Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP024146 Escherichia coli strain 14EC029 plasmid p14EC029e, complete sequence 0 crisprs NA 0 0 1 0
CP024145 Escherichia coli strain 14EC029 plasmid p14EC029d, complete sequence 0 crisprs RT,DEDDh 0 0 0 0
CP024142 Escherichia coli strain 14EC029 plasmid p14EC029a, complete sequence 0 crisprs c2c9_V-U4 0 0 1 0
CP024143 Escherichia coli strain 14EC029 plasmid p14EC029b, complete sequence 0 crisprs csa3 0 0 1 0
CP024141 Escherichia coli strain 14EC029 chromosome, complete genome 12 crisprs cas3,RT,csa3,PD-DExK,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,DEDDh,DinG,c2c9_V-U4 0 14 11 0
CP024144 Escherichia coli strain 14EC029 plasmid p14EC029c, complete sequence 0 crisprs csa3 0 0 1 0

Results visualization

1. CP024142
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2118 : 33528 34 Saccharomonospora_phage(16.67%) transposase,integrase attL 3207:3221|attR 35492:35506
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP024146
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 79296 : 88228 10 Stx2-converting_phage(44.44%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. CP024141
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP024141_1 661154-661271 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP024141_2 1053284-1053800 Orphan I-E
8 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP024141_3 1080848-1081241 TypeI-E I-E
6 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP024141_4 1629791-1629932 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP024141_5 1856242-1856377 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP024141_6 2305030-2305153 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP024141_8 3362723-3362867 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP024141_9 3859616-3859712 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP024141_10 3874842-3874995 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP024141_11 4084713-4084828 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP024141_12 4107741-4107873 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP024141_13 4353233-4353382 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP024141_7 7.1|3063456|40|CP024141|CRISPRCasFinder 3063456-3063495 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 0 1.0
CP024141_12 12.1|4107758|42|CP024141|PILER-CR 4107758-4107799 42 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141085-141126 0 1.0
CP024141_12 12.2|4107817|40|CP024141|PILER-CR 4107817-4107856 40 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141028-141067 1 0.975
CP024141_6 6.1|2305073|38|CP024141|CRISPRCasFinder 2305073-2305110 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
CP024141_3 3.11|1081181|33|CP024141|CRT 1081181-1081213 33 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 246936-246968 3 0.909
CP024141_10 10.1|3874895|48|CP024141|CRISPRCasFinder 3874895-3874942 48 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4089-4136 3 0.938
CP024141_10 10.1|3874895|48|CP024141|CRISPRCasFinder 3874895-3874942 48 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4088-4135 3 0.938
CP024141_10 10.1|3874895|48|CP024141|CRISPRCasFinder 3874895-3874942 48 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4088-4135 3 0.938
CP024141_10 10.1|3874895|48|CP024141|CRISPRCasFinder 3874895-3874942 48 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4088-4135 3 0.938
CP024141_5 5.1|1856282|56|CP024141|CRISPRCasFinder 1856282-1856337 56 MT230312 Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence 104-159 4 0.929
