatcgcg Protospacer
******.*********** *** *..****
50. spacer 5.7|3094111|32|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
cccttcggtgtgccaatcagcgc-gtgcagcct CRISPR spacer
gccgtcggtgtgccgatcagcgcggcgccgcg- Protospacer
** **********.******** *.** **
51. spacer 5.9|3094233|33|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031599 (Roseovarius indicus strain DSM 26383 plasmid pRIdsm_01, complete sequence) position: , mismatch: 7, identity: 0.788
ctcctcataaccgaatcgctgcaccagatcgga CRISPR spacer
cgcttgttgaccgagtcgctgcaccaggtcgga Protospacer
* *.* *.*****.************.*****
52. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.781
gcagcgagctggtcggccaccgccttgtgctg CRISPR spacer
gccgcgagcaggtcggccaccgccagccgccg Protospacer
** ****** ************** .**.*
53. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
gcagcgagctggtcggccaccgccttgtgctg CRISPR spacer
tcaccgagctggacggccaccgcctcatcgtg Protospacer
** ******** ************..* **
54. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 7, identity: 0.781
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tggccgccgcggtgttcgaggcgctggacgat Protospacer
.*..** *****.*****************
55. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.781
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
cgatcggggcggcgttcgtggcgctgccgctc Protospacer
******* ********** ******* *
56. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tggccgccgcggtgttcgaggcgctggacgat Protospacer
.*..** *****.*****************
57. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tggccgccgcggtgttcgaggcgctggacgat Protospacer
.*..** *****.*****************
58. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.781
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tggccgccgcggtgttcgaggcgctggacgat Protospacer
.*..** *****.*****************
59. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to MN586020 (Microbacterium phage Megan, complete genome) position: , mismatch: 7, identity: 0.781
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcggcggcgcgacgttcgtggcgctggacgag Protospacer
. . *******.****** *********** *
60. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 7, identity: 0.781
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ccgcgggcgcggcgatcgaggcgctggccgcg Protospacer
* .. ********* ************ **.*
61. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP015090 (Pelagibaca abyssi strain JLT2014 plasmid pPABY2, complete sequence) position: , mismatch: 7, identity: 0.781
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ccatcggcgcggggatcgaggcgctgatcggc Protospacer
* ********** * ***********. **
62. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP012575 (Clavibacter michiganensis subsp. capsici strain PF008 plasmid pCM2, complete sequence) position: , mismatch: 7, identity: 0.781
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
agctcgacgcggcgttcgcggcgctggcggag Protospacer
* ***.*********** ******** * *
63. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP020697 (Sulfitobacter sp. D7 plasmid p3SUD7, complete sequence) position: , mismatch: 7, identity: 0.781
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
cggaacgcgcggtgtttgaggcgctggacgag Protospacer
**. ******.***.************* *
64. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to CP048046 (Clavibacter michiganensis subsp. capsici strain 1207 plasmid pCM2_1207, complete sequence) position: , mismatch: 7, identity: 0.781
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
agctcgacgcggcgttcgcggcgctggcggag Protospacer
* ***.*********** ******** * *
65. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP048050 (Clavibacter michiganensis subsp. capsici strain 1101 plasmid pCM2_1101, complete sequence) position: , mismatch: 7, identity: 0.781
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
agctcgacgcggcgttcgcggcgctggcggag Protospacer
* ***.*********** ******** * *
66. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP048048 (Clavibacter michiganensis subsp. capsici strain 1106 plasmid pCM2_1106, complete sequence) position: , mismatch: 7, identity: 0.781
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
agctcgacgcggcgttcgcggcgctggcggag Protospacer
* ***.*********** ******** * *
67. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 7, identity: 0.781
cgatcggcgcggcgttcgaggcgctg-gacgtg CRISPR spacer
cgatcggcacggcgttcgatgcgccgcgatac- Protospacer
********.********** ****.* **...
68. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP019603 (Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence) position: , mismatch: 7, identity: 0.781
cgatcg-gcgcggcgttcgaggcgctggacgtg CRISPR spacer
-ggtcgcccgaggcgttcgaggcgctgtacgat Protospacer
*.*** ** **************** ***
69. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
cgatcgg-cgcggcgttcgaggcgctggacgtg CRISPR spacer
-gaccgaccgcggcgtccgaggcgctggtcgaa Protospacer
**.**. ********.*********** ** .
70. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.781
cgatcgg-cgcggcgttcgaggcgctggacgtg CRISPR spacer
-gaccgaccgcggcgtccgaggcgctggtcgaa Protospacer
**.**. ********.*********** ** .
71. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP050953 (Rhodococcus sp. DMU1 plasmid unnamed) position: , mismatch: 7, identity: 0.781
---cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
atgcgct---cccggcgttcgaggccctgggcgtg Protospacer
** * * ************* ****.****
72. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 7, identity: 0.781
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ggacggccgcggcgttcgtggcgatggacgag Protospacer
**. * *********** **** ****** *
73. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 7, identity: 0.781
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tggccgccgcggtgttcgaggcgctggacgat Protospacer
.*..** *****.*****************
74. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.781
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
cgatcggggcggcgttcgtggcgctgccgctc Protospacer
******* ********** ******* *
75. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tggccgccgcggtgttcgaggcgctggacgat Protospacer
.*..** *****.*****************
76. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tggccgccgcggtgttcgaggcgctggacgat Protospacer
.*..** *****.*****************
77. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.781
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tggccgccgcggtgttcgaggcgctggacgat Protospacer
.*..** *****.*****************
78. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to MN586020 (Microbacterium phage Megan, complete genome) position: , mismatch: 7, identity: 0.781
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcggcggcgcgacgttcgtggcgctggacgag Protospacer
. . *******.****** *********** *
79. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 7, identity: 0.781
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ccgcgggcgcggcgatcgaggcgctggccgcg Protospacer
* .. ********* ************ **.*
80. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP015090 (Pelagibaca abyssi strain JLT2014 plasmid pPABY2, complete sequence) position: , mismatch: 7, identity: 0.781
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ccatcggcgcggggatcgaggcgctgatcggc Protospacer
* ********** * ***********. **
81. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP012575 (Clavibacter michiganensis subsp. capsici strain PF008 plasmid pCM2, complete sequence) position: , mismatch: 7, identity: 0.781
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
agctcgacgcggcgttcgcggcgctggcggag Protospacer
* ***.*********** ******** * *
82. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP020697 (Sulfitobacter sp. D7 plasmid p3SUD7, complete sequence) position: , mismatch: 7, identity: 0.781
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
cggaacgcgcggtgtttgaggcgctggacgag Protospacer
**. ******.***.************* *
83. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to CP048046 (Clavibacter michiganensis subsp. capsici strain 1207 plasmid pCM2_1207, complete sequence) position: , mismatch: 7, identity: 0.781
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
agctcgacgcggcgttcgcggcgctggcggag Protospacer
* ***.*********** ******** * *
84. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP048050 (Clavibacter michiganensis subsp. capsici strain 1101 plasmid pCM2_1101, complete sequence) position: , mismatch: 7, identity: 0.781
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
agctcgacgcggcgttcgcggcgctggcggag Protospacer
* ***.*********** ******** * *
85. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP048048 (Clavibacter michiganensis subsp. capsici strain 1106 plasmid pCM2_1106, complete sequence) position: , mismatch: 7, identity: 0.781
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
agctcgacgcggcgttcgcggcgctggcggag Protospacer
* ***.*********** ******** * *
86. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 7, identity: 0.781
cgatcggcgcggcgttcgaggcgctg-gacgtg CRISPR spacer
cgatcggcacggcgttcgatgcgccgcgatac- Protospacer
********.********** ****.* **...
87. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP019603 (Croceicoccus marinus strain E4A9 plasmid pCME4A9I, complete sequence) position: , mismatch: 7, identity: 0.781
cgatcg-gcgcggcgttcgaggcgctggacgtg CRISPR spacer
-ggtcgcccgaggcgttcgaggcgctgtacgat Protospacer
*.*** ** **************** ***
88. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
cgatcgg-cgcggcgttcgaggcgctggacgtg CRISPR spacer
-gaccgaccgcggcgtccgaggcgctggtcgaa Protospacer
**.**. ********.*********** ** .
89. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.781
cgatcgg-cgcggcgttcgaggcgctggacgtg CRISPR spacer
-gaccgaccgcggcgtccgaggcgctggtcgaa Protospacer
**.**. ********.*********** ** .
90. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP050953 (Rhodococcus sp. DMU1 plasmid unnamed) position: , mismatch: 7, identity: 0.781
---cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
atgcgct---cccggcgttcgaggccctgggcgtg Protospacer
** * * ************* ****.****
91. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 7, identity: 0.781
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ggacggccgcggcgttcgtggcgatggacgag Protospacer
**. * *********** **** ****** *
92. spacer 5.28|3095399|33|CP020026|CRISPRCasFinder,CRT matches to NC_014811 (Mycolicibacterium gilvum Spyr1 plasmid pMSPYR101, complete sequence) position: , mismatch: 7, identity: 0.788
ccagtccggcgcagtcgcgccaagcacggccac- CRISPR spacer
ccactccggcgcagtggcgccaag-gcgacgatg Protospacer
*** *********** ******** .**.* *.
93. spacer 5.29|3095461|31|CP020026|CRISPRCasFinder,CRT matches to NZ_CP013071 (Sphingobium indicum B90A plasmid pSRL1, complete sequence) position: , mismatch: 7, identity: 0.774
acttcggcatggaggctgagcgcgccgacca CRISPR spacer
tccccggcatgcaggctgagcgcgtcgagcc Protospacer
*..******* ************.*** *
94. spacer 5.29|3095461|31|CP020026|CRISPRCasFinder,CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 7, identity: 0.774
acttcggcatggaggctgagcgcgccgacca CRISPR spacer
gttccggcatggatgctgagcgcgcccagct Protospacer
..*.********* ************ * *
95. spacer 5.29|3095461|31|CP020026|CRISPRCasFinder,CRT matches to NC_047861 (Bordetella phage vB_BbrM_PHB04, complete genome) position: , mismatch: 7, identity: 0.774
acttcggcatggaggctgagcgc--gccgacca CRISPR spacer
acttcggcctggaggccgagcgcaaggcggt-- Protospacer
******** *******.****** * **..
96. spacer 5.30|3095521|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 7, identity: 0.781
tggatggctaaccggtacgcggtggatagcgc- CRISPR spacer
tcgatggcgaaccggtacacggtgg-tgtcgtc Protospacer
* ****** *********.****** *. **.
97. spacer 5.35|3095828|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP020445 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed5, complete sequence) position: , mismatch: 7, identity: 0.781
gtccgcgcccggtcaccgcctgctgcacggtg CRISPR spacer
ggccgcgcccggtcacggcctggtgctggtcg Protospacer
* ************** ***** *** * .*
98. spacer 5.38|3096012|33|CP020026|CRISPRCasFinder,CRT matches to CP053410 (Salmonella enterica strain 2014K-0203 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
gtcggcgctggcggggcggcgtataccccatga CRISPR spacer
accggcgctggcggggcggcgtagacatcaata Protospacer
..********************* ** .** *
99. spacer 5.38|3096012|33|CP020026|CRISPRCasFinder,CRT matches to CP053320 (Salmonella enterica subsp. arizonae serovar 41:z4,z23:- strain 2016K-0011 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
gtcggcgctggcggggcggcgtataccccatga CRISPR spacer
accggcgctggcggggcggcgtagacatcaata Protospacer
..********************* ** .** *
100. spacer 5.38|3096012|33|CP020026|CRISPRCasFinder,CRT matches to NC_028696 (Salmonella phage SEN22, complete genome) position: , mismatch: 7, identity: 0.788
gtcggcgctggcggggcggcgtatacc-ccatga CRISPR spacer
tctggcgctggcggggcggcgtagaccggcata- Protospacer
..******************** *** ***.
101. spacer 5.40|3096135|32|CP020026|CRISPRCasFinder,CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 7, identity: 0.781
tcgatcggccgcgccgggcgctcgacgcccaa CRISPR spacer
ccgatcggctgcgccaggcgctcgacggcttc Protospacer
.********.*****.*********** *.
102. spacer 5.44|3096380|32|CP020026|CRISPRCasFinder,CRT matches to KX523125 (Mycobacterium phage BuzzBuzz, complete genome) position: , mismatch: 7, identity: 0.781
ttggcgatgagcgccacggtcttggcggtctc CRISPR spacer
tcggatcggatcgccacggtcttggcgatctc Protospacer
*.** ** ****************.****
103. spacer 5.44|3096380|32|CP020026|CRISPRCasFinder,CRT matches to KC661272 (Mycobacterium phage Methuselah, complete genome) position: , mismatch: 7, identity: 0.781
ttggcgatgagcgccacggtcttggcggtctc CRISPR spacer
tcggatcggatcgccacggtcttggcgatctc Protospacer
*.** ** ****************.****
104. spacer 5.44|3096380|32|CP020026|CRISPRCasFinder,CRT matches to MF185729 (Mycobacterium phage KADY, complete genome) position: , mismatch: 7, identity: 0.781
ttggcgatgagcgccacggtcttggcggtctc CRISPR spacer
tcggatcggatcgccacggtcttggcgatctc Protospacer
*.** ** ****************.****
105. spacer 5.44|3096380|32|CP020026|CRISPRCasFinder,CRT matches to MN096368 (Mycobacterium phage Soshari, complete genome) position: , mismatch: 7, identity: 0.781
ttggcgatgagcgccacggtcttggcggtctc CRISPR spacer
tcggatcggatcgccacggtcttggcgatctc Protospacer
*.** ** ****************.****
106. spacer 5.44|3096380|32|CP020026|CRISPRCasFinder,CRT matches to NC_004682 (Mycobacterium virus Bxz2, complete genome) position: , mismatch: 7, identity: 0.781
ttggcgatgagcgccacggtcttggcggtctc CRISPR spacer
tcggatcggatcgccacggtcttggcgatctc Protospacer
*.** ** ****************.****
107. spacer 5.44|3096380|32|CP020026|CRISPRCasFinder,CRT matches to MK433273 (Mycobacterium phage Daishi, complete genome) position: , mismatch: 7, identity: 0.781
ttggcgatgagcgccacggtcttggcggtctc CRISPR spacer
tcggatcggatcgccacggtcttggcgatctc Protospacer
*.** ** ****************.****
108. spacer 5.44|3096380|32|CP020026|CRISPRCasFinder,CRT matches to KX670788 (Mycobacterium phage Louie6, complete genome) position: , mismatch: 7, identity: 0.781
ttggcgatgagcgccacggtcttggcggtctc CRISPR spacer
tcggatcggatcgccacggtcttggcgatctc Protospacer
*.** ** ****************.****
109. spacer 5.44|3096380|32|CP020026|CRISPRCasFinder,CRT matches to MN585984 (Mycobacterium phage AgronaGT15, complete genome) position: , mismatch: 7, identity: 0.781
ttggcgatgagcgccacggtcttggcggtctc CRISPR spacer
tcggatcggatcgccacggtcttggcgatctc Protospacer
*.** ** ****************.****
110. spacer 5.44|3096380|32|CP020026|CRISPRCasFinder,CRT matches to MH513975 (Mycobacterium phage Misomonster, complete genome) position: , mismatch: 7, identity: 0.781
ttggcgatgagcgccacggtcttggcggtctc CRISPR spacer
tcggatcggatcgccacggtcttggcgatctc Protospacer
*.** ** ****************.****
111. spacer 5.44|3096380|32|CP020026|CRISPRCasFinder,CRT matches to KP017310 (Mycobacterium phage Phoxy, complete genome) position: , mismatch: 7, identity: 0.781
ttggcgatgagcgccacggtcttggcggtctc CRISPR spacer
tcggatcggatcgccacggtcttggcgatctc Protospacer
*.** ** ****************.****
112. spacer 5.44|3096380|32|CP020026|CRISPRCasFinder,CRT matches to KP017311 (Mycobacterium phage Spike509, complete genome) position: , mismatch: 7, identity: 0.781
ttggcgatgagcgccacggtcttggcggtctc CRISPR spacer
tcggatcggatcgccacggtcttggcgatctc Protospacer
*.** ** ****************.****
113. spacer 5.44|3096380|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP010856 (Marinovum algicola DG 898 plasmid pMaD1, complete sequence) position: , mismatch: 7, identity: 0.781
