1. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
2. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
3. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
4. spacer 1.1|14355|21|CP027063|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
5. spacer 1.1|14355|21|CP027063|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
6. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
7. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
8. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
9. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
10. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
11. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
12. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
13. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
14. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
15. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
16. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
17. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
18. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
19. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
20. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
21. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
22. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
23. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
24. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
25. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
26. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
27. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
28. spacer 1.1|14355|21|CP027063|CRT matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
29. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
30. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
31. spacer 1.1|14355|21|CP027063|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
32. spacer 1.1|14355|21|CP027063|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
33. spacer 1.1|14355|21|CP027063|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
34. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
35. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
36. spacer 1.1|14355|21|CP027063|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
37. spacer 1.1|14355|21|CP027063|CRT matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
38. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
39. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
40. spacer 1.1|14355|21|CP027063|CRT matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
41. spacer 1.1|14355|21|CP027063|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
42. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
43. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
44. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
45. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
46. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
47. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
48. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
49. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
50. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
51. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
52. spacer 1.1|14355|21|CP027063|CRT matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
53. spacer 1.1|14355|21|CP027063|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
54. spacer 1.1|14355|21|CP027063|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
55. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
56. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
57. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
58. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
59. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
60. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
61. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
62. spacer 1.1|14355|21|CP027063|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
63. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
64. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
65. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
66. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
67. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
68. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
69. spacer 1.1|14355|21|CP027063|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
70. spacer 1.1|14355|21|CP027063|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
71. spacer 1.1|14355|21|CP027063|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 0, identity: 1.0
acggatccgctaccggtgctc CRISPR spacer
acggatccgctaccggtgctc Protospacer
*********************
72. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0
acagggccgctgccggtgctc CRISPR spacer
acagggccgctgccggtgctc Protospacer
*********************
73. spacer 1.2|14397|21|CP027063|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0
acagggccgctgccggtgctc CRISPR spacer
acagggccgctgccggtgctc Protospacer
*********************
74. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0
acagggccgctgccggtgctc CRISPR spacer
acagggccgctgccggtgctc Protospacer
*********************
75. spacer 1.2|14397|21|CP027063|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 0, identity: 1.0
acagggccgctgccggtgctc CRISPR spacer
acagggccgctgccggtgctc Protospacer
*********************
76. spacer 1.2|14397|21|CP027063|CRT matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0
acagggccgctgccggtgctc CRISPR spacer
acagggccgctgccggtgctc Protospacer
*********************
77. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0
acagggccgctgccggtgctc CRISPR spacer
acagggccgctgccggtgctc Protospacer
*********************
78. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0
acagggccgctgccggtgctc CRISPR spacer
acagggccgctgccggtgctc Protospacer
*********************
79. spacer 1.2|14397|21|CP027063|CRT matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 0, identity: 1.0
acagggccgctgccggtgctc CRISPR spacer
acagggccgctgccggtgctc Protospacer
*********************
80. spacer 1.2|14397|21|CP027063|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0
acagggccgctgccggtgctc CRISPR spacer
acagggccgctgccggtgctc Protospacer
*********************
81. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
acagggccgctgccggtgctc CRISPR spacer
acagggccgctgccggtgctc Protospacer
*********************
82. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
acagggccgctgccggtgctc CRISPR spacer
acagggccgctgccggtgctc Protospacer
*********************
83. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP041093 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acagggccgctgccggtgctc CRISPR spacer
acagggccgctgccggtgctc Protospacer
*********************
84. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0
acagggccgctgccggtgctc CRISPR spacer
acagggccgctgccggtgctc Protospacer
*********************
85. spacer 1.2|14397|21|CP027063|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0
acagggccgctgccggtgctc CRISPR spacer
acagggccgctgccggtgctc Protospacer
*********************
86. spacer 1.2|14397|21|CP027063|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0
acagggccgctgccggtgctc CRISPR spacer
acagggccgctgccggtgctc Protospacer
*********************
87. spacer 1.2|14397|21|CP027063|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0
acagggccgctgccggtgctc CRISPR spacer
acagggccgctgccggtgctc Protospacer
*********************
88. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0
acagggccgctgccggtgctc CRISPR spacer
acagggccgctgccggtgctc Protospacer
*********************
89. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
acagggccgctgccggtgctc CRISPR spacer
acagggccgctgccggtgctc Protospacer
*********************
90. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 0, identity: 1.0
acagggccgctgccggtgctc CRISPR spacer
acagggccgctgccggtgctc Protospacer
*********************
91. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0
acagggccgctgccggtgctc CRISPR spacer
acagggccgctgccggtgctc Protospacer
*********************
92. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acagggccgctgccggtgctc CRISPR spacer
acagggccgctgccggtgctc Protospacer
*********************
93. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0
acagggccgctgccggtgctc CRISPR spacer
acagggccgctgccggtgctc Protospacer
*********************
94. spacer 1.2|14397|21|CP027063|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0
acagggccgctgccggtgctc CRISPR spacer
acagggccgctgccggtgctc Protospacer
*********************
95. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acagggccgctgccggtgctc CRISPR spacer
acagggccgctgccggtgctc Protospacer
*********************
96. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0
acagggccgctgccggtgctc CRISPR spacer
acagggccgctgccggtgctc Protospacer
*********************
97. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0
acagggccgctgccggtgctc CRISPR spacer
acagggccgctgccggtgctc Protospacer
*********************
98. spacer 1.2|14397|21|CP027063|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0
acagggccgctgccggtgctc CRISPR spacer
acagggccgctgccggtgctc Protospacer
*********************
99. spacer 1.2|14397|21|CP027063|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0
acagggccgctgccggtgctc CRISPR spacer
acagggccgctgccggtgctc Protospacer
*********************
100. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acagggccgctgccggtgctc CRISPR spacer
acagggccgctgccggtgctc Protospacer
*********************
101. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0
acagggccgctgccggtgctc CRISPR spacer
acagggccgctgccggtgctc Protospacer
*********************
102. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 0, identity: 1.0
acagggccgctgccggtgctc CRISPR spacer
acagggccgctgccggtgctc Protospacer
*********************
103. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0
acagggccgctgccggtgctc CRISPR spacer
acagggccgctgccggtgctc Protospacer
*********************
104. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0
acagggccgctgccggtgctc CRISPR spacer
acagggccgctgccggtgctc Protospacer
*********************
105. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acagggccgctgccggtgctc CRISPR spacer
acagggccgctgccggtgctc Protospacer
*********************
106. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0
acagggccgctgccggtgctc CRISPR spacer
acagggccgctgccggtgctc Protospacer
*********************
107. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0
acagggccgctgccggtgctc CRISPR spacer
acagggccgctgccggtgctc Protospacer
*********************
108. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0
acagggccgctgccggtgctc CRISPR spacer
acagggccgctgccggtgctc Protospacer
*********************
109. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0
acagggccgctgccggtgctc CRISPR spacer
acagggccgctgccggtgctc Protospacer
*********************
110. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0
acagggccgctgccggtgctc CRISPR spacer
acagggccgctgccggtgctc Protospacer
*********************
111. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acagggccgctgccggtgctc CRISPR spacer
acagggccgctgccggtgctc Protospacer
*********************
112. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0
acagggccgctgccggtgctc CRISPR spacer
acagggccgctgccggtgctc Protospacer
*********************
113. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0
acagggccgctgccggtgctc CRISPR spacer
acagggccgctgccggtgctc Protospacer
*********************
114. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0
acagggccgctgccggtgctc CRISPR spacer
acagggccgctgccggtgctc Protospacer
*********************
115. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0
acagggccgctgccggtgctc CRISPR spacer
acagggccgctgccggtgctc Protospacer
*********************
116. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0
acagggccgctgccggtgctc CRISPR spacer
acagggccgctgccggtgctc Protospacer
*********************
117. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
acagggccgctgccggtgctc CRISPR spacer
acagggccgctgccggtgctc Protospacer
*********************
118. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acagggccgctgccggtgctc CRISPR spacer
acagggccgctgccggtgctc Protospacer
*********************
119. spacer 1.3|14439|21|CP027063|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
120. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
121. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
122. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
123. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
124. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP041093 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
125. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
126. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
127. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
128. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
129. spacer 1.3|14439|21|CP027063|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
130. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
131. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
132. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
133. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
134. spacer 1.3|14439|21|CP027063|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
135. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
136. spacer 1.3|14439|21|CP027063|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
137. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
138. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
139. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
140. spacer 1.3|14439|21|CP027063|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
141. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
142. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
143. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
144. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
145. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
146. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
147. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
148. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
149. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
150. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
151. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
152. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
153. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtagct Protospacer
*********************
154. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
155. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
156. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
157. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
158. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
159. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
160. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
161. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
162. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
163. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
164. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
165. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
166. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
167. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
168. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
169. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
170. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
171. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
172. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
173. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
174. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
175. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
176. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
177. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
178. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
179. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
180. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
181. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
182. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
183. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
184. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
185. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
186. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
187. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
188. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
189. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
190. spacer 1.4|14481|21|CP027063|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
191. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
192. spacer 1.4|14481|21|CP027063|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
193. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
194. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
195. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
196. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
197. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP041093 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
198. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
199. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
200. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
201. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
202. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
203. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
204. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
205. spacer 1.4|14481|21|CP027063|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
206. spacer 1.4|14481|21|CP027063|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
207. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
208. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
209. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
210. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
211. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
212. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
213. spacer 1.4|14481|21|CP027063|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
214. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
215. spacer 1.4|14481|21|CP027063|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
216. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
217. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
218. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
219. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
220. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
221. spacer 1.4|14481|21|CP027063|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
222. spacer 1.4|14481|21|CP027063|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
*********************
223. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
224. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
225. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
226. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
227. spacer 1.5|14523|21|CP027063|CRT matches to MN200128 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-Vir-RC, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
228. spacer 1.5|14523|21|CP027063|CRT matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
229. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
230. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
231. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP024708 (Klebsiella pneumoniae strain cr-hvkp3 plasmid pPUTH1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
232. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
233. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
234. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
235. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
236. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
237. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
238. spacer 1.5|14523|21|CP027063|CRT matches to LR134211 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
239. spacer 1.5|14523|21|CP027063|CRT matches to NC_005249 (Klebsiella pneumoniae CG43 plasmid pLVPK, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
240. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
241. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
242. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
243. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
244. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
245. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
246. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
247. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
248. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
249. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
250. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
251. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
252. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
253. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
254. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
255. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
256. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
257. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
258. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
259. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP042975 (Klebsiella pneumoniae strain KPN55602 plasmid pK55602_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
260. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
261. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
262. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
263. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
264. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
265. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
266. spacer 1.5|14523|21|CP027063|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
267. spacer 1.5|14523|21|CP027063|CRT matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
268. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
269. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
270. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
271. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
272. spacer 1.5|14523|21|CP027063|CRT matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
273. spacer 1.5|14523|21|CP027063|CRT matches to CP052363 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
274. spacer 1.5|14523|21|CP027063|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
275. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
276. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
277. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
278. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
279. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
280. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
281. spacer 1.5|14523|21|CP027063|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
282. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
283. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
284. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
285. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
286. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
287. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
288. spacer 1.5|14523|21|CP027063|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
289. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
290. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
291. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
292. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP026587 (Klebsiella pneumoniae strain NUHL30457 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
293. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
294. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
295. spacer 1.5|14523|21|CP027063|CRT matches to NZ_LR745046 (Klebsiella pneumoniae isolate Kpn2166 plasmid pVIR_Kpn2166) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
296. spacer 1.5|14523|21|CP027063|CRT matches to NZ_LR745043 (Klebsiella pneumoniae isolate Klebsiella pneumoniae kpn154 plasmid pVIR_Kpn154) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
297. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
298. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
299. spacer 1.5|14523|21|CP027063|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
300. spacer 1.5|14523|21|CP027063|CRT matches to NC_017541 (Klebsiella pneumoniae KCTC 2242 plasmid pKCTC2242, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
301. spacer 1.5|14523|21|CP027063|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
302. spacer 1.5|14523|21|CP027063|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
303. spacer 1.6|14565|21|CP027063|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
304. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
305. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
306. spacer 1.6|14565|21|CP027063|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
307. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP025081 (Klebsiella pneumoniae strain SGH10 plasmid pSGH10, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
308. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
309. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
310. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP030924 (Klebsiella pneumoniae subsp. pneumoniae strain KC-Pl-HB1 plasmid pKC-Pl-HB1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
311. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP026022 (Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
312. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP014011 (Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
313. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP037743 (Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_hv, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
314. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
315. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
316. spacer 1.6|14565|21|CP027063|CRT matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
317. spacer 1.6|14565|21|CP027063|CRT matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
318. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
319. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
320. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
321. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
322. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
323. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
324. spacer 1.6|14565|21|CP027063|CRT matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
325. spacer 1.6|14565|21|CP027063|CRT matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
326. spacer 1.6|14565|21|CP027063|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
327. spacer 1.6|14565|21|CP027063|CRT matches to CP052432 (Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
328. spacer 1.6|14565|21|CP027063|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
329. spacer 1.6|14565|21|CP027063|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
330. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP019049 (Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
331. spacer 1.6|14565|21|CP027063|CRT matches to MK347238 (Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
332. spacer 1.6|14565|21|CP027063|CRT matches to MK347238 (Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
333. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
334. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
335. spacer 1.6|14565|21|CP027063|CRT matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
336. spacer 1.6|14565|21|CP027063|CRT matches to NZ_LR134257 (Klebsiella aerogenes strain NCTC9644 plasmid 4, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
337. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
338. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
339. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
340. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP014009 (Klebsiella pneumoniae subsp. pneumoniae strain RJF293 plasmid pRJF293, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
341. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
342. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
343. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
344. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
345. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
346. spacer 1.6|14565|21|CP027063|CRT matches to LR134211 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
347. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
348. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
349. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
350. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
351. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
352. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
353. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
354. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
355. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
356. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
357. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
358. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
359. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP032241 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
360. spacer 1.6|14565|21|CP027063|CRT matches to NC_006625 (Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 plasmid pK2044, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
361. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
362. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
363. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
364. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
365. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
366. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
367. spacer 1.6|14565|21|CP027063|CRT matches to NC_019789 (Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
368. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
369. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
370. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
371. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
372. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
373. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
374. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
375. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
376. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
377. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
378. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
379. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
380. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP047193 (Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
381. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
382. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
383. spacer 1.6|14565|21|CP027063|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
384. spacer 1.6|14565|21|CP027063|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
385. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
386. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
387. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
388. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
389. spacer 1.6|14565|21|CP027063|CRT matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
390. spacer 1.6|14565|21|CP027063|CRT matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
391. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP032164 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
392. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
393. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
394. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
395. spacer 1.6|14565|21|CP027063|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
396. spacer 1.6|14565|21|CP027063|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
397. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
398. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
399. spacer 1.6|14565|21|CP027063|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
400. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
401. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
402. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP040540 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-VIR, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
403. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
404. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
405. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
406. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
407. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
408. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
409. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
410. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
411. spacer 1.6|14565|21|CP027063|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
412. spacer 1.6|14565|21|CP027063|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
413. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
414. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
415. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
416. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
417. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP052037 (Klebsiella pneumoniae strain KPN41053 plasmid pKPN41953, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
418. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
419. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
420. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
421. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
422. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
423. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
424. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
425. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
426. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
427. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
428. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
429. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
430. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP034083 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-vir, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
431. spacer 1.6|14565|21|CP027063|CRT matches to CP050281 (Klebsiella pneumoniae strain 9949 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
432. spacer 1.6|14565|21|CP027063|CRT matches to CP029383 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
433. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
434. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
435. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP026012 (Klebsiella pneumoniae strain K2044 plasmid pK2044, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
436. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP026024 (Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
437. spacer 1.6|14565|21|CP027063|CRT matches to NZ_AP019549 (Klebsiella pneumoniae strain THC11 plasmid pTHC11-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
438. spacer 1.6|14565|21|CP027063|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
439. spacer 1.6|14565|21|CP027063|CRT matches to CP050276 (Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
440. spacer 1.6|14565|21|CP027063|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
441. spacer 1.6|14565|21|CP027063|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
442. spacer 1.6|14565|21|CP027063|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
443. spacer 1.6|14565|21|CP027063|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
444. spacer 1.6|14565|21|CP027063|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
445. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
446. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
447. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
448. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
449. spacer 1.6|14565|21|CP027063|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
450. spacer 1.6|14565|21|CP027063|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
451. spacer 1.6|14565|21|CP027063|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
452. spacer 1.6|14565|21|CP027063|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
453. spacer 1.6|14565|21|CP027063|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
454. spacer 1.6|14565|21|CP027063|CRT matches to NZ_MK413722 (Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
455. spacer 1.6|14565|21|CP027063|CRT matches to NC_017541 (Klebsiella pneumoniae KCTC 2242 plasmid pKCTC2242, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
456. spacer 1.6|14565|21|CP027063|CRT matches to NZ_MH255828 (Klebsiella pneumoniae subsp. pneumoniae strain SH9 plasmid pSH9-VIR, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
457. spacer 1.6|14565|21|CP027063|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
458. spacer 1.6|14565|21|CP027063|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
459. spacer 1.6|14565|21|CP027063|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
460. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP016815 (Klebsiella pneumoniae strain ED23 plasmid unamed, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
461. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
462. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
463. spacer 1.6|14565|21|CP027063|CRT matches to NZ_MG053312 (Klebsiella pneumoniae strain KP267 plasmid pVir-CR-HvKP267, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
464. spacer 1.6|14565|21|CP027063|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
465. spacer 1.6|14565|21|CP027063|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
466. spacer 1.6|14565|21|CP027063|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
467. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
468. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
469. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
470. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 0, identity: 1.0
acggggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*********************
471. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
472. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
473. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
474. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
475. spacer 1.7|14607|21|CP027063|CRT matches to MN200128 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-Vir-RC, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
476. spacer 1.7|14607|21|CP027063|CRT matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
477. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
478. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
479. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP024708 (Klebsiella pneumoniae strain cr-hvkp3 plasmid pPUTH1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
480. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
481. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
482. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
483. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
484. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
485. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
486. spacer 1.7|14607|21|CP027063|CRT matches to LR134211 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
487. spacer 1.7|14607|21|CP027063|CRT matches to NC_005249 (Klebsiella pneumoniae CG43 plasmid pLVPK, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
488. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
489. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
490. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
491. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
492. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
493. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
494. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
495. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
496. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
497. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
498. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
499. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
500. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
501. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
502. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
503. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
504. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
505. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
506. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
507. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP042975 (Klebsiella pneumoniae strain KPN55602 plasmid pK55602_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
508. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
509. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
510. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
511. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
512. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
513. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
514. spacer 1.7|14607|21|CP027063|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
515. spacer 1.7|14607|21|CP027063|CRT matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
516. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
517. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
518. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
519. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
520. spacer 1.7|14607|21|CP027063|CRT matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
521. spacer 1.7|14607|21|CP027063|CRT matches to CP052363 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
522. spacer 1.7|14607|21|CP027063|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
523. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
524. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
525. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
526. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
527. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
528. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
529. spacer 1.7|14607|21|CP027063|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
530. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
531. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
532. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
533. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
534. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
535. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
536. spacer 1.7|14607|21|CP027063|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
537. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
538. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
539. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
540. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP026587 (Klebsiella pneumoniae strain NUHL30457 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
541. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
542. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
543. spacer 1.7|14607|21|CP027063|CRT matches to NZ_LR745046 (Klebsiella pneumoniae isolate Kpn2166 plasmid pVIR_Kpn2166) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
544. spacer 1.7|14607|21|CP027063|CRT matches to NZ_LR745043 (Klebsiella pneumoniae isolate Klebsiella pneumoniae kpn154 plasmid pVIR_Kpn154) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
545. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
546. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
547. spacer 1.7|14607|21|CP027063|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
548. spacer 1.7|14607|21|CP027063|CRT matches to NC_017541 (Klebsiella pneumoniae KCTC 2242 plasmid pKCTC2242, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
549. spacer 1.7|14607|21|CP027063|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
550. spacer 1.7|14607|21|CP027063|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctc Protospacer
*********************
551. spacer 1.8|14649|21|CP027063|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
552. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
553. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
554. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
555. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
556. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
557. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
558. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
559. spacer 1.8|14649|21|CP027063|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
560. spacer 1.8|14649|21|CP027063|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
561. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
562. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
563. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
564. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
565. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
566. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
567. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
568. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
569. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
570. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
571. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
572. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
573. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
574. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
575. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
576. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
577. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
578. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
579. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
580. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
581. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
582. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
583. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
584. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
585. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
586. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
587. spacer 1.8|14649|21|CP027063|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
588. spacer 1.8|14649|21|CP027063|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
589. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
590. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
591. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
592. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
593. spacer 1.8|14649|21|CP027063|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
594. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
595. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
596. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
597. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
598. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
599. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
600. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
601. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
602. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
603. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
604. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
605. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
606. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
607. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
608. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
609. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
610. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
611. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
612. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
613. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
614. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
615. spacer 1.8|14649|21|CP027063|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
616. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
617. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
618. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
619. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
620. spacer 1.8|14649|21|CP027063|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
621. spacer 1.8|14649|21|CP027063|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
622. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
623. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*********************
624. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
625. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
626. spacer 1.9|14691|21|CP027063|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
627. spacer 1.9|14691|21|CP027063|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
628. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP025081 (Klebsiella pneumoniae strain SGH10 plasmid pSGH10, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
629. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP014011 (Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
630. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP014011 (Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
631. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP037743 (Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_hv, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
632. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
633. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
634. spacer 1.9|14691|21|CP027063|CRT matches to MT035874 (Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
635. spacer 1.9|14691|21|CP027063|CRT matches to MT035874 (Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
636. spacer 1.9|14691|21|CP027063|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
637. spacer 1.9|14691|21|CP027063|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
638. spacer 1.9|14691|21|CP027063|CRT matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
639. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
640. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
641. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
642. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
643. spacer 1.9|14691|21|CP027063|CRT matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
644. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP033955 (Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
645. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP033955 (Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
646. spacer 1.9|14691|21|CP027063|CRT matches to CP052432 (Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
647. spacer 1.9|14691|21|CP027063|CRT matches to CP052363 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
648. spacer 1.9|14691|21|CP027063|CRT matches to MK347227 (Klebsiella pneumoniae strain K187 plasmid pK187_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
649. spacer 1.9|14691|21|CP027063|CRT matches to MK347228 (Klebsiella pneumoniae strain K195 plasmid pK195_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
650. spacer 1.9|14691|21|CP027063|CRT matches to MK347230 (Klebsiella pneumoniae strain K202 plasmid pK202_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
651. spacer 1.9|14691|21|CP027063|CRT matches to MK347231 (Klebsiella pneumoniae strain K204 plasmid pK204_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
652. spacer 1.9|14691|21|CP027063|CRT matches to MK347238 (Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
653. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
654. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
655. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
656. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
657. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
658. spacer 1.9|14691|21|CP027063|CRT matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
659. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
660. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP014009 (Klebsiella pneumoniae subsp. pneumoniae strain RJF293 plasmid pRJF293, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
661. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
662. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
663. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
664. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
665. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
666. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
667. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
668. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
669. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP032241 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
670. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP032241 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
671. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
672. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
673. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
674. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP047193 (Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
675. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP047193 (Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
676. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
677. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
678. spacer 1.9|14691|21|CP027063|CRT matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
679. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP032164 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
680. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP032164 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
681. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
682. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
683. spacer 1.9|14691|21|CP027063|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
684. spacer 1.9|14691|21|CP027063|CRT matches to CP052190 (Klebsiella pneumoniae strain F16KP0019 plasmid pF16KP0019-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
685. spacer 1.9|14691|21|CP027063|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
686. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
687. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP040540 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-VIR, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
688. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
689. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
690. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
691. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
692. spacer 1.9|14691|21|CP027063|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
693. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
694. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
695. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP034124 (Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
696. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP034124 (Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
697. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP034124 (Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
698. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
699. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
700. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
701. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
702. spacer 1.9|14691|21|CP027063|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
703. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
704. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
705. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
706. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP034083 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-vir, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
707. spacer 1.9|14691|21|CP027063|CRT matches to CP029383 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
708. spacer 1.9|14691|21|CP027063|CRT matches to CP029383 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
709. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
710. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP026012 (Klebsiella pneumoniae strain K2044 plasmid pK2044, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
711. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP026024 (Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
712. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP026024 (Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
713. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
714. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
715. spacer 1.9|14691|21|CP027063|CRT matches to CP050276 (Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
716. spacer 1.9|14691|21|CP027063|CRT matches to CP050276 (Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
717. spacer 1.9|14691|21|CP027063|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
718. spacer 1.9|14691|21|CP027063|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
719. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP026587 (Klebsiella pneumoniae strain NUHL30457 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
720. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
721. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
722. spacer 1.9|14691|21|CP027063|CRT matches to NZ_LR745043 (Klebsiella pneumoniae isolate Klebsiella pneumoniae kpn154 plasmid pVIR_Kpn154) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
723. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
724. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
725. spacer 1.9|14691|21|CP027063|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
726. spacer 1.9|14691|21|CP027063|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
727. spacer 1.9|14691|21|CP027063|CRT matches to NZ_MK413719 (Klebsiella pneumoniae strain 362713 plasmid p362713-HI3, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
728. spacer 1.9|14691|21|CP027063|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
729. spacer 1.9|14691|21|CP027063|CRT matches to NC_017541 (Klebsiella pneumoniae KCTC 2242 plasmid pKCTC2242, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
730. spacer 1.9|14691|21|CP027063|CRT matches to NZ_MH255828 (Klebsiella pneumoniae subsp. pneumoniae strain SH9 plasmid pSH9-VIR, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
731. spacer 1.9|14691|21|CP027063|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
732. spacer 1.9|14691|21|CP027063|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
733. spacer 1.9|14691|21|CP027063|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
734. spacer 1.9|14691|21|CP027063|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
735. spacer 1.9|14691|21|CP027063|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
736. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
737. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
738. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
739. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
740. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
741. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
742. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP026022 (Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
743. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP026022 (Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
744. spacer 1.9|14691|21|CP027063|CRT matches to MN200128 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-Vir-RC, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
745. spacer 1.9|14691|21|CP027063|CRT matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
746. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
747. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
748. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP019049 (Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
749. spacer 1.9|14691|21|CP027063|CRT matches to NZ_LR134257 (Klebsiella aerogenes strain NCTC9644 plasmid 4, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
750. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
751. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
752. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
753. spacer 1.9|14691|21|CP027063|CRT matches to LR134211 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
754. spacer 1.9|14691|21|CP027063|CRT matches to NC_005249 (Klebsiella pneumoniae CG43 plasmid pLVPK, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
755. spacer 1.9|14691|21|CP027063|CRT matches to NC_006625 (Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 plasmid pK2044, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
756. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
757. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
758. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
759. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
760. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
761. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
762. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
763. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
764. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
765. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
766. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
767. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
768. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
769. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
770. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
771. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
772. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
773. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
774. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
775. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
776. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
777. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
778. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
779. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
780. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
781. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
782. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
783. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
784. spacer 1.9|14691|21|CP027063|CRT matches to CP050281 (Klebsiella pneumoniae strain 9949 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
785. spacer 1.9|14691|21|CP027063|CRT matches to CP050281 (Klebsiella pneumoniae strain 9949 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
786. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP042975 (Klebsiella pneumoniae strain KPN55602 plasmid pK55602_1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
787. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
788. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
789. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP016815 (Klebsiella pneumoniae strain ED23 plasmid unamed, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
790. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
791. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
792. spacer 1.9|14691|21|CP027063|CRT matches to NZ_MG053312 (Klebsiella pneumoniae strain KP267 plasmid pVir-CR-HvKP267, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
793. spacer 1.9|14691|21|CP027063|CRT matches to NZ_MG053312 (Klebsiella pneumoniae strain KP267 plasmid pVir-CR-HvKP267, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
794. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
795. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 0, identity: 1.0
acgggaccgctgccggtagtc CRISPR spacer
acgggaccgctgccggtagtc Protospacer
*********************
796. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
797. spacer 1.10|14733|21|CP027063|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
798. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
799. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
800. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
801. spacer 1.10|14733|21|CP027063|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
802. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
803. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
804. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
805. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
806. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
807. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
808. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP041093 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
809. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
810. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
811. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
812. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
813. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
814. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
815. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
816. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
817. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
818. spacer 1.10|14733|21|CP027063|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
819. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
820. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
821. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
822. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
823. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
824. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
825. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
826. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
827. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
828. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
829. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
830. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
831. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
832. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
833. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
834. spacer 1.10|14733|21|CP027063|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
835. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggtc Protospacer
*********************
836. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
837. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
838. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
839. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
840. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
841. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
842. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
843. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
844. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
845. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
846. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
847. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
848. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
849. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
850. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
851. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
852. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
853. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
854. spacer 1.11|14775|21|CP027063|CRT matches to NC_016980 (Klebsiella pneumoniae plasmid pNDM-MAR, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
855. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
856. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
857. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
858. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
859. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
860. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
861. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
862. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
863. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
864. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
865. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
866. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
867. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
868. spacer 1.11|14775|21|CP027063|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
869. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP037442 (Klebsiella sp. PO552 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
870. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
871. spacer 1.11|14775|21|CP027063|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
872. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
873. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
874. spacer 1.11|14775|21|CP027063|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
875. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
876. spacer 1.11|14775|21|CP027063|CRT matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
877. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
878. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
879. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
880. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP041093 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
881. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
882. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
883. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
884. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
885. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
886. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
887. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
888. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
889. spacer 1.11|14775|21|CP027063|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
890. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
891. spacer 1.11|14775|21|CP027063|CRT matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
892. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
893. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
894. spacer 1.11|14775|21|CP027063|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
895. spacer 1.11|14775|21|CP027063|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
896. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
897. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
898. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
899. spacer 1.11|14775|21|CP027063|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
900. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
901. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
902. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
903. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
904. spacer 1.11|14775|21|CP027063|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
905. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
906. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
907. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
908. spacer 1.11|14775|21|CP027063|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
909. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
910. spacer 1.11|14775|21|CP027063|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
911. spacer 1.11|14775|21|CP027063|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
912. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
913. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
914. spacer 1.11|14775|21|CP027063|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
915. spacer 1.11|14775|21|CP027063|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
916. spacer 1.11|14775|21|CP027063|CRT matches to NZ_MK413719 (Klebsiella pneumoniae strain 362713 plasmid p362713-HI3, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
917. spacer 1.11|14775|21|CP027063|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
918. spacer 1.11|14775|21|CP027063|CRT matches to NZ_MK413722 (Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
919. spacer 1.11|14775|21|CP027063|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
920. spacer 1.11|14775|21|CP027063|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
921. spacer 1.11|14775|21|CP027063|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
922. spacer 1.11|14775|21|CP027063|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccagtgacc Protospacer
*********************
923. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
924. spacer 1.12|14817|21|CP027063|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
925. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
926. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP037442 (Klebsiella sp. PO552 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
927. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
928. spacer 1.12|14817|21|CP027063|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
929. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
930. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
931. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
932. spacer 1.12|14817|21|CP027063|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
933. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
934. spacer 1.12|14817|21|CP027063|CRT matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
935. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
936. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
937. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
938. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
939. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
940. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
941. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP041093 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
942. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
943. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
944. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
945. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
946. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
947. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
948. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
949. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
950. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
951. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
952. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
953. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
954. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
955. spacer 1.12|14817|21|CP027063|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
956. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
957. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
958. spacer 1.12|14817|21|CP027063|CRT matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
959. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
960. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
961. spacer 1.12|14817|21|CP027063|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
962. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
963. spacer 1.12|14817|21|CP027063|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
964. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
965. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
966. spacer 1.12|14817|21|CP027063|CRT matches to NC_016980 (Klebsiella pneumoniae plasmid pNDM-MAR, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
967. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
968. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
969. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
970. spacer 1.12|14817|21|CP027063|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
971. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
972. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
973. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
974. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
975. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
976. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
977. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
978. spacer 1.12|14817|21|CP027063|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
979. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
980. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
981. spacer 1.12|14817|21|CP027063|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
982. spacer 1.12|14817|21|CP027063|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
983. spacer 1.12|14817|21|CP027063|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
984. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
985. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
986. spacer 1.12|14817|21|CP027063|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
987. spacer 1.12|14817|21|CP027063|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
988. spacer 1.12|14817|21|CP027063|CRT matches to NZ_MK413719 (Klebsiella pneumoniae strain 362713 plasmid p362713-HI3, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
989. spacer 1.12|14817|21|CP027063|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
990. spacer 1.12|14817|21|CP027063|CRT matches to NZ_MK413722 (Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
991. spacer 1.12|14817|21|CP027063|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
992. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
993. spacer 1.12|14817|21|CP027063|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
994. spacer 1.12|14817|21|CP027063|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
995. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
996. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtggtc Protospacer
*********************
997. spacer 1.1|14355|21|CP027063|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
998. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
999. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1000. spacer 1.1|14355|21|CP027063|CRT matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1001. spacer 1.1|14355|21|CP027063|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1002. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1003. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1004. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1005. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1006. spacer 1.1|14355|21|CP027063|CRT matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1007. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1008. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1009. spacer 1.1|14355|21|CP027063|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1010. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1011. spacer 1.1|14355|21|CP027063|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1012. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
ccggatccgctaccggtgctc Protospacer
********************
1013. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP026022 (Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1014. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP026022 (Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1015. spacer 1.1|14355|21|CP027063|CRT matches to MN200128 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-Vir-RC, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1016. spacer 1.1|14355|21|CP027063|CRT matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1017. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP019049 (Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1018. spacer 1.1|14355|21|CP027063|CRT matches to NZ_LR134257 (Klebsiella aerogenes strain NCTC9644 plasmid 4, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1019. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1020. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1021. spacer 1.1|14355|21|CP027063|CRT matches to LR134211 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1022. spacer 1.1|14355|21|CP027063|CRT matches to NC_005249 (Klebsiella pneumoniae CG43 plasmid pLVPK, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1023. spacer 1.1|14355|21|CP027063|CRT matches to NC_006625 (Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 plasmid pK2044, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1024. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1025. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1026. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1027. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1028. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1029. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1030. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1031. spacer 1.1|14355|21|CP027063|CRT matches to CP050281 (Klebsiella pneumoniae strain 9949 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1032. spacer 1.1|14355|21|CP027063|CRT matches to CP050281 (Klebsiella pneumoniae strain 9949 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1033. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP042975 (Klebsiella pneumoniae strain KPN55602 plasmid pK55602_1, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1034. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP016815 (Klebsiella pneumoniae strain ED23 plasmid unamed, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1035. spacer 1.1|14355|21|CP027063|CRT matches to NZ_MG053312 (Klebsiella pneumoniae strain KP267 plasmid pVir-CR-HvKP267, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1036. spacer 1.1|14355|21|CP027063|CRT matches to NZ_MG053312 (Klebsiella pneumoniae strain KP267 plasmid pVir-CR-HvKP267, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1037. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1038. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1039. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP025081 (Klebsiella pneumoniae strain SGH10 plasmid pSGH10, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1040. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP014011 (Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1041. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP014011 (Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1042. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP037743 (Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_hv, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1043. spacer 1.1|14355|21|CP027063|CRT matches to MT035874 (Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1044. spacer 1.1|14355|21|CP027063|CRT matches to MT035874 (Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1045. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP033955 (Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1046. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP033955 (Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1047. spacer 1.1|14355|21|CP027063|CRT matches to CP052432 (Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1048. spacer 1.1|14355|21|CP027063|CRT matches to CP052363 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1049. spacer 1.1|14355|21|CP027063|CRT matches to MK347227 (Klebsiella pneumoniae strain K187 plasmid pK187_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1050. spacer 1.1|14355|21|CP027063|CRT matches to MK347228 (Klebsiella pneumoniae strain K195 plasmid pK195_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1051. spacer 1.1|14355|21|CP027063|CRT matches to MK347230 (Klebsiella pneumoniae strain K202 plasmid pK202_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1052. spacer 1.1|14355|21|CP027063|CRT matches to MK347238 (Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1053. spacer 1.1|14355|21|CP027063|CRT matches to MK347238 (Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1054. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1055. spacer 1.1|14355|21|CP027063|CRT matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1056. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1057. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP014009 (Klebsiella pneumoniae subsp. pneumoniae strain RJF293 plasmid pRJF293, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1058. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1059. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1060. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1061. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1062. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP032241 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1063. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP032241 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1064. spacer 1.1|14355|21|CP027063|CRT matches to CP052563 (Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1065. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP047193 (Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1066. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP047193 (Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1067. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1068. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1069. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP032164 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1070. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP032164 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1071. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1072. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1073. spacer 1.1|14355|21|CP027063|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1074. spacer 1.1|14355|21|CP027063|CRT matches to CP052190 (Klebsiella pneumoniae strain F16KP0019 plasmid pF16KP0019-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1075. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP040540 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-VIR, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1076. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1077. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1078. spacer 1.1|14355|21|CP027063|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1079. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP034124 (Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1080. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP034124 (Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1081. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP034124 (Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1082. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1083. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP034083 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-vir, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1084. spacer 1.1|14355|21|CP027063|CRT matches to CP029383 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1085. spacer 1.1|14355|21|CP027063|CRT matches to CP029383 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1086. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP026012 (Klebsiella pneumoniae strain K2044 plasmid pK2044, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1087. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP026024 (Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1088. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP026024 (Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1089. spacer 1.1|14355|21|CP027063|CRT matches to CP050276 (Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1090. spacer 1.1|14355|21|CP027063|CRT matches to CP050276 (Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1091. spacer 1.1|14355|21|CP027063|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1092. spacer 1.1|14355|21|CP027063|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1093. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP026587 (Klebsiella pneumoniae strain NUHL30457 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1094. spacer 1.1|14355|21|CP027063|CRT matches to NZ_LR745043 (Klebsiella pneumoniae isolate Klebsiella pneumoniae kpn154 plasmid pVIR_Kpn154) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1095. spacer 1.1|14355|21|CP027063|CRT matches to NZ_MK413719 (Klebsiella pneumoniae strain 362713 plasmid p362713-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1096. spacer 1.1|14355|21|CP027063|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1097. spacer 1.1|14355|21|CP027063|CRT matches to NC_017541 (Klebsiella pneumoniae KCTC 2242 plasmid pKCTC2242, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1098. spacer 1.1|14355|21|CP027063|CRT matches to NZ_MH255828 (Klebsiella pneumoniae subsp. pneumoniae strain SH9 plasmid pSH9-VIR, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1099. spacer 1.1|14355|21|CP027063|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1100. spacer 1.1|14355|21|CP027063|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1101. spacer 1.1|14355|21|CP027063|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 1, identity: 0.952
acggatccgctaccggtgctc CRISPR spacer
acggatccgctgccggtgctc Protospacer
***********.*********
1102. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
aaagggccgctgccggtgctc Protospacer
* *******************
1103. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
aaagggccgctgccggtgctc Protospacer
* *******************
1104. spacer 1.2|14397|21|CP027063|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
**.******************
1105. spacer 1.2|14397|21|CP027063|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
aaagggccgctgccggtgctc Protospacer
* *******************
1106. spacer 1.2|14397|21|CP027063|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
aaagggccgctgccggtgctc Protospacer
* *******************
1107. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP037442 (Klebsiella sp. PO552 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
**.******************
1108. spacer 1.2|14397|21|CP027063|CRT matches to MT035874 (Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
**.******************
1109. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP033955 (Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
**.******************
1110. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP034776 (Klebsiella pneumoniae strain 18CPO060 plasmid phvKP060, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
**.******************
1111. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
**.******************
1112. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
**.******************
1113. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
**.******************
1114. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
aaagggccgctgccggtgctc Protospacer
* *******************
1115. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
aaagggccgctgccggtgctc Protospacer
* *******************
1116. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
**.******************
1117. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acaggaccgctgccggtgctc Protospacer
*****.***************
1118. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acaggaccgctgccggtgctc Protospacer
*****.***************
1119. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
**.******************
1120. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
**.******************
1121. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
**.******************
1122. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
**.******************
1123. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
**.******************
1124. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
aaagggccgctgccggtgctc Protospacer
* *******************
1125. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
aaagggccgctgccggtgctc Protospacer
* *******************
1126. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acaggaccgctgccggtgctc Protospacer
*****.***************
1127. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
**.******************
1128. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
**.******************
1129. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
**.******************
1130. spacer 1.2|14397|21|CP027063|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
**.******************
1131. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acaggaccgctgccggtgctc Protospacer
*****.***************
1132. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
**.******************
1133. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
**.******************
1134. spacer 1.2|14397|21|CP027063|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
**.******************
1135. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
**.******************
1136. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
aaagggccgctgccggtgctc Protospacer
* *******************
1137. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
**.******************
1138. spacer 1.2|14397|21|CP027063|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acaggaccgctgccggtgctc Protospacer
*****.***************
1139. spacer 1.2|14397|21|CP027063|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
**.******************
1140. spacer 1.2|14397|21|CP027063|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
**.******************
1141. spacer 1.2|14397|21|CP027063|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
**.******************
1142. spacer 1.2|14397|21|CP027063|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
**.******************
1143. spacer 1.2|14397|21|CP027063|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
**.******************
1144. spacer 1.2|14397|21|CP027063|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
**.******************
1145. spacer 1.2|14397|21|CP027063|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
**.******************
1146. spacer 1.2|14397|21|CP027063|CRT matches to NZ_MH263654 (Klebsiella pneumoniae strain QL24 plasmid pKPN-QL24, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
**.******************
1147. spacer 1.2|14397|21|CP027063|CRT matches to NZ_MH263654 (Klebsiella pneumoniae strain QL24 plasmid pKPN-QL24, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
**.******************
1148. spacer 1.2|14397|21|CP027063|CRT matches to NZ_MH263654 (Klebsiella pneumoniae strain QL24 plasmid pKPN-QL24, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
**.******************
1149. spacer 1.2|14397|21|CP027063|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
aaagggccgctgccggtgctc Protospacer
* *******************
1150. spacer 1.2|14397|21|CP027063|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acagggccgctgccagtgctc Protospacer
**************.******
1151. spacer 1.2|14397|21|CP027063|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acagggccgctaccggtgctc Protospacer
***********.*********
1152. spacer 1.2|14397|21|CP027063|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
aaagggccgctgccggtgctc Protospacer
* *******************
1153. spacer 1.2|14397|21|CP027063|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
**.******************
1154. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acaggaccgctgccggtgctc Protospacer
*****.***************
1155. spacer 1.2|14397|21|CP027063|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
aaagggccgctgccggtgctc Protospacer
* *******************
1156. spacer 1.2|14397|21|CP027063|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
aaagggccgctgccggtgctc Protospacer
* *******************
1157. spacer 1.2|14397|21|CP027063|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
**.******************
1158. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
**.******************
1159. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
**.******************
1160. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acagggccactgccggtgctc Protospacer
********.************
1161. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
**.******************
1162. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
**.******************
1163. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
aaagggccgctgccggtgctc Protospacer
* *******************
1164. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
aaagggccgctgccggtgctc Protospacer
* *******************
1165. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
**.******************
1166. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
**.******************
1167. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
**.******************
1168. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
**.******************
1169. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
**.******************
1170. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
**.******************
1171. spacer 1.2|14397|21|CP027063|CRT matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
aaagggccgctgccggtgctc Protospacer
* *******************
1172. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
**.******************
1173. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 1, identity: 0.952
acagggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
**.******************
1174. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtggct Protospacer
*****************.***
1175. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtggct Protospacer
*****************.***
1176. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtggct Protospacer
*****************.***
1177. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtggct Protospacer
*****************.***
1178. spacer 1.3|14439|21|CP027063|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtggct Protospacer
*****************.***
1179. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtggct Protospacer
*****************.***
1180. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.952
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtggct Protospacer
*****************.***
1181. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtggct Protospacer
*****************.***
1182. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 1, identity: 0.952
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtggct Protospacer
*****************.***
1183. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgacggtggct Protospacer
*****************.***
1184. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 1, identity: 0.952
acgtgaccgctgacggtagct CRISPR spacer
atgtgaccgctgacggtagct Protospacer
*.*******************
1185. spacer 1.3|14439|21|CP027063|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtgaccgctgacggtagct CRISPR spacer
atgtgaccgctgacggtagct Protospacer
*.*******************
1186. spacer 1.3|14439|21|CP027063|CRT matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 1, identity: 0.952
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgatggtagct Protospacer
*************.*******
1187. spacer 1.3|14439|21|CP027063|CRT matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 1, identity: 0.952
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgatggtagct Protospacer
*************.*******
1188. spacer 1.3|14439|21|CP027063|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgatggtagct Protospacer
*************.*******
1189. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgatggtagct Protospacer
*************.*******
1190. spacer 1.3|14439|21|CP027063|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 1, identity: 0.952
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgatggtagct Protospacer
*************.*******
1191. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 1, identity: 0.952
acgtgaccgctgacggtagct CRISPR spacer
acgtgaccgctgatggtagct Protospacer
*************.*******
1192. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1193. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1194. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1195. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1196. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1197. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1198. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1199. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1200. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1201. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1202. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1203. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1204. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1205. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1206. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1207. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1208. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1209. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1210. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1211. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1212. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1213. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1214. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1215. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1216. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1217. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1218. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1219. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1220. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1221. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1222. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1223. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1224. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1225. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1226. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1227. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1228. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1229. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1230. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1231. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1232. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1233. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1234. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1235. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1236. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1237. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1238. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1239. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1240. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1241. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1242. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1243. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1244. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1245. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1246. spacer 1.4|14481|21|CP027063|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1247. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1248. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1249. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1250. spacer 1.4|14481|21|CP027063|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1251. spacer 1.4|14481|21|CP027063|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1252. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1253. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1254. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1255. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1256. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1257. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1258. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1259. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1260. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1261. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1262. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1263. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1264. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1265. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1266. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1267. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1268. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1269. spacer 1.4|14481|21|CP027063|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1270. spacer 1.4|14481|21|CP027063|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1271. spacer 1.4|14481|21|CP027063|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1272. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1273. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1274. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1275. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccactgacggtggct Protospacer
********.************
1276. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1277. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1278. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1279. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1280. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1281. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1282. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1283. spacer 1.4|14481|21|CP027063|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1284. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1285. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1286. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1287. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1288. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1289. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1290. spacer 1.4|14481|21|CP027063|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1291. spacer 1.4|14481|21|CP027063|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1292. spacer 1.4|14481|21|CP027063|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1293. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1294. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1295. spacer 1.4|14481|21|CP027063|CRT matches to MF185718 (Arthrobacter phage Colucci, complete genome) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggcc Protospacer