CP024141_2 2.7|1053679|32|CP024141|PILER-CR,CRISPRCasFinder,CRT 1053679-1053710 32 NZ_MG299151 Shigella sonnei strain SH287-2 plasmid pSH287-2, complete sequence 51276-51307 7 0.781
CP024141_2 2.7|1053679|32|CP024141|PILER-CR,CRISPRCasFinder,CRT 1053679-1053710 32 NZ_KY471628 Shigella sonnei strain SH15sh99 plasmid pSH15sh99, complete sequence 45716-45747 7 0.781
CP024141_2 2.7|1053679|32|CP024141|PILER-CR,CRISPRCasFinder,CRT 1053679-1053710 32 NZ_MG299131 Shigella sonnei strain SH271-2 plasmid pSH271-2, complete sequence 51276-51307 7 0.781
CP024141_2 2.7|1053679|32|CP024141|PILER-CR,CRISPRCasFinder,CRT 1053679-1053710 32 NZ_KY471629 Shigella sonnei strain SH15sh105 plasmid pSH15sh104, complete sequence 45716-45747 7 0.781
CP024141_2 2.7|1053679|32|CP024141|PILER-CR,CRISPRCasFinder,CRT 1053679-1053710 32 NZ_MG299133 Shigella sonnei strain SH272-2 plasmid pSH272-2, complete sequence 51276-51307 7 0.781
CP024141_2 2.7|1053679|32|CP024141|PILER-CR,CRISPRCasFinder,CRT 1053679-1053710 32 NZ_MG299128 Shigella sonnei strain SH262-2 plasmid pSH262-2, complete sequence 51276-51307 7 0.781
CP024141_2 2.7|1053679|32|CP024141|PILER-CR,CRISPRCasFinder,CRT 1053679-1053710 32 NZ_MG299147 Shigella sonnei strain SH284-2 plasmid pSH284-2, complete sequence 51276-51307 7 0.781
CP024141_2 2.7|1053679|32|CP024141|PILER-CR,CRISPRCasFinder,CRT 1053679-1053710 32 NC_018995 Escherichia coli plasmid pHUSEC41-1, complete sequence 29015-29046 7 0.781
CP024141_2 2.7|1053679|32|CP024141|PILER-CR,CRISPRCasFinder,CRT 1053679-1053710 32 NZ_CP053235 Escherichia coli strain SCU-106 plasmid pSCU-106-1, complete sequence 78292-78323 7 0.781
CP024141_2 2.7|1053679|32|CP024141|PILER-CR,CRISPRCasFinder,CRT 1053679-1053710 32 NZ_CP005999 Escherichia coli B7A plasmid pEB1, complete sequence 39563-39594 7 0.781
CP024141_2 2.7|1053679|32|CP024141|PILER-CR,CRISPRCasFinder,CRT 1053679-1053710 32 KU932021 Escherichia coli plasmid pEC3I, complete sequence 51902-51933 7 0.781
CP024141_2 2.7|1053679|32|CP024141|PILER-CR,CRISPRCasFinder,CRT 1053679-1053710 32 NZ_CP024154 Escherichia coli strain 14EC033 plasmid p14EC033g, complete sequence 18560-18591 7 0.781
CP024141_2 2.7|1053679|32|CP024141|PILER-CR,CRISPRCasFinder,CRT 1053679-1053710 32 NC_011754 Escherichia coli ED1a plasmid pECOED, complete sequence 49240-49271 7 0.781
CP024141_2 2.7|1053679|32|CP024141|PILER-CR,CRISPRCasFinder,CRT 1053679-1053710 32 NZ_CP015141 Escherichia coli strain Ecol_732 plasmid pEC732_3, complete sequence 81434-81465 7 0.781
CP024141_2 2.7|1053679|32|CP024141|PILER-CR,CRISPRCasFinder,CRT 1053679-1053710 32 NZ_LR213460 Shigella sonnei strain AUSMDU00008333 isolate AUSMDU00008333 plasmid 3 28916-28947 7 0.781
CP024141_2 2.7|1053679|32|CP024141|PILER-CR,CRISPRCasFinder,CRT 1053679-1053710 32 NZ_MH287044 Escherichia coli strain 5.1-R1 plasmid pCERC6, complete sequence 36182-36213 7 0.781
CP024141_2 2.7|1053679|32|CP024141|PILER-CR,CRISPRCasFinder,CRT 1053679-1053710 32 NZ_MH618673 Escherichia coli strain 838B plasmid p838B-R, complete sequence 32230-32261 7 0.781
CP024141_2 2.6|1053618|32|CP024141|PILER-CR,CRISPRCasFinder,CRT 1053618-1053649 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1417960-1417991 8 0.75
CP024141_3 3.4|1081060|32|CP024141|PILER-CR 1081060-1081091 32 MK448454 Streptococcus satellite phage Javan361, complete genome 9192-9223 8 0.75
CP024141_3 3.11|1081181|33|CP024141|CRT 1081181-1081213 33 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 1428097-1428129 8 0.758