ttggcgatgagcgccacggtcttggcggtctc- CRISPR spacer
ttggcgatgagcgacacggtatt-ctggtcatg Protospacer
************* ****** ** .**** .
114. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.788
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcgatcggggcggcgttcgtggcgctgccgctc Protospacer
******** ********** ******* *
115. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP013415 (Burkholderia ubonensis strain MSMB2035 plasmid pMSMB2035, complete sequence) position: , mismatch: 7, identity: 0.788
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ccgctcggcgcggcgttcgatgcgcttcgcggg Protospacer
** **************** ***** .** *
116. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 7, identity: 0.788
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gccgcgggcgcggcgatcgaggcgctggccgcg Protospacer
** .. ********* ************ **.*
117. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP021033 (Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence) position: , mismatch: 7, identity: 0.788
gcgatcggcgcggcgttcgaggcgctg-gacgtg CRISPR spacer
tcgatcggcacggcgttcgatgcgccgcgatat- Protospacer
********.********** ****.* **..*
118. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP012575 (Clavibacter michiganensis subsp. capsici strain PF008 plasmid pCM2, complete sequence) position: , mismatch: 7, identity: 0.788
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gagctcgacgcggcgttcgcggcgctggcggag Protospacer
* * ***.*********** ******** * *
119. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.788
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
acgatcggcgcgctgttcgaggcgcggacggtg Protospacer
.*********** .*********** *. ***
120. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP020952 (Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence) position: , mismatch: 7, identity: 0.788
gcgatcggcgcggcgttcgaggcgctg-gacgtg CRISPR spacer
tcgatcggcacggcgttcgatgcgccgcgatat- Protospacer
********.********** ****.* **..*
121. spacer 5.47|3095093|33|CP020026|PILER-CR matches to CP048046 (Clavibacter michiganensis subsp. capsici strain 1207 plasmid pCM2_1207, complete sequence) position: , mismatch: 7, identity: 0.788
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gagctcgacgcggcgttcgcggcgctggcggag Protospacer
* * ***.*********** ******** * *
122. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP048050 (Clavibacter michiganensis subsp. capsici strain 1101 plasmid pCM2_1101, complete sequence) position: , mismatch: 7, identity: 0.788
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gagctcgacgcggcgttcgcggcgctggcggag Protospacer
* * ***.*********** ******** * *
123. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP048048 (Clavibacter michiganensis subsp. capsici strain 1106 plasmid pCM2_1106, complete sequence) position: , mismatch: 7, identity: 0.788
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gagctcgacgcggcgttcgcggcgctggcggag Protospacer
* * ***.*********** ******** * *
124. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 7, identity: 0.788
gcgatcggcgcggcgttcgaggcgctggacgtg--- CRISPR spacer
gcgatcgtcgaggcgttcgaggc---ggaactgttc Protospacer
******* ** ************ *** **
125. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.788
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcgatcggggcggcgttcgtggcgctgccgctc Protospacer
******** ********** ******* *
126. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP013415 (Burkholderia ubonensis strain MSMB2035 plasmid pMSMB2035, complete sequence) position: , mismatch: 7, identity: 0.788
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ccgctcggcgcggcgttcgatgcgcttcgcggg Protospacer
** **************** ***** .** *
127. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 7, identity: 0.788
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gccgcgggcgcggcgatcgaggcgctggccgcg Protospacer
** .. ********* ************ **.*
128. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP021033 (Rhizobium sp. NXC14 plasmid pRspNXC14c, complete sequence) position: , mismatch: 7, identity: 0.788
gcgatcggcgcggcgttcgaggcgctg-gacgtg CRISPR spacer
tcgatcggcacggcgttcgatgcgccgcgatat- Protospacer
********.********** ****.* **..*
129. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP012575 (Clavibacter michiganensis subsp. capsici strain PF008 plasmid pCM2, complete sequence) position: , mismatch: 7, identity: 0.788
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gagctcgacgcggcgttcgcggcgctggcggag Protospacer
* * ***.*********** ******** * *
130. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.788
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
acgatcggcgcgctgttcgaggcgcggacggtg Protospacer
.*********** .*********** *. ***
131. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP020952 (Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence) position: , mismatch: 7, identity: 0.788
gcgatcggcgcggcgttcgaggcgctg-gacgtg CRISPR spacer
tcgatcggcacggcgttcgatgcgccgcgatat- Protospacer
********.********** ****.* **..*
132. spacer 5.48|3095154|33|CP020026|PILER-CR matches to CP048046 (Clavibacter michiganensis subsp. capsici strain 1207 plasmid pCM2_1207, complete sequence) position: , mismatch: 7, identity: 0.788
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gagctcgacgcggcgttcgcggcgctggcggag Protospacer
* * ***.*********** ******** * *
133. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP048050 (Clavibacter michiganensis subsp. capsici strain 1101 plasmid pCM2_1101, complete sequence) position: , mismatch: 7, identity: 0.788
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gagctcgacgcggcgttcgcggcgctggcggag Protospacer
* * ***.*********** ******** * *
134. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP048048 (Clavibacter michiganensis subsp. capsici strain 1106 plasmid pCM2_1106, complete sequence) position: , mismatch: 7, identity: 0.788
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gagctcgacgcggcgttcgcggcgctggcggag Protospacer
* * ***.*********** ******** * *
135. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 7, identity: 0.788
gcgatcggcgcggcgttcgaggcgctggacgtg--- CRISPR spacer
gcgatcgtcgaggcgttcgaggc---ggaactgttc Protospacer
******* ** ************ *** **
136. spacer 5.52|3095398|34|CP020026|PILER-CR matches to NC_014811 (Mycolicibacterium gilvum Spyr1 plasmid pMSPYR101, complete sequence) position: , mismatch: 7, identity: 0.794
gccagtccggcgcagtcgcgccaagcacggccac- CRISPR spacer
gccactccggcgcagtggcgccaag-gcgacgatg Protospacer
**** *********** ******** .**.* *.
137. spacer 5.53|3095460|32|CP020026|PILER-CR matches to NZ_CP013071 (Sphingobium indicum B90A plasmid pSRL1, complete sequence) position: , mismatch: 7, identity: 0.781
gacttcggcatggaggctgagcgcgccgacca CRISPR spacer
gtccccggcatgcaggctgagcgcgtcgagcc Protospacer
* *..******* ************.*** *
138. spacer 5.53|3095460|32|CP020026|PILER-CR matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 7, identity: 0.781
--gacttcggcatggaggctgagcgcgccgacca CRISPR spacer
ctgcccttg--atggaggctgagatcgccgacca Protospacer
* *.*.* ************ *********
139. spacer 5.57|3095704|34|CP020026|PILER-CR matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 7, identity: 0.794
gccgagcgca-cctcagcggcgagtacgtggcgct CRISPR spacer
-tcgactccatcctcagcgtcgagttcgtggcgct Protospacer
.*** . ** ******** ***** *********
140. spacer 5.68|3096379|33|CP020026|PILER-CR matches to KX523125 (Mycobacterium phage BuzzBuzz, complete genome) position: , mismatch: 7, identity: 0.788
gttggcgatgagcgccacggtcttggcggtctc CRISPR spacer
gtcggatcggatcgccacggtcttggcgatctc Protospacer
**.** ** ****************.****
141. spacer 5.68|3096379|33|CP020026|PILER-CR matches to KC661272 (Mycobacterium phage Methuselah, complete genome) position: , mismatch: 7, identity: 0.788
gttggcgatgagcgccacggtcttggcggtctc CRISPR spacer
gtcggatcggatcgccacggtcttggcgatctc Protospacer
**.** ** ****************.****
142. spacer 5.68|3096379|33|CP020026|PILER-CR matches to MF185729 (Mycobacterium phage KADY, complete genome) position: , mismatch: 7, identity: 0.788
gttggcgatgagcgccacggtcttggcggtctc CRISPR spacer
gtcggatcggatcgccacggtcttggcgatctc Protospacer
**.** ** ****************.****
143. spacer 5.68|3096379|33|CP020026|PILER-CR matches to MN096368 (Mycobacterium phage Soshari, complete genome) position: , mismatch: 7, identity: 0.788
gttggcgatgagcgccacggtcttggcggtctc CRISPR spacer
gtcggatcggatcgccacggtcttggcgatctc Protospacer
**.** ** ****************.****
144. spacer 5.68|3096379|33|CP020026|PILER-CR matches to NC_004682 (Mycobacterium virus Bxz2, complete genome) position: , mismatch: 7, identity: 0.788
gttggcgatgagcgccacggtcttggcggtctc CRISPR spacer
gtcggatcggatcgccacggtcttggcgatctc Protospacer
**.** ** ****************.****
145. spacer 5.68|3096379|33|CP020026|PILER-CR matches to MK433273 (Mycobacterium phage Daishi, complete genome) position: , mismatch: 7, identity: 0.788
gttggcgatgagcgccacggtcttggcggtctc CRISPR spacer
gtcggatcggatcgccacggtcttggcgatctc Protospacer
**.** ** ****************.****
146. spacer 5.68|3096379|33|CP020026|PILER-CR matches to KX670788 (Mycobacterium phage Louie6, complete genome) position: , mismatch: 7, identity: 0.788
gttggcgatgagcgccacggtcttggcggtctc CRISPR spacer
gtcggatcggatcgccacggtcttggcgatctc Protospacer
**.** ** ****************.****
147. spacer 5.68|3096379|33|CP020026|PILER-CR matches to MN585984 (Mycobacterium phage AgronaGT15, complete genome) position: , mismatch: 7, identity: 0.788
gttggcgatgagcgccacggtcttggcggtctc CRISPR spacer
gtcggatcggatcgccacggtcttggcgatctc Protospacer
**.** ** ****************.****
148. spacer 5.68|3096379|33|CP020026|PILER-CR matches to MH513975 (Mycobacterium phage Misomonster, complete genome) position: , mismatch: 7, identity: 0.788
gttggcgatgagcgccacggtcttggcggtctc CRISPR spacer
gtcggatcggatcgccacggtcttggcgatctc Protospacer
**.** ** ****************.****
149. spacer 5.68|3096379|33|CP020026|PILER-CR matches to KP017310 (Mycobacterium phage Phoxy, complete genome) position: , mismatch: 7, identity: 0.788
gttggcgatgagcgccacggtcttggcggtctc CRISPR spacer
gtcggatcggatcgccacggtcttggcgatctc Protospacer
**.** ** ****************.****
150. spacer 5.68|3096379|33|CP020026|PILER-CR matches to KP017311 (Mycobacterium phage Spike509, complete genome) position: , mismatch: 7, identity: 0.788
gttggcgatgagcgccacggtcttggcggtctc CRISPR spacer
gtcggatcggatcgccacggtcttggcgatctc Protospacer
**.** ** ****************.****
151. spacer 5.68|3096379|33|CP020026|PILER-CR matches to NZ_CP013053 (Sinorhizobium americanum CCGM7 plasmid B, complete sequence) position: , mismatch: 7, identity: 0.788
gttggcgatgagcgccacggtcttggcggtctc--- CRISPR spacer
cttggcgatgaccgcctcggtcttgtc---ctcgat Protospacer
********** **** ******** * ***
152. spacer 2.15|380828|33|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034154 (Rhodococcus sp. NJ-530 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.758
cgaccccgacaccggcaagcgcgtgccggtcga-- CRISPR spacer
cgaccgcgacaccggcaatcgcgt--cggctagga Protospacer
***** ************ ***** ***....
153. spacer 2.15|380828|33|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 8, identity: 0.758
cgaccccgacaccggcaagcgcgtgccggtcga CRISPR spacer
ccgcgtcttcaccggcgagcgcgtgccgctcga Protospacer
* .* .* *******.*********** ****
154. spacer 3.1|975528|28|CP020026|CRISPRCasFinder matches to AY539836 (Burkholderia cenocepacia phage BcepMu, complete genome) position: , mismatch: 8, identity: 0.714
aaaggtctgccgatgcgctacaacgcta CRISPR spacer
cgtcgtgtgccgatgcgctacaacggcg Protospacer
. ** ****************** ..
155. spacer 4.4|1867609|33|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NC_022043 (Paracoccus aminophilus JCM 7686 plasmid pAMI5, complete sequence) position: , mismatch: 8, identity: 0.758
ggctcttccttctcggtcttgcgcgggcggcca CRISPR spacer
tccgccgccttctcggccttgcgcgggcggctt Protospacer
* *. *********.**************.
156. spacer 4.9|1867959|33|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to AP018487 (Mycobacterium phage HC DNA, complete genome) position: , mismatch: 8, identity: 0.758
----cgcgggcgctgtggccagtagcggccgtcgtcc CRISPR spacer
gcatcacgg----tgtggccggtagcggccgtcgccg Protospacer
*.*** *******.*************.*
157. spacer 4.9|1867959|33|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to MN234195 (Mycobacterium phage Xula, complete genome) position: , mismatch: 8, identity: 0.758
----cgcgggcgctgtggccagtagcggccgtcgtcc CRISPR spacer
gcatcacgg----tgtggccggtagcggccgtcgccg Protospacer
*.*** *******.*************.*
158. spacer 4.9|1867959|33|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to MN234236 (Mycobacterium phage QueenHazel, complete genome) position: , mismatch: 8, identity: 0.758
----cgcgggcgctgtggccagtagcggccgtcgtcc CRISPR spacer
gcatcacgg----tgtggccggtagcggccgtcgccg Protospacer
*.*** *******.*************.*
159. spacer 4.9|1867959|33|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to HM152765 (Mycobacterium phage Island3, complete genome) position: , mismatch: 8, identity: 0.758
----cgcgggcgctgtggccagtagcggccgtcgtcc CRISPR spacer
gcatcacgg----tgtggccggtagcggccgtcgccg Protospacer
*.*** *******.*************.*
160. spacer 4.9|1867959|33|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NC_011291 (Mycobacterium phage Brujita, complete genome) position: , mismatch: 8, identity: 0.758
----cgcgggcgctgtggccagtagcggccgtcgtcc CRISPR spacer
gcatcacgg----tgtggccggtagcggccgtcgccg Protospacer
*.*** *******.*************.*
161. spacer 4.9|1867959|33|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NC_023697 (Mycobacterium phage Babsiella, complete genome) position: , mismatch: 8, identity: 0.758
----cgcgggcgctgtggccagtagcggccgtcgtcc CRISPR spacer
gcatcacgg----tgtggccggtagcggccgtcgccg Protospacer
*.*** *******.*************.*
162. spacer 4.15|1868382|35|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NC_017078 (Selenomonas ruminantium subsp. lactilytica TAM6421 plasmid pSRC1, complete sequence) position: , mismatch: 8, identity: 0.771
tccttcttcgttgtcaatctctacgacttcggtgt CRISPR spacer
tcctttttcgttgtcaatcgctacgctcccgttat Protospacer
*****.************* ***** ...** *.*
163. spacer 4.28|1869301|32|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP017562 (Pseudanabaena sp. ABRG5-3 plasmid ABRG53b, complete sequence) position: , mismatch: 8, identity: 0.75
tccgcagaccatctgaatgcagcctgcacttt CRISPR spacer
ggtgaatgccatctgaattgagcctgcacttt Protospacer
.* * .********** ************
164. spacer 4.28|1869301|32|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013506 (Rhizobium sp. N1341 plasmid pRspN1341a, complete sequence) position: , mismatch: 8, identity: 0.75
tccgcagaccatctgaatgcagcctgcacttt CRISPR spacer
ttctggaatcatttgaatgcagccttcacttt Protospacer
*.* ..*.***.************ ******
165. spacer 4.28|1869301|32|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013569 (Rhizobium phaseoli strain N771 plasmid pRphaN771a, complete sequence) position: , mismatch: 8, identity: 0.75
tccgcagaccatctgaatgcagcctgcacttt CRISPR spacer
ttctggaatcatttgaatgcagccttcacttt Protospacer
*.* ..*.***.************ ******
166. spacer 5.1|3093744|32|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NC_011981 (Agrobacterium vitis S4 plasmid pAtS4e, complete sequence) position: , mismatch: 8, identity: 0.75
cattcacgatctccacggccttcgccagtcgc CRISPR spacer
catccacgatctccacggccttcacacggaaa Protospacer
***.*******************.* * .
167. spacer 5.1|3093744|32|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022991 (Paraburkholderia aromaticivorans strain BN5 plasmid pBN1, complete sequence) position: , mismatch: 8, identity: 0.75
---cattcacgatctccacggccttcgccagtcgc CRISPR spacer
tcgcat---cgatctcgtcggccttcgccagttcg Protospacer
*** ******* **************.
168. spacer 5.2|3093805|32|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044073 (Pseudomonas oryzihabitans strain FDAARGOS_657 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
atgtcggcctgcatcccgttgccctgatcaac CRISPR spacer
ccgccgagctgcatcccttcgccctgatcaat Protospacer
.*.**. ********* *.***********.
169. spacer 5.3|3093866|32|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 8, identity: 0.75
tcggcgcacgcacaggcgcacgcgctgttgaa CRISPR spacer
gcggcgcccgcacaggcgcccgcgaaggtcag Protospacer
****** *********** **** * * *.
170. spacer 5.3|3093866|32|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015322 (Mesorhizobium amorphae CCNWGS0123 plasmid pM0123d, complete sequence) position: , mismatch: 8, identity: 0.75
tcggcgcacgcacaggcgcacgcgctgttgaa CRISPR spacer
tcccccatcgaacaggcgctcgcgctgttgat Protospacer
** * ** ******** ***********
171. spacer 5.3|3093866|32|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NC_009507 (Sphingomonas wittichii RW1 plasmid pSWIT01, complete sequence) position: , mismatch: 8, identity: 0.75
tcggcgcacgcacaggcgcacgcgctgttgaa CRISPR spacer
ccggcgcacgaacaggcgctcgcggtccagac Protospacer
.********* ******** **** * . **
172. spacer 5.8|3094172|32|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to KR827394 (Uncultured bacterium plasmid pKAZ5, complete sequence) position: , mismatch: 8, identity: 0.75
cgtttgcggctgcatggccacgatgcgcaaca CRISPR spacer
cgcgggcggctgcatgggcaccatgcgcggcg Protospacer
**. ************ *** ******..*.
173. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to MF919498 (Mycobacterium phage Cindaradix, complete genome) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
ttggcgatctcgtcggccaccgccttg-gcgat Protospacer
..**** ** **************** ** .
174. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
175. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
176. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
177. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
178. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
179. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
180. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
181. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
182. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
183. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
184. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
185. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
186. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
187. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
188. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
189. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
190. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP046254 (Sphingobium sp. CAP-1 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg CRISPR spacer
agagcgcgatggtcggccaccgccttcgggcg Protospacer
. **** * ***************** * .*
191. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
192. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
193. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
194. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
195. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
196. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
197. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
198. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
199. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
200. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
201. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
202. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
203. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
204. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
205. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
206. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
207. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
208. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
209. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
210. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
211. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
212. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
213. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
214. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
215. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
216. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
217. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
218. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
219. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
220. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
221. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
222. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
223. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
224. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
225. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
226. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
227. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
228. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
229. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
230. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
231. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
232. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
233. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
234. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
235. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
236. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
237. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
238. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
239. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
240. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
241. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
242. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
243. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
244. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
245. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
246. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
247. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
248. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
249. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
250. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
251. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
252. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
253. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
254. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
255. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
256. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
257. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
258. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
259. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
260. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
261. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
262. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
atggcgagctggtcggcctcggccttg-gcgat Protospacer
...*************** * ****** ** .
263. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to MN813696 (Mycobacterium phage Cintron, complete genome) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
ttggcgatctcgtcggccaccgccttg-gcgat Protospacer
..**** ** **************** ** .
264. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to EU744250 (Mycobacterium virus Pukovnik, complete genome) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
ttggcgatctcgtcggccaccgccttg-gcgat Protospacer
..**** ** **************** ** .
265. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NC_042339 (Mycobacterium virus Arturo, complete genome) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg- CRISPR spacer
ttggcgatctcgtcggccaccgccttg-gcgat Protospacer
..**** ** **************** ** .
266. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg CRISPR spacer
cccaccggcaggtcggccaccgtcttgtgccg Protospacer
* .* .** ************.*******.*
267. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgccttgtgctg CRISPR spacer
ggttcgaggtggtcggccatcgccttgatgtg Protospacer
* **** **********.******* **
268. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
gcagcgagctggtcggccaccgcc--ttgtgctg CRISPR spacer
tcagcgagcacgtcggccaccgccaaccgagc-- Protospacer
******** ************* ..* **
269. spacer 5.13|3094479|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP039694 (Agrobacterium larrymoorei strain CFBP5473 plasmid pTiCFBP5473, complete sequence) position: , mismatch: 8, identity: 0.75
cgcaccttgtcaaccccgacggcaaagaggcc CRISPR spacer
tctacgtcatcaacccagacggcaaagaagcc Protospacer
. .** *..******* ***********.***
270. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
271. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
272. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
273. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP015089 (Pelagibaca abyssi strain JLT2014 plasmid pPABY5, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
aaggcccggttgagcagcgggcgcacgcccag Protospacer
* *.******* **********.*****
274. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
275. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
276. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
277. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
278. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
279. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
280. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
281. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
282. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
283. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
284. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
285. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
286. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
287. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
288. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
289. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
290. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
291. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
292. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
293. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
294. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
295. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
296. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
297. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
298. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
299. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
300. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
301. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
302. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
303. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
304. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
305. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
306. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
307. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
308. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
309. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
310. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
311. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
312. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
313. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
314. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
315. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
316. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
317. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
318. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
319. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
320. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
321. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
322. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
323. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
324. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
325. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
326. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
327. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
328. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
329. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
330. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
331. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
332. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
cgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
333. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP015738 (Shinella sp. HZN7 plasmid pShin-02, complete sequence) position: , mismatch: 8, identity: 0.75
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcttcggcgcggcgttcctggcgctggagctc Protospacer
. ************** ********* *
334. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NC_031230 (Gordonia phage Yvonnetastic, complete genome) position: , mismatch: 8, identity: 0.75
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
acatcgacgcggcgttcgaggcgctacagaag Protospacer
****.******************. * . *
335. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 8, identity: 0.75
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
agttgcgcgcggcgttcgaagcgctcgacgaa Protospacer
* * *************.***** **** .
336. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 8, identity: 0.75
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
agttgcgcgcggcgttcgaagcgctcgacgaa Protospacer
* * *************.***** **** .
337. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 8, identity: 0.75
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
aggcctgcgcggcggtggaggcgctggacgcc Protospacer
*..* ******** * *************.
338. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.75
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
agagcggcgcggtgttcgaggcgcgcctcgtc Protospacer
** ********.*********** ***
339. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 8, identity: 0.75
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
cgatcgccgcggcgctcgaggcgatctccgat Protospacer
****** *******.******** * **
340. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NC_015221 (Nitrosomonas sp. AL212 plasmid pNAL21202, complete sequence) position: , mismatch: 8, identity: 0.75
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgttcttc Protospacer
. ************** * ******* * *
341. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP013412 (Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence) position: , mismatch: 8, identity: 0.75
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgctcgtggcgctgttcttc Protospacer
. ************.*** ******* * *
342. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgctcgtggcgctgttcttc Protospacer
. ************.*** ******* * *
343. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to MN813686 (Mycobacterium phage BirdsNest, complete genome) position: , mismatch: 8, identity: 0.75
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
cgatcggcgcggcggtcgagccgccctcgttg Protospacer
************** ***** ***. **
344. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_LR134459 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence) position: , mismatch: 8, identity: 0.75
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
cgcgcggcgcggcgctcgaggagctggtgcag Protospacer
** **********.****** ***** *
345. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 8, identity: 0.75
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
atctggacgcggcgttcgcggcgctggccggg Protospacer
* *.*********** ******** ** *
346. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
cgatcggcgcggcgttcgaggcgctggacgtg- CRISPR spacer
gcttccgggcggcgttcgaggcgct-gacgccc Protospacer
** * ***************** ****.
347. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP046573 (Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence) position: , mismatch: 8, identity: 0.75
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
agggcggcgccgcgctcgaggcgctgggccgg Protospacer
*. ****** ***.************.* *
348. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP015738 (Shinella sp. HZN7 plasmid pShin-02, complete sequence) position: , mismatch: 8, identity: 0.75
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcttcggcgcggcgttcctggcgctggagctc Protospacer
. ************** ********* *
349. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NC_031230 (Gordonia phage Yvonnetastic, complete genome) position: , mismatch: 8, identity: 0.75
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
acatcgacgcggcgttcgaggcgctacagaag Protospacer
****.******************. * . *
350. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 8, identity: 0.75
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
agttgcgcgcggcgttcgaagcgctcgacgaa Protospacer
* * *************.***** **** .
351. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 8, identity: 0.75
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
agttgcgcgcggcgttcgaagcgctcgacgaa Protospacer
* * *************.***** **** .
352. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 8, identity: 0.75
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
aggcctgcgcggcggtggaggcgctggacgcc Protospacer
*..* ******** * *************.
353. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.75
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
agagcggcgcggtgttcgaggcgcgcctcgtc Protospacer
** ********.*********** ***
354. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 8, identity: 0.75
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
cgatcgccgcggcgctcgaggcgatctccgat Protospacer
****** *******.******** * **
355. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NC_015221 (Nitrosomonas sp. AL212 plasmid pNAL21202, complete sequence) position: , mismatch: 8, identity: 0.75
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgttcttc Protospacer
. ************** * ******* * *
356. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP013412 (Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence) position: , mismatch: 8, identity: 0.75
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgctcgtggcgctgttcttc Protospacer
. ************.*** ******* * *
357. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgctcgtggcgctgttcttc Protospacer
. ************.*** ******* * *
358. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to MN813686 (Mycobacterium phage BirdsNest, complete genome) position: , mismatch: 8, identity: 0.75
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
cgatcggcgcggcggtcgagccgccctcgttg Protospacer
************** ***** ***. **
359. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_LR134459 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence) position: , mismatch: 8, identity: 0.75
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
cgcgcggcgcggcgctcgaggagctggtgcag Protospacer
** **********.****** ***** *
360. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 8, identity: 0.75
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
atctggacgcggcgttcgcggcgctggccggg Protospacer
* *.*********** ******** ** *
361. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
cgatcggcgcggcgttcgaggcgctggacgtg- CRISPR spacer
gcttccgggcggcgttcgaggcgct-gacgccc Protospacer
** * ***************** ****.
362. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP046573 (Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence) position: , mismatch: 8, identity: 0.75
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
agggcggcgccgcgctcgaggcgctgggccgg Protospacer
*. ****** ***.************.* *
363. spacer 5.28|3095399|33|CP020026|CRISPRCasFinder,CRT matches to NZ_CP032676 (Rhodococcus rhodochrous strain ATCC BAA870 plasmid pNit, complete sequence) position: , mismatch: 8, identity: 0.758
ccagtccggcgcagtcgcgccaagcacggccac CRISPR spacer
gacgccgcgcgcagtctcgccgagcacggccac Protospacer
*.* ******** ****.***********
364. spacer 5.29|3095461|31|CP020026|CRISPRCasFinder,CRT matches to NC_017791 (Deinococcus gobiensis I-0 plasmid P2, complete sequence) position: , mismatch: 8, identity: 0.742
acttcggcatggaggctgagcgcgccgacca CRISPR spacer
tccagggcctggaggctgagcgcgacgaact Protospacer
*. *** *************** *** *
365. spacer 5.29|3095461|31|CP020026|CRISPRCasFinder,CRT matches to NZ_CP020385 (Rhodovulum sp. MB263 plasmid pRSMBA, complete sequence) position: , mismatch: 8, identity: 0.742
acttcggcatggaggctgagcgcgccgacca CRISPR spacer
tcgccggcctggacgctgagcgcgccgccgg Protospacer
* .**** **** ************* * .
366. spacer 5.34|3095767|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
ttctcgtcgatttcgacgtagcgggtattcca CRISPR spacer
acctcgtcgatctcgtcgtagcgggtcagcga Protospacer
.*********.*** ********** * *
367. spacer 5.35|3095828|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75
gtccgcgcccggtcaccgcctgctgcacggtg CRISPR spacer
acacgcgcccggtctccgcctgcagcaggccg Protospacer
.. *********** ******** *** * .*
368. spacer 5.35|3095828|32|CP020026|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75
gtccgcgcccggtcaccgcctgctgcacggtg CRISPR spacer
tgcctcgcccggtgaccgcctgctgatcgacg Protospacer
** ******** *********** **..*
369. spacer 5.35|3095828|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 8, identity: 0.75
gtccgcgcccggtcaccgcctgctgcacggtg CRISPR spacer
ggaagtccccggtcaccgcctccggcacggcg Protospacer
* *. ************** * ******.*
370. spacer 5.38|3096012|33|CP020026|CRISPRCasFinder,CRT matches to LC487996 (Stx2-converting phage Stx2a 981509 genes for Shiga toxin 2 production region, complete sequence) position: , mismatch: 8, identity: 0.758
gtcggcgctggcggggcggcgtataccccatga CRISPR spacer
accggcgctggcgggacggcgtagacttcaata Protospacer
..*************.******* **..** *
371. spacer 5.39|3096074|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP016080 (Mesorhizobium loti NZP2037 plasmid pML2037, complete sequence) position: , mismatch: 8, identity: 0.75
ctgatcgactgcgcgccttctacgctgtacga CRISPR spacer
ttgatcgcctgcgcgccttctacggtttggac Protospacer
.****** **************** * *. .
372. spacer 5.40|3096135|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgatcggccgcgccgggcgctcgacgcccaa CRISPR spacer
cctgtcggccgcgacgggcgcacgacgccggt Protospacer
.* .********* ******* ******* .
373. spacer 5.40|3096135|32|CP020026|CRISPRCasFinder,CRT matches to NC_011143 (Phenylobacterium zucineum HLK1 plasmid, complete sequence) position: , mismatch: 8, identity: 0.75
tcgatcggccgcgccgggcgctcgacgcccaa CRISPR spacer
ttctgcggccgccccgggcgctcgtcgcctga Protospacer
*. ******* *********** ****..*
374. spacer 5.41|3096196|33|CP020026|CRISPRCasFinder,CRT matches to NZ_CP020891 (Xanthomonas citri pv. citri strain TX160197 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.758
-cagcgcgctttttgccgtgctgctggcaacaac CRISPR spacer
gtagt-cgcgttttggcgtgctgctggcaatgat Protospacer
.**. *** ***** **************..*.
375. spacer 5.41|3096196|33|CP020026|CRISPRCasFinder,CRT matches to NZ_CP020884 (Xanthomonas citri pv. citri strain TX160042 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.758
-cagcgcgctttttgccgtgctgctggcaacaac CRISPR spacer
gtagt-cgcgttttggcgtgctgctggcaatgat Protospacer
.**. *** ***** **************..*.
376. spacer 5.41|3096196|33|CP020026|CRISPRCasFinder,CRT matches to CP030168 (Xanthomonas citri pv. punicae strain LMG7504 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.758
-cagcgcgctttttgccgtgctgctggcaacaac CRISPR spacer
gtagt-cgcgttttggcgtgctgctggcaatgat Protospacer
.**. *** ***** **************..*.
377. spacer 5.44|3096380|32|CP020026|CRISPRCasFinder,CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 8, identity: 0.75
ttggcgatgagcgccacggtcttggcggtctc CRISPR spacer
agcacgatcagcgccacggtgttggcggttcc Protospacer
.**** *********** ********..*
378. spacer 5.44|3096380|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 8, identity: 0.75
ttggcgatgagcgccacggtcttggcggtctc CRISPR spacer
agcaccttgaccgtcacggtcttggcggtctc Protospacer
.* *** **.******************
379. spacer 5.44|3096380|32|CP020026|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75
ttggcgatgagcgccacggtcttggcggtctc CRISPR spacer
gacgcgatgaacgccacggtctcggcgacgtc Protospacer
*******.***********.****.. **
380. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP015089 (Pelagibaca abyssi strain JLT2014 plasmid pPABY5, complete sequence) position: , mismatch: 8, identity: 0.758
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
gaaggcccggttgagcagcgggcgcacgcccag Protospacer
* * *.******* **********.*****
381. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 8, identity: 0.758
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
atggccgccgcggtgttcgaggcgctggacgat Protospacer
..*..** *****.*****************
382. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.758
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
atggccgccgcggtgttcgaggcgctggacgat Protospacer
..*..** *****.*****************
383. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.758
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
atggccgccgcggtgttcgaggcgctggacgat Protospacer
..*..** *****.*****************
384. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 8, identity: 0.758
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
atggccgccgcggtgttcgaggcgctggacgat Protospacer
..*..** *****.*****************
385. spacer 5.47|3095093|33|CP020026|PILER-CR matches to MN586020 (Microbacterium phage Megan, complete genome) position: , mismatch: 8, identity: 0.758
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcggcggcgcgacgttcgtggcgctggacgag Protospacer
. . *******.****** *********** *
386. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP015738 (Shinella sp. HZN7 plasmid pShin-02, complete sequence) position: , mismatch: 8, identity: 0.758
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gtcttcggcgcggcgttcctggcgctggagctc Protospacer
*. ************** ********* *
387. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP015090 (Pelagibaca abyssi strain JLT2014 plasmid pPABY2, complete sequence) position: , mismatch: 8, identity: 0.758
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tccatcggcgcggggatcgaggcgctgatcggc Protospacer
* ********** * ***********. **
388. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 8, identity: 0.758
gcgatcg-gcgcggcgttcgaggcgctggacgtg CRISPR spacer
-cagttgcgcgcggcgttcgaagcgctcgacgaa Protospacer
*..*.* *************.***** **** .
389. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP020697 (Sulfitobacter sp. D7 plasmid p3SUD7, complete sequence) position: , mismatch: 8, identity: 0.758
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ccggaacgcgcggtgtttgaggcgctggacgag Protospacer
**. ******.***.************* *
390. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 8, identity: 0.758
gcgatcg-gcgcggcgttcgaggcgctggacgtg CRISPR spacer
-cagttgcgcgcggcgttcgaagcgctcgacgaa Protospacer
*..*.* *************.***** **** .
391. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 8, identity: 0.758
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gaggcctgcgcggcggtggaggcgctggacgcc Protospacer
* *..* ******** * *************.
392. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 8, identity: 0.758
gcgatcggcgcggcgttcgaggcgctg-gacgtg CRISPR spacer
tcgatcggcacggcgttcgatgcgccgcgatac- Protospacer
********.********** ****.* **...
393. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 8, identity: 0.758
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
atggccgccgcggtgttcgaggcgctggacgat Protospacer
..*..** *****.*****************
394. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.758
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
atggccgccgcggtgttcgaggcgctggacgat Protospacer
..*..** *****.*****************
395. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.758
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
atggccgccgcggtgttcgaggcgctggacgat Protospacer
..*..** *****.*****************
396. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 8, identity: 0.758
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
atggccgccgcggtgttcgaggcgctggacgat Protospacer
..*..** *****.*****************
397. spacer 5.48|3095154|33|CP020026|PILER-CR matches to MN586020 (Microbacterium phage Megan, complete genome) position: , mismatch: 8, identity: 0.758
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcggcggcgcgacgttcgtggcgctggacgag Protospacer
. . *******.****** *********** *
398. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP015738 (Shinella sp. HZN7 plasmid pShin-02, complete sequence) position: , mismatch: 8, identity: 0.758
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gtcttcggcgcggcgttcctggcgctggagctc Protospacer
*. ************** ********* *
399. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP015090 (Pelagibaca abyssi strain JLT2014 plasmid pPABY2, complete sequence) position: , mismatch: 8, identity: 0.758
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tccatcggcgcggggatcgaggcgctgatcggc Protospacer
* ********** * ***********. **
400. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 8, identity: 0.758
gcgatcg-gcgcggcgttcgaggcgctggacgtg CRISPR spacer
-cagttgcgcgcggcgttcgaagcgctcgacgaa Protospacer
*..*.* *************.***** **** .
401. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP020697 (Sulfitobacter sp. D7 plasmid p3SUD7, complete sequence) position: , mismatch: 8, identity: 0.758
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ccggaacgcgcggtgtttgaggcgctggacgag Protospacer
**. ******.***.************* *
402. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 8, identity: 0.758
gcgatcg-gcgcggcgttcgaggcgctggacgtg CRISPR spacer
-cagttgcgcgcggcgttcgaagcgctcgacgaa Protospacer
*..*.* *************.***** **** .
403. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 8, identity: 0.758
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gaggcctgcgcggcggtggaggcgctggacgcc Protospacer
* *..* ******** * *************.
404. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 8, identity: 0.758
gcgatcggcgcggcgttcgaggcgctg-gacgtg CRISPR spacer
tcgatcggcacggcgttcgatgcgccgcgatac- Protospacer
********.********** ****.* **...
405. spacer 5.52|3095398|34|CP020026|PILER-CR matches to NZ_CP032676 (Rhodococcus rhodochrous strain ATCC BAA870 plasmid pNit, complete sequence) position: , mismatch: 8, identity: 0.765
gccagtccggcgcagtcgcgccaagcacggccac CRISPR spacer
ggacgccgcgcgcagtctcgccgagcacggccac Protospacer
* *.* ******** ****.***********
406. spacer 5.53|3095460|32|CP020026|PILER-CR matches to NC_047861 (Bordetella phage vB_BbrM_PHB04, complete genome) position: , mismatch: 8, identity: 0.75
gacttcggcatggaggctgagcgc--gccgacca CRISPR spacer
cacttcggcctggaggccgagcgcaaggcggt-- Protospacer
******** *******.****** * **..
407. spacer 5.59|3095827|33|CP020026|PILER-CR matches to NZ_CP020445 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.758
ggtccgcgcccggtcaccgcctgctgcacggtg CRISPR spacer
cggccgcgcccggtcacggcctggtgctggtcg Protospacer
* ************** ***** *** * .*
408. spacer 5.62|3096011|34|CP020026|PILER-CR matches to CP053410 (Salmonella enterica strain 2014K-0203 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
agtcggcgctggcggggcggcgtataccccatga CRISPR spacer
taccggcgctggcggggcggcgtagacatcaata Protospacer
..********************* ** .** *
409. spacer 5.62|3096011|34|CP020026|PILER-CR matches to CP053320 (Salmonella enterica subsp. arizonae serovar 41:z4,z23:- strain 2016K-0011 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
agtcggcgctggcggggcggcgtataccccatga CRISPR spacer
taccggcgctggcggggcggcgtagacatcaata Protospacer
..********************* ** .** *
410. spacer 5.62|3096011|34|CP020026|PILER-CR matches to NC_028696 (Salmonella phage SEN22, complete genome) position: , mismatch: 8, identity: 0.765
agtcggcgctggcggggcggcgtatacc-ccatga CRISPR spacer
ttctggcgctggcggggcggcgtagaccggcata- Protospacer
..******************** *** ***.