********************.
1296. spacer 1.4|14481|21|CP027063|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
.********************
1297. spacer 1.4|14481|21|CP027063|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1298. spacer 1.4|14481|21|CP027063|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
*** *****************
1299. spacer 1.4|14481|21|CP027063|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1300. spacer 1.4|14481|21|CP027063|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
*** *****************
1301. spacer 1.4|14481|21|CP027063|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgtcggtggct Protospacer
************ ********
1302. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1303. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1304. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
*** *****************
1305. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgtcggtggct Protospacer
************ ********
1306. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgatggtggct Protospacer
*************.*******
1307. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1308. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
*** *****************
1309. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgtcggtggct Protospacer
************ ********
1310. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1311. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
*** *****************
1312. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
*** *****************
1313. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1314. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
*** *****************
1315. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgtcggtggct Protospacer
************ ********
1316. spacer 1.4|14481|21|CP027063|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgtcggtggct Protospacer
************ ********
1317. spacer 1.4|14481|21|CP027063|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
*** *****************
1318. spacer 1.4|14481|21|CP027063|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1319. spacer 1.4|14481|21|CP027063|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1320. spacer 1.4|14481|21|CP027063|CRT matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgatggtggct Protospacer
*************.*******
1321. spacer 1.4|14481|21|CP027063|CRT matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgatggtggct Protospacer
*************.*******
1322. spacer 1.4|14481|21|CP027063|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgatggtggct Protospacer
*************.*******
1323. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgtcggtggct Protospacer
************ ********
1324. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
*** *****************
1325. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1326. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
*** *****************
1327. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1328. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgtcggtggct Protospacer
************ ********
1329. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
*** *****************
1330. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1331. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
*** *****************
1332. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
*** *****************
1333. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1334. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgtcggtggct Protospacer
************ ********
1335. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
*** *****************
1336. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1337. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
*** *****************
1338. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
*** *****************
1339. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtagct Protospacer
*****************.***
1340. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgatggtggct Protospacer
*************.*******
1341. spacer 1.4|14481|21|CP027063|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgatggtggct Protospacer
*************.*******
1342. spacer 1.4|14481|21|CP027063|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
*** *****************
1343. spacer 1.5|14523|21|CP027063|CRT matches to MN200128 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-Vir-RC, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1344. spacer 1.5|14523|21|CP027063|CRT matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1345. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP024708 (Klebsiella pneumoniae strain cr-hvkp3 plasmid pPUTH1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1346. spacer 1.5|14523|21|CP027063|CRT matches to LR134211 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1347. spacer 1.5|14523|21|CP027063|CRT matches to NC_005249 (Klebsiella pneumoniae CG43 plasmid pLVPK, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1348. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1349. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP042975 (Klebsiella pneumoniae strain KPN55602 plasmid pK55602_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1350. spacer 1.5|14523|21|CP027063|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1351. spacer 1.5|14523|21|CP027063|CRT matches to CP052363 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1352. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctt Protospacer
********************.
1353. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1354. spacer 1.5|14523|21|CP027063|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctt Protospacer
********************.
1355. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1356. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1357. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgtcggtgctc Protospacer
************.********
1358. spacer 1.5|14523|21|CP027063|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1359. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1360. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP026587 (Klebsiella pneumoniae strain NUHL30457 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1361. spacer 1.5|14523|21|CP027063|CRT matches to NZ_LR745046 (Klebsiella pneumoniae isolate Kpn2166 plasmid pVIR_Kpn2166) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1362. spacer 1.5|14523|21|CP027063|CRT matches to NZ_LR745043 (Klebsiella pneumoniae isolate Klebsiella pneumoniae kpn154 plasmid pVIR_Kpn154) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1363. spacer 1.5|14523|21|CP027063|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1364. spacer 1.5|14523|21|CP027063|CRT matches to NC_017541 (Klebsiella pneumoniae KCTC 2242 plasmid pKCTC2242, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1365. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1366. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1367. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1368. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1369. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1370. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1371. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1372. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1373. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1374. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1375. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1376. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1377. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1378. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1379. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1380. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1381. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1382. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1383. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1384. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1385. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1386. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1387. spacer 1.5|14523|21|CP027063|CRT matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1388. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1389. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1390. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1391. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1392. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1393. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1394. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1395. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1396. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1397. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1398. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1399. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1400. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1401. spacer 1.5|14523|21|CP027063|CRT matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1402. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1403. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1404. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1405. spacer 1.5|14523|21|CP027063|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1406. spacer 1.5|14523|21|CP027063|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1407. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1408. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1409. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1410. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1411. spacer 1.5|14523|21|CP027063|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1412. spacer 1.5|14523|21|CP027063|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1413. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1414. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1415. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1416. spacer 1.5|14523|21|CP027063|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctt Protospacer
********************.
1417. spacer 1.5|14523|21|CP027063|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1418. spacer 1.5|14523|21|CP027063|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1419. spacer 1.5|14523|21|CP027063|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1420. spacer 1.5|14523|21|CP027063|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1421. spacer 1.5|14523|21|CP027063|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1422. spacer 1.5|14523|21|CP027063|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1423. spacer 1.5|14523|21|CP027063|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1424. spacer 1.5|14523|21|CP027063|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1425. spacer 1.5|14523|21|CP027063|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1426. spacer 1.5|14523|21|CP027063|CRT matches to NZ_MK413719 (Klebsiella pneumoniae strain 362713 plasmid p362713-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1427. spacer 1.5|14523|21|CP027063|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1428. spacer 1.5|14523|21|CP027063|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1429. spacer 1.5|14523|21|CP027063|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1430. spacer 1.5|14523|21|CP027063|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1431. spacer 1.5|14523|21|CP027063|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1432. spacer 1.5|14523|21|CP027063|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1433. spacer 1.5|14523|21|CP027063|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1434. spacer 1.5|14523|21|CP027063|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgttgccggtgctc Protospacer
*********.***********
1435. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgttgccggtgctc Protospacer
*********.***********
1436. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1437. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgttgccggtgctc Protospacer
*********.***********
1438. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1439. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgttgccggtgctc Protospacer
*********.***********
1440. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgttgccggtgctc Protospacer
*********.***********
1441. spacer 1.5|14523|21|CP027063|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgcaggtgctc Protospacer
************* *******
1442. spacer 1.5|14523|21|CP027063|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgttgccggtgctc Protospacer
*********.***********
1443. spacer 1.5|14523|21|CP027063|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1444. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP037442 (Klebsiella sp. PO552 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1445. spacer 1.5|14523|21|CP027063|CRT matches to MT035874 (Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1446. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP033955 (Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1447. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP034776 (Klebsiella pneumoniae strain 18CPO060 plasmid phvKP060, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1448. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgttgccggtgctc Protospacer
*********.***********
1449. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1450. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1451. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1452. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1453. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgttgccggtgctc Protospacer
*********.***********
1454. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgttgccggtgctc Protospacer
*********.***********
1455. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgttgccggtgctc Protospacer
*********.***********
1456. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgttgccggtgctc Protospacer
*********.***********
1457. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1458. spacer 1.5|14523|21|CP027063|CRT matches to NZ_MH263654 (Klebsiella pneumoniae strain QL24 plasmid pKPN-QL24, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1459. spacer 1.5|14523|21|CP027063|CRT matches to NZ_MH263654 (Klebsiella pneumoniae strain QL24 plasmid pKPN-QL24, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1460. spacer 1.5|14523|21|CP027063|CRT matches to NZ_MH263654 (Klebsiella pneumoniae strain QL24 plasmid pKPN-QL24, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1461. spacer 1.6|14565|21|CP027063|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1462. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1463. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1464. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1465. spacer 1.6|14565|21|CP027063|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
.********************
1466. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1467. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1468. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1469. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1470. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1471. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1472. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1473. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1474. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1475. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1476. spacer 1.6|14565|21|CP027063|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
.********************
1477. spacer 1.6|14565|21|CP027063|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
.********************
1478. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
1479. spacer 1.6|14565|21|CP027063|CRT matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
1480. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1481. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
1482. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
1483. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
1484. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
.********************
1485. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
.********************
1486. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
1487. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
1488. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1489. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgggggcgctgacggtggct Protospacer
****** **************
1490. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1491. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1492. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1493. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1494. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
1495. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
1496. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1497. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
.********************
1498. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1499. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1500. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1501. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
.********************
1502. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
.********************
1503. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
.********************
1504. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
1505. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
1506. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
1507. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
.********************
1508. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1509. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1510. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1511. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1512. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1513. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1514. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
1515. spacer 1.6|14565|21|CP027063|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1516. spacer 1.6|14565|21|CP027063|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgggggcgctgacggtggct Protospacer
****** **************
1517. spacer 1.6|14565|21|CP027063|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1518. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
1519. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1520. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1521. spacer 1.6|14565|21|CP027063|CRT matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
1522. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
1523. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
1524. spacer 1.6|14565|21|CP027063|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
1525. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
1526. spacer 1.6|14565|21|CP027063|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1527. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
1528. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1529. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1530. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
1531. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1532. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1533. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
1534. spacer 1.6|14565|21|CP027063|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
1535. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1536. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1537. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
.********************
1538. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
.********************
1539. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
.********************
1540. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
.********************
1541. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
.********************
1542. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
.********************
1543. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
1544. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
1545. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1546. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1547. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1548. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1549. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
1550. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
1551. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
1552. spacer 1.6|14565|21|CP027063|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1553. spacer 1.6|14565|21|CP027063|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
1554. spacer 1.6|14565|21|CP027063|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
1555. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1556. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1557. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1558. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1559. spacer 1.6|14565|21|CP027063|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
1560. spacer 1.6|14565|21|CP027063|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
1561. spacer 1.6|14565|21|CP027063|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
1562. spacer 1.6|14565|21|CP027063|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
1563. spacer 1.6|14565|21|CP027063|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
gcggggccgctgacggtggct Protospacer
.********************
1564. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1565. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1566. spacer 1.6|14565|21|CP027063|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
1567. spacer 1.6|14565|21|CP027063|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
1568. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
1569. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
1570. spacer 1.6|14565|21|CP027063|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1571. spacer 1.6|14565|21|CP027063|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1572. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1573. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1574. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1575. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1576. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
1577. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1578. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1579. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
1580. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
1581. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1582. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1583. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1584. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1585. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1586. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1587. spacer 1.6|14565|21|CP027063|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
1588. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1589. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1590. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1591. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1592. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1593. spacer 1.6|14565|21|CP027063|CRT matches to NZ_MK413719 (Klebsiella pneumoniae strain 362713 plasmid p362713-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
atggggccgctgacggtggct Protospacer
*.*******************
1594. spacer 1.6|14565|21|CP027063|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1595. spacer 1.6|14565|21|CP027063|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.952
acggggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggct Protospacer
*** *****************
1596. spacer 1.7|14607|21|CP027063|CRT matches to MN200128 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-Vir-RC, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1597. spacer 1.7|14607|21|CP027063|CRT matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1598. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP024708 (Klebsiella pneumoniae strain cr-hvkp3 plasmid pPUTH1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1599. spacer 1.7|14607|21|CP027063|CRT matches to LR134211 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1600. spacer 1.7|14607|21|CP027063|CRT matches to NC_005249 (Klebsiella pneumoniae CG43 plasmid pLVPK, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1601. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1602. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP042975 (Klebsiella pneumoniae strain KPN55602 plasmid pK55602_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1603. spacer 1.7|14607|21|CP027063|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1604. spacer 1.7|14607|21|CP027063|CRT matches to CP052363 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1605. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctt Protospacer