CP024141_4 4.1|1629845|34|CP024141|CRISPRCasFinder 1629845-1629878 34 NZ_CP044307 Escherichia coli strain C27A plasmid pC27A-2, complete sequence 15030-15063 9 0.735
CP024141_2 2.1|1053313|32|CP024141|PILER-CR,CRISPRCasFinder,CRT 1053313-1053344 32 NZ_CP030933 Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence 51062-51093 10 0.688
CP024141_3 3.1|1080877|32|CP024141|PILER-CR 1080877-1080908 32 CP011075 Brevibacillus laterosporus strain B9 plasmid unnamed1, complete sequence 244686-244717 10 0.688
CP024141_3 3.1|1080877|32|CP024141|PILER-CR 1080877-1080908 32 GU075905 Prochlorococcus phage P-HM2, complete genome 78536-78567 10 0.688
CP024141_3 3.6|1080876|33|CP024141|CRT 1080876-1080908 33 GU075905 Prochlorococcus phage P-HM2, complete genome 78535-78567 10 0.697
CP024141_3 3.11|1081181|33|CP024141|CRT 1081181-1081213 33 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 141278-141310 10 0.697
CP024141_4 4.1|1629845|34|CP024141|CRISPRCasFinder 1629845-1629878 34 NZ_CP010859 Marinovum algicola DG 898 plasmid pMaD4, complete sequence 3636-3669 10 0.706
CP024141_5 5.1|1856282|56|CP024141|CRISPRCasFinder 1856282-1856337 56 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4157-4212 10 0.821
CP024141_5 5.1|1856282|56|CP024141|CRISPRCasFinder 1856282-1856337 56 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4156-4211 10 0.821
CP024141_5 5.1|1856282|56|CP024141|CRISPRCasFinder 1856282-1856337 56 NZ_CP044308 Escherichia coli strain C27A plasmid pC27A-3, complete sequence 115797-115852 10 0.821
CP024141_5 5.1|1856282|56|CP024141|CRISPRCasFinder 1856282-1856337 56 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4156-4211 10 0.821
CP024141_5 5.1|1856282|56|CP024141|CRISPRCasFinder 1856282-1856337 56 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4156-4211 10 0.821
CP024141_5 5.1|1856282|56|CP024141|CRISPRCasFinder 1856282-1856337 56 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229185-229240 11 0.804
CP024141_5 5.1|1856282|56|CP024141|CRISPRCasFinder 1856282-1856337 56 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239679-239734 11 0.804
CP024141_5 5.1|1856282|56|CP024141|CRISPRCasFinder 1856282-1856337 56 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230591-230646 11 0.804
CP024141_5 5.1|1856282|56|CP024141|CRISPRCasFinder 1856282-1856337 56 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211561-211616 11 0.804
CP024141_5 5.1|1856282|56|CP024141|CRISPRCasFinder 1856282-1856337 56 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229286-229341 12 0.786
CP024141_5 5.1|1856282|56|CP024141|CRISPRCasFinder 1856282-1856337 56 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239780-239835 12 0.786
CP024141_5 5.1|1856282|56|CP024141|CRISPRCasFinder 1856282-1856337 56 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230692-230747 12 0.786
CP024141_5 5.1|1856282|56|CP024141|CRISPRCasFinder 1856282-1856337 56 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211662-211717 12 0.786
CP024141_5 5.1|1856282|56|CP024141|CRISPRCasFinder 1856282-1856337 56 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229084-229139 13 0.768
CP024141_5 5.1|1856282|56|CP024141|CRISPRCasFinder 1856282-1856337 56 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239578-239633 13 0.768
CP024141_5 5.1|1856282|56|CP024141|CRISPRCasFinder 1856282-1856337 56 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230490-230545 13 0.768
CP024141_5 5.1|1856282|56|CP024141|CRISPRCasFinder 1856282-1856337 56 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211460-211515 13 0.768