411. spacer 5.62|3096011|34|CP020026|PILER-CR matches to MG969415 (UNVERIFIED: Salmonella phage GE_vB_TR, complete genome) position: , mismatch: 8, identity: 0.765
agtcggcgctggcggggcggcgtataccccatga CRISPR spacer
agccggcgctggcggcgcggcgtagagcggaata Protospacer
**.************ ******** * * * *
412. spacer 5.64|3096134|33|CP020026|PILER-CR matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 8, identity: 0.758
gtcgatcggccgcgccgggcgctcgacgcccaa CRISPR spacer
tccgatcggctgcgccaggcgctcgacggcttc Protospacer
.********.*****.*********** *.
413. spacer 5.65|3096195|34|CP020026|PILER-CR matches to NZ_CP020884 (Xanthomonas citri pv. citri strain TX160042 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.765
-gcagcgcgctttttgccgtgctgctggcaacaac CRISPR spacer
agtagt-cgcgttttggcgtgctgctggcaatgat Protospacer
*.**. *** ***** **************..*.
414. spacer 5.65|3096195|34|CP020026|PILER-CR matches to CP030168 (Xanthomonas citri pv. punicae strain LMG7504 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.765
-gcagcgcgctttttgccgtgctgctggcaacaac CRISPR spacer
agtagt-cgcgttttggcgtgctgctggcaatgat Protospacer
*.**. *** ***** **************..*.
415. spacer 5.65|3096195|34|CP020026|PILER-CR matches to NZ_CP020891 (Xanthomonas citri pv. citri strain TX160197 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.765
-gcagcgcgctttttgccgtgctgctggcaacaac CRISPR spacer
agtagt-cgcgttttggcgtgctgctggcaatgat Protospacer
*.**. *** ***** **************..*.
416. spacer 1.4|378212|34|CP020026|CRISPRCasFinder,CRT,PILER-CR matches to KU708005 (Pseudomonas phage phiAH14b, complete genome) position: , mismatch: 9, identity: 0.735
gcgccattgccaacaacaagcgcggcgcggtctt CRISPR spacer
cagacattgccaacaacgtgcgcggcgcgttgga Protospacer
* *************. ********** *
417. spacer 2.1|379845|33|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016024 (Ralstonia insidiosa strain ATCC 49129 plasmid pRI-1, complete sequence) position: , mismatch: 9, identity: 0.727
gccgatgacttcgtggacgtcagcaagcccatc CRISPR spacer
ggagatgacttggtcgacgtcagcaaggaactt Protospacer
* ******** ** ************ *.
418. spacer 2.8|380339|32|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to MT104473 (Pseudomonas phage MR13, complete genome) position: , mismatch: 9, identity: 0.719
ttctcggcgtcgttgttgcgacgatcagaaac CRISPR spacer
acatgggcgtcggtgtttcgacgatcagccag Protospacer
. * ******* **** ********** *
419. spacer 2.8|380339|32|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to MT104475 (Pseudomonas phage MR15, complete genome) position: , mismatch: 9, identity: 0.719
ttctcggcgtcgttgttgcgacgatcagaaac CRISPR spacer
acatgggcgtcggtgtttcgacgatcagccag Protospacer
. * ******* **** ********** *
420. spacer 2.14|380758|33|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 9, identity: 0.727
ttgcggaccgcaaggcgcagctggtcggcaaca CRISPR spacer
gcgaggaccgcaaggcgcagcaggccgggatag Protospacer
.* ***************** **.*** * .
421. spacer 2.15|380828|33|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to MK291445 (Paracoccus phage vB_PyeM_Pyei1, complete genome) position: , mismatch: 9, identity: 0.727
cgaccccgacaccggcaagcgcgtgccggtcga CRISPR spacer
ccggcaggacaccggccagcgcgtgcaggtcag Protospacer
* . * ********* ********* ****..
422. spacer 4.4|1867609|33|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025552 (Streptomyces rimosus strain WT5260 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
ggctcttccttctcggtcttgcgcgggcggcca CRISPR spacer
cggtggtccgtgtcggtcttgcgcgggcggaag Protospacer
* * *** * ****************** .
423. spacer 4.11|1868100|33|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to KR063280 (Gordonia phage GMA6, complete genome) position: , mismatch: 9, identity: 0.727
cccgccgaggcagccgacgtacaccttctttcc CRISPR spacer
gccgccgaggtagtcgacgtacaccgcaccgcc Protospacer
*********.**.*********** . .. **
424. spacer 4.17|1868525|33|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to MT701595 (Streptomyces phage Shaeky, complete genome) position: , mismatch: 9, identity: 0.727
ggcgctcccgccccaggctctaccaactgagct CRISPR spacer
ggattaagagccccgcgctctaccaactgagct Protospacer
** . *****. *****************
425. spacer 4.17|1868525|33|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to MN047793 (Xanthomonas phage Xoo-sp13, complete genome) position: , mismatch: 9, identity: 0.727
ggcgctcccgccccaggctctaccaactgagct CRISPR spacer
cggtttattgcccgatgctctaccaactgagct Protospacer
* .* ..**** * *****************
426. spacer 4.33|1869654|33|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014942 (Rhodococcus sp. BH4 plasmid, complete sequence) position: , mismatch: 9, identity: 0.727
tcatctgcgcttgtgtaggtgtggcgcggcggt CRISPR spacer
accagtgcgcgtgtgtaggggtggcgcggtcgg Protospacer
* ***** ******** *********. *
427. spacer 5.1|3093744|32|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 9, identity: 0.719
cattcacgatctccacggccttcgccagtcgc CRISPR spacer
ttgcgaggatctccgcagccttcgccagtcgg Protospacer
. . * *******.*.**************
428. spacer 5.4|3093927|32|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013454 (Burkholderia vietnamiensis strain MSMB608WGS plasmid pMSMB608, complete sequence) position: , mismatch: 9, identity: 0.719
cgatggcgcgcgcggctatccgcgcagcgatc CRISPR spacer
gtaccgcgcgggcggcaatccgcgcagcgcga Protospacer
*. ***** ***** ************
429. spacer 5.4|3093927|32|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011296 (Rhodococcus erythropolis strain BG43 plasmid pRLCBG43, complete sequence) position: , mismatch: 9, identity: 0.719
cgatggcgcgcgcggctatccgcgcagcgatc CRISPR spacer
gcgggtcctgcgcgcctatccgcgcaacgatc Protospacer
. * * .***** ***********.*****
430. spacer 5.9|3094233|33|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029211 (Aquabacterium olei strain NBRC 110486 plasmid pTB101, complete sequence) position: , mismatch: 9, identity: 0.727
ctcctcataaccgaatcgctgcaccagatcgga CRISPR spacer
gccctcatgaccgactcgctgcaccacgtcctg Protospacer
.******.***** *********** .** .
431. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP035637 (Enterobacter cloacae strain EN3600 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719
gcagcgagctggtcggccaccgccttgtgctg CRISPR spacer
gtcagtgcctggtcggccactgccttgttctg Protospacer
*. . . ************.******* ***
432. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 9, identity: 0.719
gcagcgagctggtcggccaccgccttgtgctg CRISPR spacer
ttcgcgatctggtcggcctccgccttgacgtc Protospacer
. **** ********** ******** *
433. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 9, identity: 0.719
gcagcgagctggtcggccaccgccttgtgctg CRISPR spacer
gctgcgagctggtcggccgccgcgcgcaacag Protospacer
** ***************.**** . .* *
434. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 9, identity: 0.719
gcagcgagctggtcggccaccgccttgtgctg CRISPR spacer
ccggtgagctggccgaccaccgccttgtcggt Protospacer
*.*.*******.**.************
435. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 9, identity: 0.719
gcagcgagctggtcggccaccgccttgtgctg CRISPR spacer
gctgcgagctggtcggccgccgcgcgcaacag Protospacer
** ***************.**** . .* *
436. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to MN813694 (Gordonia phage Opie, complete genome) position: , mismatch: 9, identity: 0.719
gcagcgagctggtcggccaccgccttgtgctg CRISPR spacer
ccgacgagctcgtcggtcaccgccttgcgtgt Protospacer
*..****** *****.**********.*.
437. spacer 5.13|3094479|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP015522 (Sphingomonas sp. NIC1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cgcaccttgtcaaccccgacggcaaagaggcc CRISPR spacer
tcttcaccgtcaaccccgacggcagcgaggcc Protospacer
. . * ..****************. ******
438. spacer 5.13|3094479|32|CP020026|CRISPRCasFinder,CRT matches to NZ_LR134459 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence) position: , mismatch: 9, identity: 0.719
cgcaccttgtcaaccccgacggcaaagaggcc CRISPR spacer
tgcaccgtgtcaacgccgacggcaccaccacc Protospacer
.***** ******* ********* . .**
439. spacer 5.20|3094911|32|CP020026|CRISPRCasFinder,CRT matches to NC_022049 (Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence) position: , mismatch: 9, identity: 0.719
cgcccatcgcggcggctttgttatccccttat CRISPR spacer
agcccatctcggcggctttgtcattgaggaat Protospacer
******* ************.**. **
440. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
441. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgctgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
442. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
443. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
444. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
445. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgctgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
446. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
447. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
448. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
449. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
450. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
451. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
452. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
453. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
454. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
455. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
456. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
457. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
458. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
459. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
460. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
461. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
462. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgctgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
463. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
464. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
465. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
466. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
467. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgctgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
468. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgctgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
469. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgctgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
470. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
471. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
472. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
473. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
474. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
475. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
476. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
477. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
478. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
479. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
480. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
481. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
482. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
483. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgctgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
484. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
485. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
486. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
487. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
488. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
489. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
490. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
491. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
492. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
493. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
494. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgctgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
495. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
496. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
497. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
498. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
499. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
500. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
501. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
502. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
503. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
504. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
505. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
506. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
507. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
508. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
509. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
510. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
511. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
512. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgctgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
513. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP009414 (Salmonella enterica strain CFSAN007428 isolate N11150 plasmid pCFSAN007428_01, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
514. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_KX815983 (Salmonella enterica subsp. enterica serovar Dublin strain N13-01125 plasmid pN13-01125, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
515. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP035548 (Salmonella enterica subsp. enterica serovar Typhimurium strain YU07-18 plasmid pYU07-18_IncA/C2, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
516. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP009411 (Salmonella enterica strain CFSAN007425 isolate 22697 plasmid pCFSAN007425_01, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
517. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP009413 (Salmonella enterica strain CFSAN007427 isolate N20272 plasmid pCFSAN007427_01, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
518. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_KJ588780 (Achromobacter xylosoxidans strain A22732 plasmid pA22732-IMP, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
519. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_KJ909290 (Aeromonas salmonicida subsp. salmonicida strain 2004-05MF26 plasmid pSN254b, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
520. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_KP688397 (Vibrio parahaemolyticus strain V36 plasmid pVPH1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
521. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_KR559888 (Klebsiella pneumoniae strain Kpn642 plasmid pKP-Gr642, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
522. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP032391 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 plasmid p34981_1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
523. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP049911 (Diaphorobacter sp. HDW4A plasmid p_unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
524. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP017987 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
525. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP045742 (Escherichia coli strain DH5alpha plasmid pTHNK130-1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
526. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP010373 (Escherichia coli strain 6409 plasmid p6409-202.186kb, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
527. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP048305 (Escherichia coli strain 9 plasmid p009_A, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
528. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP025240 (Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1928 plasmid pSNE3-1928, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
529. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP025242 (Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1929 plasmid pSNE1-1929, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
530. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP024192 (Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
531. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_LS992184 (Citrobacter freundii isolate Citrobacter freundii str. U2785 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
532. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP018716 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-2, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
533. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP018722 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-2, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
534. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP018704 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-2, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
535. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP029249 (Salmonella enterica subsp. enterica serovar Thompson strain HFCDC-SM-846 plasmid p846, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
536. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_AP022377 (Providencia stuartii strain BML2537 plasmid pBML2537, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
537. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP012682 (Salmonella enterica subsp. enterica serovar Typhimurium strain 33676 plasmid p33676_IncA/C, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
538. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP032385 (Salmonella enterica subsp. enterica serovar Dublin strain CVM N53043 plasmid pN53043_1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
539. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP014978 (Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1896 isolate ST03-F34 plasmid pSTY1-1896, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
540. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP031564 (Klebsiella pneumoniae strain 2-1 plasmid pKP21AC2, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
541. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP032397 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 plasmid p22429, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
542. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to MN254970 (Escherichia coli strain EC009 plasmid pEC009.1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
543. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP014658 (Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1736 plasmid pSAN1-1736, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
544. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP043190 (Escherichia coli O16:H48 strain PG20180175 plasmid pPG20180175.1-IncAC2, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
545. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP044142 (Escherichia coli O157 strain AR-0429 plasmid pAR-0429-1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
546. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP025231 (Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1924 plasmid pSNE1-1924, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
547. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to MF495478 (Aeromonas salmonicida plasmid pS121-1b, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
548. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP038330 (Escherichia coli O157:H7 strain NE 1092-2 plasmid pNE1092-3, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
549. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP043215 (Salmonella enterica subsp. enterica serovar Heidelberg strain SL-312 plasmid pET8.1-IncAC2, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
550. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to KU160531 (Vibrio alginolyticus strain VAS3-1 plasmid pVAS3-1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
551. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP028562 (Aeromonas hydrophila subsp. hydrophila strain WCHAH045096 plasmid p1_045096, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
552. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP009560 (Salmonella enterica subsp. enterica serovar Newport str. CVM 22425 plasmid pCVM22425, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
553. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP033574 (Shewanella algae strain KC-Na-R1 plasmid pKC-Na-R1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
554. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NC_022372 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid pYT3 DNA, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
555. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to KU238092 (Uncultured bacterium plasmid pDTC28, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
556. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP009562 (Salmonella enterica subsp. enterica serovar Newport str. CVM 22513 plasmid pCVM22513, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
557. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP038464 (Aeromonas hydrophila strain WCX23 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
558. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NC_009140 (Salmonella enterica subsp. enterica serovar Newport str. SL254 plasmid pSN254, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
559. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP038466 (Aeromonas hydrophila strain 23-C-23 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
560. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP028563 (Aeromonas hydrophila subsp. hydrophila strain WCHAH045096 plasmid p2_045096, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
561. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NC_017645 (Escherichia coli UMNK88 plasmid pUMNK88, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
562. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP009567 (Salmonella enterica subsp. enterica serovar Newport str. CVM 22462 plasmid pCFSAN000934_02, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
563. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP007636 (Vibrio cholerae strain 2012EL-2176 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
564. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_AP022566 (Mycolicibacterium alvei strain JCM 12272 plasmid pJCM12272, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
acaccggcgcggcgttcgaggctcaggaaaga Protospacer
*.****************** * *** . .
565. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NC_012690 (Escherichia coli plasmid peH4H, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
566. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP041052 (Enterobacter hormaechei strain C126 plasmid pEnC126NDM, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
567. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP032238 (Escherichia coli strain ECCWS199 plasmid pTB221, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
568. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP024557 (Klebsiella pneumoniae strain INF164 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
569. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP041172 (Salmonella enterica subsp. enterica serovar Thompson strain SH11G0791 plasmid pSH11G0791, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
570. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP024529 (Klebsiella pneumoniae strain INF157 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
571. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP032491 (Salmonella enterica subsp. enterica serovar Typhimurium strain SL26 plasmid pSL26_IncA/C2, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
572. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP032496 (Salmonella enterica subsp. enterica serovar Typhimurium strain SO21 plasmid pSO21_IncA/C2, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
573. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP024522 (Klebsiella pneumoniae strain INF158 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
574. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP015139 (Escherichia coli strain Ecol_732 plasmid pEC732_IMP14, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
575. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NC_019066 (Escherichia coli plasmid pAPEC1990_61, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
576. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to CP028804 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
577. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to KY014465 (Vibrio parahaemolyticus plasmid pVPS114, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
578. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to KY014466 (Vibrio vulnificus plasmid pVVS1-per1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
579. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP025275 (Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1923 plasmid pSNE2-1923) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
580. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP027670 (Simplicispira suum strain SC1-8 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
581. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP038450 (Aeromonas media strain R50-22 plasmid pAeme6, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
582. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to CP028419 (Aeromonas hydrophila strain WCX23 plasmid pWCX23_1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
583. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP024550 (Klebsiella pneumoniae strain INF163 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
584. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP018318 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-2, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
585. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP025236 (Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1926 plasmid pSNE2-1926, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
586. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP013115 (Shewanella xiamenensis strain T17 plasmid pSx1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
587. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP009570 (Salmonella enterica subsp. enterica serovar Newport str. CVM N1543 isolate CFSAN000926 plasmid pCVMN1543, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
588. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP009564 (Salmonella enterica subsp. enterica serovar Newport str. CVM 21550 plasmid pCVM21550, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
589. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP009563 (Salmonella enterica subsp. enterica serovar Newport str. CVM 21538 plasmid pCVM21538, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
590. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP041209 (Salmonella enterica subsp. enterica serovar Newport strain SAP18-8729 plasmid pCFSAN074384_1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
591. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NC_019906 (Pseudomonas putida HB3267 plasmid pPC9, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
592. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP018689 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-2, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
593. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tggacggcgcggccgtcgaggcgctggcgcag Protospacer
.*. ********* ************ *
594. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NC_019116 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH163_135, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
595. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NC_019118 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH696_135, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
596. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NC_019121 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH111_166, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
597. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NC_012692 (Escherichia coli plasmid pAR060302, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
598. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NC_012693 (Salmonella enterica plasmid pAM04528, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
599. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP024564 (Klebsiella pneumoniae strain INF278 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
600. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NC_019380 (Aeromonas hydrophila plasmid pR148, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
601. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP046032 (Salmonella sp. HNK130 plasmid pTHNK130-2, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
602. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP046034 (Salmonella sp. HNK130 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
603. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP032395 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 22453 plasmid p22453_1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
604. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NC_023898 (Klebsiella pneumoniae plasmid pRMH760, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
605. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022170 (Aeromonas salmonicida strain S121 plasmid pS121-1a, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
606. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP031297 (Escherichia coli strain EC17GD31 plasmid pGD31-NDM, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
607. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP050740 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST56 plasmid pST56-1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
608. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP018698 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-2, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
609. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to MN604267 (Salmonella enterica subsp. enterica serovar London strain SAL-19-0623 plasmid pSAL-19-0623_NDM, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
610. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to MN604268 (Escherichia coli strain J53 plasmid pJ53_SAL-19-0623_NDM, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
611. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP018710 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-2, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
612. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NC_024998 (Acidovorax avenae subsp. avenae plasmid pAAA83 DNA, complete sequence, strain: 83) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
613. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP032380 (Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69807 plasmid pSDU1-USMARC-69807, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
614. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP032448 (Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69840 plasmid pSDU2-USMARC-69840, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
615. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_MH105050 (Salmonella enterica subsp. enterica serovar Lomita strain SL131 plasmid pSL131_IncA/C-IncX3, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
616. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_MK205418 (Salmonella enterica subsp. enterica serovar Dublin strain 14-1360 plasmid p14-1360-1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
617. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_MK205416 (Salmonella enterica subsp. enterica serovar Dublin strain N13-01070 plasmid pN13-01070-1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
618. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_MK757441 (Alcaligenes faecalis strain AN70 plasmid pAN70-1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
619. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP009410 (Salmonella enterica strain CFSAN007405 isolate 30034 plasmid pCFSAN007405_01, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
620. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_MF344573 (Klebsiella pneumoniae strain N201205880 plasmid p205880-Ct1/2, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
621. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_MH113855 (Vibrio alginolyticus strain Vb1796 plasmid pVb1796, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
622. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_MH457126 (Vibrio alginolyticus strain Vb1394 plasmid pC1394, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
623. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to MT219816 (Escherichia coli strain RF173-1 plasmid pRF173-1_87k_tetX, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
624. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_MF582638 (Klebsiella pneumoniae strain KKp4 plasmid pKKp4-VIM, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
625. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_LC507075 (Providencia rettgeri strain BML2526 plasmid p.BML2526, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
626. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_LN809998 (Pseudomonas aeruginosa strain MH19 plasmid pPAMH19, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
627. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_MF627445 (Vibrio parahaemolyticus strain Vb0499 plasmid pVb0499, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
628. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NC_019105 (Salmonella enterica subsp. enterica serovar Dublin plasmid pSD_88, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
629. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP020913 (Salmonella enterica subsp. enterica serovar Montevideo str. CDC 2010K-0257 plasmid pSMO-2010K-0257, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
630. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP041162 (Leisingera aquaemixtae strain R2C4 plasmid unnamed6) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcctgcgcgcggccttcgcggcgctggacttc Protospacer
* ******* **** ********** *
631. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcgccggggcggcggtcgaggcgctggcccag Protospacer
..*** ****** ************ * *
632. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP011515 (Mitsuaria sp. 7 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tccttggcgcggcgttcgcggcggtggatccg Protospacer
. *.************* **** ****. .*
633. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcgccggggcggcggtcgaggcgctggcccag Protospacer
..*** ****** ************ * *
634. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP013381 (Burkholderia sp. Bp5365 strain MSMB43 plasmid pMSMB43, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
cgatcggcgcggtgttcgacgcgttcccgtcg Protospacer
************.****** ***.* .*
635. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP015420 (Rhodovulum sulfidophilum DSM 1374 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
atatgcgcgcggccttcgaggcgcgggactat Protospacer
** ******* ********** ****
636. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP053710 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
cgatcggcgaggagttcgaggcgtatggctac Protospacer
********* ** **********. *.*
637. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP053710 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
cgatcggcgaggagttcgaggcgtatggctac Protospacer
********* ** **********. *.*
638. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP053711 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
cgatcggcgaggagttcgaggcgtatggctac Protospacer
********* ** **********. *.*
639. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_AP014801 (Rhodovulum sulfidophilum plasmid Plasmid1 DNA, complete genome, strain: DSM 2351) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
atatgcgcgcggccttcgaggcgcgggactat Protospacer
** ******* ********** ****
640. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
641. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgctgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
642. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
643. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
644. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
645. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgctgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
646. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
647. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
648. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
649. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
650. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
651. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
652. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
653. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
654. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
655. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
656. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
657. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
658. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
659. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
660. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
661. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
662. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgctgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
663. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
664. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
665. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
666. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
667. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgctgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
668. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgctgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
669. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgctgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
670. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
671. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
672. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
673. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
674. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
675. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
676. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
677. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
678. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
679. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
680. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
681. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
682. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
683. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgctgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
684. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
685. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
686. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
687. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
688. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
689. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
690. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
691. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
692. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
693. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
694. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgctgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
695. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
696. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
697. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
698. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
699. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
700. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
701. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
702. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
703. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
704. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
705. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
706. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
707. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
708. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
709. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
710. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
711. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
712. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgctgcgttcgaggcgctgcagaac Protospacer
******* *************** * .
713. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP009414 (Salmonella enterica strain CFSAN007428 isolate N11150 plasmid pCFSAN007428_01, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
714. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_KX815983 (Salmonella enterica subsp. enterica serovar Dublin strain N13-01125 plasmid pN13-01125, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
715. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP035548 (Salmonella enterica subsp. enterica serovar Typhimurium strain YU07-18 plasmid pYU07-18_IncA/C2, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
716. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP009411 (Salmonella enterica strain CFSAN007425 isolate 22697 plasmid pCFSAN007425_01, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
717. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP009413 (Salmonella enterica strain CFSAN007427 isolate N20272 plasmid pCFSAN007427_01, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
718. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_KJ588780 (Achromobacter xylosoxidans strain A22732 plasmid pA22732-IMP, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
719. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_KJ909290 (Aeromonas salmonicida subsp. salmonicida strain 2004-05MF26 plasmid pSN254b, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
720. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_KP688397 (Vibrio parahaemolyticus strain V36 plasmid pVPH1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
721. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_KR559888 (Klebsiella pneumoniae strain Kpn642 plasmid pKP-Gr642, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
722. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP032391 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 plasmid p34981_1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
723. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP049911 (Diaphorobacter sp. HDW4A plasmid p_unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
724. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP017987 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
725. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP045742 (Escherichia coli strain DH5alpha plasmid pTHNK130-1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
726. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP010373 (Escherichia coli strain 6409 plasmid p6409-202.186kb, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
727. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP048305 (Escherichia coli strain 9 plasmid p009_A, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
728. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP025240 (Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1928 plasmid pSNE3-1928, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
729. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP025242 (Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1929 plasmid pSNE1-1929, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
730. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP024192 (Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
731. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_LS992184 (Citrobacter freundii isolate Citrobacter freundii str. U2785 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
732. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP018716 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-2, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
733. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP018722 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-2, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
734. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP018704 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-2, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
735. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP029249 (Salmonella enterica subsp. enterica serovar Thompson strain HFCDC-SM-846 plasmid p846, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
736. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_AP022377 (Providencia stuartii strain BML2537 plasmid pBML2537, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
737. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP012682 (Salmonella enterica subsp. enterica serovar Typhimurium strain 33676 plasmid p33676_IncA/C, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
738. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP032385 (Salmonella enterica subsp. enterica serovar Dublin strain CVM N53043 plasmid pN53043_1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
739. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP014978 (Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1896 isolate ST03-F34 plasmid pSTY1-1896, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
740. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP031564 (Klebsiella pneumoniae strain 2-1 plasmid pKP21AC2, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
741. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP032397 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 plasmid p22429, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
742. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to MN254970 (Escherichia coli strain EC009 plasmid pEC009.1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
743. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP014658 (Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1736 plasmid pSAN1-1736, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
744. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP043190 (Escherichia coli O16:H48 strain PG20180175 plasmid pPG20180175.1-IncAC2, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
745. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP044142 (Escherichia coli O157 strain AR-0429 plasmid pAR-0429-1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
746. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP025231 (Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1924 plasmid pSNE1-1924, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
747. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to MF495478 (Aeromonas salmonicida plasmid pS121-1b, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
748. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP038330 (Escherichia coli O157:H7 strain NE 1092-2 plasmid pNE1092-3, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
749. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP043215 (Salmonella enterica subsp. enterica serovar Heidelberg strain SL-312 plasmid pET8.1-IncAC2, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
750. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to KU160531 (Vibrio alginolyticus strain VAS3-1 plasmid pVAS3-1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
751. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP028562 (Aeromonas hydrophila subsp. hydrophila strain WCHAH045096 plasmid p1_045096, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
752. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP009560 (Salmonella enterica subsp. enterica serovar Newport str. CVM 22425 plasmid pCVM22425, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
753. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP033574 (Shewanella algae strain KC-Na-R1 plasmid pKC-Na-R1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
754. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NC_022372 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid pYT3 DNA, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
755. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to KU238092 (Uncultured bacterium plasmid pDTC28, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
756. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP009562 (Salmonella enterica subsp. enterica serovar Newport str. CVM 22513 plasmid pCVM22513, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
757. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP038464 (Aeromonas hydrophila strain WCX23 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
758. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NC_009140 (Salmonella enterica subsp. enterica serovar Newport str. SL254 plasmid pSN254, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
759. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP038466 (Aeromonas hydrophila strain 23-C-23 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
760. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP028563 (Aeromonas hydrophila subsp. hydrophila strain WCHAH045096 plasmid p2_045096, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
761. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NC_017645 (Escherichia coli UMNK88 plasmid pUMNK88, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
762. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP009567 (Salmonella enterica subsp. enterica serovar Newport str. CVM 22462 plasmid pCFSAN000934_02, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
763. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP007636 (Vibrio cholerae strain 2012EL-2176 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
764. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_AP022566 (Mycolicibacterium alvei strain JCM 12272 plasmid pJCM12272, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
acaccggcgcggcgttcgaggctcaggaaaga Protospacer
*.****************** * *** . .
765. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NC_012690 (Escherichia coli plasmid peH4H, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
766. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP041052 (Enterobacter hormaechei strain C126 plasmid pEnC126NDM, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
767. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP032238 (Escherichia coli strain ECCWS199 plasmid pTB221, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
768. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP024557 (Klebsiella pneumoniae strain INF164 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
769. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP041172 (Salmonella enterica subsp. enterica serovar Thompson strain SH11G0791 plasmid pSH11G0791, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
770. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP024529 (Klebsiella pneumoniae strain INF157 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
771. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP032491 (Salmonella enterica subsp. enterica serovar Typhimurium strain SL26 plasmid pSL26_IncA/C2, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
772. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP032496 (Salmonella enterica subsp. enterica serovar Typhimurium strain SO21 plasmid pSO21_IncA/C2, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
773. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP024522 (Klebsiella pneumoniae strain INF158 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
774. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP015139 (Escherichia coli strain Ecol_732 plasmid pEC732_IMP14, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
775. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NC_019066 (Escherichia coli plasmid pAPEC1990_61, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
776. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to CP028804 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
777. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to KY014465 (Vibrio parahaemolyticus plasmid pVPS114, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
778. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to KY014466 (Vibrio vulnificus plasmid pVVS1-per1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
779. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP025275 (Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1923 plasmid pSNE2-1923) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
780. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP027670 (Simplicispira suum strain SC1-8 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
781. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP038450 (Aeromonas media strain R50-22 plasmid pAeme6, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
782. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to CP028419 (Aeromonas hydrophila strain WCX23 plasmid pWCX23_1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
783. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP024550 (Klebsiella pneumoniae strain INF163 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
784. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP018318 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-2, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
785. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP025236 (Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1926 plasmid pSNE2-1926, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
786. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP013115 (Shewanella xiamenensis strain T17 plasmid pSx1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
787. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP009570 (Salmonella enterica subsp. enterica serovar Newport str. CVM N1543 isolate CFSAN000926 plasmid pCVMN1543, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
788. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP009564 (Salmonella enterica subsp. enterica serovar Newport str. CVM 21550 plasmid pCVM21550, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
789. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP009563 (Salmonella enterica subsp. enterica serovar Newport str. CVM 21538 plasmid pCVM21538, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
790. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP041209 (Salmonella enterica subsp. enterica serovar Newport strain SAP18-8729 plasmid pCFSAN074384_1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
791. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NC_019906 (Pseudomonas putida HB3267 plasmid pPC9, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
792. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP018689 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-2, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
793. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tggacggcgcggccgtcgaggcgctggcgcag Protospacer
.*. ********* ************ *
794. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NC_019116 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH163_135, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
795. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NC_019118 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH696_135, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
796. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NC_019121 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH111_166, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
797. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NC_012692 (Escherichia coli plasmid pAR060302, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
798. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NC_012693 (Salmonella enterica plasmid pAM04528, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
799. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP024564 (Klebsiella pneumoniae strain INF278 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
800. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NC_019380 (Aeromonas hydrophila plasmid pR148, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
801. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP046032 (Salmonella sp. HNK130 plasmid pTHNK130-2, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
802. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP046034 (Salmonella sp. HNK130 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
803. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP032395 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 22453 plasmid p22453_1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
804. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NC_023898 (Klebsiella pneumoniae plasmid pRMH760, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
805. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022170 (Aeromonas salmonicida strain S121 plasmid pS121-1a, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
806. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP031297 (Escherichia coli strain EC17GD31 plasmid pGD31-NDM, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
807. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP050740 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST56 plasmid pST56-1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
808. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP018698 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-2, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
809. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to MN604267 (Salmonella enterica subsp. enterica serovar London strain SAL-19-0623 plasmid pSAL-19-0623_NDM, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
810. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to MN604268 (Escherichia coli strain J53 plasmid pJ53_SAL-19-0623_NDM, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
811. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP018710 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-2, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
812. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NC_024998 (Acidovorax avenae subsp. avenae plasmid pAAA83 DNA, complete sequence, strain: 83) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
813. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP032380 (Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69807 plasmid pSDU1-USMARC-69807, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
814. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP032448 (Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69840 plasmid pSDU2-USMARC-69840, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
815. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_MH105050 (Salmonella enterica subsp. enterica serovar Lomita strain SL131 plasmid pSL131_IncA/C-IncX3, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
816. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_MK205418 (Salmonella enterica subsp. enterica serovar Dublin strain 14-1360 plasmid p14-1360-1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
817. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_MK205416 (Salmonella enterica subsp. enterica serovar Dublin strain N13-01070 plasmid pN13-01070-1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
818. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_MK757441 (Alcaligenes faecalis strain AN70 plasmid pAN70-1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
819. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP009410 (Salmonella enterica strain CFSAN007405 isolate 30034 plasmid pCFSAN007405_01, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
820. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_MF344573 (Klebsiella pneumoniae strain N201205880 plasmid p205880-Ct1/2, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
821. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_MH113855 (Vibrio alginolyticus strain Vb1796 plasmid pVb1796, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
822. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_MH457126 (Vibrio alginolyticus strain Vb1394 plasmid pC1394, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
823. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to MT219816 (Escherichia coli strain RF173-1 plasmid pRF173-1_87k_tetX, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
824. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_MF582638 (Klebsiella pneumoniae strain KKp4 plasmid pKKp4-VIM, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
825. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_LC507075 (Providencia rettgeri strain BML2526 plasmid p.BML2526, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
826. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_LN809998 (Pseudomonas aeruginosa strain MH19 plasmid pPAMH19, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
827. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_MF627445 (Vibrio parahaemolyticus strain Vb0499 plasmid pVb0499, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
828. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NC_019105 (Salmonella enterica subsp. enterica serovar Dublin plasmid pSD_88, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
829. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP020913 (Salmonella enterica subsp. enterica serovar Montevideo str. CDC 2010K-0257 plasmid pSMO-2010K-0257, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
830. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP041162 (Leisingera aquaemixtae strain R2C4 plasmid unnamed6) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcctgcgcgcggccttcgcggcgctggacttc Protospacer
* ******* **** ********** *
831. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcgccggggcggcggtcgaggcgctggcccag Protospacer
..*** ****** ************ * *
832. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP011515 (Mitsuaria sp. 7 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tccttggcgcggcgttcgcggcggtggatccg Protospacer
. *.************* **** ****. .*
833. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcgccggggcggcggtcgaggcgctggcccag Protospacer
..*** ****** ************ * *
834. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP013381 (Burkholderia sp. Bp5365 strain MSMB43 plasmid pMSMB43, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
cgatcggcgcggtgttcgacgcgttcccgtcg Protospacer
************.****** ***.* .*
835. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP015420 (Rhodovulum sulfidophilum DSM 1374 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
atatgcgcgcggccttcgaggcgcgggactat Protospacer
** ******* ********** ****
836. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP053710 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
cgatcggcgaggagttcgaggcgtatggctac Protospacer
********* ** **********. *.*
837. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP053710 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
cgatcggcgaggagttcgaggcgtatggctac Protospacer
********* ** **********. *.*
838. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP053711 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
cgatcggcgaggagttcgaggcgtatggctac Protospacer
********* ** **********. *.*
839. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_AP014801 (Rhodovulum sulfidophilum plasmid Plasmid1 DNA, complete genome, strain: DSM 2351) position: , mismatch: 9, identity: 0.719
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
atatgcgcgcggccttcgaggcgcgggactat Protospacer
** ******* ********** ****
840. spacer 5.27|3095338|32|CP020026|CRISPRCasFinder,CRT matches to NZ_LN832560 (Paracoccus aminovorans isolate JCM7685 plasmid II, complete sequence) position: , mismatch: 9, identity: 0.719
gccaggcgacggttttcccagacataatcttg CRISPR spacer
gccaggcgcaggttttcccagaccgcgcccag Protospacer
******** ************* ..*. *
841. spacer 5.29|3095461|31|CP020026|CRISPRCasFinder,CRT matches to MN693269 (Marine virus AFVG_25M487, complete genome) position: , mismatch: 9, identity: 0.71
acttcggcatggaggctgagcgcgccgacca CRISPR spacer
ccttcgccatggaggctgagcgctgccttgt Protospacer
***** **************** * .
842. spacer 5.29|3095461|31|CP020026|CRISPRCasFinder,CRT matches to MN693269 (Marine virus AFVG_25M487, complete genome) position: , mismatch: 9, identity: 0.71
acttcggcatggaggctgagcgcgccgacca CRISPR spacer
ccttcgccatggaggctgagcgctgccttgt Protospacer
***** **************** * .
843. spacer 5.29|3095461|31|CP020026|CRISPRCasFinder,CRT matches to NZ_LR134469 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 27, complete sequence) position: , mismatch: 9, identity: 0.71
acttcggcatggaggctgagcgcgccgacca CRISPR spacer
gggacggcatcgaggccgagcgcgccgcctg Protospacer
. ****** *****.********** *..
844. spacer 5.29|3095461|31|CP020026|CRISPRCasFinder,CRT matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 9, identity: 0.71
acttcggcatggaggctgagcgcgccgacca CRISPR spacer
gtgccggcatagaagctgagcgcgccgccgt Protospacer
.. .******.**.************* *
845. spacer 5.29|3095461|31|CP020026|CRISPRCasFinder,CRT matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 9, identity: 0.71
acttcggcatggaggctgagcgcgccgacca CRISPR spacer
tgcccttgatggaggctgagatcgccgacca Protospacer
..* ************ *********
846. spacer 5.32|3095643|33|CP020026|CRISPRCasFinder,CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.727
cggtgcgttctcatcaccggggcgcacgactca CRISPR spacer
cagcatcttctcatcaccggggcgaacggcttc Protospacer
*.*... ***************** ***.**.
847. spacer 5.35|3095828|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP015738 (Shinella sp. HZN7 plasmid pShin-02, complete sequence) position: , mismatch: 9, identity: 0.719
gtccgcgcccggtcaccgcctgctgcacggtg CRISPR spacer
catcgcgcccgctcaccgcctcctgcgccagg Protospacer
.******** ********* ****.* . *
848. spacer 5.40|3096135|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 9, identity: 0.719
tcgatcggccgcgccgggcgctcgacgcccaa CRISPR spacer
tgattcgaccgcgccgggcgctcgccgagcgc Protospacer
* . ***.**************** ** *.
849. spacer 5.40|3096135|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 9, identity: 0.719
tcgatcggccgcgccgggcgctcgacgcccaa CRISPR spacer
ccgatcggcagcgcggggcgctcgcctcgttc Protospacer
.******** **** ********* * * .
850. spacer 5.40|3096135|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP024895 (Amycolatopsis sp. AA4 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
tcgatcggccgcgccgggcgctcgacgcccaa CRISPR spacer
cggccaggccgcgctgggcgctcgccgccgac Protospacer
. * . ********.********* **** *
851. spacer 5.40|3096135|32|CP020026|CRISPRCasFinder,CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 9, identity: 0.719
tcgatcggccgcgccgggcgctcgacgcccaa CRISPR spacer
aggcgcgggcgcgccgggccctcgacgccttc Protospacer
* *** ********** *********.
852. spacer 5.40|3096135|32|CP020026|CRISPRCasFinder,CRT matches to NC_011892 (Methylobacterium nodulans ORS 2060 plasmid pMNOD01, complete sequence) position: , mismatch: 9, identity: 0.719
tcgatcggccgcgccgggcgctcgacgcccaa CRISPR spacer
gagatcggccgcgtcgagcgctcgatcttcat Protospacer
***********.**.********. ..**
853. spacer 5.40|3096135|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP015043 (Rhodovulum sp. P5 plasmid pRGUI04, complete sequence) position: , mismatch: 9, identity: 0.719
tcgatcggccgcgccgggcgctcgacgcccaa CRISPR spacer
cccgccggccgcgccgggcgctggccgcgctg Protospacer
.* ..***************** * *** * .
854. spacer 5.40|3096135|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP015043 (Rhodovulum sp. P5 plasmid pRGUI04, complete sequence) position: , mismatch: 9, identity: 0.719
tcgatcggccgcgccgggcgctcgacgcccaa CRISPR spacer
cccgccggccgcgccgggcgctggccgcgctg Protospacer
.* ..***************** * *** * .
855. spacer 5.40|3096135|32|CP020026|CRISPRCasFinder,CRT matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 9, identity: 0.719
tcgatcggccgcgccgggcgctcgacgcccaa CRISPR spacer
tcgatgggccgcgccgagcgctcagggcagcc Protospacer
***** **********.******.. **
856. spacer 5.40|3096135|32|CP020026|CRISPRCasFinder,CRT matches to MN703407 (Microbacterium phage Leaf, complete genome) position: , mismatch: 9, identity: 0.719
tcgatcggccgcgccgggcgctc-----gacgcccaa CRISPR spacer
tcgatcgggcgcgccgggagctcccgctggtg----- Protospacer
******** ********* **** *..*
857. spacer 5.40|3096135|32|CP020026|CRISPRCasFinder,CRT matches to MN703414 (Microbacterium phage Dewdrop, complete genome) position: , mismatch: 9, identity: 0.719
tcgatcggccgcgccgggcgctc-----gacgcccaa CRISPR spacer
tcgatcgggcgcgccgggagctcccgctggtg----- Protospacer
******** ********* **** *..*
858. spacer 5.41|3096196|33|CP020026|CRISPRCasFinder,CRT matches to NZ_CP054607 (Sulfitobacter pseudonitzschiae strain H46 plasmid unnamed8, complete sequence) position: , mismatch: 9, identity: 0.727
cagcgcgctttttgccgtgctgctggcaacaac CRISPR spacer
cagcgcgctttgcgccgtgctgctgaatgagcc Protospacer
*********** .************. . . *
859. spacer 5.41|3096196|33|CP020026|CRISPRCasFinder,CRT matches to NZ_CP045408 (Roseovarius sp. THAF9 plasmid pTHAF9_d, complete sequence) position: , mismatch: 9, identity: 0.727
cagcgcgctttttgccgtgctgctggcaacaac CRISPR spacer
cagcgcgctttgcgccgtgctgctgaatgagcc Protospacer
*********** .************. . . *
860. spacer 5.44|3096380|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP046574 (Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence) position: , mismatch: 9, identity: 0.719
ttggcgatgagcgccacggtcttggcggtctc CRISPR spacer
ccgccggtgatcgccacggtcttggcggcggt Protospacer
..* **.*** *****************. .
861. spacer 5.44|3096380|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 9, identity: 0.719
ttggcgatgagcgccacggtcttggcggtctc CRISPR spacer
ttccagatgagcgccacagacttggcggcgaa Protospacer
** ************.* ********.
862. spacer 5.44|3096380|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP020911 (Rhizobium etli strain NXC12 plasmid pRetNXC12e, complete sequence) position: , mismatch: 9, identity: 0.719
ttggcgatgagcgccacggtcttggcggtctc CRISPR spacer
ttggcggtgatcgccacggtcttttcccccgg Protospacer
******.*** ************ * .*
863. spacer 5.44|3096380|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP025613 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
ttggcgatgagcgccacggtcttggcggtctc CRISPR spacer
ttatggatgagcgccacggtctcgccggggct Protospacer
**. *****************.* *** ..
864. spacer 5.44|3096380|32|CP020026|CRISPRCasFinder,CRT matches to MN304822 (Phage 64_12, partial genome) position: , mismatch: 9, identity: 0.719
ttggcgatgagcgccacggtcttggcggtctc CRISPR spacer
tgggcgaggaccgccacggtcttggtgccaag Protospacer
* ***** ** **************.* .
865. spacer 5.45|3094971|33|CP020026|PILER-CR matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
866. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
867. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
868. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
869. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
870. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
871. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
872. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
873. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
874. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
875. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
876. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
877. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
878. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
879. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
880. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
881. spacer 5.45|3094971|33|CP020026|PILER-CR matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
882. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
883. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
884. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
885. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
886. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
887. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
888. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
889. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
890. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
891. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
892. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
893. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
894. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
895. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
896. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
897. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
898. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
899. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
900. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
901. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
902. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
903. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
904. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
905. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
906. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
907. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
908. spacer 5.45|3094971|33|CP020026|PILER-CR matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
909. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
910. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
911. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
912. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
913. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
914. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
915. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
916. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
917. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
918. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
919. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
920. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
921. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
922. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
923. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
924. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
925. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
926. spacer 5.45|3094971|33|CP020026|PILER-CR matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
ccgggccgggtcgatcagcgcgcgcgcgccctc Protospacer
. * *. ***.******** ***********.
927. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP013381 (Burkholderia sp. Bp5365 strain MSMB43 plasmid pMSMB43, complete sequence) position: , mismatch: 9, identity: 0.727
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcgatcggcgcggtgttcgacgcgttcccgtcg Protospacer
*************.****** ***.* .*
928. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP053710 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.727
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcgatcggcgaggagttcgaggcgtatggctac Protospacer
********** ** **********. *.*
929. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP053710 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.727
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcgatcggcgaggagttcgaggcgtatggctac Protospacer
********** ** **********. *.*
930. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP053711 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.727
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcgatcggcgaggagttcgaggcgtatggctac Protospacer
********** ** **********. *.*
931. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NC_015221 (Nitrosomonas sp. AL212 plasmid pNAL21202, complete sequence) position: , mismatch: 9, identity: 0.727
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgttcttc Protospacer
. ************** * ******* * *
932. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP013412 (Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence) position: , mismatch: 9, identity: 0.727
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgctcgtggcgctgttcttc Protospacer
. ************.*** ******* * *
933. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgctcgtggcgctgttcttc Protospacer
. ************.*** ******* * *
934. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP009547 (Burkholderia sp. 2002721687 plasmid pBTU, complete sequence) position: , mismatch: 9, identity: 0.727
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcgatcggcgcggtgttcgacgcgttcccgtcg Protospacer
*************.****** ***.* .*
935. spacer 5.47|3095093|33|CP020026|PILER-CR matches to MN813686 (Mycobacterium phage BirdsNest, complete genome) position: , mismatch: 9, identity: 0.727
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcgatcggcgcggcggtcgagccgccctcgttg Protospacer
************** ***** ***. **
936. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP013381 (Burkholderia sp. Bp5365 strain MSMB43 plasmid pMSMB43, complete sequence) position: , mismatch: 9, identity: 0.727
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcgatcggcgcggtgttcgacgcgttcccgtcg Protospacer
*************.****** ***.* .*
937. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP053710 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.727
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcgatcggcgaggagttcgaggcgtatggctac Protospacer
********** ** **********. *.*
938. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP053710 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.727
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcgatcggcgaggagttcgaggcgtatggctac Protospacer
********** ** **********. *.*
939. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP053711 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.727
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcgatcggcgaggagttcgaggcgtatggctac Protospacer
********** ** **********. *.*
940. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NC_015221 (Nitrosomonas sp. AL212 plasmid pNAL21202, complete sequence) position: , mismatch: 9, identity: 0.727
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgttcttc Protospacer
. ************** * ******* * *
941. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP013412 (Burkholderia thailandensis strain 2002721643 plasmid p2002721643, complete sequence) position: , mismatch: 9, identity: 0.727
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgctcgtggcgctgttcttc Protospacer
. ************.*** ******* * *
942. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.727
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgctcgtggcgctgttcttc Protospacer
. ************.*** ******* * *
943. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP009547 (Burkholderia sp. 2002721687 plasmid pBTU, complete sequence) position: , mismatch: 9, identity: 0.727
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcgatcggcgcggtgttcgacgcgttcccgtcg Protospacer
*************.****** ***.* .*
944. spacer 5.48|3095154|33|CP020026|PILER-CR matches to MN813686 (Mycobacterium phage BirdsNest, complete genome) position: , mismatch: 9, identity: 0.727
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tcgatcggcgcggcggtcgagccgccctcgttg Protospacer
************** ***** ***. **
945. spacer 5.51|3095337|33|CP020026|PILER-CR matches to NZ_LN832560 (Paracoccus aminovorans isolate JCM7685 plasmid II, complete sequence) position: , mismatch: 9, identity: 0.727
ggccaggcgacggttttcccagacataatcttg CRISPR spacer
ggccaggcgcaggttttcccagaccgcgcccag Protospacer
********* ************* ..*. *
946. spacer 5.53|3095460|32|CP020026|PILER-CR matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 9, identity: 0.719
gacttcggcatggaggctgagcgcgccgacca CRISPR spacer
ggtgccggcatagaagctgagcgcgccgccgt Protospacer
*.. .******.**.************* *
947. spacer 5.53|3095460|32|CP020026|PILER-CR matches to NC_017791 (Deinococcus gobiensis I-0 plasmid P2, complete sequence) position: , mismatch: 9, identity: 0.719
gacttcggcatggaggctgagcgcgccgacca CRISPR spacer
ctccagggcctggaggctgagcgcgacgaact Protospacer
*. *** *************** *** *
948. spacer 5.53|3095460|32|CP020026|PILER-CR matches to NZ_CP020385 (Rhodovulum sp. MB263 plasmid pRSMBA, complete sequence) position: , mismatch: 9, identity: 0.719
gacttcggcatggaggctgagcgcgccgacca CRISPR spacer
ctcgccggcctggacgctgagcgcgccgccgg Protospacer
* .**** **** ************* * .
949. spacer 5.56|3095642|34|CP020026|PILER-CR matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.735
gcggtgcgttctcatcaccggggcgcacgactca CRISPR spacer
gcagcatcttctcatcaccggggcgaacggcttc Protospacer
**.*... ***************** ***.**.
950. spacer 5.58|3095766|33|CP020026|PILER-CR matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.727
gttctcgtcgatttcgacgtagcgggtattcca CRISPR spacer
cacctcgtcgatctcgtcgtagcgggtcagcga Protospacer
.*********.*** ********** * *
951. spacer 5.59|3095827|33|CP020026|PILER-CR matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.727
ggtccgcgcccggtcaccgcctgctgcacggtg CRISPR spacer
aacacgcgcccggtctccgcctgcagcaggccg Protospacer
... *********** ******** *** * .*
952. spacer 5.62|3096011|34|CP020026|PILER-CR matches to LC487996 (Stx2-converting phage Stx2a 981509 genes for Shiga toxin 2 production region, complete sequence) position: , mismatch: 9, identity: 0.735
agtcggcgctggcggggcggcgtataccccatga CRISPR spacer
taccggcgctggcgggacggcgtagacttcaata Protospacer
..*************.******* **..** *
953. spacer 5.64|3096134|33|CP020026|PILER-CR matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgatcggccgcgccgggcgctcgacgcccaa CRISPR spacer
ccctgtcggccgcgacgggcgcacgacgccggt Protospacer
.* .********* ******* ******* .
954. spacer 5.64|3096134|33|CP020026|PILER-CR matches to NC_011143 (Phenylobacterium zucineum HLK1 plasmid, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgatcggccgcgccgggcgctcgacgcccaa CRISPR spacer
attctgcggccgccccgggcgctcgtcgcctga Protospacer
.*. ******* *********** ****..*
955. spacer 5.64|3096134|33|CP020026|PILER-CR matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgatcggccgcgccgggcgctcgacgcccaa CRISPR spacer
gaggcgcgggcgcgccgggccctcgacgccttc Protospacer
* * *** ********** *********.
956. spacer 5.65|3096195|34|CP020026|PILER-CR matches to MK291445 (Paracoccus phage vB_PyeM_Pyei1, complete genome) position: , mismatch: 9, identity: 0.735
gcagcgcgctttttgccgtgctgctggcaacaac----- CRISPR spacer
gcagcgcgctgtttgccgcgctgc-----accgcccggg Protospacer
********** *******.***** ** .*
957. spacer 5.68|3096379|33|CP020026|PILER-CR matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 9, identity: 0.727
gttggcgatgagcgccacggtcttggcggtctc CRISPR spacer
cagcacgatcagcgccacggtgttggcggttcc Protospacer
.**** *********** ********..*
958. spacer 5.68|3096379|33|CP020026|PILER-CR matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 9, identity: 0.727
gttggcgatgagcgccacggtcttggcggtctc CRISPR spacer
cagcaccttgaccgtcacggtcttggcggtctc Protospacer
.* *** **.******************
959. spacer 5.68|3096379|33|CP020026|PILER-CR matches to NZ_CP020911 (Rhizobium etli strain NXC12 plasmid pRetNXC12e, complete sequence) position: , mismatch: 9, identity: 0.727
gttggcgatgagcgccacggtcttggcggtctc CRISPR spacer
gttggcggtgatcgccacggtcttttcccccgg Protospacer
*******.*** ************ * .*
960. spacer 5.68|3096379|33|CP020026|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.727
gttggcgatgagcgccacggtcttggcggtctc CRISPR spacer
cgacgcgatgaacgccacggtctcggcgacgtc Protospacer
*******.***********.****.. **
961. spacer 1.4|378212|34|CP020026|CRISPRCasFinder,CRT,PILER-CR matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 10, identity: 0.706
gcgccattgccaacaacaagcgcggcgcggtctt CRISPR spacer
aagccaatgccaacaagaagcgcggcttgaacga Protospacer
. **** ********* ********* .*. *
962. spacer 1.4|378212|34|CP020026|CRISPRCasFinder,CRT,PILER-CR matches to NC_011879 (Pseudarthrobacter chlorophenolicus A6 plasmid pACHL01, complete sequence) position: , mismatch: 10, identity: 0.706
gcgccattgccaacaacaagcgcggcgcggtctt CRISPR spacer
tggccattgccaacaacaagcacagcaagaccgc Protospacer
*******************.*.**. *..* .
963. spacer 2.11|380548|33|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032532 (Bacillus megaterium NCT-2 plasmid pNCT2_4, complete sequence) position: , mismatch: 10, identity: 0.697
caaaacacagcaagatattcacattaggtgcta CRISPR spacer
ataaagatagcaagatattcacattaatttaat Protospacer
*** *.******************. *
964. spacer 4.17|1868525|33|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to MF805809 (Escherichia phage vB_EcoM_PHB05, complete genome) position: , mismatch: 10, identity: 0.697
ggcgctcccgccccaggctctaccaactgagct CRISPR spacer
gagttaaaagccccttgctctaccaactgagct Protospacer
*. . ***** *****************
965. spacer 4.29|1869370|34|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010837 (Sphingomonas hengshuiensis strain WHSC-8 isolate soil of Hengshui Lake plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
ccgcgacgggggcacagctagccgcgcttgagac CRISPR spacer
aggatttgggggcacagcttgccgcgctggatgc Protospacer
* .************ ******** ** .*
966. spacer 5.1|3093744|32|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NC_012523 (Rhodococcus opacus B4 plasmid pKNR, complete sequence) position: , mismatch: 10, identity: 0.688
cattcacgatctccacggccttcgccagtcgc CRISPR spacer
cgccttcgaacaccacggccttcgccagtgcg Protospacer
*.... *** * *****************
967. spacer 5.1|3093744|32|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.688
cattcacgatctccacggccttcgccagtcgc CRISPR spacer
agacaatgatctcgtcggccttcgccagtcct Protospacer
. . *.****** *************** .
968. spacer 5.3|3093866|32|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to KY945355 (Mycobacterium phage Shandong1, complete genome) position: , mismatch: 10, identity: 0.688
tcggcgcacgcacaggcgcacgcgctgttgaa CRISPR spacer
atcacgcacgaactggcgcacgcgctggtcgg Protospacer
. .****** ** ************* * ..
969. spacer 5.4|3093927|32|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014169 (Sphingomonas panacis strain DCY99 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cgatggcgcgcgcggctatccgcgcagcgatc CRISPR spacer
gctcggcgcgcggggctatctgcgcagcttcg Protospacer
.******** *******.******* .
970. spacer 5.8|3094172|32|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 10, identity: 0.688
cgtttgcggctgcatggccacgatgcgcaaca CRISPR spacer
accctgcggctgcttggccgcgatgcggaggc Protospacer
..********* *****.******* *.
971. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP049157 (Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence) position: , mismatch: 10, identity: 0.688
gcagcgagctggtcggccaccgccttgtgctg CRISPR spacer
cgctcgggatggtcggccaccgccttgcggaa Protospacer
**.* ******************.* .
972. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP049317 (Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence) position: , mismatch: 10, identity: 0.688
gcagcgagctggtcggccaccgccttgtgctg CRISPR spacer
cgctcgggatggtcggccaccgccttgcggaa Protospacer
**.* ******************.* .
973. spacer 5.10|3094295|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688
gcagcgagctggtcggccaccgccttgtgctg CRISPR spacer
ttggtgagctggccgaccaccgccttgtcggt Protospacer
..*.*******.**.************
974. spacer 5.14|3094540|33|CP020026|CRISPRCasFinder,CRT matches to NZ_CP025613 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697
tatggttatccacgccgctgctgcgcagcctcc CRISPR spacer
tcaaccggtccacgccgctgctgcgctacctct Protospacer
* . . .****************** .****.
975. spacer 5.16|3094664|33|CP020026|CRISPRCasFinder,CRT matches to NZ_CP025810 (Sulfitobacter sp. SK025 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.697
cctcccagcgctgctggatgccttgccacaggc CRISPR spacer
gacagaagcgctgccggatgccttgccgcaagg Protospacer
. ********.************.**.*
976. spacer 5.19|3094850|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP039632 (Pseudomonas veronii strain Pvy plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
gtgtagcgcatgcccagataggcatcgatctc CRISPR spacer
gccggtgacatgcccaggtagccatcgatctt Protospacer
*. . .*********.*** *********.
977. spacer 5.19|3094850|32|CP020026|CRISPRCasFinder,CRT matches to NZ_AP015030 (Pseudomonas putida strain KF715 plasmid pKF715A, complete sequence) position: , mismatch: 10, identity: 0.688
gtgtagcgcatgcccagataggcatcgatctc CRISPR spacer
gccggtgacatgcccaggtagccatcgatctt Protospacer
*. . .*********.*** *********.
978. spacer 5.21|3094972|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP016453 (Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence) position: , mismatch: 10, identity: 0.688
tcgcctcggttgatcagcgggcgcgcgccctt CRISPR spacer
gcatagcggttgatcagggggcgcgctccggc Protospacer
*.. *********** ******** ** .
979. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP032687 (Rhizobium sp. CCGE531 plasmid pRCCGE531b, complete sequence) position: , mismatch: 10, identity: 0.688
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
cgatcggggcggcggtcgaggcgagcaaatcc Protospacer
******* ****** ******** .* .
980. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP043475 (Mycobacterium grossiae strain DSM 104744 plasmid pGP01, complete sequence) position: , mismatch: 10, identity: 0.688
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gccgcgccgcggcgtttgaggcgctggccaca Protospacer
** *********.********** *...
981. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP043475 (Mycobacterium grossiae strain DSM 104744 plasmid pGP01, complete sequence) position: , mismatch: 10, identity: 0.688
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gccgcgccgcggcgtttgaggcgctggccaca Protospacer
** *********.********** *...
982. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP032692 (Rhizobium sp. CCGE532 plasmid pRCCGE532b, complete sequence) position: , mismatch: 10, identity: 0.688
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
cgatcggggcggcggtcgaggcgagcaaatcc Protospacer
******* ****** ******** .* .
983. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaagcgctgcagaac Protospacer
******* ********.****** * .
984. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NC_020061 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899b, complete sequence) position: , mismatch: 10, identity: 0.688
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
cgatcggggcggcggtcgaggcgagcaaatcc Protospacer
******* ****** ******** .* .
985. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NC_014811 (Mycolicibacterium gilvum Spyr1 plasmid pMSPYR101, complete sequence) position: , mismatch: 10, identity: 0.688
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tagtcggcgcggcgttcgtggccctgcgccgc Protospacer
...*************** *** *** .*
986. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP032696 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525b, complete sequence) position: , mismatch: 10, identity: 0.688
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
cgatcggggcggcggtcgaggcgagcaattgc Protospacer
******* ****** ******** .*.
987. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP016453 (Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence) position: , mismatch: 10, identity: 0.688
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
acatcggcgcggcgatcgacgcgctacgcaaa Protospacer
************ **** *****. .*. .
988. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP032687 (Rhizobium sp. CCGE531 plasmid pRCCGE531b, complete sequence) position: , mismatch: 10, identity: 0.688
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
cgatcggggcggcggtcgaggcgagcaaatcc Protospacer
******* ****** ******** .* .
989. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP043475 (Mycobacterium grossiae strain DSM 104744 plasmid pGP01, complete sequence) position: , mismatch: 10, identity: 0.688
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gccgcgccgcggcgtttgaggcgctggccaca Protospacer
** *********.********** *...
990. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP043475 (Mycobacterium grossiae strain DSM 104744 plasmid pGP01, complete sequence) position: , mismatch: 10, identity: 0.688
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gccgcgccgcggcgtttgaggcgctggccaca Protospacer
** *********.********** *...
991. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP032692 (Rhizobium sp. CCGE532 plasmid pRCCGE532b, complete sequence) position: , mismatch: 10, identity: 0.688
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
cgatcggggcggcggtcgaggcgagcaaatcc Protospacer
******* ****** ******** .* .
992. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gcttcggcgccgcgttcgaagcgctgcagaac Protospacer
******* ********.****** * .
993. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NC_020061 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899b, complete sequence) position: , mismatch: 10, identity: 0.688
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
cgatcggggcggcggtcgaggcgagcaaatcc Protospacer
******* ****** ******** .* .
994. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NC_014811 (Mycolicibacterium gilvum Spyr1 plasmid pMSPYR101, complete sequence) position: , mismatch: 10, identity: 0.688
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
tagtcggcgcggcgttcgtggccctgcgccgc Protospacer
...*************** *** *** .*
995. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP032696 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525b, complete sequence) position: , mismatch: 10, identity: 0.688
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
cgatcggggcggcggtcgaggcgagcaattgc Protospacer
******* ****** ******** .*.
996. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP016453 (Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence) position: , mismatch: 10, identity: 0.688
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
acatcggcgcggcgatcgacgcgctacgcaaa Protospacer
************ **** *****. .*. .
997. spacer 5.40|3096135|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP012699 (Microbacterium sp. No. 7 plasmid B, complete sequence) position: , mismatch: 10, identity: 0.688
tcgatcggccgcgccgggcgctcgacgcccaa CRISPR spacer
gcgatcgtccgcgcggggcgctcgatcgtggt Protospacer
****** ****** **********. . .
998. spacer 5.40|3096135|32|CP020026|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.688
tcgatcggccgcgccgggcgctcgacgcccaa CRISPR spacer
aggctcggcggcgccgggcgttcgacggtgcc Protospacer
* ***** **********.****** .
999. spacer 5.41|3096196|33|CP020026|CRISPRCasFinder,CRT matches to NC_022043 (Paracoccus aminophilus JCM 7686 plasmid pAMI5, complete sequence) position: , mismatch: 10, identity: 0.697
cagcgcgctttttgccgtgctgctggcaacaac CRISPR spacer
tggcacgcttttcgccgtgctgctggtgctgtc Protospacer
..**.*******.*************.. .. *
1000. spacer 5.42|3096258|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP015095 (Pelagibaca abyssi strain JLT2014 plasmid pPABY4, complete sequence) position: , mismatch: 10, identity: 0.688
ctgctgggcacgctcgacggacccgttgataa CRISPR spacer
gcgctcggcacgctcgacggatccgaggtcgc Protospacer
.*** ***************.*** * ..
1001. spacer 5.44|3096380|32|CP020026|CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 10, identity: 0.688
ttggcgatgagcgccacggtcttggcggtctc CRISPR spacer
ggctcagaaagcgccacgttcttggcggtttc Protospacer
*.. .********* **********.**
1002. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP009414 (Salmonella enterica strain CFSAN007428 isolate N11150 plasmid pCFSAN007428_01, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1003. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_KX815983 (Salmonella enterica subsp. enterica serovar Dublin strain N13-01125 plasmid pN13-01125, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1004. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP035548 (Salmonella enterica subsp. enterica serovar Typhimurium strain YU07-18 plasmid pYU07-18_IncA/C2, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1005. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP009411 (Salmonella enterica strain CFSAN007425 isolate 22697 plasmid pCFSAN007425_01, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1006. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP009413 (Salmonella enterica strain CFSAN007427 isolate N20272 plasmid pCFSAN007427_01, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1007. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_KJ588780 (Achromobacter xylosoxidans strain A22732 plasmid pA22732-IMP, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1008. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_KJ909290 (Aeromonas salmonicida subsp. salmonicida strain 2004-05MF26 plasmid pSN254b, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1009. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_KP688397 (Vibrio parahaemolyticus strain V36 plasmid pVPH1, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1010. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_KR559888 (Klebsiella pneumoniae strain Kpn642 plasmid pKP-Gr642, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1011. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP032391 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 plasmid p34981_1, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1012. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP049911 (Diaphorobacter sp. HDW4A plasmid p_unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1013. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP017987 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1014. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP045742 (Escherichia coli strain DH5alpha plasmid pTHNK130-1, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1015. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP010373 (Escherichia coli strain 6409 plasmid p6409-202.186kb, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1016. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP048305 (Escherichia coli strain 9 plasmid p009_A, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1017. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP025240 (Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1928 plasmid pSNE3-1928, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1018. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP025242 (Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1929 plasmid pSNE1-1929, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1019. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP024192 (Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1020. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_LS992184 (Citrobacter freundii isolate Citrobacter freundii str. U2785 plasmid 2, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1021. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP018716 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-2, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1022. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP018722 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-2, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1023. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP018704 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-2, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1024. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP029249 (Salmonella enterica subsp. enterica serovar Thompson strain HFCDC-SM-846 plasmid p846, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1025. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_AP022377 (Providencia stuartii strain BML2537 plasmid pBML2537, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1026. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP012682 (Salmonella enterica subsp. enterica serovar Typhimurium strain 33676 plasmid p33676_IncA/C, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1027. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP032385 (Salmonella enterica subsp. enterica serovar Dublin strain CVM N53043 plasmid pN53043_1, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1028. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP014978 (Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1896 isolate ST03-F34 plasmid pSTY1-1896, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1029. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP031564 (Klebsiella pneumoniae strain 2-1 plasmid pKP21AC2, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1030. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP032397 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 plasmid p22429, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1031. spacer 5.47|3095093|33|CP020026|PILER-CR matches to MN254970 (Escherichia coli strain EC009 plasmid pEC009.1, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1032. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP014658 (Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1736 plasmid pSAN1-1736, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1033. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP043190 (Escherichia coli O16:H48 strain PG20180175 plasmid pPG20180175.1-IncAC2, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1034. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP044142 (Escherichia coli O157 strain AR-0429 plasmid pAR-0429-1, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1035. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP025231 (Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1924 plasmid pSNE1-1924, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1036. spacer 5.47|3095093|33|CP020026|PILER-CR matches to MF495478 (Aeromonas salmonicida plasmid pS121-1b, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1037. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP038330 (Escherichia coli O157:H7 strain NE 1092-2 plasmid pNE1092-3, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1038. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP043215 (Salmonella enterica subsp. enterica serovar Heidelberg strain SL-312 plasmid pET8.1-IncAC2, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1039. spacer 5.47|3095093|33|CP020026|PILER-CR matches to KU160531 (Vibrio alginolyticus strain VAS3-1 plasmid pVAS3-1, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1040. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP028562 (Aeromonas hydrophila subsp. hydrophila strain WCHAH045096 plasmid p1_045096, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1041. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP009560 (Salmonella enterica subsp. enterica serovar Newport str. CVM 22425 plasmid pCVM22425, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1042. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP033574 (Shewanella algae strain KC-Na-R1 plasmid pKC-Na-R1, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1043. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NC_022372 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid pYT3 DNA, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1044. spacer 5.47|3095093|33|CP020026|PILER-CR matches to KU238092 (Uncultured bacterium plasmid pDTC28, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1045. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP009562 (Salmonella enterica subsp. enterica serovar Newport str. CVM 22513 plasmid pCVM22513, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1046. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP038464 (Aeromonas hydrophila strain WCX23 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1047. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NC_009140 (Salmonella enterica subsp. enterica serovar Newport str. SL254 plasmid pSN254, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1048. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP038466 (Aeromonas hydrophila strain 23-C-23 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1049. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP028563 (Aeromonas hydrophila subsp. hydrophila strain WCHAH045096 plasmid p2_045096, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1050. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NC_017645 (Escherichia coli UMNK88 plasmid pUMNK88, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1051. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP009567 (Salmonella enterica subsp. enterica serovar Newport str. CVM 22462 plasmid pCFSAN000934_02, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1052. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP007636 (Vibrio cholerae strain 2012EL-2176 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1053. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_AP022566 (Mycolicibacterium alvei strain JCM 12272 plasmid pJCM12272, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
cacaccggcgcggcgttcgaggctcaggaaaga Protospacer
*.****************** * *** . .
1054. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NC_012690 (Escherichia coli plasmid peH4H, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1055. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP041052 (Enterobacter hormaechei strain C126 plasmid pEnC126NDM, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1056. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP032238 (Escherichia coli strain ECCWS199 plasmid pTB221, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1057. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP024557 (Klebsiella pneumoniae strain INF164 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1058. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP041172 (Salmonella enterica subsp. enterica serovar Thompson strain SH11G0791 plasmid pSH11G0791, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1059. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP024529 (Klebsiella pneumoniae strain INF157 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1060. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP032491 (Salmonella enterica subsp. enterica serovar Typhimurium strain SL26 plasmid pSL26_IncA/C2, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1061. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP032496 (Salmonella enterica subsp. enterica serovar Typhimurium strain SO21 plasmid pSO21_IncA/C2, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1062. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP024522 (Klebsiella pneumoniae strain INF158 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1063. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP015139 (Escherichia coli strain Ecol_732 plasmid pEC732_IMP14, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1064. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NC_019066 (Escherichia coli plasmid pAPEC1990_61, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1065. spacer 5.47|3095093|33|CP020026|PILER-CR matches to CP028804 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1066. spacer 5.47|3095093|33|CP020026|PILER-CR matches to KY014465 (Vibrio parahaemolyticus plasmid pVPS114, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1067. spacer 5.47|3095093|33|CP020026|PILER-CR matches to KY014466 (Vibrio vulnificus plasmid pVVS1-per1, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1068. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP025275 (Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1923 plasmid pSNE2-1923) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1069. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP027670 (Simplicispira suum strain SC1-8 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1070. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP038450 (Aeromonas media strain R50-22 plasmid pAeme6, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1071. spacer 5.47|3095093|33|CP020026|PILER-CR matches to CP028419 (Aeromonas hydrophila strain WCX23 plasmid pWCX23_1, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1072. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP024550 (Klebsiella pneumoniae strain INF163 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1073. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP018318 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-2, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1074. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP025236 (Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1926 plasmid pSNE2-1926, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1075. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP013115 (Shewanella xiamenensis strain T17 plasmid pSx1, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1076. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP009570 (Salmonella enterica subsp. enterica serovar Newport str. CVM N1543 isolate CFSAN000926 plasmid pCVMN1543, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1077. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP009564 (Salmonella enterica subsp. enterica serovar Newport str. CVM 21550 plasmid pCVM21550, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1078. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP009563 (Salmonella enterica subsp. enterica serovar Newport str. CVM 21538 plasmid pCVM21538, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1079. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP041209 (Salmonella enterica subsp. enterica serovar Newport strain SAP18-8729 plasmid pCFSAN074384_1, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1080. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NC_019906 (Pseudomonas putida HB3267 plasmid pPC9, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1081. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP018689 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-2, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1082. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NC_019116 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH163_135, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1083. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NC_019118 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH696_135, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1084. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NC_019121 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH111_166, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1085. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NC_012692 (Escherichia coli plasmid pAR060302, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1086. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NC_012693 (Salmonella enterica plasmid pAM04528, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1087. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP024564 (Klebsiella pneumoniae strain INF278 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1088. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NC_019380 (Aeromonas hydrophila plasmid pR148, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1089. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP046032 (Salmonella sp. HNK130 plasmid pTHNK130-2, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1090. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP046034 (Salmonella sp. HNK130 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1091. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP032395 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 22453 plasmid p22453_1, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1092. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NC_023898 (Klebsiella pneumoniae plasmid pRMH760, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1093. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP022170 (Aeromonas salmonicida strain S121 plasmid pS121-1a, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1094. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP031297 (Escherichia coli strain EC17GD31 plasmid pGD31-NDM, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1095. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP050740 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST56 plasmid pST56-1, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1096. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP018698 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-2, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1097. spacer 5.47|3095093|33|CP020026|PILER-CR matches to MN604267 (Salmonella enterica subsp. enterica serovar London strain SAL-19-0623 plasmid pSAL-19-0623_NDM, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1098. spacer 5.47|3095093|33|CP020026|PILER-CR matches to MN604268 (Escherichia coli strain J53 plasmid pJ53_SAL-19-0623_NDM, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1099. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP018710 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-2, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1100. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NC_024998 (Acidovorax avenae subsp. avenae plasmid pAAA83 DNA, complete sequence, strain: 83) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1101. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP032380 (Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69807 plasmid pSDU1-USMARC-69807, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1102. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP032448 (Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69840 plasmid pSDU2-USMARC-69840, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1103. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_MH105050 (Salmonella enterica subsp. enterica serovar Lomita strain SL131 plasmid pSL131_IncA/C-IncX3, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1104. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_MK205418 (Salmonella enterica subsp. enterica serovar Dublin strain 14-1360 plasmid p14-1360-1, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1105. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_MK205416 (Salmonella enterica subsp. enterica serovar Dublin strain N13-01070 plasmid pN13-01070-1, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1106. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_MK757441 (Alcaligenes faecalis strain AN70 plasmid pAN70-1, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1107. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP009410 (Salmonella enterica strain CFSAN007405 isolate 30034 plasmid pCFSAN007405_01, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1108. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_MF344573 (Klebsiella pneumoniae strain N201205880 plasmid p205880-Ct1/2, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1109. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_MH113855 (Vibrio alginolyticus strain Vb1796 plasmid pVb1796, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1110. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_MH457126 (Vibrio alginolyticus strain Vb1394 plasmid pC1394, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1111. spacer 5.47|3095093|33|CP020026|PILER-CR matches to MT219816 (Escherichia coli strain RF173-1 plasmid pRF173-1_87k_tetX, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1112. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_MF582638 (Klebsiella pneumoniae strain KKp4 plasmid pKKp4-VIM, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1113. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_LC507075 (Providencia rettgeri strain BML2526 plasmid p.BML2526, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1114. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_LN809998 (Pseudomonas aeruginosa strain MH19 plasmid pPAMH19, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1115. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_MF627445 (Vibrio parahaemolyticus strain Vb0499 plasmid pVb0499, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1116. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NC_019105 (Salmonella enterica subsp. enterica serovar Dublin plasmid pSD_88, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1117. spacer 5.47|3095093|33|CP020026|PILER-CR matches to NZ_CP020913 (Salmonella enterica subsp. enterica serovar Montevideo str. CDC 2010K-0257 plasmid pSMO-2010K-0257, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1118. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP009414 (Salmonella enterica strain CFSAN007428 isolate N11150 plasmid pCFSAN007428_01, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1119. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_KX815983 (Salmonella enterica subsp. enterica serovar Dublin strain N13-01125 plasmid pN13-01125, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1120. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP035548 (Salmonella enterica subsp. enterica serovar Typhimurium strain YU07-18 plasmid pYU07-18_IncA/C2, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1121. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP009411 (Salmonella enterica strain CFSAN007425 isolate 22697 plasmid pCFSAN007425_01, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1122. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP009413 (Salmonella enterica strain CFSAN007427 isolate N20272 plasmid pCFSAN007427_01, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1123. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_KJ588780 (Achromobacter xylosoxidans strain A22732 plasmid pA22732-IMP, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1124. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_KJ909290 (Aeromonas salmonicida subsp. salmonicida strain 2004-05MF26 plasmid pSN254b, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1125. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_KP688397 (Vibrio parahaemolyticus strain V36 plasmid pVPH1, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1126. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_KR559888 (Klebsiella pneumoniae strain Kpn642 plasmid pKP-Gr642, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1127. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP032391 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 plasmid p34981_1, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1128. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP049911 (Diaphorobacter sp. HDW4A plasmid p_unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1129. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP017987 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1130. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP045742 (Escherichia coli strain DH5alpha plasmid pTHNK130-1, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1131. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP010373 (Escherichia coli strain 6409 plasmid p6409-202.186kb, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1132. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP048305 (Escherichia coli strain 9 plasmid p009_A, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1133. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP025240 (Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1928 plasmid pSNE3-1928, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1134. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP025242 (Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1929 plasmid pSNE1-1929, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1135. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP024192 (Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1136. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_LS992184 (Citrobacter freundii isolate Citrobacter freundii str. U2785 plasmid 2, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1137. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP018716 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-2, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1138. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP018722 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-2, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1139. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP018704 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-2, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1140. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP029249 (Salmonella enterica subsp. enterica serovar Thompson strain HFCDC-SM-846 plasmid p846, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1141. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_AP022377 (Providencia stuartii strain BML2537 plasmid pBML2537, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1142. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP012682 (Salmonella enterica subsp. enterica serovar Typhimurium strain 33676 plasmid p33676_IncA/C, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1143. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP032385 (Salmonella enterica subsp. enterica serovar Dublin strain CVM N53043 plasmid pN53043_1, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1144. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP014978 (Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1896 isolate ST03-F34 plasmid pSTY1-1896, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1145. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP031564 (Klebsiella pneumoniae strain 2-1 plasmid pKP21AC2, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1146. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP032397 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 plasmid p22429, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1147. spacer 5.48|3095154|33|CP020026|PILER-CR matches to MN254970 (Escherichia coli strain EC009 plasmid pEC009.1, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1148. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP014658 (Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1736 plasmid pSAN1-1736, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1149. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP043190 (Escherichia coli O16:H48 strain PG20180175 plasmid pPG20180175.1-IncAC2, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1150. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP044142 (Escherichia coli O157 strain AR-0429 plasmid pAR-0429-1, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1151. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP025231 (Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1924 plasmid pSNE1-1924, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1152. spacer 5.48|3095154|33|CP020026|PILER-CR matches to MF495478 (Aeromonas salmonicida plasmid pS121-1b, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1153. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP038330 (Escherichia coli O157:H7 strain NE 1092-2 plasmid pNE1092-3, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1154. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP043215 (Salmonella enterica subsp. enterica serovar Heidelberg strain SL-312 plasmid pET8.1-IncAC2, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1155. spacer 5.48|3095154|33|CP020026|PILER-CR matches to KU160531 (Vibrio alginolyticus strain VAS3-1 plasmid pVAS3-1, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1156. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP028562 (Aeromonas hydrophila subsp. hydrophila strain WCHAH045096 plasmid p1_045096, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1157. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP009560 (Salmonella enterica subsp. enterica serovar Newport str. CVM 22425 plasmid pCVM22425, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1158. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP033574 (Shewanella algae strain KC-Na-R1 plasmid pKC-Na-R1, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1159. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NC_022372 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid pYT3 DNA, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1160. spacer 5.48|3095154|33|CP020026|PILER-CR matches to KU238092 (Uncultured bacterium plasmid pDTC28, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1161. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP009562 (Salmonella enterica subsp. enterica serovar Newport str. CVM 22513 plasmid pCVM22513, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1162. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP038464 (Aeromonas hydrophila strain WCX23 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1163. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NC_009140 (Salmonella enterica subsp. enterica serovar Newport str. SL254 plasmid pSN254, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1164. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP038466 (Aeromonas hydrophila strain 23-C-23 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1165. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP028563 (Aeromonas hydrophila subsp. hydrophila strain WCHAH045096 plasmid p2_045096, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1166. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NC_017645 (Escherichia coli UMNK88 plasmid pUMNK88, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1167. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP009567 (Salmonella enterica subsp. enterica serovar Newport str. CVM 22462 plasmid pCFSAN000934_02, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1168. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP007636 (Vibrio cholerae strain 2012EL-2176 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1169. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_AP022566 (Mycolicibacterium alvei strain JCM 12272 plasmid pJCM12272, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
cacaccggcgcggcgttcgaggctcaggaaaga Protospacer
*.****************** * *** . .
1170. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NC_012690 (Escherichia coli plasmid peH4H, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1171. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP041052 (Enterobacter hormaechei strain C126 plasmid pEnC126NDM, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1172. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP032238 (Escherichia coli strain ECCWS199 plasmid pTB221, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1173. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP024557 (Klebsiella pneumoniae strain INF164 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1174. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP041172 (Salmonella enterica subsp. enterica serovar Thompson strain SH11G0791 plasmid pSH11G0791, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1175. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP024529 (Klebsiella pneumoniae strain INF157 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1176. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP032491 (Salmonella enterica subsp. enterica serovar Typhimurium strain SL26 plasmid pSL26_IncA/C2, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1177. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP032496 (Salmonella enterica subsp. enterica serovar Typhimurium strain SO21 plasmid pSO21_IncA/C2, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1178. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP024522 (Klebsiella pneumoniae strain INF158 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1179. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP015139 (Escherichia coli strain Ecol_732 plasmid pEC732_IMP14, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1180. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NC_019066 (Escherichia coli plasmid pAPEC1990_61, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1181. spacer 5.48|3095154|33|CP020026|PILER-CR matches to CP028804 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pCMY2_085072, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1182. spacer 5.48|3095154|33|CP020026|PILER-CR matches to KY014465 (Vibrio parahaemolyticus plasmid pVPS114, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1183. spacer 5.48|3095154|33|CP020026|PILER-CR matches to KY014466 (Vibrio vulnificus plasmid pVVS1-per1, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1184. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP025275 (Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1923 plasmid pSNE2-1923) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1185. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP027670 (Simplicispira suum strain SC1-8 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1186. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP038450 (Aeromonas media strain R50-22 plasmid pAeme6, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1187. spacer 5.48|3095154|33|CP020026|PILER-CR matches to CP028419 (Aeromonas hydrophila strain WCX23 plasmid pWCX23_1, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1188. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP024550 (Klebsiella pneumoniae strain INF163 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1189. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP018318 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-2, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1190. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP025236 (Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1926 plasmid pSNE2-1926, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1191. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP013115 (Shewanella xiamenensis strain T17 plasmid pSx1, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1192. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP009570 (Salmonella enterica subsp. enterica serovar Newport str. CVM N1543 isolate CFSAN000926 plasmid pCVMN1543, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1193. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP009564 (Salmonella enterica subsp. enterica serovar Newport str. CVM 21550 plasmid pCVM21550, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1194. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP009563 (Salmonella enterica subsp. enterica serovar Newport str. CVM 21538 plasmid pCVM21538, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1195. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP041209 (Salmonella enterica subsp. enterica serovar Newport strain SAP18-8729 plasmid pCFSAN074384_1, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1196. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NC_019906 (Pseudomonas putida HB3267 plasmid pPC9, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1197. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP018689 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-2, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1198. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NC_019116 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH163_135, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1199. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NC_019118 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH696_135, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1200. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NC_019121 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH111_166, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1201. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NC_012692 (Escherichia coli plasmid pAR060302, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1202. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NC_012693 (Salmonella enterica plasmid pAM04528, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1203. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP024564 (Klebsiella pneumoniae strain INF278 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1204. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NC_019380 (Aeromonas hydrophila plasmid pR148, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1205. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP046032 (Salmonella sp. HNK130 plasmid pTHNK130-2, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1206. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP046034 (Salmonella sp. HNK130 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1207. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP032395 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 22453 plasmid p22453_1, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1208. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NC_023898 (Klebsiella pneumoniae plasmid pRMH760, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1209. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP022170 (Aeromonas salmonicida strain S121 plasmid pS121-1a, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1210. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP031297 (Escherichia coli strain EC17GD31 plasmid pGD31-NDM, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1211. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP050740 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST56 plasmid pST56-1, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1212. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP018698 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-2, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1213. spacer 5.48|3095154|33|CP020026|PILER-CR matches to MN604267 (Salmonella enterica subsp. enterica serovar London strain SAL-19-0623 plasmid pSAL-19-0623_NDM, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1214. spacer 5.48|3095154|33|CP020026|PILER-CR matches to MN604268 (Escherichia coli strain J53 plasmid pJ53_SAL-19-0623_NDM, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1215. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP018710 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-2, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1216. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NC_024998 (Acidovorax avenae subsp. avenae plasmid pAAA83 DNA, complete sequence, strain: 83) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1217. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP032380 (Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69807 plasmid pSDU1-USMARC-69807, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1218. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP032448 (Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69840 plasmid pSDU2-USMARC-69840, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1219. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_MH105050 (Salmonella enterica subsp. enterica serovar Lomita strain SL131 plasmid pSL131_IncA/C-IncX3, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1220. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_MK205418 (Salmonella enterica subsp. enterica serovar Dublin strain 14-1360 plasmid p14-1360-1, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1221. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_MK205416 (Salmonella enterica subsp. enterica serovar Dublin strain N13-01070 plasmid pN13-01070-1, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1222. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_MK757441 (Alcaligenes faecalis strain AN70 plasmid pAN70-1, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1223. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP009410 (Salmonella enterica strain CFSAN007405 isolate 30034 plasmid pCFSAN007405_01, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1224. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_MF344573 (Klebsiella pneumoniae strain N201205880 plasmid p205880-Ct1/2, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1225. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_MH113855 (Vibrio alginolyticus strain Vb1796 plasmid pVb1796, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1226. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_MH457126 (Vibrio alginolyticus strain Vb1394 plasmid pC1394, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1227. spacer 5.48|3095154|33|CP020026|PILER-CR matches to MT219816 (Escherichia coli strain RF173-1 plasmid pRF173-1_87k_tetX, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1228. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_MF582638 (Klebsiella pneumoniae strain KKp4 plasmid pKKp4-VIM, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1229. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_LC507075 (Providencia rettgeri strain BML2526 plasmid p.BML2526, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1230. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_LN809998 (Pseudomonas aeruginosa strain MH19 plasmid pPAMH19, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1231. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_MF627445 (Vibrio parahaemolyticus strain Vb0499 plasmid pVb0499, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1232. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NC_019105 (Salmonella enterica subsp. enterica serovar Dublin plasmid pSD_88, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1233. spacer 5.48|3095154|33|CP020026|PILER-CR matches to NZ_CP020913 (Salmonella enterica subsp. enterica serovar Montevideo str. CDC 2010K-0257 plasmid pSMO-2010K-0257, complete sequence) position: , mismatch: 10, identity: 0.697
gcgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
ttcatcggcgcggcgttggtggcgctgtttttc Protospacer
. ************** * ******* . *
1234. spacer 5.53|3095460|32|CP020026|PILER-CR matches to NZ_LR134469 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 27, complete sequence) position: , mismatch: 10, identity: 0.688
gacttcggcatggaggctgagcgcgccgacca CRISPR spacer
cgggacggcatcgaggccgagcgcgccgcctg Protospacer
. ****** *****.********** *..
1235. spacer 5.65|3096195|34|CP020026|PILER-CR matches to NZ_CP054607 (Sulfitobacter pseudonitzschiae strain H46 plasmid unnamed8, complete sequence) position: , mismatch: 10, identity: 0.706
gcagcgcgctttttgccgtgctgctggcaacaac CRISPR spacer
ccagcgcgctttgcgccgtgctgctgaatgagcc Protospacer
*********** .************. . . *
1236. spacer 5.65|3096195|34|CP020026|PILER-CR matches to NZ_CP045408 (Roseovarius sp. THAF9 plasmid pTHAF9_d, complete sequence) position: , mismatch: 10, identity: 0.706
gcagcgcgctttttgccgtgctgctggcaacaac CRISPR spacer
ccagcgcgctttgcgccgtgctgctgaatgagcc Protospacer
*********** .************. . . *
1237. spacer 5.68|3096379|33|CP020026|PILER-CR matches to NZ_CP046574 (Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence) position: , mismatch: 10, identity: 0.697
gttggcgatgagcgccacggtcttggcggtctc CRISPR spacer
tccgccggtgatcgccacggtcttggcggcggt Protospacer
..* **.*** *****************. .
1238. spacer 5.23|3095094|32|CP020026|CRISPRCasFinder,CRT matches to NC_009341 (Mycolicibacterium gilvum PYR-GCK plasmid pMFLV03, complete sequence) position: , mismatch: 11, identity: 0.656
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gccgcgccgcggcgtttgaggcgctggcgaca Protospacer
** *********.********** ...
1239. spacer 5.24|3095155|32|CP020026|CRISPRCasFinder,CRT matches to NC_009341 (Mycolicibacterium gilvum PYR-GCK plasmid pMFLV03, complete sequence) position: , mismatch: 11, identity: 0.656
cgatcggcgcggcgttcgaggcgctggacgtg CRISPR spacer
gccgcgccgcggcgtttgaggcgctggcgaca Protospacer
** *********.********** ...
1240. spacer 5.64|3096134|33|CP020026|PILER-CR matches to NZ_CP012699 (Microbacterium sp. No. 7 plasmid B, complete sequence) position: , mismatch: 11, identity: 0.667
gtcgatcggccgcgccgggcgctcgacgcccaa CRISPR spacer
cgcgatcgtccgcgcggggcgctcgatcgtggt Protospacer
****** ****** **********. . .
1241. spacer 5.65|3096195|34|CP020026|PILER-CR matches to NC_022043 (Paracoccus aminophilus JCM 7686 plasmid pAMI5, complete sequence) position: , mismatch: 11, identity: 0.676
gcagcgcgctttttgccgtgctgctggcaacaac CRISPR spacer
ttggcacgcttttcgccgtgctgctggtgctgtc Protospacer
..**.*******.*************.. .. *
1242. spacer 4.15|1868382|35|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to MN692948 (Marine virus AFVG_117M19, complete genome) position: , mismatch: 12, identity: 0.657
tccttcttcgttgtcaatctctacgacttcggtgt CRISPR spacer
aaggccttcgttgttaacctctacgacttcaacac Protospacer
.*********.**.************.....
1243. spacer 4.35|1869793|34|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 12, identity: 0.647
agctgcgcgcgggtgaggtcaacgcgaaagcgcg CRISPR spacer
ttctgcgcgcgggtgacgtcaaggcgcggcgaaa Protospacer
************** ***** *** .. . .
1244. spacer 4.35|1869793|34|CP020026|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 12, identity: 0.647
agctgcgcgcgggtgaggtcaacgcgaaagcgcg CRISPR spacer
ttctgcgcgcgggtgacgtcaaggcgcggcgaaa Protospacer
************** ***** *** .. . .