********************.
1606. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1607. spacer 1.7|14607|21|CP027063|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctt Protospacer
********************.
1608. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1609. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1610. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgtcggtgctc Protospacer
************.********
1611. spacer 1.7|14607|21|CP027063|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1612. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1613. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP026587 (Klebsiella pneumoniae strain NUHL30457 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1614. spacer 1.7|14607|21|CP027063|CRT matches to NZ_LR745046 (Klebsiella pneumoniae isolate Kpn2166 plasmid pVIR_Kpn2166) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1615. spacer 1.7|14607|21|CP027063|CRT matches to NZ_LR745043 (Klebsiella pneumoniae isolate Klebsiella pneumoniae kpn154 plasmid pVIR_Kpn154) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1616. spacer 1.7|14607|21|CP027063|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1617. spacer 1.7|14607|21|CP027063|CRT matches to NC_017541 (Klebsiella pneumoniae KCTC 2242 plasmid pKCTC2242, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1618. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1619. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1620. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1621. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1622. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1623. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1624. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1625. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1626. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1627. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1628. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1629. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1630. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1631. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1632. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1633. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1634. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1635. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1636. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1637. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1638. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1639. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1640. spacer 1.7|14607|21|CP027063|CRT matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1641. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1642. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1643. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1644. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1645. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1646. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1647. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1648. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1649. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1650. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1651. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1652. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1653. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1654. spacer 1.7|14607|21|CP027063|CRT matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1655. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1656. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1657. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1658. spacer 1.7|14607|21|CP027063|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1659. spacer 1.7|14607|21|CP027063|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1660. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1661. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1662. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1663. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1664. spacer 1.7|14607|21|CP027063|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1665. spacer 1.7|14607|21|CP027063|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1666. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1667. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1668. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1669. spacer 1.7|14607|21|CP027063|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgccggtgctt Protospacer
********************.
1670. spacer 1.7|14607|21|CP027063|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1671. spacer 1.7|14607|21|CP027063|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1672. spacer 1.7|14607|21|CP027063|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1673. spacer 1.7|14607|21|CP027063|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1674. spacer 1.7|14607|21|CP027063|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1675. spacer 1.7|14607|21|CP027063|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1676. spacer 1.7|14607|21|CP027063|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1677. spacer 1.7|14607|21|CP027063|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1678. spacer 1.7|14607|21|CP027063|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1679. spacer 1.7|14607|21|CP027063|CRT matches to NZ_MK413719 (Klebsiella pneumoniae strain 362713 plasmid p362713-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1680. spacer 1.7|14607|21|CP027063|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1681. spacer 1.7|14607|21|CP027063|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1682. spacer 1.7|14607|21|CP027063|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1683. spacer 1.7|14607|21|CP027063|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1684. spacer 1.7|14607|21|CP027063|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1685. spacer 1.7|14607|21|CP027063|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
gcgtggccgctgccggtgctc Protospacer
.********************
1686. spacer 1.7|14607|21|CP027063|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1687. spacer 1.7|14607|21|CP027063|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgttgccggtgctc Protospacer
*********.***********
1688. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgttgccggtgctc Protospacer
*********.***********
1689. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1690. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgttgccggtgctc Protospacer
*********.***********
1691. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1692. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgttgccggtgctc Protospacer
*********.***********
1693. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgttgccggtgctc Protospacer
*********.***********
1694. spacer 1.7|14607|21|CP027063|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgctgcaggtgctc Protospacer
************* *******
1695. spacer 1.7|14607|21|CP027063|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgttgccggtgctc Protospacer
*********.***********
1696. spacer 1.7|14607|21|CP027063|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1697. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP037442 (Klebsiella sp. PO552 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1698. spacer 1.7|14607|21|CP027063|CRT matches to MT035874 (Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1699. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP033955 (Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1700. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP034776 (Klebsiella pneumoniae strain 18CPO060 plasmid phvKP060, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1701. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgttgccggtgctc Protospacer
*********.***********
1702. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1703. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1704. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1705. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1706. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgttgccggtgctc Protospacer
*********.***********
1707. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgttgccggtgctc Protospacer
*********.***********
1708. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgttgccggtgctc Protospacer
*********.***********
1709. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acgtggccgttgccggtgctc Protospacer
*********.***********
1710. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1711. spacer 1.7|14607|21|CP027063|CRT matches to NZ_MH263654 (Klebsiella pneumoniae strain QL24 plasmid pKPN-QL24, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1712. spacer 1.7|14607|21|CP027063|CRT matches to NZ_MH263654 (Klebsiella pneumoniae strain QL24 plasmid pKPN-QL24, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1713. spacer 1.7|14607|21|CP027063|CRT matches to NZ_MH263654 (Klebsiella pneumoniae strain QL24 plasmid pKPN-QL24, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgccggtgctc CRISPR spacer
acggggccgctgccggtgctc Protospacer
*** *****************
1714. spacer 1.8|14649|21|CP027063|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1715. spacer 1.8|14649|21|CP027063|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1716. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1717. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1718. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1719. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1720. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1721. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1722. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1723. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
************* *******
1724. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1725. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1726. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1727. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
************* *******
1728. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1729. spacer 1.8|14649|21|CP027063|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1730. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1731. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1732. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1733. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
************* *******
1734. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1735. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1736. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1737. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1738. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
************* *******
1739. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1740. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1741. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1742. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1743. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
************* *******
1744. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1745. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1746. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1747. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1748. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1749. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtgaccgctgacggtggct Protospacer
*****.***************
1750. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtgaccgctgacggtggct Protospacer
*****.***************
1751. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1752. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1753. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1754. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1755. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1756. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1757. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1758. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1759. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1760. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1761. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1762. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1763. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1764. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1765. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1766. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1767. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
************* *******
1768. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1769. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1770. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1771. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1772. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1773. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1774. spacer 1.8|14649|21|CP027063|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1775. spacer 1.8|14649|21|CP027063|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1776. spacer 1.8|14649|21|CP027063|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1777. spacer 1.8|14649|21|CP027063|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1778. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1779. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1780. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
************* *******
1781. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1782. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1783. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1784. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtgaccgctgacggtggct Protospacer
*****.***************
1785. spacer 1.8|14649|21|CP027063|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1786. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1787. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1788. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1789. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
************* *******
1790. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1791. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1792. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1793. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgactgtggct Protospacer
************** ******
1794. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1795. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1796. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1797. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtgaccgctgacggtggct Protospacer
*****.***************
1798. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1799. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1800. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1801. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
************* *******
1802. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1803. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1804. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1805. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtgaccgctgacggtggct Protospacer
*****.***************
1806. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1807. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1808. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtgaccgctgacggtggct Protospacer
*****.***************
1809. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1810. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1811. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1812. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
************* *******
1813. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1814. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1815. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1816. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
************* *******
1817. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1818. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1819. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1820. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtgaccgctgacggtggct Protospacer
*****.***************
1821. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1822. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1823. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1824. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtgaccgctgacggtggct Protospacer
*****.***************
1825. spacer 1.8|14649|21|CP027063|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1826. spacer 1.8|14649|21|CP027063|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1827. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1828. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1829. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1830. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
************* *******
1831. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1832. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1833. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1834. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1835. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