1. spacer 7.1|3063456|40|CP024141|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgctgcgggtcattcttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
****************************************

2. spacer 12.1|4107758|42|CP024141|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 0, identity: 1.0

tgtcacacgcagataaatccaactttcaatattgttaagttc	CRISPR spacer
tgtcacacgcagataaatccaactttcaatattgttaagttc	Protospacer
******************************************

3. spacer 12.2|4107817|40|CP024141|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 1, identity: 0.975

catggcgtagcaaaaagaaattttcaatattgctttatgg	CRISPR spacer
catggcgtagaaaaaagaaattttcaatattgctttatgg	Protospacer
********** *****************************

4. spacer 6.1|2305073|38|CP024141|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

5. spacer 3.11|1081181|33|CP024141|CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 3, identity: 0.909

gggcgcactggatgcgatgatggatatcactta	CRISPR spacer
ggacgcactggatgcgatgatggacatcacttg	Protospacer
**.*********************.*******.

6. spacer 10.1|3874895|48|CP024141|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 3, identity: 0.938

tcagcgtcgcatcaggcatctgcgcataaccgccggatgcggcgtaaa	CRISPR spacer
ccagcgtcgcatcaggcatctgcgcataactgccggatgcggcataaa	Protospacer
.*****************************.************.****

7. spacer 10.1|3874895|48|CP024141|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 3, identity: 0.938

tcagcgtcgcatcaggcatctgcgcataaccgccggatgcggcgtaaa	CRISPR spacer
ccagcgtcgcatcaggcatctgcgcataactgccggatgcggcataaa	Protospacer
.*****************************.************.****

8. spacer 10.1|3874895|48|CP024141|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 3, identity: 0.938

tcagcgtcgcatcaggcatctgcgcataaccgccggatgcggcgtaaa	CRISPR spacer
ccagcgtcgcatcaggcatctgcgcataactgccggatgcggcataaa	Protospacer
.*****************************.************.****

9. spacer 10.1|3874895|48|CP024141|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 3, identity: 0.938

tcagcgtcgcatcaggcatctgcgcataaccgccggatgcggcgtaaa	CRISPR spacer
ccagcgtcgcatcaggcatctgcgcataactgccggatgcggcataaa	Protospacer
.*****************************.************.****

10. spacer 5.1|1856282|56|CP024141|CRISPRCasFinder matches to MT230312 (Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence) position: , mismatch: 4, identity: 0.929

ctgaatgccggatgcggcgtgaacgccttatccgtcctacggttctgtgctcgggt	CRISPR spacer
acgatcgccggatgcggcgtgaacgccttatccgtcctacggttctgtgctcgggt	Protospacer
 .** .**************************************************

11. spacer 2.7|1053679|32|CP024141|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG299151 (Shigella sonnei strain SH287-2 plasmid pSH287-2, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

12. spacer 2.7|1053679|32|CP024141|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY471628 (Shigella sonnei strain SH15sh99 plasmid pSH15sh99, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

13. spacer 2.7|1053679|32|CP024141|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG299131 (Shigella sonnei strain SH271-2 plasmid pSH271-2, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

14. spacer 2.7|1053679|32|CP024141|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY471629 (Shigella sonnei strain SH15sh105 plasmid pSH15sh104, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

15. spacer 2.7|1053679|32|CP024141|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG299133 (Shigella sonnei strain SH272-2 plasmid pSH272-2, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

16. spacer 2.7|1053679|32|CP024141|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG299128 (Shigella sonnei strain SH262-2 plasmid pSH262-2, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

17. spacer 2.7|1053679|32|CP024141|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG299147 (Shigella sonnei strain SH284-2 plasmid pSH284-2, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

18. spacer 2.7|1053679|32|CP024141|PILER-CR,CRISPRCasFinder,CRT matches to NC_018995 (Escherichia coli plasmid pHUSEC41-1, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

19. spacer 2.7|1053679|32|CP024141|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053235 (Escherichia coli strain SCU-106 plasmid pSCU-106-1, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

20. spacer 2.7|1053679|32|CP024141|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP005999 (Escherichia coli B7A plasmid pEB1, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

21. spacer 2.7|1053679|32|CP024141|PILER-CR,CRISPRCasFinder,CRT matches to KU932021 (Escherichia coli plasmid pEC3I, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

22. spacer 2.7|1053679|32|CP024141|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024154 (Escherichia coli strain 14EC033 plasmid p14EC033g, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

23. spacer 2.7|1053679|32|CP024141|PILER-CR,CRISPRCasFinder,CRT matches to NC_011754 (Escherichia coli ED1a plasmid pECOED, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

24. spacer 2.7|1053679|32|CP024141|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015141 (Escherichia coli strain Ecol_732 plasmid pEC732_3, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

25. spacer 2.7|1053679|32|CP024141|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR213460 (Shigella sonnei strain AUSMDU00008333 isolate AUSMDU00008333 plasmid 3) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

26. spacer 2.7|1053679|32|CP024141|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH287044 (Escherichia coli strain 5.1-R1 plasmid pCERC6, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

27. spacer 2.7|1053679|32|CP024141|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH618673 (Escherichia coli strain 838B plasmid p838B-R, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

28. spacer 2.6|1053618|32|CP024141|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tcaacgcgctcagacgttgcgtgagtgaacca	CRISPR spacer
acaacgcggtcggacgttgcgtgattaccccg	Protospacer
 ******* **.************ *.  **.

29. spacer 3.4|1081060|32|CP024141|PILER-CR matches to MK448454 (Streptococcus satellite phage Javan361, complete genome) position: , mismatch: 8, identity: 0.75

tccgtttggtccaccaaatgtttgatgcttca	CRISPR spacer
tcttatcaatccaccaaatttttgattcttca	Protospacer
**.  *...********** ****** *****

30. spacer 3.11|1081181|33|CP024141|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.758

gggcgcactggatgcgatgatggata---tcactta	CRISPR spacer
gggcgcactggaagcggtgatggaggggcgcac---	Protospacer
************ ***.******* .    ***   

31. spacer 4.1|1629845|34|CP024141|CRISPRCasFinder matches to NZ_CP044307 (Escherichia coli strain C27A plasmid pC27A-2, complete sequence) position: , mismatch: 9, identity: 0.735

tgcatccggcacccggagcctgatgcgacgctgg	CRISPR spacer
atcaacaattaccaggtgcctgatgcgacgctgg	Protospacer
  ** * . .*** ** *****************

32. spacer 2.1|1053313|32|CP024141|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030933 (Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence) position: , mismatch: 10, identity: 0.688

tccacgctgtaacggccatcattaagtttagt	CRISPR spacer
ccgctgctgtgacgcccatcattaagttactc	Protospacer
.*  .*****.*** *************   .

33. spacer 3.1|1080877|32|CP024141|PILER-CR matches to CP011075 (Brevibacillus laterosporus strain B9 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

acggacaaaatatatattgatttgcgaattat	CRISPR spacer
tgaggcaaaatatagattgatttccgaaaata	Protospacer
  .*.********* ******** ****    

34. spacer 3.1|1080877|32|CP024141|PILER-CR matches to GU075905 (Prochlorococcus phage P-HM2, complete genome) position: , mismatch: 10, identity: 0.688

acggacaaaatatatattgatttgcgaattat	CRISPR spacer
acggaaaaattatatattgattttacttctgg	Protospacer
***** *** *************     .*. 

35. spacer 3.6|1080876|33|CP024141|CRT matches to GU075905 (Prochlorococcus phage P-HM2, complete genome) position: , mismatch: 10, identity: 0.697

gacggacaaaatatatattgatttgcgaattat	CRISPR spacer
gacggaaaaattatatattgattttacttctgg	Protospacer
****** *** *************     .*. 

36. spacer 3.11|1081181|33|CP024141|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 10, identity: 0.697

gggcgcactggatgcgatgatggatatcactta	CRISPR spacer
cggcgcactggaaccgatgatggatgcgatgag	Protospacer
 ***********  ***********.. *.  .