************* *******
1836. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1837. spacer 1.8|14649|21|CP027063|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1838. spacer 1.8|14649|21|CP027063|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1839. spacer 1.8|14649|21|CP027063|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtgaccgctgacggtggct Protospacer
*****.***************
1840. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1841. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1842. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1843. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1844. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgaaggtggct Protospacer
************* *******
1845. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1846. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1847. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1848. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1849. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP041093 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1850. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1851. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1852. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1853. spacer 1.8|14649|21|CP027063|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1854. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggct Protospacer
.********************
1855. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acgtgaccgctgacggtggct Protospacer
*****.***************
1856. spacer 1.8|14649|21|CP027063|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1857. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP025081 (Klebsiella pneumoniae strain SGH10 plasmid pSGH10, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1858. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP030924 (Klebsiella pneumoniae subsp. pneumoniae strain KC-Pl-HB1 plasmid pKC-Pl-HB1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1859. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP026022 (Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1860. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP014011 (Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1861. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP037743 (Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_hv, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1862. spacer 1.8|14649|21|CP027063|CRT matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1863. spacer 1.8|14649|21|CP027063|CRT matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1864. spacer 1.8|14649|21|CP027063|CRT matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1865. spacer 1.8|14649|21|CP027063|CRT matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1866. spacer 1.8|14649|21|CP027063|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1867. spacer 1.8|14649|21|CP027063|CRT matches to CP052432 (Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1868. spacer 1.8|14649|21|CP027063|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1869. spacer 1.8|14649|21|CP027063|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1870. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP019049 (Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1871. spacer 1.8|14649|21|CP027063|CRT matches to MK347238 (Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1872. spacer 1.8|14649|21|CP027063|CRT matches to MK347238 (Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1873. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1874. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1875. spacer 1.8|14649|21|CP027063|CRT matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1876. spacer 1.8|14649|21|CP027063|CRT matches to NZ_LR134257 (Klebsiella aerogenes strain NCTC9644 plasmid 4, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1877. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1878. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1879. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP014009 (Klebsiella pneumoniae subsp. pneumoniae strain RJF293 plasmid pRJF293, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1880. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1881. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1882. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1883. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1884. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1885. spacer 1.8|14649|21|CP027063|CRT matches to LR134211 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1886. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1887. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1888. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1889. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1890. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1891. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1892. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1893. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1894. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP032241 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1895. spacer 1.8|14649|21|CP027063|CRT matches to NC_006625 (Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 plasmid pK2044, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1896. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1897. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1898. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1899. spacer 1.8|14649|21|CP027063|CRT matches to NC_019789 (Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1900. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1901. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1902. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1903. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1904. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1905. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1906. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1907. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP047193 (Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1908. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1909. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1910. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1911. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1912. spacer 1.8|14649|21|CP027063|CRT matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1913. spacer 1.8|14649|21|CP027063|CRT matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1914. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP032164 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1915. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1916. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1917. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1918. spacer 1.8|14649|21|CP027063|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1919. spacer 1.8|14649|21|CP027063|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1920. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1921. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1922. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1923. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1924. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP040540 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-VIR, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1925. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1926. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1927. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1928. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1929. spacer 1.8|14649|21|CP027063|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1930. spacer 1.8|14649|21|CP027063|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1931. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1932. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1933. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP052037 (Klebsiella pneumoniae strain KPN41053 plasmid pKPN41953, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1934. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1935. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1936. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1937. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1938. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1939. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1940. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1941. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1942. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP034083 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-vir, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1943. spacer 1.8|14649|21|CP027063|CRT matches to CP050281 (Klebsiella pneumoniae strain 9949 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1944. spacer 1.8|14649|21|CP027063|CRT matches to CP029383 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1945. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1946. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1947. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP026012 (Klebsiella pneumoniae strain K2044 plasmid pK2044, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1948. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP026024 (Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1949. spacer 1.8|14649|21|CP027063|CRT matches to NZ_AP019549 (Klebsiella pneumoniae strain THC11 plasmid pTHC11-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1950. spacer 1.8|14649|21|CP027063|CRT matches to CP050276 (Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1951. spacer 1.8|14649|21|CP027063|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1952. spacer 1.8|14649|21|CP027063|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1953. spacer 1.8|14649|21|CP027063|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1954. spacer 1.8|14649|21|CP027063|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1955. spacer 1.8|14649|21|CP027063|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1956. spacer 1.8|14649|21|CP027063|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1957. spacer 1.8|14649|21|CP027063|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1958. spacer 1.8|14649|21|CP027063|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1959. spacer 1.8|14649|21|CP027063|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1960. spacer 1.8|14649|21|CP027063|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1961. spacer 1.8|14649|21|CP027063|CRT matches to NZ_MK413722 (Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1962. spacer 1.8|14649|21|CP027063|CRT matches to NC_017541 (Klebsiella pneumoniae KCTC 2242 plasmid pKCTC2242, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1963. spacer 1.8|14649|21|CP027063|CRT matches to NZ_MH255828 (Klebsiella pneumoniae subsp. pneumoniae strain SH9 plasmid pSH9-VIR, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1964. spacer 1.8|14649|21|CP027063|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1965. spacer 1.8|14649|21|CP027063|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1966. spacer 1.8|14649|21|CP027063|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1967. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP016815 (Klebsiella pneumoniae strain ED23 plasmid unamed, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1968. spacer 1.8|14649|21|CP027063|CRT matches to NZ_MG053312 (Klebsiella pneumoniae strain KP267 plasmid pVir-CR-HvKP267, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1969. spacer 1.8|14649|21|CP027063|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1970. spacer 1.8|14649|21|CP027063|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1971. spacer 1.8|14649|21|CP027063|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1972. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1973. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1974. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1975. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 1, identity: 0.952
acgtggccgctgacggtggct CRISPR spacer
acggggccgctgacggtggct Protospacer
*** *****************
1976. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 1, identity: 0.952
acgggaccgctgccggtagtc CRISPR spacer
acggggccgctgccggtagtc Protospacer
*****.***************
1977. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 1, identity: 0.952
acgggaccgctgccggtagtc CRISPR spacer
acggggccgctgccggtagtc Protospacer
*****.***************
1978. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP024582 (Roseomonas sp. FDAARGOS_362 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggcggctgtcggtggtc Protospacer
******* *************
1979. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
acaggggcgataccagtgacc CRISPR spacer
acagggacgataccagtgacc Protospacer
******.**************
1980. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.952
acaggggcgataccagtgacc CRISPR spacer
acaggggcgataccggtgacc Protospacer
**************.******
1981. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtgatc Protospacer
******************.**
1982. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtgatc Protospacer
******************.**
1983. spacer 1.12|14817|21|CP027063|CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggtcgctgctggtggtc CRISPR spacer
gcgttgtcgctgctggtggtc Protospacer
**** ****************
1984. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 1, identity: 0.952
gcgtggtcgctgctggtggtc CRISPR spacer
gcgttgtcgctgctggtggtc Protospacer
**** ****************
1985. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtgatc Protospacer
******************.**
1986. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtgatc Protospacer
******************.**
1987. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtgatc Protospacer
******************.**
1988. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtgatc Protospacer
******************.**
1989. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtgatc Protospacer
******************.**
1990. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtgatc Protospacer
******************.**
1991. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtgatc Protospacer
******************.**
1992. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtgatc Protospacer
******************.**
1993. spacer 1.12|14817|21|CP027063|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.952
gcgtggtcgctgctggtggtc CRISPR spacer
gcgtggtcgctgctggtgatc Protospacer
******************.**
1994. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.905
acgtggccgctgccggtgctc CRISPR spacer
gtgtggccgctgccggtgctc Protospacer
..*******************
1995. spacer 1.6|14565|21|CP027063|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 2, identity: 0.905
acggggccgctgacggtggct CRISPR spacer
gaggggccgctgacggtggct Protospacer
. *******************
1996. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.905
acgtggccgctgccggtgctc CRISPR spacer
gtgtggccgctgccggtgctc Protospacer
..*******************
1997. spacer 1.8|14649|21|CP027063|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 2, identity: 0.905
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggtc Protospacer
*******************..
1998. spacer 1.8|14649|21|CP027063|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 2, identity: 0.905
acgtggccgctgacggtggct CRISPR spacer
acgtggccgctgacggtggtc Protospacer
*******************..
1999. spacer 1.8|14649|21|CP027063|CRT matches to MF185718 (Arthrobacter phage Colucci, complete genome) position: , mismatch: 2, identity: 0.905
acgtggccgctgacggtggct CRISPR spacer
gcgtggccgctgacggtggcc Protospacer
.*******************.
2000. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP030828 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750a, complete sequence) position: , mismatch: 2, identity: 0.905
acgggaccgctgccggtagtc CRISPR spacer
gcgggaccgctgccggtagtt Protospacer
.*******************.
2001. spacer 1.10|14733|21|CP027063|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.905
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggct Protospacer
*******************..
2002. spacer 1.10|14733|21|CP027063|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 2, identity: 0.905
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggct Protospacer
*******************..
2003. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 2, identity: 0.905
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggct Protospacer
*******************..
2004. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.905
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggct Protospacer
*******************..
2005. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 2, identity: 0.905
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggct Protospacer
*******************..
2006. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 2, identity: 0.905
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggct Protospacer
*******************..
2007. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.905
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggct Protospacer
*******************..
2008. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 2, identity: 0.905
gcgtggccgctgtcggtggtc CRISPR spacer
gcgtggccgctgtcggtggct Protospacer
*******************..