37. spacer 4.1|1629845|34|CP024141|CRISPRCasFinder matches to NZ_CP010859 (Marinovum algicola DG 898 plasmid pMaD4, complete sequence) position: , mismatch: 10, identity: 0.706

tgcatccggcacccggagcctgatgcgacgctgg	CRISPR spacer
tgtcgaaggcacccgcaccctgatgcgacgcgcc	Protospacer
**.    ******** * *************   

38. spacer 5.1|1856282|56|CP024141|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 10, identity: 0.821

ctgaatgccggatgcggcgtgaacgccttatccgtcctacggttctgtgctcgggt-	CRISPR spacer
acaactgccggatgcggcgtgaacgccttatccgtcctaccgttcag-gcacaagtt	Protospacer
 ..* *********************************** **** * ** *..** 

39. spacer 5.1|1856282|56|CP024141|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 10, identity: 0.821

ctgaatgccggatgcggcgtgaacgccttatccgtcctacggttctgtgctcgggt-	CRISPR spacer
acaactgccggatgcggcgtgaacgccttatccgtcctaccgttcag-gcacaagtt	Protospacer
 ..* *********************************** **** * ** *..** 

40. spacer 5.1|1856282|56|CP024141|CRISPRCasFinder matches to NZ_CP044308 (Escherichia coli strain C27A plasmid pC27A-3, complete sequence) position: , mismatch: 10, identity: 0.821

ctgaatgccggatgcggcgtgaacgccttatccgtcctacggttctgtgctcgggt-	CRISPR spacer
acaactgccggatgcggcgtgaacgccttatccgtcctaccgttcag-gcacaagtt	Protospacer
 ..* *********************************** **** * ** *..** 

41. spacer 5.1|1856282|56|CP024141|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 10, identity: 0.821

ctgaatgccggatgcggcgtgaacgccttatccgtcctacggttctgtgctcgggt-	CRISPR spacer
acaactgccggatgcggcgtgaacgccttatccgtcctaccgttcag-gcacaagtt	Protospacer
 ..* *********************************** **** * ** *..** 

42. spacer 5.1|1856282|56|CP024141|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 10, identity: 0.821

ctgaatgccggatgcggcgtgaacgccttatccgtcctacggttctgtgctcgggt-	CRISPR spacer
acaactgccggatgcggcgtgaacgccttatccgtcctaccgttcag-gcacaagtt	Protospacer
 ..* *********************************** **** * ** *..** 

43. spacer 5.1|1856282|56|CP024141|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 11, identity: 0.804

ctgaatgccggatgcggcgtgaacgccttatccgtcctacggttctgtgctcgggt---	CRISPR spacer
acgactgccggatgcggcgtgaacgccttatccggcctacggat---ggcgcgggaatt	Protospacer
 .** ***************************** ******* *    ** ****    

44. spacer 5.1|1856282|56|CP024141|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 11, identity: 0.804

ctgaatgccggatgcggcgtgaacgccttatccgtcctacggttctgtgctcgggt---	CRISPR spacer
acgactgccggatgcggcgtgaacgccttatccggcctacggat---ggcgcgggaatt	Protospacer
 .** ***************************** ******* *    ** ****    

45. spacer 5.1|1856282|56|CP024141|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 11, identity: 0.804

ctgaatgccggatgcggcgtgaacgccttatccgtcctacggttctgtgctcgggt---	CRISPR spacer
acgactgccggatgcggcgtgaacgccttatccggcctacggat---ggcgcgggaatt	Protospacer
 .** ***************************** ******* *    ** ****    

46. spacer 5.1|1856282|56|CP024141|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 11, identity: 0.804

ctgaatgccggatgcggcgtgaacgccttatccgtcctacggttctgtgctcgggt---	CRISPR spacer
acgactgccggatgcggcgtgaacgccttatccggcctacggat---ggcgcgggaatt	Protospacer
 .** ***************************** ******* *    ** ****    

47. spacer 5.1|1856282|56|CP024141|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.786

ctgaatgccggatgcggcgtgaacgccttatccgtcctacggttctgtgctcgggt-	CRISPR spacer
acgactgccggatgcggcgtgaacgccttatccggcctacgggt-ggcgcgagaatt	Protospacer
 .** ***************************** ******* *  *.**  *..* 

48. spacer 5.1|1856282|56|CP024141|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.786

ctgaatgccggatgcggcgtgaacgccttatccgtcctacggttctgtgctcgggt-	CRISPR spacer
acgactgccggatgcggcgtgaacgccttatccggcctacgggt-ggcgcgagaatt	Protospacer
 .** ***************************** ******* *  *.**  *..* 

49. spacer 5.1|1856282|56|CP024141|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.786

ctgaatgccggatgcggcgtgaacgccttatccgtcctacggttctgtgctcgggt-	CRISPR spacer
acgactgccggatgcggcgtgaacgccttatccggcctacgggt-ggcgcgagaatt	Protospacer
 .** ***************************** ******* *  *.**  *..* 

50. spacer 5.1|1856282|56|CP024141|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.786

ctgaatgccggatgcggcgtgaacgccttatccgtcctacggttctgtgctcgggt-	CRISPR spacer
acgactgccggatgcggcgtgaacgccttatccggcctacgggt-ggcgcgagaatt	Protospacer
 .** ***************************** ******* *  *.**  *..* 

51. spacer 5.1|1856282|56|CP024141|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 13, identity: 0.768

ctgaatgccggatgcggcgtgaacgccttatccgtcctacggttctgtgctcgggt-	CRISPR spacer
acgactgccggatgcggcgtgaacgccttatccggcctacggat-ggcgtgagaatt	Protospacer
 .** ***************************** ******* *  *.*.  *..* 

52. spacer 5.1|1856282|56|CP024141|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 13, identity: 0.768

ctgaatgccggatgcggcgtgaacgccttatccgtcctacggttctgtgctcgggt-	CRISPR spacer
acgactgccggatgcggcgtgaacgccttatccggcctacggat-ggcgtgagaatt	Protospacer
 .** ***************************** ******* *  *.*.  *..* 

53. spacer 5.1|1856282|56|CP024141|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 13, identity: 0.768

ctgaatgccggatgcggcgtgaacgccttatccgtcctacggttctgtgctcgggt-	CRISPR spacer
acgactgccggatgcggcgtgaacgccttatccggcctacggat-ggcgtgagaatt	Protospacer
 .** ***************************** ******* *  *.*.  *..* 

54. spacer 5.1|1856282|56|CP024141|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 13, identity: 0.768

ctgaatgccggatgcggcgtgaacgccttatccgtcctacggttctgtgctcgggt-	CRISPR spacer
acgactgccggatgcggcgtgaacgccttatccggcctacggat-ggcgtgagaatt	Protospacer
 .** ***************************** ******* *  *.*.  *..* 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1088606 : 1101789 12 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_2 1181859 : 1188675 9 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_3 1251214 : 1291118 50 Salmonella_phage(57.14%) tail,holin,terminase,head NA
DBSCAN-SWA_4 1758127 : 1767568 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_5 1923641 : 2014343 91 Escherichia_phage(45.1%) head,protease,tail,holin,portal,terminase,integrase,capsid,transposase attL 1954254:1954269|attR 1985535:1985550
DBSCAN-SWA_6 2390998 : 2445675 73 Enterobacteria_phage(37.25%) head,tail,portal,terminase,integrase,capsid,lysis,transposase attL 2386288:2386303|attR 2418717:2418732
DBSCAN-SWA_7 2608061 : 2627888 17 Enterobacteria_phage(22.22%) protease,portal,terminase,capsid,transposase NA
DBSCAN-SWA_8 2689616 : 2745342 64 Escherichia_phage(52.08%) tail,tRNA,coat,terminase,integrase,lysis,transposase attL 2708529:2708545|attR 2750943:2750959
DBSCAN-SWA_9 3191719 : 3279519 93 Salmonella_phage(60.71%) head,plate,protease,tail,portal,tRNA,integrase,capsid,transposase attL 3257098:3257114|attR 3282815:3282831
DBSCAN-SWA_10 3849834 : 3901695 51 Enterobacteria_phage(33.33%) plate,capsid,integrase attL 3849730:3849749|attR 3861821:3861840
DBSCAN-SWA_11 4311855 : 4336868 23 Stx2-converting_phage(14.29%) holin,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. CP024143
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 57807 : 158208 112 Escherichia_phage(34.21%) integrase,transposase attL 100644:100703|attR 154196:155016
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. CP024144
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 19566 : 61135 42 Escherichia_phage(40.0%) integrase,transposase attL 7767:7782|attR 59855:59870
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage