Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP027064 Klebsiella variicola strain WCHKV030666 chromosome, complete genome 3 crisprs csa3,cas3,DEDDh,DinG,cas3HD,WYL 0 1 10 0
CP027063 Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence 1 crisprs DEDDh 0 12 1 0

Results visualization

1. CP027064
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027064_1 3996511-3996619 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027064_2 4460151-4460288 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027064_3 4765145-4765269 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP027064_3 3.1|4765188|39|CP027064|CRISPRCasFinder 4765188-4765226 39 CP052361 Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-5, complete sequence 5211-5249 9 0.769
CP027064_3 3.1|4765188|39|CP027064|CRISPRCasFinder 4765188-4765226 39 CP052429 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-2, complete sequence 1930-1968 9 0.769
CP027064_3 3.1|4765188|39|CP027064|CRISPRCasFinder 4765188-4765226 39 NZ_KU295136 Escherichia coli strain BK28610 plasmid pBK28610, complete sequence 14121-14159 9 0.769
CP027064_3 3.1|4765188|39|CP027064|CRISPRCasFinder 4765188-4765226 39 NZ_CP010366 Enterobacter hormaechei subsp. oharae strain 34978 plasmid p34978-13.828kb, complete sequence 4109-4147 9 0.769

1. spacer 3.1|4765188|39|CP027064|CRISPRCasFinder matches to CP052361 (Klebsiella pneumoniae strain D16KP0144 plasmid pD16KP0144-5, complete sequence) position: , mismatch: 9, identity: 0.769

---ggtaaatgcaaaaaggcaacgcaagttgccttttttagg	CRISPR spacer
ccggctgaa---aaaaaggcaccgcaaggtgccttttttaca	Protospacer
   * *.**   ********* ****** *********** .

2. spacer 3.1|4765188|39|CP027064|CRISPRCasFinder matches to CP052429 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-2, complete sequence) position: , mismatch: 9, identity: 0.769

---ggtaaatgcaaaaaggcaacgcaagttgccttttttagg	CRISPR spacer
ccggctgaa---aaaaaggcaccgcaaggtgccttttttaca	Protospacer
   * *.**   ********* ****** *********** .

3. spacer 3.1|4765188|39|CP027064|CRISPRCasFinder matches to NZ_KU295136 (Escherichia coli strain BK28610 plasmid pBK28610, complete sequence) position: , mismatch: 9, identity: 0.769

--ggtaaatgcaaaaaggcaacgcaagttgccttttttagg	CRISPR spacer
cggctgaa--aaaaaaggcaccgcaaggtgccttttttaca	Protospacer
  * *.**   ********* ****** *********** .

4. spacer 3.1|4765188|39|CP027064|CRISPRCasFinder matches to NZ_CP010366 (Enterobacter hormaechei subsp. oharae strain 34978 plasmid p34978-13.828kb, complete sequence) position: , mismatch: 9, identity: 0.769

--ggtaaatgcaaaaaggcaacgcaagttgccttttttagg	CRISPR spacer
cggctgaa--aaaaaaggcaccgcaaggtgccttttttaca	Protospacer
  * *.**   ********* ****** *********** .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1187604 : 1196691 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_2 1646672 : 1653598 6 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_3 1925970 : 1976334 58 Enterobacteria_phage(40.62%) capsid,tRNA,tail,portal,plate,integrase,terminase attL 1927841:1927857|attR 1963434:1963450
DBSCAN-SWA_4 2758011 : 2768892 9 Escherichia_phage(87.5%) NA NA
DBSCAN-SWA_5 2860194 : 2902502 64 Salmonella_phage(34.04%) head,holin,tail,integrase attL 2858369:2858383|attR 2862806:2862820
DBSCAN-SWA_6 3021084 : 3033672 8 Klebsiella_phage(62.5%) tail NA
DBSCAN-SWA_7 3036739 : 3080494 60 Salmonella_phage(29.55%) coat,holin,tRNA,terminase NA
DBSCAN-SWA_8 3394230 : 3441975 52 Enterobacteria_phage(22.22%) head,capsid,tRNA,tail,portal,protease,holin,integrase,terminase attL 3408430:3408444|attR 3443579:3443593
DBSCAN-SWA_9 3684082 : 3693530 8 Brazilian_cedratvirus(16.67%) protease,tRNA NA
DBSCAN-SWA_10 4197110 : 4210998 14 Morganella_phage(20.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP027063
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027063_1 14334-14858 Orphan NA
12 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP050836 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence 123178-123198 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 39435-39455 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 145355-145375 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 149908-149928 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 150034-150054 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 344909-344929 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 174177-174197 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP027063 Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence 14355-14375 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP026172 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence 44604-44624 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP026172 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence 44856-44876 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP019161 Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence 196253-196273 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP009865 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence 45776-45796 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP004000 Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence 44971-44991 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP004000 Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence 45097-45117 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 94321-94341 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 94573-94593 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP026398 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence 134244-134264 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP026398 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence 134496-134516 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 162441-162461 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 162693-162713 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 166114-166134 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP017451 Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence 300152-300172 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 301738-301758 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 231659-231679 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 76440-76460 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 7577-7597 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 94393-94413 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 2520-2540 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 153396-153416 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 1552-1572 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 CP052329 Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence 117202-117222 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_KX029332 Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence 1930-1950 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_KX029332 Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence 2056-2076 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 294561-294581 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 294813-294833 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 CP052400 Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence 123053-123073 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 MN543585 Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence 181694-181714 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 134688-134708 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 115131-115151 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 MN543571 Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence 107420-107440 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 121187-121207 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 156508-156528 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 156634-156654 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP013713 Klebsiella pneumoniae strain J1 plasmid 2, complete sequence 6021-6041 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP042482 Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence 200923-200943 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP024875 Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence 126002-126022 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 157194-157214 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 157320-157340 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP031582 Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence 87176-87196 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP031582 Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence 87302-87322 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP015026 Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence 120755-120775 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 MF943217 Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence 141279-141299 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 118677-118697 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 118951-118971 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 188302-188322 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP032915 Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence 20570-20590 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP032208 Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence 127895-127915 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 196803-196823 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP050827 Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence 91095-91115 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 12875-12895 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 13127-13147 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 1887-1907 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP028390 Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence 192511-192531 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP034054 Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence 1594-1614 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 144560-144580 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP034046 Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence 1594-1614 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 212268-212288 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 164786-164806 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 134261-134281 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 197989-198009 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 160155-160175 0 1.0
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 1510-1530 0 1.0
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 CP052329 Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence 117160-117180 0 1.0
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 294771-294791 0 1.0
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 CP052400 Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence 123011-123031 0 1.0
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 MN543585 Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence 181652-181672 0 1.0
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 134646-134666 0 1.0
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 115089-115109 0 1.0
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 MN543571 Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence 107378-107398 0 1.0
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 121145-121165 0 1.0
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 174135-174155 0 1.0
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 344951-344971 0 1.0
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP041093 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence 149413-149433 0 1.0
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP013713 Klebsiella pneumoniae strain J1 plasmid 2, complete sequence 5979-5999 0 1.0
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 119200-119220 0 1.0
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 118635-118655 0 1.0
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 118909-118929 0 1.0
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP032915 Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence 20528-20548 0 1.0
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 196761-196781 0 1.0
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP050827 Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence 91053-91073 0 1.0
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 13085-13105 0 1.0
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP034054 Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence 1552-1572 0 1.0
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 144518-144538 0 1.0
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 118906-118926 0 1.0
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP034046 Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence 1552-1572 0 1.0
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 212226-212246 0 1.0
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 164744-164764 0 1.0
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 134219-134239 0 1.0
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 197947-197967 0 1.0
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 39477-39497 0 1.0
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 145397-145417 0 1.0
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP027063 Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence 14397-14417 0 1.0
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP026172 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence 44646-44666 0 1.0
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP026172 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence 44898-44918 0 1.0
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 34024-34044 0 1.0
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 94363-94383 0 1.0
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP026398 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence 134286-134306 0 1.0
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP026398 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence 134538-134558 0 1.0
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 162483-162503 0 1.0
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 166156-166176 0 1.0
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP017451 Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence 300194-300214 0 1.0
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 301780-301800 0 1.0
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 231701-231721 0 1.0
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 76482-76502 0 1.0
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 7619-7639 0 1.0
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP021699 Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence 326765-326785 0 1.0
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 94435-94455 0 1.0
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 153438-153458 0 1.0
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 CP052329 Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence 117118-117138 0 1.0
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 134604-134624 0 1.0
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 115047-115067 0 1.0
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 174093-174113 0 1.0
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 344993-345013 0 1.0
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 NZ_CP041093 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence 149371-149391 0 1.0
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 NZ_CP013713 Klebsiella pneumoniae strain J1 plasmid 2, complete sequence 5937-5957 0 1.0
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 NZ_CP042482 Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence 200839-200859 0 1.0
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 NZ_CP024875 Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence 125918-125938 0 1.0
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 NZ_CP015026 Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence 120671-120691 0 1.0
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 119158-119178 0 1.0
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 188218-188238 0 1.0
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 NZ_CP032915 Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence 20486-20506 0 1.0
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 196719-196739 0 1.0
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 NZ_CP050827 Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence 91011-91031 0 1.0
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 1803-1823 0 1.0
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 NZ_CP034054 Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence 1510-1530 0 1.0
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 118864-118884 0 1.0
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 NZ_CP034046 Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence 1510-1530 0 1.0
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 212184-212204 0 1.0
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 164702-164722 0 1.0
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 197905-197925 0 1.0
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 NZ_CP050836 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence 123262-123282 0 1.0
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 39519-39539 0 1.0
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 145439-145459 0 1.0
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 NZ_CP027063 Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence 14439-14459 0 1.0
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 166198-166218 0 1.0
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 NZ_CP017451 Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence 463002-463022 0 1.0
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 301822-301842 0 1.0
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 231743-231763 0 1.0
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 76524-76544 0 1.0
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 7661-7681 0 1.0
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 NZ_CP021699 Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence 326807-326827 0 1.0
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 94477-94497 0 1.0
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 153480-153500 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP050836 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence 123304-123324 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP050836 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence 123850-123870 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 39561-39581 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 39981-40001 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 145481-145501 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 145901-145921 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 345035-345055 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 345497-345517 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 173589-173609 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 174051-174071 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP027063 Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence 14481-14501 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP019161 Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence 196566-196586 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 94951-94971 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 163071-163091 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 166240-166260 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 166702-166722 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP017451 Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence 463044-463064 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP017451 Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence 463464-463484 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 301864-301884 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 302326-302346 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 231785-231805 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 232205-232225 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 76566-76586 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 77028-77048 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 7703-7723 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 8123-8143 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP021699 Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence 326849-326869 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP021699 Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence 327311-327331 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 94519-94539 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 94981-95001 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 153522-153542 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 153564-153584 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 154003-154023 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 1258-1278 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 1300-1320 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 1426-1446 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 CP052329 Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence 117076-117096 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 294183-294203 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 CP052400 Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence 122927-122947 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 134142-134162 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 134562-134582 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 114585-114605 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 115005-115025 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP041093 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence 149329-149349 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP013713 Klebsiella pneumoniae strain J1 plasmid 2, complete sequence 5414-5434 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP013713 Klebsiella pneumoniae strain J1 plasmid 2, complete sequence 5895-5915 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP042482 Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence 200797-200817 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP024875 Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence 125330-125350 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP024875 Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence 125876-125896 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP015026 Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence 120083-120103 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP015026 Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence 120629-120649 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 118696-118716 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 119116-119136 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 188176-188196 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP032915 Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence 19963-19983 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 196215-196235 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 196677-196697 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP050827 Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence 90969-90989 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 12497-12517 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 1761-1781 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP034054 Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence 1468-1488 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 118822-118842 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP034046 Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence 1468-1488 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 211722-211742 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 212142-212162 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 164240-164260 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 164660-164680 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 197401-197421 0 1.0
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 197863-197883 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP050836 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence 123346-123366 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP050836 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence 123892-123912 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 39603-39623 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 40023-40043 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 MN200128 Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-Vir-RC, complete sequence 214404-214424 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 MN200130 Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence 329221-329241 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 145523-145543 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 145943-145963 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP024708 Klebsiella pneumoniae strain cr-hvkp3 plasmid pPUTH1, complete sequence 12824-12844 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 345077-345097 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 345539-345559 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 173547-173567 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 174009-174029 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP027063 Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence 14523-14543 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP027063 Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence 14607-14627 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 LR134211 Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2 202796-202816 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NC_005249 Klebsiella pneumoniae CG43 plasmid pLVPK, complete sequence 217763-217783 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP019161 Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence 196608-196628 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP019161 Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence 196692-196712 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP009865 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence 45944-45964 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 94993-95013 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 163113-163133 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 166282-166302 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 166744-166764 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP017451 Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence 463086-463106 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP017451 Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence 463506-463526 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 301906-301926 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 302368-302388 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 231827-231847 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 232247-232267 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 76608-76628 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 77070-77090 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 7745-7765 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 8165-8185 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP021699 Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence 326891-326911 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP021699 Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence 327353-327373 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP042975 Klebsiella pneumoniae strain KPN55602 plasmid pK55602_1, complete sequence 41915-41935 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 94561-94581 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 95023-95043 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 153606-153626 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 154045-154065 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 1384-1404 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 294141-294161 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 CP052400 Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence 122885-122905 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 MN543585 Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence 181526-181546 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 134100-134120 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 134520-134540 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 114543-114563 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 114963-114983 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 MN543571 Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence 107252-107272 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 CP052363 Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-1, complete sequence 201325-201345 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 121019-121039 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP013713 Klebsiella pneumoniae strain J1 plasmid 2, complete sequence 5372-5392 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP042482 Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence 200755-200775 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP024875 Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence 125288-125308 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP024875 Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence 125834-125854 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP015026 Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence 120041-120061 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP015026 Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence 120587-120607 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 118654-118674 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 188134-188154 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP032915 Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence 19921-19941 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 196173-196193 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 196635-196655 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP050827 Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence 90927-90947 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 12455-12475 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 1719-1739 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP034054 Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence 1426-1446 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 144392-144412 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP034046 Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence 1426-1446 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP026587 Klebsiella pneumoniae strain NUHL30457 plasmid p1, complete sequence 134199-134219 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 211680-211700 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 212100-212120 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_LR745046 Klebsiella pneumoniae isolate Kpn2166 plasmid pVIR_Kpn2166 209567-209587 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_LR745043 Klebsiella pneumoniae isolate Klebsiella pneumoniae kpn154 plasmid pVIR_Kpn154 198418-198438 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 164198-164218 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 164618-164638 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 134093-134113 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NC_017541 Klebsiella pneumoniae KCTC 2242 plasmid pKCTC2242, complete sequence 139598-139618 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 197359-197379 0 1.0
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 197821-197841 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 CP052329 Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence 116805-116825 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP050836 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence 123640-123660 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP050836 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence 123934-123954 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_KX029332 Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence 1216-1236 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP025081 Klebsiella pneumoniae strain SGH10 plasmid pSGH10, complete sequence 212327-212347 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 39771-39791 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 40065-40085 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP030924 Klebsiella pneumoniae subsp. pneumoniae strain KC-Pl-HB1 plasmid pKC-Pl-HB1, complete sequence 75554-75574 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP026022 Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence 75502-75522 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP014011 Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence 109389-109409 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP037743 Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_hv, complete sequence 209956-209976 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 294099-294119 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 294393-294413 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 MN543585 Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence 181087-181107 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 MN543585 Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence 181213-181233 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 145691-145711 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 145985-146005 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 134058-134078 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 134352-134372 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 114501-114521 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 114795-114815 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 MN543571 Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence 106813-106833 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 MN543571 Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence 106939-106959 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 150748-150768 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 CP052432 Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-1, complete sequence 162141-162161 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 120622-120642 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 120748-120768 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP019049 Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence 131337-131357 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 MK347238 Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence 158952-158972 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 MK347238 Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence 159204-159224 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP020854 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence 103159-103179 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP020854 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence 103285-103305 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 LC549807 Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence 281390-281410 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_LR134257 Klebsiella aerogenes strain NCTC9644 plasmid 4, complete sequence 77117-77137 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP027063 Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence 14565-14585 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP031563 Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence 235190-235210 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP031563 Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence 235316-235336 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP014009 Klebsiella pneumoniae subsp. pneumoniae strain RJF293 plasmid pRJF293, complete sequence 44108-44128 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP012754 Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence 252382-252402 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP012754 Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence 252508-252528 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP031736 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence 34531-34551 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP031736 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence 34657-34677 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 155794-155814 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 LR134211 Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2 202544-202564 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP031799 Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence 117988-118008 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP031799 Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence 118114-118134 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP036336 Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence 24422-24442 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP036336 Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence 24548-24568 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP013713 Klebsiella pneumoniae strain J1 plasmid 2, complete sequence 5330-5350 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP013713 Klebsiella pneumoniae strain J1 plasmid 2, complete sequence 5624-5644 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP024875 Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence 125246-125266 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP024875 Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence 125540-125560 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP021958 Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u 125635-125655 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP021958 Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u 125761-125781 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP021961 Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence 71007-71027 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP021961 Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence 71133-71153 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP032241 Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence 218346-218366 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NC_006625 Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 plasmid pK2044, complete sequence 146350-146370 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP026172 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence 45275-45295 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 296739-296759 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 34318-34338 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP019161 Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence 196356-196376 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP019161 Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence 196650-196670 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP031582 Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence 86336-86356 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NC_019789 Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence 281828-281848 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP009865 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence 46257-46277 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP009865 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence 46383-46403 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP044036 Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence 27806-27826 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP044036 Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence 27932-27952 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP008933 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence 183458-183478 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP008933 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence 183584-183604 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP004000 Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence 45769-45789 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 94741-94761 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 95035-95055 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP015026 Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence 119999-120019 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP015026 Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence 120293-120313 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP026398 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence 134915-134935 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP047193 Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence 164013-164033 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 6696-6716 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 6822-6842 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 118612-118632 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 118906-118926 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP028929 Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence 198233-198253 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP028929 Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence 198359-198379 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 162861-162881 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 163155-163175 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 MF943217 Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence 140901-140921 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 MF943217 Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence 140943-140963 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP032164 Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence 182448-182468 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP016921 Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence 82220-82240 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP016921 Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence 82346-82366 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 205886-205906 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 CP050156 Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence 1468-1488 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 CP050156 Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence 1594-1614 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 108380-108400 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 108506-108526 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 118298-118318 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP023917 Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence 135057-135077 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP023917 Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence 135183-135203 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP040540 Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-VIR, complete sequence 158958-158978 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP017451 Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence 463254-463274 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP017451 Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence 463548-463568 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP020902 Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence 108421-108441 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP020902 Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence 108547-108567 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP032915 Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence 19879-19899 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP032915 Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence 20173-20193 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP045675 Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence 161455-161475 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP045675 Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence 161581-161601 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 139466-139486 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 139592-139612 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 231995-232015 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 232289-232309 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP032208 Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence 127013-127033 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 66604-66624 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP052037 Klebsiella pneumoniae strain KPN41053 plasmid pKPN41953, complete sequence 179746-179766 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP040595 Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence 216162-216182 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP040595 Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence 216288-216308 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP006799 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence 262125-262145 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP006799 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence 262251-262271 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 7913-7933 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 8207-8227 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 12413-12433 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 12707-12727 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 190410-190430 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 190536-190556 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP028390 Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence 192133-192153 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP028390 Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence 192175-192195 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP034083 Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-vir, complete sequence 212360-212380 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 CP050281 Klebsiella pneumoniae strain 9949 plasmid unnamed1, complete sequence 105596-105616 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 CP029383 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence 161582-161602 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 143953-143973 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 144079-144099 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP026012 Klebsiella pneumoniae strain K2044 plasmid pK2044, complete sequence 77782-77802 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP026024 Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence 113436-113456 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_AP019549 Klebsiella pneumoniae strain THC11 plasmid pTHC11-1, complete sequence 227094-227114 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 118612-118632 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 CP050276 Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence 203837-203857 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 MK649822 Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence 166498-166518 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 MK649822 Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence 166624-166644 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 MK649822 Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence 166750-166770 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 MK649825 Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence 173123-173143 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 MK649825 Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence 173249-173269 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 211638-211658 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 211932-211952 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 164156-164176 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 164450-164470 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 1468-1488 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 1594-1614 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 133654-133674 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 133780-133800 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_MK413721 Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence 1468-1488 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_MK413722 Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence 1216-1236 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NC_017541 Klebsiella pneumoniae KCTC 2242 plasmid pKCTC2242, complete sequence 139850-139870 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_MH255828 Klebsiella pneumoniae subsp. pneumoniae strain SH9 plasmid pSH9-VIR, complete sequence 169375-169395 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 194250-194270 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 194376-194396 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 159482-159502 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP016815 Klebsiella pneumoniae strain ED23 plasmid unamed, complete sequence 134966-134986 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 153793-153813 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 154087-154107 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_MG053312 Klebsiella pneumoniae strain KP267 plasmid pVir-CR-HvKP267, complete sequence 133103-133123 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 1468-1488 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 1594-1614 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 1468-1488 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP025462 Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence 164384-164404 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP025462 Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence 164510-164530 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP034406 Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence 220941-220961 0 1.0
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP034406 Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence 221067-221087 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP050836 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence 123346-123366 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP050836 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence 123892-123912 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 39603-39623 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 40023-40043 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 MN200128 Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-Vir-RC, complete sequence 214404-214424 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 MN200130 Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence 329221-329241 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 145523-145543 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 145943-145963 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP024708 Klebsiella pneumoniae strain cr-hvkp3 plasmid pPUTH1, complete sequence 12824-12844 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 345077-345097 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 345539-345559 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 173547-173567 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 174009-174029 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP027063 Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence 14523-14543 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP027063 Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence 14607-14627 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 LR134211 Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2 202796-202816 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NC_005249 Klebsiella pneumoniae CG43 plasmid pLVPK, complete sequence 217763-217783 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP019161 Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence 196608-196628 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP019161 Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence 196692-196712 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP009865 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence 45944-45964 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 94993-95013 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 163113-163133 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 166282-166302 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 166744-166764 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP017451 Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence 463086-463106 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP017451 Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence 463506-463526 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 301906-301926 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 302368-302388 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 231827-231847 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 232247-232267 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 76608-76628 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 77070-77090 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 7745-7765 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 8165-8185 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP021699 Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence 326891-326911 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP021699 Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence 327353-327373 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP042975 Klebsiella pneumoniae strain KPN55602 plasmid pK55602_1, complete sequence 41915-41935 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 94561-94581 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 95023-95043 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 153606-153626 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 154045-154065 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 1384-1404 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 294141-294161 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 CP052400 Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence 122885-122905 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 MN543585 Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence 181526-181546 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 134100-134120 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 134520-134540 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 114543-114563 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 114963-114983 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 MN543571 Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence 107252-107272 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 CP052363 Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-1, complete sequence 201325-201345 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 121019-121039 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP013713 Klebsiella pneumoniae strain J1 plasmid 2, complete sequence 5372-5392 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP042482 Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence 200755-200775 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP024875 Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence 125288-125308 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP024875 Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence 125834-125854 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP015026 Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence 120041-120061 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP015026 Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence 120587-120607 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 118654-118674 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 188134-188154 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP032915 Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence 19921-19941 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 196173-196193 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 196635-196655 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP050827 Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence 90927-90947 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 12455-12475 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 1719-1739 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP034054 Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence 1426-1446 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 144392-144412 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP034046 Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence 1426-1446 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP026587 Klebsiella pneumoniae strain NUHL30457 plasmid p1, complete sequence 134199-134219 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 211680-211700 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 212100-212120 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_LR745046 Klebsiella pneumoniae isolate Kpn2166 plasmid pVIR_Kpn2166 209567-209587 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_LR745043 Klebsiella pneumoniae isolate Klebsiella pneumoniae kpn154 plasmid pVIR_Kpn154 198418-198438 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 164198-164218 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 164618-164638 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 134093-134113 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NC_017541 Klebsiella pneumoniae KCTC 2242 plasmid pKCTC2242, complete sequence 139598-139618 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 197359-197379 0 1.0
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 197821-197841 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 CP052329 Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence 116763-116783 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP050836 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence 123724-123744 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP050836 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence 123766-123786 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP050836 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence 123976-123996 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 39897-39917 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 40107-40127 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 294057-294077 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 294267-294287 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 CP052400 Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence 122488-122508 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 CP052400 Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence 122530-122550 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 145817-145837 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 146027-146047 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 134016-134036 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 134226-134246 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 114459-114479 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 114669-114689 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 173673-173693 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 173715-173735 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 345371-345391 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 345413-345433 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP027063 Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence 14649-14669 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP013713 Klebsiella pneumoniae strain J1 plasmid 2, complete sequence 5246-5266 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP013713 Klebsiella pneumoniae strain J1 plasmid 2, complete sequence 5540-5560 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP024875 Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence 125204-125224 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP024875 Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence 125414-125434 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP024875 Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence 125456-125476 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP026172 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence 45107-45127 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP019161 Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence 196440-196460 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP019161 Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence 196482-196502 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP019161 Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence 196734-196754 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 94867-94887 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 95077-95097 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP015026 Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence 119957-119977 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP015026 Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence 120167-120187 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP015026 Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence 120209-120229 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP026398 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence 134747-134767 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 118528-118548 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 118822-118842 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 162987-163007 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 163197-163217 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 166576-166596 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 166618-166638 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 118423-118443 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP017451 Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence 463380-463400 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP017451 Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence 463590-463610 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP032915 Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence 19837-19857 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP032915 Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence 20089-20109 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 302200-302220 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 302242-302262 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 232121-232141 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 232331-232351 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 196299-196319 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 196341-196361 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 76902-76922 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 76944-76964 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 8039-8059 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 8249-8269 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 12371-12391 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 12581-12601 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP021699 Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence 327185-327205 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP021699 Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence 327227-327247 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP034054 Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence 1258-1278 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 94855-94875 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 94897-94917 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 118528-118548 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 211596-211616 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 211806-211826 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 164114-164134 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 164324-164344 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 197485-197505 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 197527-197547 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 153919-153939 0 1.0
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 154129-154149 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 1174-1194 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 1216-1236 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 CP052329 Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence 116679-116699 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 CP052329 Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence 116721-116741 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP025081 Klebsiella pneumoniae strain SGH10 plasmid pSGH10, complete sequence 212159-212179 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP014011 Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence 108885-108905 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP014011 Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence 109221-109241 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP037743 Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_hv, complete sequence 209788-209808 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 293973-293993 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 294015-294035 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 MT035874 Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence 210408-210428 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 MT035874 Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence 210744-210764 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 CP052400 Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence 122404-122424 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 CP052400 Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence 122446-122466 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 MN543585 Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence 180919-180939 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 133932-133952 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 133974-133994 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 114375-114395 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 114417-114437 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 MN543571 Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence 106645-106665 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP033955 Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence 180337-180357 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP033955 Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence 180673-180693 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 CP052432 Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-1, complete sequence 161973-161993 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 CP052363 Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-1, complete sequence 201409-201429 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 MK347227 Klebsiella pneumoniae strain K187 plasmid pK187_rmpA2, complete sequence 159142-159162 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 MK347228 Klebsiella pneumoniae strain K195 plasmid pK195_rmpA2, complete sequence 158700-158720 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 MK347230 Klebsiella pneumoniae strain K202 plasmid pK202_rmpA2, complete sequence 158007-158027 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 MK347231 Klebsiella pneumoniae strain K204 plasmid pK204_rmpA2, complete sequence 157498-157518 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 MK347238 Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence 158784-158804 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP020854 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence 102991-103011 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 173295-173315 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 173337-173357 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 345749-345769 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 345791-345811 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 LC549807 Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence 281222-281242 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP031563 Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence 235022-235042 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP014009 Klebsiella pneumoniae subsp. pneumoniae strain RJF293 plasmid pRJF293, complete sequence 43940-43960 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP031799 Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence 117820-117840 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP036336 Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence 24254-24274 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP042482 Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence 200336-200356 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP024875 Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence 125078-125098 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP024875 Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence 125120-125140 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP024875 Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence 125162-125182 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP021958 Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u 125467-125487 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP021961 Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence 70839-70859 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP032241 Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence 217842-217862 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP032241 Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence 218178-218198 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP015026 Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence 119831-119851 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP015026 Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence 119873-119893 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP015026 Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence 119915-119935 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP047193 Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence 163515-163535 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP047193 Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence 163845-163865 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 6528-6548 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP028929 Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence 198065-198085 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 MF943217 Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence 140733-140753 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP032164 Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence 181944-181964 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP032164 Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence 182280-182300 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP016921 Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence 82052-82072 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 205718-205738 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 CP050156 Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence 1300-1320 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 CP052190 Klebsiella pneumoniae strain F16KP0019 plasmid pF16KP0019-1, complete sequence 212494-212514 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 118130-118150 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 187715-187735 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP040540 Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-VIR, complete sequence 158790-158810 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP020902 Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence 108253-108273 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP032915 Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence 19753-19773 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP032915 Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence 19795-19815 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP045675 Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence 161287-161307 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 139298-139318 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 195921-195941 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 195963-195983 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP034124 Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence 180345-180365 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP034124 Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence 180639-180659 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP034124 Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence 180933-180953 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP050827 Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence 90717-90737 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 12287-12307 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 12329-12349 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 190242-190262 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 1300-1320 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP028390 Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence 191965-191985 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP034054 Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence 1174-1194 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP034054 Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence 1216-1236 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP034083 Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-vir, complete sequence 212192-212212 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 CP029383 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence 161078-161098 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 CP029383 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence 161414-161434 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 143785-143805 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP026012 Klebsiella pneumoniae strain K2044 plasmid pK2044, complete sequence 77614-77634 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP026024 Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence 112932-112952 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP026024 Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence 113268-113288 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP034046 Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence 1174-1194 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP034046 Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence 1216-1236 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 CP050276 Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence 203334-203354 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 CP050276 Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence 203670-203690 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 MK649822 Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence 166330-166350 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 MK649825 Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence 172955-172975 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP026587 Klebsiella pneumoniae strain NUHL30457 plasmid p1, complete sequence 134283-134303 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 211512-211532 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 211554-211574 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_LR745043 Klebsiella pneumoniae isolate Klebsiella pneumoniae kpn154 plasmid pVIR_Kpn154 198502-198522 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 164030-164050 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 164072-164092 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 1300-1320 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 133486-133506 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_MK413719 Klebsiella pneumoniae strain 362713 plasmid p362713-HI3, complete sequence 1300-1320 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_MK413721 Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence 1300-1320 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NC_017541 Klebsiella pneumoniae KCTC 2242 plasmid pKCTC2242, complete sequence 139682-139702 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_MH255828 Klebsiella pneumoniae subsp. pneumoniae strain SH9 plasmid pSH9-VIR, complete sequence 169210-169230 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 194082-194102 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 197107-197127 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 197149-197169 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 1300-1320 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 1300-1320 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP050836 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence 124018-124038 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP050836 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence 124060-124080 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP050836 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence 124102-124122 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP050836 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence 124144-124164 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 40149-40169 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 40191-40211 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP026022 Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence 75670-75690 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP026022 Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence 76006-76026 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 MN200128 Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-Vir-RC, complete sequence 214320-214340 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 MN200130 Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence 329137-329157 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 146069-146089 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 146111-146131 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP019049 Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence 131505-131525 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_LR134257 Klebsiella aerogenes strain NCTC9644 plasmid 4, complete sequence 77285-77305 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP027063 Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence 14691-14711 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP012754 Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence 252676-252696 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP031736 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence 34825-34845 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 LR134211 Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2 202712-202732 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NC_005249 Klebsiella pneumoniae CG43 plasmid pLVPK, complete sequence 217679-217699 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NC_006625 Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 plasmid pK2044, complete sequence 146518-146538 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP026172 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence 45443-45463 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP019161 Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence 196776-196796 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP009865 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence 46551-46571 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP044036 Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence 28100-28120 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP008933 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence 183752-183772 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 95119-95139 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 95161-95181 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP026398 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence 135083-135103 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 163239-163259 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 163281-163301 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 108674-108694 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 166954-166974 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 166996-167016 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP023917 Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence 135351-135371 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP017451 Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence 463632-463652 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP017451 Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence 463674-463694 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 302578-302598 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 302620-302640 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 232373-232393 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 232415-232435 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP040595 Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence 216456-216476 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 77280-77300 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 77322-77342 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP006799 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence 262419-262439 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 8291-8311 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 8333-8353 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP021699 Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence 327563-327583 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP021699 Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence 327605-327625 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 CP050281 Klebsiella pneumoniae strain 9949 plasmid unnamed1, complete sequence 105764-105784 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 CP050281 Klebsiella pneumoniae strain 9949 plasmid unnamed1, complete sequence 106098-106118 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP042975 Klebsiella pneumoniae strain KPN55602 plasmid pK55602_1, complete sequence 41831-41851 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 95233-95253 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 95275-95295 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP016815 Klebsiella pneumoniae strain ED23 plasmid unamed, complete sequence 135134-135154 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 154171-154191 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 154213-154233 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_MG053312 Klebsiella pneumoniae strain KP267 plasmid pVir-CR-HvKP267, complete sequence 133271-133291 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_MG053312 Klebsiella pneumoniae strain KP267 plasmid pVir-CR-HvKP267, complete sequence 133607-133627 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP025462 Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence 164678-164698 0 1.0
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP034406 Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence 221235-221255 0 1.0
CP027063_1 1.10|14733|21|CP027063|CRT 14733-14753 21 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 1132-1152 0 1.0
CP027063_1 1.10|14733|21|CP027063|CRT 14733-14753 21 CP052329 Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence 116637-116657 0 1.0
CP027063_1 1.10|14733|21|CP027063|CRT 14733-14753 21 NZ_CP050836 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence 124186-124206 0 1.0
CP027063_1 1.10|14733|21|CP027063|CRT 14733-14753 21 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 40233-40253 0 1.0
CP027063_1 1.10|14733|21|CP027063|CRT 14733-14753 21 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 293931-293951 0 1.0
CP027063_1 1.10|14733|21|CP027063|CRT 14733-14753 21 CP052400 Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence 122362-122382 0 1.0
CP027063_1 1.10|14733|21|CP027063|CRT 14733-14753 21 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 146153-146173 0 1.0
CP027063_1 1.10|14733|21|CP027063|CRT 14733-14753 21 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 133890-133910 0 1.0
CP027063_1 1.10|14733|21|CP027063|CRT 14733-14753 21 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 114333-114353 0 1.0
CP027063_1 1.10|14733|21|CP027063|CRT 14733-14753 21 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 173253-173273 0 1.0
CP027063_1 1.10|14733|21|CP027063|CRT 14733-14753 21 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 345833-345853 0 1.0
CP027063_1 1.10|14733|21|CP027063|CRT 14733-14753 21 NZ_CP027063 Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence 14733-14753 0 1.0
CP027063_1 1.10|14733|21|CP027063|CRT 14733-14753 21 NZ_CP041093 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence 149287-149307 0 1.0
CP027063_1 1.10|14733|21|CP027063|CRT 14733-14753 21 NZ_CP013713 Klebsiella pneumoniae strain J1 plasmid 2, complete sequence 5204-5224 0 1.0
CP027063_1 1.10|14733|21|CP027063|CRT 14733-14753 21 NZ_CP024875 Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence 125036-125056 0 1.0
CP027063_1 1.10|14733|21|CP027063|CRT 14733-14753 21 NZ_CP026172 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence 45485-45505 0 1.0
CP027063_1 1.10|14733|21|CP027063|CRT 14733-14753 21 NZ_CP019161 Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence 196818-196838 0 1.0
CP027063_1 1.10|14733|21|CP027063|CRT 14733-14753 21 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 95203-95223 0 1.0
CP027063_1 1.10|14733|21|CP027063|CRT 14733-14753 21 NZ_CP015026 Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence 119789-119809 0 1.0
CP027063_1 1.10|14733|21|CP027063|CRT 14733-14753 21 NZ_CP026398 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence 135125-135145 0 1.0
CP027063_1 1.10|14733|21|CP027063|CRT 14733-14753 21 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 163323-163343 0 1.0
CP027063_1 1.10|14733|21|CP027063|CRT 14733-14753 21 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 167038-167058 0 1.0
CP027063_1 1.10|14733|21|CP027063|CRT 14733-14753 21 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 118088-118108 0 1.0
CP027063_1 1.10|14733|21|CP027063|CRT 14733-14753 21 NZ_CP017451 Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence 463716-463736 0 1.0
CP027063_1 1.10|14733|21|CP027063|CRT 14733-14753 21 NZ_CP032915 Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence 19711-19731 0 1.0
CP027063_1 1.10|14733|21|CP027063|CRT 14733-14753 21 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 302662-302682 0 1.0
CP027063_1 1.10|14733|21|CP027063|CRT 14733-14753 21 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 232457-232477 0 1.0
CP027063_1 1.10|14733|21|CP027063|CRT 14733-14753 21 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 195879-195899 0 1.0
CP027063_1 1.10|14733|21|CP027063|CRT 14733-14753 21 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 77364-77384 0 1.0
CP027063_1 1.10|14733|21|CP027063|CRT 14733-14753 21 NZ_CP050827 Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence 90675-90695 0 1.0
CP027063_1 1.10|14733|21|CP027063|CRT 14733-14753 21 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 8375-8395 0 1.0
CP027063_1 1.10|14733|21|CP027063|CRT 14733-14753 21 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 12245-12265 0 1.0
CP027063_1 1.10|14733|21|CP027063|CRT 14733-14753 21 NZ_CP021699 Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence 327647-327667 0 1.0
CP027063_1 1.10|14733|21|CP027063|CRT 14733-14753 21 NZ_CP034054 Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence 1132-1152 0 1.0
CP027063_1 1.10|14733|21|CP027063|CRT 14733-14753 21 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 95317-95337 0 1.0
CP027063_1 1.10|14733|21|CP027063|CRT 14733-14753 21 NZ_CP034046 Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence 1132-1152 0 1.0
CP027063_1 1.10|14733|21|CP027063|CRT 14733-14753 21 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 211470-211490 0 1.0
CP027063_1 1.10|14733|21|CP027063|CRT 14733-14753 21 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 163988-164008 0 1.0
CP027063_1 1.10|14733|21|CP027063|CRT 14733-14753 21 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 197065-197085 0 1.0
CP027063_1 1.10|14733|21|CP027063|CRT 14733-14753 21 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 154255-154275 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP050836 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence 124228-124248 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 40275-40295 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 146195-146215 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 345875-345895 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 173211-173231 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP027063 Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence 14775-14795 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP012754 Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence 252886-252906 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP031736 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence 35035-35055 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP026172 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence 45527-45547 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP019161 Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence 196860-196880 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP009865 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence 46761-46781 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP044036 Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence 28310-28330 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP008933 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence 183962-183982 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 95245-95265 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP026398 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence 135167-135187 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 163365-163385 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 108884-108904 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 167080-167100 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NC_016980 Klebsiella pneumoniae plasmid pNDM-MAR, complete sequence 125582-125602 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP017451 Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence 463758-463778 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 302704-302724 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 232499-232519 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP040595 Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence 216666-216686 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 77406-77426 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP006799 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence 262629-262649 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 8417-8437 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP021699 Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence 327689-327709 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 95359-95379 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 154297-154317 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP025462 Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence 164888-164908 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP034406 Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence 221445-221465 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 1090-1110 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 CP052329 Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence 116595-116615 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP037442 Klebsiella sp. PO552 plasmid p1, complete sequence 187538-187558 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 293889-293909 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 CP052400 Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence 122320-122340 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 133848-133868 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 114291-114311 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 120496-120516 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP020854 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence 102781-102801 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 LC549807 Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence 281012-281032 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP031563 Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence 234812-234832 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP031799 Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence 117610-117630 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP036336 Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence 24044-24064 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP041093 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence 149245-149265 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP013713 Klebsiella pneumoniae strain J1 plasmid 2, complete sequence 5162-5182 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP042482 Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence 200126-200146 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP024875 Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence 124994-125014 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP021958 Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u 125257-125277 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP021961 Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence 70629-70649 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 296613-296633 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP015026 Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence 119747-119767 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 6318-6338 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 118444-118464 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP028929 Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence 197855-197875 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 MF943217 Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence 140523-140543 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP016921 Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence 81842-81862 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 205508-205528 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 CP050156 Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence 1090-1110 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 118046-118066 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 187295-187315 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP020902 Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence 108043-108063 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP045675 Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence 161077-161097 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 139088-139108 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 195837-195857 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP050827 Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence 90633-90653 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 12203-12223 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 190032-190052 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 1090-1110 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP028390 Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence 191755-191775 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP034054 Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence 1090-1110 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 143575-143595 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 118444-118464 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP034046 Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence 1090-1110 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 MK649822 Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence 166120-166140 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 MK649825 Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence 172745-172765 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 211428-211448 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 163946-163966 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 1090-1110 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 133276-133296 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_MK413719 Klebsiella pneumoniae strain 362713 plasmid p362713-HI3, complete sequence 1090-1110 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_MK413721 Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence 1090-1110 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_MK413722 Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence 1090-1110 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 193872-193892 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 197023-197043 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 1090-1110 0 1.0
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 1090-1110 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 1048-1068 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 CP052329 Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence 116553-116573 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 40317-40337 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP037442 Klebsiella sp. PO552 plasmid p1, complete sequence 187496-187516 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 293847-293867 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 CP052400 Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence 122278-122298 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 146237-146257 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 133806-133826 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 114249-114269 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 120454-120474 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP020854 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence 102739-102759 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 LC549807 Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence 280970-280990 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP027063 Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence 14817-14837 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP031563 Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence 234770-234790 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP012754 Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence 252928-252948 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP031736 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence 35077-35097 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP031799 Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence 117568-117588 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP036336 Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence 24002-24022 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP041093 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence 149203-149223 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP013713 Klebsiella pneumoniae strain J1 plasmid 2, complete sequence 5120-5140 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP042482 Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence 200084-200104 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP021958 Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u 125215-125235 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP021961 Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence 70587-70607 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP026172 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence 45569-45589 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 296571-296591 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP019161 Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence 196902-196922 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP009865 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence 46803-46823 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP044036 Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence 28352-28372 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP008933 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence 184004-184024 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 95287-95307 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP026398 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence 135209-135229 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 6276-6296 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 118402-118422 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP028929 Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence 197813-197833 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 163407-163427 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 MF943217 Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence 140481-140501 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP016921 Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence 81800-81820 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 205466-205486 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 CP050156 Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence 1048-1068 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 108926-108946 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 118004-118024 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP023917 Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence 135603-135623 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 187253-187273 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NC_016980 Klebsiella pneumoniae plasmid pNDM-MAR, complete sequence 125624-125644 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP017451 Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence 463800-463820 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP020902 Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence 108001-108021 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP045675 Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence 161035-161055 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 139046-139066 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 232541-232561 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP040595 Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence 216708-216728 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP006799 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence 262671-262691 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP050827 Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence 90591-90611 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 8459-8479 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 12161-12181 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 189990-190010 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 1048-1068 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP028390 Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence 191713-191733 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 143533-143553 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 118402-118422 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 MK649822 Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence 166078-166098 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 MK649825 Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence 172703-172723 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 211386-211406 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 163904-163924 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 1048-1068 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 133234-133254 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_MK413719 Klebsiella pneumoniae strain 362713 plasmid p362713-HI3, complete sequence 1048-1068 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_MK413721 Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence 1048-1068 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_MK413722 Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence 1048-1068 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 193830-193850 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 154339-154359 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 1048-1068 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 1048-1068 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP025462 Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence 164930-164950 0 1.0
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP034406 Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence 221487-221507 0 1.0
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 150916-150936 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP009865 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence 46509-46529 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP004000 Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence 45937-45957 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 2940-2960 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_KX029332 Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence 1048-1068 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 155626-155646 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP042482 Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence 200378-200398 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 34486-34506 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP031582 Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence 86168-86188 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 MF943217 Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence 140775-140795 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 187757-187777 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP032208 Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence 126845-126865 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 1342-1362 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP028390 Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence 192007-192027 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 159356-159376 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP021699 Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence 326723-326743 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP026022 Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence 75628-75648 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP026022 Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence 75964-75984 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 MN200128 Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-Vir-RC, complete sequence 214278-214298 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 MN200130 Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence 329095-329115 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP019049 Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence 131463-131483 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_LR134257 Klebsiella aerogenes strain NCTC9644 plasmid 4, complete sequence 77243-77263 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP012754 Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence 252634-252654 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP031736 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence 34783-34803 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 LR134211 Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2 202670-202690 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NC_005249 Klebsiella pneumoniae CG43 plasmid pLVPK, complete sequence 217637-217657 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NC_006625 Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 plasmid pK2044, complete sequence 146476-146496 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP044036 Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence 28058-28078 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP008933 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence 183710-183730 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 108632-108652 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP023917 Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence 135309-135329 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 66772-66792 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP040595 Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence 216414-216434 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP006799 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence 262377-262397 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 CP050281 Klebsiella pneumoniae strain 9949 plasmid unnamed1, complete sequence 105722-105742 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 CP050281 Klebsiella pneumoniae strain 9949 plasmid unnamed1, complete sequence 106056-106076 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP042975 Klebsiella pneumoniae strain KPN55602 plasmid pK55602_1, complete sequence 41789-41809 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP016815 Klebsiella pneumoniae strain ED23 plasmid unamed, complete sequence 135092-135112 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_MG053312 Klebsiella pneumoniae strain KP267 plasmid pVir-CR-HvKP267, complete sequence 133229-133249 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_MG053312 Klebsiella pneumoniae strain KP267 plasmid pVir-CR-HvKP267, complete sequence 133565-133585 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP025462 Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence 164636-164656 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP034406 Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence 221193-221213 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP025081 Klebsiella pneumoniae strain SGH10 plasmid pSGH10, complete sequence 212201-212221 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP014011 Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence 108927-108947 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP014011 Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence 109263-109283 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP037743 Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_hv, complete sequence 209830-209850 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 MT035874 Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence 210450-210470 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 MT035874 Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence 210786-210806 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP033955 Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence 180379-180399 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP033955 Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence 180715-180735 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 CP052432 Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-1, complete sequence 162015-162035 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 CP052363 Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-1, complete sequence 201451-201471 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 MK347227 Klebsiella pneumoniae strain K187 plasmid pK187_rmpA2, complete sequence 159184-159204 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 MK347228 Klebsiella pneumoniae strain K195 plasmid pK195_rmpA2, complete sequence 158742-158762 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 MK347230 Klebsiella pneumoniae strain K202 plasmid pK202_rmpA2, complete sequence 158049-158069 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 MK347238 Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence 158826-158846 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 MK347238 Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence 159078-159098 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP020854 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence 103033-103053 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 LC549807 Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence 281264-281284 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP031563 Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence 235064-235084 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP014009 Klebsiella pneumoniae subsp. pneumoniae strain RJF293 plasmid pRJF293, complete sequence 43982-44002 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP031799 Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence 117862-117882 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP036336 Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence 24296-24316 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP021958 Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u 125509-125529 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP021961 Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence 70881-70901 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP032241 Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence 217884-217904 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP032241 Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence 218220-218240 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 CP052563 Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-1, complete sequence 211110-211130 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP047193 Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence 163557-163577 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP047193 Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence 163887-163907 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 6570-6590 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP028929 Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence 198107-198127 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP032164 Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence 181986-182006 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP032164 Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence 182322-182342 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP016921 Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence 82094-82114 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 205760-205780 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 CP050156 Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence 1342-1362 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 CP052190 Klebsiella pneumoniae strain F16KP0019 plasmid pF16KP0019-1, complete sequence 212536-212556 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP040540 Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-VIR, complete sequence 158832-158852 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP020902 Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence 108295-108315 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP045675 Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence 161329-161349 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 139340-139360 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP034124 Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence 180387-180407 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP034124 Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence 180681-180701 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP034124 Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence 180975-180995 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 190284-190304 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP034083 Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-vir, complete sequence 212234-212254 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 CP029383 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence 161120-161140 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 CP029383 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence 161456-161476 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP026012 Klebsiella pneumoniae strain K2044 plasmid pK2044, complete sequence 77656-77676 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP026024 Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence 112974-112994 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP026024 Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence 113310-113330 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 CP050276 Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence 203376-203396 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 CP050276 Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence 203712-203732 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 MK649822 Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence 166372-166392 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 MK649825 Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence 172997-173017 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_CP026587 Klebsiella pneumoniae strain NUHL30457 plasmid p1, complete sequence 134325-134345 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_LR745043 Klebsiella pneumoniae isolate Klebsiella pneumoniae kpn154 plasmid pVIR_Kpn154 198544-198564 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_MK413719 Klebsiella pneumoniae strain 362713 plasmid p362713-HI3, complete sequence 1342-1362 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_MK413721 Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence 1342-1362 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NC_017541 Klebsiella pneumoniae KCTC 2242 plasmid pKCTC2242, complete sequence 139724-139744 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_MH255828 Klebsiella pneumoniae subsp. pneumoniae strain SH9 plasmid pSH9-VIR, complete sequence 169252-169272 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 194124-194144 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 1342-1362 1 0.952
CP027063_1 1.1|14355|21|CP027063|CRT 14355-14375 21 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 1342-1362 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 157152-157172 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 157278-157298 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_KX029332 Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence 1510-1530 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_KX029332 Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence 1888-1908 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_KX029332 Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence 2014-2034 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP037442 Klebsiella sp. PO552 plasmid p1, complete sequence 187622-187642 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 MT035874 Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence 210870-210890 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP033955 Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence 180799-180819 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP034776 Klebsiella pneumoniae strain 18CPO060 plasmid phvKP060, complete sequence 1393-1413 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP020854 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence 103201-103221 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP031563 Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence 235232-235252 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 156088-156108 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 156466-156486 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 156592-156612 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP036336 Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence 24464-24484 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP042482 Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence 200881-200901 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP024875 Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence 125960-125980 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP021958 Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u 125677-125697 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP021961 Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence 71049-71069 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 296781-296801 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 296865-296885 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 296907-296927 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP031582 Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence 87134-87154 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP031582 Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence 87260-87280 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP015026 Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence 120713-120733 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 6738-6758 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP028929 Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence 198275-198295 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP016921 Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence 82262-82282 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 CP050156 Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence 1510-1530 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 188260-188280 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP020902 Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence 108463-108483 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP045675 Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence 161497-161517 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 139508-139528 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP032208 Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence 127433-127453 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP032208 Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence 127853-127873 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 190452-190472 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 1845-1865 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 MK649822 Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence 166540-166560 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 MK649822 Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence 166666-166686 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 MK649822 Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence 166792-166812 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 MK649825 Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence 173165-173185 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 1342-1362 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 1510-1530 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 194292-194312 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_MH263654 Klebsiella pneumoniae strain QL24 plasmid pKPN-QL24, complete sequence 198862-198882 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_MH263654 Klebsiella pneumoniae strain QL24 plasmid pKPN-QL24, complete sequence 198904-198924 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_MH263654 Klebsiella pneumoniae strain QL24 plasmid pKPN-QL24, complete sequence 198946-198966 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 159945-159965 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 159987-160007 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 160071-160091 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 160113-160133 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 1510-1530 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP050836 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence 123220-123240 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 149950-149970 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 150076-150096 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 150454-150474 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP012754 Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence 252466-252486 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP031736 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence 34615-34635 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP009865 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence 45818-45838 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP044036 Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence 27890-27910 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP008933 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence 183542-183562 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP004000 Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence 45013-45033 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP004000 Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence 45139-45159 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP004000 Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence 45517-45537 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 108464-108484 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP023917 Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence 135141-135161 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 66184-66204 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP040595 Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence 216246-216266 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP006799 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence 262209-262229 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_MF150122 Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence 2562-2582 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP025462 Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence 164468-164488 1 0.952
CP027063_1 1.2|14397|21|CP027063|CRT 14397-14417 21 NZ_CP034406 Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence 221025-221045 1 0.952
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 173379-173399 1 0.952
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 345707-345727 1 0.952
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 196005-196025 1 0.952
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 NZ_CP034046 Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence 1258-1278 1 0.952
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 197191-197211 1 0.952
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 166912-166932 1 0.952
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 302536-302556 1 0.952
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 77238-77258 1 0.952
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 NZ_CP021699 Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence 327521-327541 1 0.952
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 95191-95211 1 0.952
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 1468-1488 1 0.952
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 CP052400 Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence 122969-122989 1 0.952
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 MN543585 Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence 181610-181630 1 0.952
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 MN543571 Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence 107336-107356 1 0.952
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 121103-121123 1 0.952
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 144476-144496 1 0.952
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 134177-134197 1 0.952
CP027063_1 1.3|14439|21|CP027063|CRT 14439-14459 21 NZ_CP009865 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence 45860-45880 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP050836 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence 123724-123744 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP050836 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence 123766-123786 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP050836 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence 123976-123996 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP050836 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence 123808-123828 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 39897-39917 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 40107-40127 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 39939-39959 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 145817-145837 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 146027-146047 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 145859-145879 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 345371-345391 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 345413-345433 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 173673-173693 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 173715-173735 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 345455-345475 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 173631-173651 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP027063 Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence 14649-14669 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP019161 Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence 196440-196460 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP019161 Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence 196482-196502 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP019161 Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence 196734-196754 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP019161 Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence 196524-196544 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 94867-94887 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 95077-95097 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 94909-94929 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 162987-163007 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 163197-163217 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 163029-163049 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 166576-166596 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 166618-166638 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 166660-166680 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP017451 Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence 463380-463400 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP017451 Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence 463590-463610 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP017451 Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence 463422-463442 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 302200-302220 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 302242-302262 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 302284-302304 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 232121-232141 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 232331-232351 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 232163-232183 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 76902-76922 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 76944-76964 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 76986-77006 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 8039-8059 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 8249-8269 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 8081-8101 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP021699 Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence 327185-327205 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP021699 Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence 327227-327247 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP021699 Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence 327269-327289 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 94855-94875 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 94897-94917 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 94939-94959 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 153919-153939 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 154129-154149 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 153961-153981 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 CP052329 Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence 116763-116783 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 294057-294077 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 294267-294287 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 294225-294245 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 CP052400 Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence 122488-122508 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 CP052400 Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence 122530-122550 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 134016-134036 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 134226-134246 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 134184-134204 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 114459-114479 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 114669-114689 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 114627-114647 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP013713 Klebsiella pneumoniae strain J1 plasmid 2, complete sequence 5246-5266 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP013713 Klebsiella pneumoniae strain J1 plasmid 2, complete sequence 5540-5560 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP013713 Klebsiella pneumoniae strain J1 plasmid 2, complete sequence 5456-5476 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP024875 Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence 125204-125224 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP024875 Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence 125414-125434 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP024875 Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence 125456-125476 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP024875 Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence 125372-125392 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP015026 Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence 119957-119977 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP015026 Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence 120167-120187 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP015026 Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence 120209-120229 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP015026 Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence 120125-120145 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 118528-118548 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 118822-118842 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 118738-118758 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP032915 Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence 19837-19857 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP032915 Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence 20089-20109 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP032915 Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence 20005-20025 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP032915 Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence 20444-20464 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 196299-196319 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 196341-196361 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 196257-196277 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 12371-12391 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 12581-12601 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 12539-12559 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP034054 Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence 1258-1278 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 118528-118548 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 211596-211616 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 211806-211826 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 211764-211784 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 164114-164134 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 164324-164344 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 164282-164302 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 197485-197505 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 197527-197547 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 197443-197463 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP026172 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence 45107-45127 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP026398 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence 134747-134767 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 MF185718 Arthrobacter phage Colucci, complete genome 3327-3347 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 118423-118443 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 150496-150516 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 150538-150558 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 150622-150642 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 150664-150684 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 150790-150810 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 34066-34086 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 34192-34212 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 34234-34254 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 34360-34380 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP009865 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence 45902-45922 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP004000 Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence 45643-45663 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP004000 Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence 45685-45705 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP004000 Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence 45811-45831 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 66226-66246 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 66268-66288 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 66394-66414 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 66478-66498 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 66520-66540 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 66646-66666 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_KX029332 Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence 1174-1194 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_KX029332 Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence 1300-1320 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_KX029332 Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence 1342-1362 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_KX029332 Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence 1468-1488 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 MN543585 Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence 181568-181588 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 MN543571 Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence 107294-107314 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 121061-121081 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 155752-155772 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 155878-155898 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 155920-155940 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 156004-156024 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 156046-156066 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP031582 Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence 86294-86314 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP031582 Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence 86420-86440 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP031582 Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence 86462-86482 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP031582 Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence 86546-86566 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP031582 Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence 86672-86692 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP031582 Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence 86714-86734 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP032208 Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence 126971-126991 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP032208 Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence 127097-127117 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP032208 Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence 127139-127159 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP032208 Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence 127223-127243 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP032208 Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence 127349-127369 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP032208 Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence 127391-127411 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 144434-144454 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 134135-134155 1 0.952
CP027063_1 1.4|14481|21|CP027063|CRT 14481-14501 21 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 159609-159629 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 MN200128 Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-Vir-RC, complete sequence 214362-214382 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 MN200130 Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence 329179-329199 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP024708 Klebsiella pneumoniae strain cr-hvkp3 plasmid pPUTH1, complete sequence 12782-12802 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 LR134211 Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2 202754-202774 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NC_005249 Klebsiella pneumoniae CG43 plasmid pLVPK, complete sequence 217721-217741 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP009865 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence 46593-46613 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP042975 Klebsiella pneumoniae strain KPN55602 plasmid pK55602_1, complete sequence 41873-41893 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 CP052400 Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence 122572-122592 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 CP052363 Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-1, complete sequence 201367-201387 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP013713 Klebsiella pneumoniae strain J1 plasmid 2, complete sequence 5853-5873 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP042482 Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence 200294-200314 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 119074-119094 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 187463-187483 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 187673-187693 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP032915 Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence 20402-20422 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 1258-1278 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 143743-143763 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP026587 Klebsiella pneumoniae strain NUHL30457 plasmid p1, complete sequence 134241-134261 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_LR745046 Klebsiella pneumoniae isolate Kpn2166 plasmid pVIR_Kpn2166 209609-209629 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_LR745043 Klebsiella pneumoniae isolate Klebsiella pneumoniae kpn154 plasmid pVIR_Kpn154 198460-198480 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 133444-133464 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NC_017541 Klebsiella pneumoniae KCTC 2242 plasmid pKCTC2242, complete sequence 139640-139660 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP012754 Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence 252718-252738 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP012754 Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence 252466-252486 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP031736 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence 34867-34887 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP031736 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence 34615-34635 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP044036 Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence 28142-28162 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP044036 Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence 27890-27910 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP008933 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence 183794-183814 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP008933 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence 183542-183562 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 108716-108736 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 108464-108484 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP023917 Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence 135393-135413 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP023917 Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence 135141-135161 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP040595 Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence 216498-216518 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP040595 Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence 216246-216266 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP006799 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence 262461-262481 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP006799 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence 262209-262229 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP025462 Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence 164720-164740 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP025462 Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence 164468-164488 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP034406 Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence 221277-221297 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP034406 Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence 221025-221045 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP020854 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence 102949-102969 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP020854 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence 103201-103221 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 LC549807 Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence 281180-281200 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP031563 Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence 234980-235000 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP031563 Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence 235232-235252 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP031799 Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence 117778-117798 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP036336 Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence 24212-24232 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP036336 Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence 24464-24484 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP021958 Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u 125425-125445 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP021958 Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u 125677-125697 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP021961 Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence 70797-70817 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP021961 Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence 71049-71069 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 6486-6506 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 6738-6758 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP028929 Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence 198023-198043 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP028929 Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence 198275-198295 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 MF943217 Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence 140691-140711 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP016921 Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence 82010-82030 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP016921 Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence 82262-82282 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 205676-205696 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 CP050156 Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence 1258-1278 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 CP050156 Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence 1510-1530 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP020902 Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence 108211-108231 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP020902 Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence 108463-108483 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP045675 Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence 161245-161265 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP045675 Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence 161497-161517 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 139256-139276 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 139508-139528 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 190200-190220 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 190452-190472 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP028390 Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence 191923-191943 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 118780-118800 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 MK649822 Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence 166288-166308 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 MK649822 Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence 166540-166560 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 MK649822 Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence 166666-166686 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 MK649822 Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence 166792-166812 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 MK649825 Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence 172913-172933 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 MK649825 Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence 173165-173185 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 1258-1278 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 1342-1362 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 1510-1530 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_MK413719 Klebsiella pneumoniae strain 362713 plasmid p362713-HI3, complete sequence 1258-1278 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_MK413721 Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence 1258-1278 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 194040-194060 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 194292-194312 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 1258-1278 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 1510-1530 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 1258-1278 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 150454-150474 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 150580-150600 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 34150-34170 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP004000 Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence 45517-45537 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP004000 Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence 45601-45621 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 66184-66204 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 66310-66330 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 66436-66456 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 CP052329 Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence 117034-117054 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_KX029332 Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence 1384-1404 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_KX029332 Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence 1510-1530 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP037442 Klebsiella sp. PO552 plasmid p1, complete sequence 187622-187642 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 MT035874 Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence 210870-210890 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP033955 Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence 180799-180819 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP034776 Klebsiella pneumoniae strain 18CPO060 plasmid phvKP060, complete sequence 1393-1413 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 155962-155982 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 156088-156108 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 296781-296801 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 296865-296885 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 296907-296927 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP031582 Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence 86504-86524 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP031582 Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence 86630-86650 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP032208 Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence 127181-127201 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP032208 Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence 127307-127327 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP032208 Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence 127433-127453 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_MH263654 Klebsiella pneumoniae strain QL24 plasmid pKPN-QL24, complete sequence 198862-198882 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_MH263654 Klebsiella pneumoniae strain QL24 plasmid pKPN-QL24, complete sequence 198904-198924 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_MH263654 Klebsiella pneumoniae strain QL24 plasmid pKPN-QL24, complete sequence 198946-198966 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 CP052329 Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence 116763-116783 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP050836 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence 123724-123744 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP050836 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence 123766-123786 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP050836 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence 123976-123996 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_KX029332 Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence 1300-1320 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 39897-39917 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 40107-40127 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 294057-294077 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 294267-294287 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 145817-145837 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 146027-146047 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 134016-134036 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 134226-134246 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 114459-114479 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 114669-114689 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 150538-150558 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 150664-150684 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP020854 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence 102907-102927 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 LC549807 Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence 281138-281158 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP027063 Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence 14649-14669 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP031563 Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence 234938-234958 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP012754 Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence 252760-252780 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP031736 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence 34909-34929 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 155878-155898 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 156004-156024 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP031799 Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence 117736-117756 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP036336 Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence 24170-24190 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP013713 Klebsiella pneumoniae strain J1 plasmid 2, complete sequence 5246-5266 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP013713 Klebsiella pneumoniae strain J1 plasmid 2, complete sequence 5498-5518 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP013713 Klebsiella pneumoniae strain J1 plasmid 2, complete sequence 5540-5560 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP024875 Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence 125204-125224 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP024875 Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence 125414-125434 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP024875 Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence 125456-125476 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP021958 Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u 125383-125403 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP021961 Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence 70755-70775 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP026172 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence 45107-45127 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 34234-34254 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP019161 Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence 196440-196460 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP019161 Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence 196482-196502 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP019161 Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence 196734-196754 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP031582 Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence 86420-86440 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP031582 Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence 86546-86566 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP031582 Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence 86672-86692 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP009865 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence 46635-46655 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP044036 Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence 28184-28204 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP008933 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence 183836-183856 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP004000 Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence 45685-45705 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 94867-94887 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 95077-95097 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP015026 Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence 119957-119977 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP015026 Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence 120167-120187 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP015026 Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence 120209-120229 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP026398 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence 134747-134767 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 6444-6464 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 118528-118548 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 118780-118800 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 118822-118842 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP028929 Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence 197981-198001 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 162987-163007 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 163197-163217 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 MF943217 Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence 140649-140669 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP016921 Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence 81968-81988 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 205634-205654 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 CP050156 Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence 1216-1236 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 108758-108778 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 118423-118443 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP023917 Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence 135435-135455 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP017451 Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence 463380-463400 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP017451 Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence 463590-463610 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP020902 Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence 108169-108189 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP032915 Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence 19837-19857 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP032915 Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence 20089-20109 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP045675 Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence 161203-161223 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 139214-139234 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 232121-232141 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 232331-232351 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP032208 Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence 127097-127117 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP032208 Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence 127223-127243 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP032208 Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence 127349-127369 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 66268-66288 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 66394-66414 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 66520-66540 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP040595 Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence 216540-216560 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP006799 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence 262503-262523 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 8039-8059 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 8249-8269 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 12371-12391 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 12581-12601 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 190158-190178 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP028390 Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence 191881-191901 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 143701-143721 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 118528-118548 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 MK649822 Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence 166246-166266 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 MK649825 Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence 172871-172891 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 211596-211616 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 211806-211826 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 164114-164134 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 164324-164344 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 1216-1236 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 133402-133422 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_MK413721 Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence 1216-1236 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 193998-194018 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 159609-159629 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 153919-153939 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 154129-154149 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 1216-1236 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 1216-1236 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP025462 Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence 164762-164782 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP034406 Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence 221319-221339 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 CP052400 Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence 122488-122508 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 CP052400 Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence 122530-122550 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 173673-173693 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 173715-173735 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 345371-345391 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 345413-345433 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP042482 Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence 200252-200272 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 166576-166596 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 166618-166638 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 187421-187441 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 187631-187651 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 302200-302220 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 302242-302262 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 196299-196319 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 196341-196361 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 76902-76922 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 76944-76964 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 1216-1236 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP021699 Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence 327185-327205 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP021699 Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence 327227-327247 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP034054 Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence 1258-1278 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 94855-94875 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 94897-94917 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_MK413719 Klebsiella pneumoniae strain 362713 plasmid p362713-HI3, complete sequence 1216-1236 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 197485-197505 1 0.952
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 197527-197547 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 MN200128 Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-Vir-RC, complete sequence 214362-214382 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 MN200130 Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence 329179-329199 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP024708 Klebsiella pneumoniae strain cr-hvkp3 plasmid pPUTH1, complete sequence 12782-12802 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 LR134211 Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2 202754-202774 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NC_005249 Klebsiella pneumoniae CG43 plasmid pLVPK, complete sequence 217721-217741 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP009865 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence 46593-46613 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP042975 Klebsiella pneumoniae strain KPN55602 plasmid pK55602_1, complete sequence 41873-41893 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 CP052400 Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence 122572-122592 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 CP052363 Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-1, complete sequence 201367-201387 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP013713 Klebsiella pneumoniae strain J1 plasmid 2, complete sequence 5853-5873 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP042482 Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence 200294-200314 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 119074-119094 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 187463-187483 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 187673-187693 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP032915 Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence 20402-20422 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 1258-1278 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 143743-143763 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP026587 Klebsiella pneumoniae strain NUHL30457 plasmid p1, complete sequence 134241-134261 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_LR745046 Klebsiella pneumoniae isolate Kpn2166 plasmid pVIR_Kpn2166 209609-209629 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_LR745043 Klebsiella pneumoniae isolate Klebsiella pneumoniae kpn154 plasmid pVIR_Kpn154 198460-198480 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 133444-133464 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NC_017541 Klebsiella pneumoniae KCTC 2242 plasmid pKCTC2242, complete sequence 139640-139660 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP012754 Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence 252718-252738 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP012754 Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence 252466-252486 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP031736 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence 34867-34887 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP031736 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence 34615-34635 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP044036 Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence 28142-28162 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP044036 Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence 27890-27910 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP008933 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence 183794-183814 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP008933 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence 183542-183562 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 108716-108736 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 108464-108484 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP023917 Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence 135393-135413 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP023917 Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence 135141-135161 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP040595 Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence 216498-216518 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP040595 Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence 216246-216266 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP006799 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence 262461-262481 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP006799 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence 262209-262229 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP025462 Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence 164720-164740 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP025462 Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence 164468-164488 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP034406 Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence 221277-221297 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP034406 Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence 221025-221045 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP020854 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence 102949-102969 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP020854 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence 103201-103221 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 LC549807 Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence 281180-281200 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP031563 Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence 234980-235000 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP031563 Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence 235232-235252 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP031799 Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence 117778-117798 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP036336 Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence 24212-24232 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP036336 Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence 24464-24484 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP021958 Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u 125425-125445 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP021958 Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u 125677-125697 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP021961 Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence 70797-70817 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP021961 Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence 71049-71069 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 6486-6506 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 6738-6758 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP028929 Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence 198023-198043 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP028929 Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence 198275-198295 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 MF943217 Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence 140691-140711 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP016921 Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence 82010-82030 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP016921 Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence 82262-82282 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 205676-205696 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 CP050156 Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence 1258-1278 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 CP050156 Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence 1510-1530 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP020902 Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence 108211-108231 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP020902 Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence 108463-108483 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP045675 Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence 161245-161265 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP045675 Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence 161497-161517 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 139256-139276 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 139508-139528 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 190200-190220 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 190452-190472 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP028390 Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence 191923-191943 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 118780-118800 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 MK649822 Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence 166288-166308 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 MK649822 Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence 166540-166560 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 MK649822 Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence 166666-166686 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 MK649822 Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence 166792-166812 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 MK649825 Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence 172913-172933 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 MK649825 Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence 173165-173185 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 1258-1278 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 1342-1362 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 1510-1530 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_MK413719 Klebsiella pneumoniae strain 362713 plasmid p362713-HI3, complete sequence 1258-1278 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_MK413721 Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence 1258-1278 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 194040-194060 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 194292-194312 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 1258-1278 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 1510-1530 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 1258-1278 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 150454-150474 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 150580-150600 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 34150-34170 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP004000 Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence 45517-45537 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP004000 Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence 45601-45621 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 66184-66204 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 66310-66330 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 66436-66456 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 CP052329 Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence 117034-117054 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_KX029332 Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence 1384-1404 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_KX029332 Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence 1510-1530 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP037442 Klebsiella sp. PO552 plasmid p1, complete sequence 187622-187642 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 MT035874 Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence 210870-210890 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP033955 Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence 180799-180819 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP034776 Klebsiella pneumoniae strain 18CPO060 plasmid phvKP060, complete sequence 1393-1413 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 155962-155982 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 156088-156108 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 296781-296801 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 296865-296885 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 296907-296927 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP031582 Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence 86504-86524 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP031582 Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence 86630-86650 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP032208 Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence 127181-127201 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP032208 Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence 127307-127327 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP032208 Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence 127433-127453 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_MH263654 Klebsiella pneumoniae strain QL24 plasmid pKPN-QL24, complete sequence 198862-198882 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_MH263654 Klebsiella pneumoniae strain QL24 plasmid pKPN-QL24, complete sequence 198904-198924 1 0.952
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_MH263654 Klebsiella pneumoniae strain QL24 plasmid pKPN-QL24, complete sequence 198946-198966 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 CP052329 Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence 117076-117096 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 CP052329 Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence 116805-116825 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP050836 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence 123304-123324 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP050836 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence 123850-123870 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP050836 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence 123640-123660 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP050836 Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence 123934-123954 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 39561-39581 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 39981-40001 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 39771-39791 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 39855-39875 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP017986 Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence 40065-40085 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 294183-294203 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 294099-294119 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 294309-294329 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 294393-294413 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 CP052400 Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence 122927-122947 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 145481-145501 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 145901-145921 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 145691-145711 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 145775-145795 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018714 Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence 145985-146005 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 134142-134162 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 134562-134582 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 134058-134078 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 134268-134288 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018720 Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence 134352-134372 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 114585-114605 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 115005-115025 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 114501-114521 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 114711-114731 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018702 Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence 114795-114815 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 173589-173609 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 174051-174071 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 345035-345055 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 345497-345517 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 173379-173399 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 345707-345727 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP027063 Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence 14481-14501 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP027063 Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence 14565-14585 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP013713 Klebsiella pneumoniae strain J1 plasmid 2, complete sequence 5414-5434 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP013713 Klebsiella pneumoniae strain J1 plasmid 2, complete sequence 5895-5915 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP013713 Klebsiella pneumoniae strain J1 plasmid 2, complete sequence 5330-5350 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP013713 Klebsiella pneumoniae strain J1 plasmid 2, complete sequence 5624-5644 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP024875 Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence 125330-125350 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP024875 Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence 125876-125896 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP024875 Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence 125246-125266 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP024875 Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence 125540-125560 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP026172 Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence 45275-45295 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP019161 Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence 196566-196586 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP019161 Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence 196356-196376 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP019161 Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence 196650-196670 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 94951-94971 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 94741-94761 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 94825-94845 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 95035-95055 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP015026 Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence 120083-120103 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP015026 Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence 120629-120649 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP015026 Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence 119999-120019 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP015026 Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence 120293-120313 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP026398 Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence 134915-134935 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 118696-118716 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 119116-119136 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 118612-118632 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 118906-118926 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 163071-163091 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 162861-162881 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 162945-162965 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 163155-163175 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 166240-166260 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 166702-166722 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 166912-166932 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 CP052539 Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence 118298-118318 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP017451 Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence 463044-463064 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP017451 Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence 463464-463484 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP017451 Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence 463254-463274 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP017451 Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence 463338-463358 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP017451 Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence 463548-463568 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP032915 Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence 19963-19983 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP032915 Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence 19879-19899 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP032915 Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence 20047-20067 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP032915 Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence 20173-20193 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 301864-301884 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 302326-302346 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 302536-302556 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 231785-231805 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 232205-232225 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 231995-232015 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 232079-232099 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018313 Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence 232289-232309 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 196215-196235 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 196677-196697 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 196005-196025 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 76566-76586 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 77028-77048 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 77238-77258 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 7703-7723 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 8123-8143 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 7913-7933 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 7997-8017 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018687 Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence 8207-8227 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 12497-12517 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 12413-12433 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 12623-12643 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 12707-12727 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP021699 Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence 326849-326869 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP021699 Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence 327311-327331 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP021699 Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence 327521-327541 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP034054 Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence 1468-1488 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 94519-94539 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 94981-95001 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 95191-95211 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 118822-118842 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 118612-118632 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 211722-211742 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 212142-212162 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 211638-211658 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 211848-211868 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018696 Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence 211932-211952 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 164240-164260 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 164660-164680 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 164156-164176 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 164366-164386 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP018708 Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence 164450-164470 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 197401-197421 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 197863-197883 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 197191-197211 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 153522-153542 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 153564-153584 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 154003-154023 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 153793-153813 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 153877-153897 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP032223 Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence 154087-154107 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 1258-1278 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 1300-1320 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP050068 Klebsiella aerogenes strain 035 plasmid p35, complete sequence 1426-1446 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP041093 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence 149329-149349 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP042482 Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence 200797-200817 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP023723 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence 188176-188196 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP050827 Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence 90969-90989 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 CP052236 Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence 1761-1781 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP034046 Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence 1468-1488 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP034046 Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence 1258-1278 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_KX029332 Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence 1216-1236 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP025081 Klebsiella pneumoniae strain SGH10 plasmid pSGH10, complete sequence 212327-212347 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP030924 Klebsiella pneumoniae subsp. pneumoniae strain KC-Pl-HB1 plasmid pKC-Pl-HB1, complete sequence 75554-75574 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP026022 Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence 75502-75522 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP014011 Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence 109389-109409 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP037743 Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_hv, complete sequence 209956-209976 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 MN543585 Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence 181087-181107 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 MN543585 Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence 181213-181233 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 MN543571 Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence 106813-106833 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 MN543571 Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence 106939-106959 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 150748-150768 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 CP052432 Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-1, complete sequence 162141-162161 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 120622-120642 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 CP052325 Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence 120748-120768 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP019049 Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence 131337-131357 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 MK347238 Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence 158952-158972 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 MK347238 Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence 159204-159224 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP020854 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence 103159-103179 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP020854 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence 103285-103305 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 LC549807 Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence 281390-281410 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_LR134257 Klebsiella aerogenes strain NCTC9644 plasmid 4, complete sequence 77117-77137 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP031563 Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence 235190-235210 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP031563 Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence 235316-235336 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP014009 Klebsiella pneumoniae subsp. pneumoniae strain RJF293 plasmid pRJF293, complete sequence 44108-44128 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP012754 Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence 252382-252402 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP012754 Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence 252508-252528 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP031736 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence 34531-34551 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP031736 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence 34657-34677 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 155794-155814 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 LR134211 Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2 202544-202564 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP031799 Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence 117988-118008 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP031799 Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence 118114-118134 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP036336 Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence 24422-24442 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP036336 Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence 24548-24568 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP021958 Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u 125635-125655 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP021958 Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u 125761-125781 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP021961 Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence 71007-71027 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP021961 Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence 71133-71153 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP032241 Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence 218346-218366 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NC_006625 Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 plasmid pK2044, complete sequence 146350-146370 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 296739-296759 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 34318-34338 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP031582 Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence 86336-86356 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NC_019789 Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence 281828-281848 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP009865 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence 46257-46277 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP009865 Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence 46383-46403 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP044036 Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence 27806-27826 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP044036 Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence 27932-27952 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP008933 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence 183458-183478 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP008933 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence 183584-183604 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP004000 Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence 45769-45789 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP047193 Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence 164013-164033 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 6696-6716 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 6822-6842 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP028929 Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence 198233-198253 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP028929 Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence 198359-198379 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 MF943217 Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence 140901-140921 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 MF943217 Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence 140943-140963 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP032164 Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence 182448-182468 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP016921 Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence 82220-82240 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP016921 Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence 82346-82366 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP034681 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence 205886-205906 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 CP050156 Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence 1468-1488 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 CP050156 Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence 1594-1614 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 108380-108400 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 108506-108526 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP023917 Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence 135057-135077 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP023917 Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence 135183-135203 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP040540 Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-VIR, complete sequence 158958-158978 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP020902 Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence 108421-108441 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP020902 Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence 108547-108567 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP045675 Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence 161455-161475 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP045675 Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence 161581-161601 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 139466-139486 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 139592-139612 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP032208 Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence 127013-127033 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 66604-66624 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP052037 Klebsiella pneumoniae strain KPN41053 plasmid pKPN41953, complete sequence 179746-179766 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP040595 Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence 216162-216182 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP040595 Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence 216288-216308 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP006799 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence 262125-262145 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP006799 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence 262251-262271 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 190410-190430 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 190536-190556 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP028390 Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence 192133-192153 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP028390 Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence 192175-192195 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP034083 Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-vir, complete sequence 212360-212380 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 CP050281 Klebsiella pneumoniae strain 9949 plasmid unnamed1, complete sequence 105596-105616 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 CP029383 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence 161582-161602 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 143953-143973 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 144079-144099 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP026012 Klebsiella pneumoniae strain K2044 plasmid pK2044, complete sequence 77782-77802 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP026024 Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence 113436-113456 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_AP019549 Klebsiella pneumoniae strain THC11 plasmid pTHC11-1, complete sequence 227094-227114 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 CP050276 Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence 203837-203857 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 MK649822 Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence 166498-166518 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 MK649822 Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence 166624-166644 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 MK649822 Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence 166750-166770 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 MK649825 Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence 173123-173143 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 MK649825 Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence 173249-173269 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 1468-1488 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 1594-1614 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 133654-133674 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 133780-133800 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_MK413721 Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence 1468-1488 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_MK413722 Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence 1216-1236 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NC_017541 Klebsiella pneumoniae KCTC 2242 plasmid pKCTC2242, complete sequence 139850-139870 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_MH255828 Klebsiella pneumoniae subsp. pneumoniae strain SH9 plasmid pSH9-VIR, complete sequence 169375-169395 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 194250-194270 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 194376-194396 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 HG918041 Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence 159482-159502 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP016815 Klebsiella pneumoniae strain ED23 plasmid unamed, complete sequence 134966-134986 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_MG053312 Klebsiella pneumoniae strain KP267 plasmid pVir-CR-HvKP267, complete sequence 133103-133123 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 1468-1488 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 1594-1614 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 1468-1488 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP025462 Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence 164384-164404 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP025462 Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence 164510-164530 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP034406 Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence 220941-220961 1 0.952
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 NZ_CP034406 Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence 221067-221087 1 0.952
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP050827 Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence 90759-90779 1 0.952
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 296823-296843 1 0.952
CP027063_1 1.10|14733|21|CP027063|CRT 14733-14753 21 NZ_CP024582 Roseomonas sp. FDAARGOS_362 plasmid unnamed1, complete sequence 54843-54863 1 0.952
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP023917 Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence 135561-135581 1 0.952
CP027063_1 1.11|14775|21|CP027063|CRT 14775-14795 21 NZ_CP032915 Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence 19669-19689 1 0.952
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 173169-173189 1 0.952
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP020848 Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence 345917-345937 1 0.952
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 482993-483013 1 0.952
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 564238-564258 1 0.952
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 167122-167142 1 0.952
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP011314 Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence 302746-302766 1 0.952
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 195795-195815 1 0.952
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 77448-77468 1 0.952
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP021699 Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence 327731-327751 1 0.952
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP034054 Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence 1048-1068 1 0.952
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 95401-95421 1 0.952
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_CP034046 Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence 1048-1068 1 0.952
CP027063_1 1.12|14817|21|CP027063|CRT 14817-14837 21 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 196981-197001 1 0.952
CP027063_1 1.5|14523|21|CP027063|CRT 14523-14543 21 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 732097-732117 2 0.905
CP027063_1 1.6|14565|21|CP027063|CRT 14565-14585 21 CP052400 Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence 122614-122634 2 0.905
CP027063_1 1.7|14607|21|CP027063|CRT 14607-14627 21 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 732097-732117 2 0.905
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 CP052327 Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence 118486-118506 2 0.905
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 CP052240 Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence 118486-118506 2 0.905
CP027063_1 1.8|14649|21|CP027063|CRT 14649-14669 21 MF185718 Arthrobacter phage Colucci, complete genome 3327-3347 2 0.905
CP027063_1 1.9|14691|21|CP027063|CRT 14691-14711 21 NZ_CP030828 Neorhizobium sp. NCHU2750 plasmid pNCHU2750a, complete sequence 367841-367861 2 0.905
CP027063_1 1.10|14733|21|CP027063|CRT 14733-14753 21 NZ_KX029332 Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence 1174-1194 2 0.905
CP027063_1 1.10|14733|21|CP027063|CRT 14733-14753 21 NZ_LN824134 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671 150790-150810 2 0.905
CP027063_1 1.10|14733|21|CP027063|CRT 14733-14753 21 NZ_CP015501 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence 155752-155772 2 0.905
CP027063_1 1.10|14733|21|CP027063|CRT 14733-14753 21 NZ_CP042866 Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence 34360-34380 2 0.905
CP027063_1 1.10|14733|21|CP027063|CRT 14733-14753 21 NZ_CP031582 Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence 86294-86314 2 0.905
CP027063_1 1.10|14733|21|CP027063|CRT 14733-14753 21 NZ_CP004000 Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence 45811-45831 2 0.905
CP027063_1 1.10|14733|21|CP027063|CRT 14733-14753 21 NZ_CP032208 Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence 126971-126991 2 0.905
CP027063_1 1.10|14733|21|CP027063|CRT 14733-14753 21 NZ_CP027156 Klebsiella pneumoniae strain AR_0363 plasmid unnamed4 66646-66666 2 0.905

1. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

2. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

3. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

4. spacer 1.1|14355|21|CP027063|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

5. spacer 1.1|14355|21|CP027063|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

6. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

7. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

8. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

9. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

10. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

11. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

12. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

13. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

14. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

15. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

16. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

17. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

18. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

19. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

20. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

21. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

22. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

23. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

24. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

25. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

26. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

27. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

28. spacer 1.1|14355|21|CP027063|CRT matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

29. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

30. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

31. spacer 1.1|14355|21|CP027063|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

32. spacer 1.1|14355|21|CP027063|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

33. spacer 1.1|14355|21|CP027063|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

34. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

35. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

36. spacer 1.1|14355|21|CP027063|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

37. spacer 1.1|14355|21|CP027063|CRT matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

38. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

39. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

40. spacer 1.1|14355|21|CP027063|CRT matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

41. spacer 1.1|14355|21|CP027063|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

42. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

43. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

44. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

45. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

46. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

47. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

48. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

49. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

50. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

51. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

52. spacer 1.1|14355|21|CP027063|CRT matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

53. spacer 1.1|14355|21|CP027063|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

54. spacer 1.1|14355|21|CP027063|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

55. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

56. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

57. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

58. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

59. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

60. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

61. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

62. spacer 1.1|14355|21|CP027063|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

63. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

64. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

65. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

66. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

67. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

68. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

69. spacer 1.1|14355|21|CP027063|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

70. spacer 1.1|14355|21|CP027063|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

71. spacer 1.1|14355|21|CP027063|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 0, identity: 1.0

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctaccggtgctc	Protospacer
*********************

72. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

acagggccgctgccggtgctc	CRISPR spacer
acagggccgctgccggtgctc	Protospacer
*********************

73. spacer 1.2|14397|21|CP027063|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

acagggccgctgccggtgctc	CRISPR spacer
acagggccgctgccggtgctc	Protospacer
*********************

74. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0

acagggccgctgccggtgctc	CRISPR spacer
acagggccgctgccggtgctc	Protospacer
*********************

75. spacer 1.2|14397|21|CP027063|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 0, identity: 1.0

acagggccgctgccggtgctc	CRISPR spacer
acagggccgctgccggtgctc	Protospacer
*********************

76. spacer 1.2|14397|21|CP027063|CRT matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0

acagggccgctgccggtgctc	CRISPR spacer
acagggccgctgccggtgctc	Protospacer
*********************

77. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

acagggccgctgccggtgctc	CRISPR spacer
acagggccgctgccggtgctc	Protospacer
*********************

78. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

acagggccgctgccggtgctc	CRISPR spacer
acagggccgctgccggtgctc	Protospacer
*********************

79. spacer 1.2|14397|21|CP027063|CRT matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 0, identity: 1.0

acagggccgctgccggtgctc	CRISPR spacer
acagggccgctgccggtgctc	Protospacer
*********************

80. spacer 1.2|14397|21|CP027063|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

acagggccgctgccggtgctc	CRISPR spacer
acagggccgctgccggtgctc	Protospacer
*********************

81. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0

acagggccgctgccggtgctc	CRISPR spacer
acagggccgctgccggtgctc	Protospacer
*********************

82. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0

acagggccgctgccggtgctc	CRISPR spacer
acagggccgctgccggtgctc	Protospacer
*********************

83. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP041093 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acagggccgctgccggtgctc	CRISPR spacer
acagggccgctgccggtgctc	Protospacer
*********************

84. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

acagggccgctgccggtgctc	CRISPR spacer
acagggccgctgccggtgctc	Protospacer
*********************

85. spacer 1.2|14397|21|CP027063|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

acagggccgctgccggtgctc	CRISPR spacer
acagggccgctgccggtgctc	Protospacer
*********************

86. spacer 1.2|14397|21|CP027063|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0

acagggccgctgccggtgctc	CRISPR spacer
acagggccgctgccggtgctc	Protospacer
*********************

87. spacer 1.2|14397|21|CP027063|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0

acagggccgctgccggtgctc	CRISPR spacer
acagggccgctgccggtgctc	Protospacer
*********************

88. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0

acagggccgctgccggtgctc	CRISPR spacer
acagggccgctgccggtgctc	Protospacer
*********************

89. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

acagggccgctgccggtgctc	CRISPR spacer
acagggccgctgccggtgctc	Protospacer
*********************

90. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 0, identity: 1.0

acagggccgctgccggtgctc	CRISPR spacer
acagggccgctgccggtgctc	Protospacer
*********************

91. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0

acagggccgctgccggtgctc	CRISPR spacer
acagggccgctgccggtgctc	Protospacer
*********************

92. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acagggccgctgccggtgctc	CRISPR spacer
acagggccgctgccggtgctc	Protospacer
*********************

93. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0

acagggccgctgccggtgctc	CRISPR spacer
acagggccgctgccggtgctc	Protospacer
*********************

94. spacer 1.2|14397|21|CP027063|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0

acagggccgctgccggtgctc	CRISPR spacer
acagggccgctgccggtgctc	Protospacer
*********************

95. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acagggccgctgccggtgctc	CRISPR spacer
acagggccgctgccggtgctc	Protospacer
*********************

96. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

acagggccgctgccggtgctc	CRISPR spacer
acagggccgctgccggtgctc	Protospacer
*********************

97. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

acagggccgctgccggtgctc	CRISPR spacer
acagggccgctgccggtgctc	Protospacer
*********************

98. spacer 1.2|14397|21|CP027063|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0

acagggccgctgccggtgctc	CRISPR spacer
acagggccgctgccggtgctc	Protospacer
*********************

99. spacer 1.2|14397|21|CP027063|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

acagggccgctgccggtgctc	CRISPR spacer
acagggccgctgccggtgctc	Protospacer
*********************

100. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acagggccgctgccggtgctc	CRISPR spacer
acagggccgctgccggtgctc	Protospacer
*********************

101. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

acagggccgctgccggtgctc	CRISPR spacer
acagggccgctgccggtgctc	Protospacer
*********************

102. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 0, identity: 1.0

acagggccgctgccggtgctc	CRISPR spacer
acagggccgctgccggtgctc	Protospacer
*********************

103. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0

acagggccgctgccggtgctc	CRISPR spacer
acagggccgctgccggtgctc	Protospacer
*********************

104. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0

acagggccgctgccggtgctc	CRISPR spacer
acagggccgctgccggtgctc	Protospacer
*********************

105. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acagggccgctgccggtgctc	CRISPR spacer
acagggccgctgccggtgctc	Protospacer
*********************

106. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0

acagggccgctgccggtgctc	CRISPR spacer
acagggccgctgccggtgctc	Protospacer
*********************

107. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0

acagggccgctgccggtgctc	CRISPR spacer
acagggccgctgccggtgctc	Protospacer
*********************

108. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0

acagggccgctgccggtgctc	CRISPR spacer
acagggccgctgccggtgctc	Protospacer
*********************

109. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0

acagggccgctgccggtgctc	CRISPR spacer
acagggccgctgccggtgctc	Protospacer
*********************

110. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0

acagggccgctgccggtgctc	CRISPR spacer
acagggccgctgccggtgctc	Protospacer
*********************

111. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acagggccgctgccggtgctc	CRISPR spacer
acagggccgctgccggtgctc	Protospacer
*********************

112. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0

acagggccgctgccggtgctc	CRISPR spacer
acagggccgctgccggtgctc	Protospacer
*********************

113. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

acagggccgctgccggtgctc	CRISPR spacer
acagggccgctgccggtgctc	Protospacer
*********************

114. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

acagggccgctgccggtgctc	CRISPR spacer
acagggccgctgccggtgctc	Protospacer
*********************

115. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

acagggccgctgccggtgctc	CRISPR spacer
acagggccgctgccggtgctc	Protospacer
*********************

116. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0

acagggccgctgccggtgctc	CRISPR spacer
acagggccgctgccggtgctc	Protospacer
*********************

117. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

acagggccgctgccggtgctc	CRISPR spacer
acagggccgctgccggtgctc	Protospacer
*********************

118. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acagggccgctgccggtgctc	CRISPR spacer
acagggccgctgccggtgctc	Protospacer
*********************

119. spacer 1.3|14439|21|CP027063|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtgaccgctgacggtagct	CRISPR spacer
acgtgaccgctgacggtagct	Protospacer
*********************

120. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtgaccgctgacggtagct	CRISPR spacer
acgtgaccgctgacggtagct	Protospacer
*********************

121. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtgaccgctgacggtagct	CRISPR spacer
acgtgaccgctgacggtagct	Protospacer
*********************

122. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtgaccgctgacggtagct	CRISPR spacer
acgtgaccgctgacggtagct	Protospacer
*********************

123. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtgaccgctgacggtagct	CRISPR spacer
acgtgaccgctgacggtagct	Protospacer
*********************

124. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP041093 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtgaccgctgacggtagct	CRISPR spacer
acgtgaccgctgacggtagct	Protospacer
*********************

125. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

acgtgaccgctgacggtagct	CRISPR spacer
acgtgaccgctgacggtagct	Protospacer
*********************

126. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 0, identity: 1.0

acgtgaccgctgacggtagct	CRISPR spacer
acgtgaccgctgacggtagct	Protospacer
*********************

127. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtgaccgctgacggtagct	CRISPR spacer
acgtgaccgctgacggtagct	Protospacer
*********************

128. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0

acgtgaccgctgacggtagct	CRISPR spacer
acgtgaccgctgacggtagct	Protospacer
*********************

129. spacer 1.3|14439|21|CP027063|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtgaccgctgacggtagct	CRISPR spacer
acgtgaccgctgacggtagct	Protospacer
*********************

130. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtgaccgctgacggtagct	CRISPR spacer
acgtgaccgctgacggtagct	Protospacer
*********************

131. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0

acgtgaccgctgacggtagct	CRISPR spacer
acgtgaccgctgacggtagct	Protospacer
*********************

132. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtgaccgctgacggtagct	CRISPR spacer
acgtgaccgctgacggtagct	Protospacer
*********************

133. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtgaccgctgacggtagct	CRISPR spacer
acgtgaccgctgacggtagct	Protospacer
*********************

134. spacer 1.3|14439|21|CP027063|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtgaccgctgacggtagct	CRISPR spacer
acgtgaccgctgacggtagct	Protospacer
*********************

135. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtgaccgctgacggtagct	CRISPR spacer
acgtgaccgctgacggtagct	Protospacer
*********************

136. spacer 1.3|14439|21|CP027063|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtgaccgctgacggtagct	CRISPR spacer
acgtgaccgctgacggtagct	Protospacer
*********************

137. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtgaccgctgacggtagct	CRISPR spacer
acgtgaccgctgacggtagct	Protospacer
*********************

138. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtgaccgctgacggtagct	CRISPR spacer
acgtgaccgctgacggtagct	Protospacer
*********************

139. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtgaccgctgacggtagct	CRISPR spacer
acgtgaccgctgacggtagct	Protospacer
*********************

140. spacer 1.3|14439|21|CP027063|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtgaccgctgacggtagct	CRISPR spacer
acgtgaccgctgacggtagct	Protospacer
*********************

141. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0

acgtgaccgctgacggtagct	CRISPR spacer
acgtgaccgctgacggtagct	Protospacer
*********************

142. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtgaccgctgacggtagct	CRISPR spacer
acgtgaccgctgacggtagct	Protospacer
*********************

143. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtgaccgctgacggtagct	CRISPR spacer
acgtgaccgctgacggtagct	Protospacer
*********************

144. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 0, identity: 1.0

acgtgaccgctgacggtagct	CRISPR spacer
acgtgaccgctgacggtagct	Protospacer
*********************

145. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtgaccgctgacggtagct	CRISPR spacer
acgtgaccgctgacggtagct	Protospacer
*********************

146. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtgaccgctgacggtagct	CRISPR spacer
acgtgaccgctgacggtagct	Protospacer
*********************

147. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0

acgtgaccgctgacggtagct	CRISPR spacer
acgtgaccgctgacggtagct	Protospacer
*********************

148. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtgaccgctgacggtagct	CRISPR spacer
acgtgaccgctgacggtagct	Protospacer
*********************

149. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtgaccgctgacggtagct	CRISPR spacer
acgtgaccgctgacggtagct	Protospacer
*********************

150. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtgaccgctgacggtagct	CRISPR spacer
acgtgaccgctgacggtagct	Protospacer
*********************

151. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0

acgtgaccgctgacggtagct	CRISPR spacer
acgtgaccgctgacggtagct	Protospacer
*********************

152. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtgaccgctgacggtagct	CRISPR spacer
acgtgaccgctgacggtagct	Protospacer
*********************

153. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtgaccgctgacggtagct	CRISPR spacer
acgtgaccgctgacggtagct	Protospacer
*********************

154. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

155. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

156. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

157. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

158. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

159. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

160. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

161. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

162. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

163. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

164. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

165. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

166. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

167. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

168. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

169. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

170. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

171. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

172. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

173. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

174. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

175. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

176. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

177. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

178. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

179. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

180. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

181. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

182. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

183. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

184. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

185. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

186. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

187. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

188. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

189. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

190. spacer 1.4|14481|21|CP027063|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

191. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

192. spacer 1.4|14481|21|CP027063|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

193. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

194. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

195. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

196. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

197. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP041093 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

198. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

199. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

200. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

201. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

202. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

203. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

204. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

205. spacer 1.4|14481|21|CP027063|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

206. spacer 1.4|14481|21|CP027063|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

207. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

208. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

209. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

210. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

211. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

212. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

213. spacer 1.4|14481|21|CP027063|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

214. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

215. spacer 1.4|14481|21|CP027063|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

216. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

217. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

218. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

219. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

220. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

221. spacer 1.4|14481|21|CP027063|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

222. spacer 1.4|14481|21|CP027063|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
*********************

223. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

224. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

225. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

226. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

227. spacer 1.5|14523|21|CP027063|CRT matches to MN200128 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-Vir-RC, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

228. spacer 1.5|14523|21|CP027063|CRT matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

229. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

230. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

231. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP024708 (Klebsiella pneumoniae strain cr-hvkp3 plasmid pPUTH1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

232. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

233. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

234. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

235. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

236. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

237. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

238. spacer 1.5|14523|21|CP027063|CRT matches to LR134211 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

239. spacer 1.5|14523|21|CP027063|CRT matches to NC_005249 (Klebsiella pneumoniae CG43 plasmid pLVPK, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

240. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

241. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

242. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

243. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

244. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

245. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

246. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

247. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

248. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

249. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

250. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

251. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

252. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

253. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

254. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

255. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

256. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

257. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

258. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

259. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP042975 (Klebsiella pneumoniae strain KPN55602 plasmid pK55602_1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

260. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

261. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

262. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

263. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

264. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

265. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

266. spacer 1.5|14523|21|CP027063|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

267. spacer 1.5|14523|21|CP027063|CRT matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

268. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

269. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

270. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

271. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

272. spacer 1.5|14523|21|CP027063|CRT matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

273. spacer 1.5|14523|21|CP027063|CRT matches to CP052363 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

274. spacer 1.5|14523|21|CP027063|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

275. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

276. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

277. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

278. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

279. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

280. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

281. spacer 1.5|14523|21|CP027063|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

282. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

283. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

284. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

285. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

286. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

287. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

288. spacer 1.5|14523|21|CP027063|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

289. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

290. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

291. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

292. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP026587 (Klebsiella pneumoniae strain NUHL30457 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

293. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

294. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

295. spacer 1.5|14523|21|CP027063|CRT matches to NZ_LR745046 (Klebsiella pneumoniae isolate Kpn2166 plasmid pVIR_Kpn2166) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

296. spacer 1.5|14523|21|CP027063|CRT matches to NZ_LR745043 (Klebsiella pneumoniae isolate Klebsiella pneumoniae kpn154 plasmid pVIR_Kpn154) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

297. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

298. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

299. spacer 1.5|14523|21|CP027063|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

300. spacer 1.5|14523|21|CP027063|CRT matches to NC_017541 (Klebsiella pneumoniae KCTC 2242 plasmid pKCTC2242, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

301. spacer 1.5|14523|21|CP027063|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

302. spacer 1.5|14523|21|CP027063|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

303. spacer 1.6|14565|21|CP027063|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

304. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

305. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

306. spacer 1.6|14565|21|CP027063|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

307. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP025081 (Klebsiella pneumoniae strain SGH10 plasmid pSGH10, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

308. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

309. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

310. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP030924 (Klebsiella pneumoniae subsp. pneumoniae strain KC-Pl-HB1 plasmid pKC-Pl-HB1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

311. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP026022 (Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

312. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP014011 (Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

313. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP037743 (Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_hv, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

314. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

315. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

316. spacer 1.6|14565|21|CP027063|CRT matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

317. spacer 1.6|14565|21|CP027063|CRT matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

318. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

319. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

320. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

321. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

322. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

323. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

324. spacer 1.6|14565|21|CP027063|CRT matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

325. spacer 1.6|14565|21|CP027063|CRT matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

326. spacer 1.6|14565|21|CP027063|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

327. spacer 1.6|14565|21|CP027063|CRT matches to CP052432 (Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

328. spacer 1.6|14565|21|CP027063|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

329. spacer 1.6|14565|21|CP027063|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

330. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP019049 (Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

331. spacer 1.6|14565|21|CP027063|CRT matches to MK347238 (Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

332. spacer 1.6|14565|21|CP027063|CRT matches to MK347238 (Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

333. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

334. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

335. spacer 1.6|14565|21|CP027063|CRT matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

336. spacer 1.6|14565|21|CP027063|CRT matches to NZ_LR134257 (Klebsiella aerogenes strain NCTC9644 plasmid 4, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

337. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

338. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

339. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

340. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP014009 (Klebsiella pneumoniae subsp. pneumoniae strain RJF293 plasmid pRJF293, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

341. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

342. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

343. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

344. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

345. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

346. spacer 1.6|14565|21|CP027063|CRT matches to LR134211 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

347. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

348. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

349. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

350. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

351. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

352. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

353. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

354. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

355. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

356. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

357. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

358. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

359. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP032241 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

360. spacer 1.6|14565|21|CP027063|CRT matches to NC_006625 (Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 plasmid pK2044, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

361. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

362. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

363. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

364. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

365. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

366. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

367. spacer 1.6|14565|21|CP027063|CRT matches to NC_019789 (Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

368. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

369. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

370. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

371. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

372. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

373. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

374. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

375. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

376. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

377. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

378. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

379. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

380. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP047193 (Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

381. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

382. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

383. spacer 1.6|14565|21|CP027063|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

384. spacer 1.6|14565|21|CP027063|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

385. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

386. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

387. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

388. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

389. spacer 1.6|14565|21|CP027063|CRT matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

390. spacer 1.6|14565|21|CP027063|CRT matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

391. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP032164 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

392. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

393. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

394. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

395. spacer 1.6|14565|21|CP027063|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

396. spacer 1.6|14565|21|CP027063|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

397. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

398. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

399. spacer 1.6|14565|21|CP027063|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

400. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

401. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

402. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP040540 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-VIR, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

403. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

404. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

405. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

406. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

407. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

408. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

409. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

410. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

411. spacer 1.6|14565|21|CP027063|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

412. spacer 1.6|14565|21|CP027063|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

413. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

414. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

415. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

416. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

417. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP052037 (Klebsiella pneumoniae strain KPN41053 plasmid pKPN41953, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

418. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

419. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

420. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

421. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

422. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

423. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

424. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

425. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

426. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

427. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

428. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

429. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

430. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP034083 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-vir, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

431. spacer 1.6|14565|21|CP027063|CRT matches to CP050281 (Klebsiella pneumoniae strain 9949 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

432. spacer 1.6|14565|21|CP027063|CRT matches to CP029383 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

433. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

434. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

435. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP026012 (Klebsiella pneumoniae strain K2044 plasmid pK2044, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

436. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP026024 (Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

437. spacer 1.6|14565|21|CP027063|CRT matches to NZ_AP019549 (Klebsiella pneumoniae strain THC11 plasmid pTHC11-1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

438. spacer 1.6|14565|21|CP027063|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

439. spacer 1.6|14565|21|CP027063|CRT matches to CP050276 (Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

440. spacer 1.6|14565|21|CP027063|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

441. spacer 1.6|14565|21|CP027063|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

442. spacer 1.6|14565|21|CP027063|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

443. spacer 1.6|14565|21|CP027063|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

444. spacer 1.6|14565|21|CP027063|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

445. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

446. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

447. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

448. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

449. spacer 1.6|14565|21|CP027063|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

450. spacer 1.6|14565|21|CP027063|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

451. spacer 1.6|14565|21|CP027063|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

452. spacer 1.6|14565|21|CP027063|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

453. spacer 1.6|14565|21|CP027063|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

454. spacer 1.6|14565|21|CP027063|CRT matches to NZ_MK413722 (Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

455. spacer 1.6|14565|21|CP027063|CRT matches to NC_017541 (Klebsiella pneumoniae KCTC 2242 plasmid pKCTC2242, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

456. spacer 1.6|14565|21|CP027063|CRT matches to NZ_MH255828 (Klebsiella pneumoniae subsp. pneumoniae strain SH9 plasmid pSH9-VIR, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

457. spacer 1.6|14565|21|CP027063|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

458. spacer 1.6|14565|21|CP027063|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

459. spacer 1.6|14565|21|CP027063|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

460. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP016815 (Klebsiella pneumoniae strain ED23 plasmid unamed, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

461. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

462. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

463. spacer 1.6|14565|21|CP027063|CRT matches to NZ_MG053312 (Klebsiella pneumoniae strain KP267 plasmid pVir-CR-HvKP267, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

464. spacer 1.6|14565|21|CP027063|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

465. spacer 1.6|14565|21|CP027063|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

466. spacer 1.6|14565|21|CP027063|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

467. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

468. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

469. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

470. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 0, identity: 1.0

acggggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*********************

471. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

472. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

473. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

474. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

475. spacer 1.7|14607|21|CP027063|CRT matches to MN200128 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-Vir-RC, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

476. spacer 1.7|14607|21|CP027063|CRT matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

477. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

478. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

479. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP024708 (Klebsiella pneumoniae strain cr-hvkp3 plasmid pPUTH1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

480. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

481. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

482. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

483. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

484. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

485. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

486. spacer 1.7|14607|21|CP027063|CRT matches to LR134211 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

487. spacer 1.7|14607|21|CP027063|CRT matches to NC_005249 (Klebsiella pneumoniae CG43 plasmid pLVPK, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

488. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

489. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

490. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

491. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

492. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

493. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

494. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

495. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

496. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

497. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

498. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

499. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

500. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

501. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

502. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

503. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

504. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

505. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

506. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

507. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP042975 (Klebsiella pneumoniae strain KPN55602 plasmid pK55602_1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

508. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

509. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

510. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

511. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

512. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

513. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

514. spacer 1.7|14607|21|CP027063|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

515. spacer 1.7|14607|21|CP027063|CRT matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

516. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

517. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

518. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

519. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

520. spacer 1.7|14607|21|CP027063|CRT matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

521. spacer 1.7|14607|21|CP027063|CRT matches to CP052363 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

522. spacer 1.7|14607|21|CP027063|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

523. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

524. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

525. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

526. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

527. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

528. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

529. spacer 1.7|14607|21|CP027063|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

530. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

531. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

532. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

533. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

534. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

535. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

536. spacer 1.7|14607|21|CP027063|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

537. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

538. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

539. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

540. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP026587 (Klebsiella pneumoniae strain NUHL30457 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

541. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

542. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

543. spacer 1.7|14607|21|CP027063|CRT matches to NZ_LR745046 (Klebsiella pneumoniae isolate Kpn2166 plasmid pVIR_Kpn2166) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

544. spacer 1.7|14607|21|CP027063|CRT matches to NZ_LR745043 (Klebsiella pneumoniae isolate Klebsiella pneumoniae kpn154 plasmid pVIR_Kpn154) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

545. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

546. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

547. spacer 1.7|14607|21|CP027063|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

548. spacer 1.7|14607|21|CP027063|CRT matches to NC_017541 (Klebsiella pneumoniae KCTC 2242 plasmid pKCTC2242, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

549. spacer 1.7|14607|21|CP027063|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

550. spacer 1.7|14607|21|CP027063|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctc	Protospacer
*********************

551. spacer 1.8|14649|21|CP027063|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

552. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

553. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

554. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

555. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

556. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

557. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

558. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

559. spacer 1.8|14649|21|CP027063|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

560. spacer 1.8|14649|21|CP027063|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

561. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

562. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

563. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

564. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

565. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

566. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

567. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

568. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

569. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

570. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

571. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

572. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

573. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

574. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

575. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

576. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

577. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

578. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

579. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

580. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

581. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

582. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

583. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

584. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

585. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

586. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

587. spacer 1.8|14649|21|CP027063|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

588. spacer 1.8|14649|21|CP027063|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

589. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

590. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

591. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

592. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

593. spacer 1.8|14649|21|CP027063|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

594. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

595. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

596. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

597. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

598. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

599. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

600. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

601. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

602. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

603. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

604. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

605. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

606. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

607. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

608. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

609. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

610. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

611. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

612. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

613. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

614. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

615. spacer 1.8|14649|21|CP027063|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

616. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

617. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

618. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

619. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

620. spacer 1.8|14649|21|CP027063|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

621. spacer 1.8|14649|21|CP027063|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

622. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

623. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*********************

624. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

625. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

626. spacer 1.9|14691|21|CP027063|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

627. spacer 1.9|14691|21|CP027063|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

628. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP025081 (Klebsiella pneumoniae strain SGH10 plasmid pSGH10, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

629. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP014011 (Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

630. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP014011 (Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

631. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP037743 (Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_hv, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

632. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

633. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

634. spacer 1.9|14691|21|CP027063|CRT matches to MT035874 (Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

635. spacer 1.9|14691|21|CP027063|CRT matches to MT035874 (Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

636. spacer 1.9|14691|21|CP027063|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

637. spacer 1.9|14691|21|CP027063|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

638. spacer 1.9|14691|21|CP027063|CRT matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

639. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

640. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

641. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

642. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

643. spacer 1.9|14691|21|CP027063|CRT matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

644. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP033955 (Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

645. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP033955 (Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

646. spacer 1.9|14691|21|CP027063|CRT matches to CP052432 (Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

647. spacer 1.9|14691|21|CP027063|CRT matches to CP052363 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

648. spacer 1.9|14691|21|CP027063|CRT matches to MK347227 (Klebsiella pneumoniae strain K187 plasmid pK187_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

649. spacer 1.9|14691|21|CP027063|CRT matches to MK347228 (Klebsiella pneumoniae strain K195 plasmid pK195_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

650. spacer 1.9|14691|21|CP027063|CRT matches to MK347230 (Klebsiella pneumoniae strain K202 plasmid pK202_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

651. spacer 1.9|14691|21|CP027063|CRT matches to MK347231 (Klebsiella pneumoniae strain K204 plasmid pK204_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

652. spacer 1.9|14691|21|CP027063|CRT matches to MK347238 (Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

653. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

654. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

655. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

656. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

657. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

658. spacer 1.9|14691|21|CP027063|CRT matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

659. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

660. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP014009 (Klebsiella pneumoniae subsp. pneumoniae strain RJF293 plasmid pRJF293, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

661. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

662. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

663. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

664. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

665. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

666. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

667. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

668. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

669. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP032241 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

670. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP032241 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

671. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

672. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

673. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

674. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP047193 (Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

675. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP047193 (Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

676. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

677. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

678. spacer 1.9|14691|21|CP027063|CRT matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

679. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP032164 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

680. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP032164 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

681. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

682. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

683. spacer 1.9|14691|21|CP027063|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

684. spacer 1.9|14691|21|CP027063|CRT matches to CP052190 (Klebsiella pneumoniae strain F16KP0019 plasmid pF16KP0019-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

685. spacer 1.9|14691|21|CP027063|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

686. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

687. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP040540 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-VIR, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

688. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

689. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

690. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

691. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

692. spacer 1.9|14691|21|CP027063|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

693. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

694. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

695. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP034124 (Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

696. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP034124 (Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

697. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP034124 (Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

698. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

699. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

700. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

701. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

702. spacer 1.9|14691|21|CP027063|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

703. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

704. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

705. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

706. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP034083 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-vir, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

707. spacer 1.9|14691|21|CP027063|CRT matches to CP029383 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

708. spacer 1.9|14691|21|CP027063|CRT matches to CP029383 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

709. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

710. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP026012 (Klebsiella pneumoniae strain K2044 plasmid pK2044, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

711. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP026024 (Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

712. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP026024 (Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

713. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

714. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

715. spacer 1.9|14691|21|CP027063|CRT matches to CP050276 (Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

716. spacer 1.9|14691|21|CP027063|CRT matches to CP050276 (Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

717. spacer 1.9|14691|21|CP027063|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

718. spacer 1.9|14691|21|CP027063|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

719. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP026587 (Klebsiella pneumoniae strain NUHL30457 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

720. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

721. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

722. spacer 1.9|14691|21|CP027063|CRT matches to NZ_LR745043 (Klebsiella pneumoniae isolate Klebsiella pneumoniae kpn154 plasmid pVIR_Kpn154) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

723. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

724. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

725. spacer 1.9|14691|21|CP027063|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

726. spacer 1.9|14691|21|CP027063|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

727. spacer 1.9|14691|21|CP027063|CRT matches to NZ_MK413719 (Klebsiella pneumoniae strain 362713 plasmid p362713-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

728. spacer 1.9|14691|21|CP027063|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

729. spacer 1.9|14691|21|CP027063|CRT matches to NC_017541 (Klebsiella pneumoniae KCTC 2242 plasmid pKCTC2242, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

730. spacer 1.9|14691|21|CP027063|CRT matches to NZ_MH255828 (Klebsiella pneumoniae subsp. pneumoniae strain SH9 plasmid pSH9-VIR, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

731. spacer 1.9|14691|21|CP027063|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

732. spacer 1.9|14691|21|CP027063|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

733. spacer 1.9|14691|21|CP027063|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

734. spacer 1.9|14691|21|CP027063|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

735. spacer 1.9|14691|21|CP027063|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

736. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

737. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

738. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

739. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

740. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

741. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

742. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP026022 (Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

743. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP026022 (Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

744. spacer 1.9|14691|21|CP027063|CRT matches to MN200128 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-Vir-RC, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

745. spacer 1.9|14691|21|CP027063|CRT matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

746. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

747. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

748. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP019049 (Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

749. spacer 1.9|14691|21|CP027063|CRT matches to NZ_LR134257 (Klebsiella aerogenes strain NCTC9644 plasmid 4, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

750. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

751. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

752. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

753. spacer 1.9|14691|21|CP027063|CRT matches to LR134211 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

754. spacer 1.9|14691|21|CP027063|CRT matches to NC_005249 (Klebsiella pneumoniae CG43 plasmid pLVPK, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

755. spacer 1.9|14691|21|CP027063|CRT matches to NC_006625 (Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 plasmid pK2044, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

756. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

757. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

758. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

759. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

760. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

761. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

762. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

763. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

764. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

765. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

766. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

767. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

768. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

769. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

770. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

771. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

772. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

773. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

774. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

775. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

776. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

777. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

778. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

779. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

780. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

781. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

782. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

783. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

784. spacer 1.9|14691|21|CP027063|CRT matches to CP050281 (Klebsiella pneumoniae strain 9949 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

785. spacer 1.9|14691|21|CP027063|CRT matches to CP050281 (Klebsiella pneumoniae strain 9949 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

786. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP042975 (Klebsiella pneumoniae strain KPN55602 plasmid pK55602_1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

787. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

788. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

789. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP016815 (Klebsiella pneumoniae strain ED23 plasmid unamed, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

790. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

791. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

792. spacer 1.9|14691|21|CP027063|CRT matches to NZ_MG053312 (Klebsiella pneumoniae strain KP267 plasmid pVir-CR-HvKP267, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

793. spacer 1.9|14691|21|CP027063|CRT matches to NZ_MG053312 (Klebsiella pneumoniae strain KP267 plasmid pVir-CR-HvKP267, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

794. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

795. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 0, identity: 1.0

acgggaccgctgccggtagtc	CRISPR spacer
acgggaccgctgccggtagtc	Protospacer
*********************

796. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgtcggtggtc	CRISPR spacer
gcgtggccgctgtcggtggtc	Protospacer
*********************

797. spacer 1.10|14733|21|CP027063|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgtcggtggtc	CRISPR spacer
gcgtggccgctgtcggtggtc	Protospacer
*********************

798. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgtcggtggtc	CRISPR spacer
gcgtggccgctgtcggtggtc	Protospacer
*********************

799. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgtcggtggtc	CRISPR spacer
gcgtggccgctgtcggtggtc	Protospacer
*********************

800. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgtcggtggtc	CRISPR spacer
gcgtggccgctgtcggtggtc	Protospacer
*********************

801. spacer 1.10|14733|21|CP027063|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgtcggtggtc	CRISPR spacer
gcgtggccgctgtcggtggtc	Protospacer
*********************

802. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgtcggtggtc	CRISPR spacer
gcgtggccgctgtcggtggtc	Protospacer
*********************

803. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgtcggtggtc	CRISPR spacer
gcgtggccgctgtcggtggtc	Protospacer
*********************

804. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgtcggtggtc	CRISPR spacer
gcgtggccgctgtcggtggtc	Protospacer
*********************

805. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgtcggtggtc	CRISPR spacer
gcgtggccgctgtcggtggtc	Protospacer
*********************

806. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgtcggtggtc	CRISPR spacer
gcgtggccgctgtcggtggtc	Protospacer
*********************

807. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgtcggtggtc	CRISPR spacer
gcgtggccgctgtcggtggtc	Protospacer
*********************

808. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP041093 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgtcggtggtc	CRISPR spacer
gcgtggccgctgtcggtggtc	Protospacer
*********************

809. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgtcggtggtc	CRISPR spacer
gcgtggccgctgtcggtggtc	Protospacer
*********************

810. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgtcggtggtc	CRISPR spacer
gcgtggccgctgtcggtggtc	Protospacer
*********************

811. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgtcggtggtc	CRISPR spacer
gcgtggccgctgtcggtggtc	Protospacer
*********************

812. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgtcggtggtc	CRISPR spacer
gcgtggccgctgtcggtggtc	Protospacer
*********************

813. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgtcggtggtc	CRISPR spacer
gcgtggccgctgtcggtggtc	Protospacer
*********************

814. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgtcggtggtc	CRISPR spacer
gcgtggccgctgtcggtggtc	Protospacer
*********************

815. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgtcggtggtc	CRISPR spacer
gcgtggccgctgtcggtggtc	Protospacer
*********************

816. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgtcggtggtc	CRISPR spacer
gcgtggccgctgtcggtggtc	Protospacer
*********************

817. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgtcggtggtc	CRISPR spacer
gcgtggccgctgtcggtggtc	Protospacer
*********************

818. spacer 1.10|14733|21|CP027063|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgtcggtggtc	CRISPR spacer
gcgtggccgctgtcggtggtc	Protospacer
*********************

819. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgtcggtggtc	CRISPR spacer
gcgtggccgctgtcggtggtc	Protospacer
*********************

820. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgtcggtggtc	CRISPR spacer
gcgtggccgctgtcggtggtc	Protospacer
*********************

821. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgtcggtggtc	CRISPR spacer
gcgtggccgctgtcggtggtc	Protospacer
*********************

822. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgtcggtggtc	CRISPR spacer
gcgtggccgctgtcggtggtc	Protospacer
*********************

823. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgtcggtggtc	CRISPR spacer
gcgtggccgctgtcggtggtc	Protospacer
*********************

824. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgtcggtggtc	CRISPR spacer
gcgtggccgctgtcggtggtc	Protospacer
*********************

825. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgtcggtggtc	CRISPR spacer
gcgtggccgctgtcggtggtc	Protospacer
*********************

826. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgtcggtggtc	CRISPR spacer
gcgtggccgctgtcggtggtc	Protospacer
*********************

827. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgtcggtggtc	CRISPR spacer
gcgtggccgctgtcggtggtc	Protospacer
*********************

828. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgtcggtggtc	CRISPR spacer
gcgtggccgctgtcggtggtc	Protospacer
*********************

829. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgtcggtggtc	CRISPR spacer
gcgtggccgctgtcggtggtc	Protospacer
*********************

830. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgtcggtggtc	CRISPR spacer
gcgtggccgctgtcggtggtc	Protospacer
*********************

831. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgtcggtggtc	CRISPR spacer
gcgtggccgctgtcggtggtc	Protospacer
*********************

832. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgtcggtggtc	CRISPR spacer
gcgtggccgctgtcggtggtc	Protospacer
*********************

833. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgtcggtggtc	CRISPR spacer
gcgtggccgctgtcggtggtc	Protospacer
*********************

834. spacer 1.10|14733|21|CP027063|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgtcggtggtc	CRISPR spacer
gcgtggccgctgtcggtggtc	Protospacer
*********************

835. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggccgctgtcggtggtc	CRISPR spacer
gcgtggccgctgtcggtggtc	Protospacer
*********************

836. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

837. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

838. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

839. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

840. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

841. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

842. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

843. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

844. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

845. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

846. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

847. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

848. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

849. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

850. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

851. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

852. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

853. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

854. spacer 1.11|14775|21|CP027063|CRT matches to NC_016980 (Klebsiella pneumoniae plasmid pNDM-MAR, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

855. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

856. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

857. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

858. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

859. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

860. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

861. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

862. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

863. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

864. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

865. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

866. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

867. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

868. spacer 1.11|14775|21|CP027063|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

869. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP037442 (Klebsiella sp. PO552 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

870. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

871. spacer 1.11|14775|21|CP027063|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

872. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

873. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

874. spacer 1.11|14775|21|CP027063|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

875. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

876. spacer 1.11|14775|21|CP027063|CRT matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

877. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

878. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

879. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

880. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP041093 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

881. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

882. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

883. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

884. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

885. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

886. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

887. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

888. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

889. spacer 1.11|14775|21|CP027063|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

890. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

891. spacer 1.11|14775|21|CP027063|CRT matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

892. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

893. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

894. spacer 1.11|14775|21|CP027063|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

895. spacer 1.11|14775|21|CP027063|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

896. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

897. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

898. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

899. spacer 1.11|14775|21|CP027063|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

900. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

901. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

902. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

903. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

904. spacer 1.11|14775|21|CP027063|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

905. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

906. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

907. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

908. spacer 1.11|14775|21|CP027063|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

909. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

910. spacer 1.11|14775|21|CP027063|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

911. spacer 1.11|14775|21|CP027063|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

912. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

913. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

914. spacer 1.11|14775|21|CP027063|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

915. spacer 1.11|14775|21|CP027063|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

916. spacer 1.11|14775|21|CP027063|CRT matches to NZ_MK413719 (Klebsiella pneumoniae strain 362713 plasmid p362713-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

917. spacer 1.11|14775|21|CP027063|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

918. spacer 1.11|14775|21|CP027063|CRT matches to NZ_MK413722 (Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

919. spacer 1.11|14775|21|CP027063|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

920. spacer 1.11|14775|21|CP027063|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

921. spacer 1.11|14775|21|CP027063|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

922. spacer 1.11|14775|21|CP027063|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccagtgacc	Protospacer
*********************

923. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

924. spacer 1.12|14817|21|CP027063|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

925. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

926. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP037442 (Klebsiella sp. PO552 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

927. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

928. spacer 1.12|14817|21|CP027063|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

929. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

930. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

931. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

932. spacer 1.12|14817|21|CP027063|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

933. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

934. spacer 1.12|14817|21|CP027063|CRT matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

935. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

936. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

937. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

938. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

939. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

940. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

941. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP041093 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

942. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

943. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

944. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

945. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

946. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

947. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

948. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

949. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

950. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

951. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

952. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

953. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

954. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

955. spacer 1.12|14817|21|CP027063|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

956. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

957. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

958. spacer 1.12|14817|21|CP027063|CRT matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

959. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

960. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

961. spacer 1.12|14817|21|CP027063|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

962. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

963. spacer 1.12|14817|21|CP027063|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

964. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

965. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

966. spacer 1.12|14817|21|CP027063|CRT matches to NC_016980 (Klebsiella pneumoniae plasmid pNDM-MAR, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

967. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

968. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

969. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

970. spacer 1.12|14817|21|CP027063|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

971. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

972. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

973. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

974. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

975. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

976. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

977. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

978. spacer 1.12|14817|21|CP027063|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

979. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

980. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

981. spacer 1.12|14817|21|CP027063|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

982. spacer 1.12|14817|21|CP027063|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

983. spacer 1.12|14817|21|CP027063|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

984. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

985. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

986. spacer 1.12|14817|21|CP027063|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

987. spacer 1.12|14817|21|CP027063|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

988. spacer 1.12|14817|21|CP027063|CRT matches to NZ_MK413719 (Klebsiella pneumoniae strain 362713 plasmid p362713-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

989. spacer 1.12|14817|21|CP027063|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

990. spacer 1.12|14817|21|CP027063|CRT matches to NZ_MK413722 (Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

991. spacer 1.12|14817|21|CP027063|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

992. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

993. spacer 1.12|14817|21|CP027063|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

994. spacer 1.12|14817|21|CP027063|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

995. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

996. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtggtc	Protospacer
*********************

997. spacer 1.1|14355|21|CP027063|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

998. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

999. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1000. spacer 1.1|14355|21|CP027063|CRT matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1001. spacer 1.1|14355|21|CP027063|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1002. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1003. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1004. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1005. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1006. spacer 1.1|14355|21|CP027063|CRT matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1007. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1008. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1009. spacer 1.1|14355|21|CP027063|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1010. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1011. spacer 1.1|14355|21|CP027063|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1012. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
ccggatccgctaccggtgctc	Protospacer
 ********************

1013. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP026022 (Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1014. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP026022 (Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1015. spacer 1.1|14355|21|CP027063|CRT matches to MN200128 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-Vir-RC, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1016. spacer 1.1|14355|21|CP027063|CRT matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1017. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP019049 (Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1018. spacer 1.1|14355|21|CP027063|CRT matches to NZ_LR134257 (Klebsiella aerogenes strain NCTC9644 plasmid 4, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1019. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1020. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1021. spacer 1.1|14355|21|CP027063|CRT matches to LR134211 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1022. spacer 1.1|14355|21|CP027063|CRT matches to NC_005249 (Klebsiella pneumoniae CG43 plasmid pLVPK, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1023. spacer 1.1|14355|21|CP027063|CRT matches to NC_006625 (Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 plasmid pK2044, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1024. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1025. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1026. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1027. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1028. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1029. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1030. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1031. spacer 1.1|14355|21|CP027063|CRT matches to CP050281 (Klebsiella pneumoniae strain 9949 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1032. spacer 1.1|14355|21|CP027063|CRT matches to CP050281 (Klebsiella pneumoniae strain 9949 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1033. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP042975 (Klebsiella pneumoniae strain KPN55602 plasmid pK55602_1, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1034. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP016815 (Klebsiella pneumoniae strain ED23 plasmid unamed, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1035. spacer 1.1|14355|21|CP027063|CRT matches to NZ_MG053312 (Klebsiella pneumoniae strain KP267 plasmid pVir-CR-HvKP267, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1036. spacer 1.1|14355|21|CP027063|CRT matches to NZ_MG053312 (Klebsiella pneumoniae strain KP267 plasmid pVir-CR-HvKP267, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1037. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1038. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1039. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP025081 (Klebsiella pneumoniae strain SGH10 plasmid pSGH10, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1040. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP014011 (Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1041. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP014011 (Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1042. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP037743 (Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_hv, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1043. spacer 1.1|14355|21|CP027063|CRT matches to MT035874 (Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1044. spacer 1.1|14355|21|CP027063|CRT matches to MT035874 (Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1045. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP033955 (Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1046. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP033955 (Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1047. spacer 1.1|14355|21|CP027063|CRT matches to CP052432 (Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-1, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1048. spacer 1.1|14355|21|CP027063|CRT matches to CP052363 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-1, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1049. spacer 1.1|14355|21|CP027063|CRT matches to MK347227 (Klebsiella pneumoniae strain K187 plasmid pK187_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1050. spacer 1.1|14355|21|CP027063|CRT matches to MK347228 (Klebsiella pneumoniae strain K195 plasmid pK195_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1051. spacer 1.1|14355|21|CP027063|CRT matches to MK347230 (Klebsiella pneumoniae strain K202 plasmid pK202_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1052. spacer 1.1|14355|21|CP027063|CRT matches to MK347238 (Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1053. spacer 1.1|14355|21|CP027063|CRT matches to MK347238 (Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1054. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1055. spacer 1.1|14355|21|CP027063|CRT matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1056. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1057. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP014009 (Klebsiella pneumoniae subsp. pneumoniae strain RJF293 plasmid pRJF293, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1058. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1059. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1060. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1061. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1062. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP032241 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1063. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP032241 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1064. spacer 1.1|14355|21|CP027063|CRT matches to CP052563 (Klebsiella pneumoniae strain A16KP0135 plasmid pA16KP0135-1, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1065. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP047193 (Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1066. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP047193 (Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1067. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1068. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1069. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP032164 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1070. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP032164 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1071. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1072. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1073. spacer 1.1|14355|21|CP027063|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1074. spacer 1.1|14355|21|CP027063|CRT matches to CP052190 (Klebsiella pneumoniae strain F16KP0019 plasmid pF16KP0019-1, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1075. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP040540 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-VIR, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1076. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1077. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1078. spacer 1.1|14355|21|CP027063|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1079. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP034124 (Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1080. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP034124 (Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1081. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP034124 (Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1082. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1083. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP034083 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-vir, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1084. spacer 1.1|14355|21|CP027063|CRT matches to CP029383 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1085. spacer 1.1|14355|21|CP027063|CRT matches to CP029383 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1086. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP026012 (Klebsiella pneumoniae strain K2044 plasmid pK2044, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1087. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP026024 (Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1088. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP026024 (Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1089. spacer 1.1|14355|21|CP027063|CRT matches to CP050276 (Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1090. spacer 1.1|14355|21|CP027063|CRT matches to CP050276 (Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1091. spacer 1.1|14355|21|CP027063|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1092. spacer 1.1|14355|21|CP027063|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1093. spacer 1.1|14355|21|CP027063|CRT matches to NZ_CP026587 (Klebsiella pneumoniae strain NUHL30457 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1094. spacer 1.1|14355|21|CP027063|CRT matches to NZ_LR745043 (Klebsiella pneumoniae isolate Klebsiella pneumoniae kpn154 plasmid pVIR_Kpn154) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1095. spacer 1.1|14355|21|CP027063|CRT matches to NZ_MK413719 (Klebsiella pneumoniae strain 362713 plasmid p362713-HI3, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1096. spacer 1.1|14355|21|CP027063|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1097. spacer 1.1|14355|21|CP027063|CRT matches to NC_017541 (Klebsiella pneumoniae KCTC 2242 plasmid pKCTC2242, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1098. spacer 1.1|14355|21|CP027063|CRT matches to NZ_MH255828 (Klebsiella pneumoniae subsp. pneumoniae strain SH9 plasmid pSH9-VIR, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1099. spacer 1.1|14355|21|CP027063|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1100. spacer 1.1|14355|21|CP027063|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1101. spacer 1.1|14355|21|CP027063|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 1, identity: 0.952

acggatccgctaccggtgctc	CRISPR spacer
acggatccgctgccggtgctc	Protospacer
***********.*********

1102. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
aaagggccgctgccggtgctc	Protospacer
* *******************

1103. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
aaagggccgctgccggtgctc	Protospacer
* *******************

1104. spacer 1.2|14397|21|CP027063|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
**.******************

1105. spacer 1.2|14397|21|CP027063|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
aaagggccgctgccggtgctc	Protospacer
* *******************

1106. spacer 1.2|14397|21|CP027063|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
aaagggccgctgccggtgctc	Protospacer
* *******************

1107. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP037442 (Klebsiella sp. PO552 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
**.******************

1108. spacer 1.2|14397|21|CP027063|CRT matches to MT035874 (Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
**.******************

1109. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP033955 (Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
**.******************

1110. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP034776 (Klebsiella pneumoniae strain 18CPO060 plasmid phvKP060, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
**.******************

1111. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
**.******************

1112. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
**.******************

1113. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
**.******************

1114. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
aaagggccgctgccggtgctc	Protospacer
* *******************

1115. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
aaagggccgctgccggtgctc	Protospacer
* *******************

1116. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
**.******************

1117. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acaggaccgctgccggtgctc	Protospacer
*****.***************

1118. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acaggaccgctgccggtgctc	Protospacer
*****.***************

1119. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
**.******************

1120. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
**.******************

1121. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
**.******************

1122. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
**.******************

1123. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
**.******************

1124. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
aaagggccgctgccggtgctc	Protospacer
* *******************

1125. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
aaagggccgctgccggtgctc	Protospacer
* *******************

1126. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acaggaccgctgccggtgctc	Protospacer
*****.***************

1127. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
**.******************

1128. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
**.******************

1129. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
**.******************

1130. spacer 1.2|14397|21|CP027063|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
**.******************

1131. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acaggaccgctgccggtgctc	Protospacer
*****.***************

1132. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
**.******************

1133. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
**.******************

1134. spacer 1.2|14397|21|CP027063|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
**.******************

1135. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
**.******************

1136. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
aaagggccgctgccggtgctc	Protospacer
* *******************

1137. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
**.******************

1138. spacer 1.2|14397|21|CP027063|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acaggaccgctgccggtgctc	Protospacer
*****.***************

1139. spacer 1.2|14397|21|CP027063|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
**.******************

1140. spacer 1.2|14397|21|CP027063|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
**.******************

1141. spacer 1.2|14397|21|CP027063|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
**.******************

1142. spacer 1.2|14397|21|CP027063|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
**.******************

1143. spacer 1.2|14397|21|CP027063|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
**.******************

1144. spacer 1.2|14397|21|CP027063|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
**.******************

1145. spacer 1.2|14397|21|CP027063|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
**.******************

1146. spacer 1.2|14397|21|CP027063|CRT matches to NZ_MH263654 (Klebsiella pneumoniae strain QL24 plasmid pKPN-QL24, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
**.******************

1147. spacer 1.2|14397|21|CP027063|CRT matches to NZ_MH263654 (Klebsiella pneumoniae strain QL24 plasmid pKPN-QL24, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
**.******************

1148. spacer 1.2|14397|21|CP027063|CRT matches to NZ_MH263654 (Klebsiella pneumoniae strain QL24 plasmid pKPN-QL24, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
**.******************

1149. spacer 1.2|14397|21|CP027063|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
aaagggccgctgccggtgctc	Protospacer
* *******************

1150. spacer 1.2|14397|21|CP027063|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acagggccgctgccagtgctc	Protospacer
**************.******

1151. spacer 1.2|14397|21|CP027063|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acagggccgctaccggtgctc	Protospacer
***********.*********

1152. spacer 1.2|14397|21|CP027063|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
aaagggccgctgccggtgctc	Protospacer
* *******************

1153. spacer 1.2|14397|21|CP027063|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
**.******************

1154. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acaggaccgctgccggtgctc	Protospacer
*****.***************

1155. spacer 1.2|14397|21|CP027063|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
aaagggccgctgccggtgctc	Protospacer
* *******************

1156. spacer 1.2|14397|21|CP027063|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
aaagggccgctgccggtgctc	Protospacer
* *******************

1157. spacer 1.2|14397|21|CP027063|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
**.******************

1158. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
**.******************

1159. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
**.******************

1160. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acagggccactgccggtgctc	Protospacer
********.************

1161. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
**.******************

1162. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
**.******************

1163. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
aaagggccgctgccggtgctc	Protospacer
* *******************

1164. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
aaagggccgctgccggtgctc	Protospacer
* *******************

1165. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
**.******************

1166. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
**.******************

1167. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
**.******************

1168. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
**.******************

1169. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
**.******************

1170. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
**.******************

1171. spacer 1.2|14397|21|CP027063|CRT matches to NZ_MF150122 (Klebsiella pneumoniae strain A64477 plasmid pKP64477b, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
aaagggccgctgccggtgctc	Protospacer
* *******************

1172. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
**.******************

1173. spacer 1.2|14397|21|CP027063|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 1, identity: 0.952

acagggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
**.******************

1174. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtgaccgctgacggtagct	CRISPR spacer
acgtgaccgctgacggtggct	Protospacer
*****************.***

1175. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtgaccgctgacggtagct	CRISPR spacer
acgtgaccgctgacggtggct	Protospacer
*****************.***

1176. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtgaccgctgacggtagct	CRISPR spacer
acgtgaccgctgacggtggct	Protospacer
*****************.***

1177. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtgaccgctgacggtagct	CRISPR spacer
acgtgaccgctgacggtggct	Protospacer
*****************.***

1178. spacer 1.3|14439|21|CP027063|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtgaccgctgacggtagct	CRISPR spacer
acgtgaccgctgacggtggct	Protospacer
*****************.***

1179. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtgaccgctgacggtagct	CRISPR spacer
acgtgaccgctgacggtggct	Protospacer
*****************.***

1180. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.952

acgtgaccgctgacggtagct	CRISPR spacer
acgtgaccgctgacggtggct	Protospacer
*****************.***

1181. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtgaccgctgacggtagct	CRISPR spacer
acgtgaccgctgacggtggct	Protospacer
*****************.***

1182. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 1, identity: 0.952

acgtgaccgctgacggtagct	CRISPR spacer
acgtgaccgctgacggtggct	Protospacer
*****************.***

1183. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtgaccgctgacggtagct	CRISPR spacer
acgtgaccgctgacggtggct	Protospacer
*****************.***

1184. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 1, identity: 0.952

acgtgaccgctgacggtagct	CRISPR spacer
atgtgaccgctgacggtagct	Protospacer
*.*******************

1185. spacer 1.3|14439|21|CP027063|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtgaccgctgacggtagct	CRISPR spacer
atgtgaccgctgacggtagct	Protospacer
*.*******************

1186. spacer 1.3|14439|21|CP027063|CRT matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 1, identity: 0.952

acgtgaccgctgacggtagct	CRISPR spacer
acgtgaccgctgatggtagct	Protospacer
*************.*******

1187. spacer 1.3|14439|21|CP027063|CRT matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 1, identity: 0.952

acgtgaccgctgacggtagct	CRISPR spacer
acgtgaccgctgatggtagct	Protospacer
*************.*******

1188. spacer 1.3|14439|21|CP027063|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtgaccgctgacggtagct	CRISPR spacer
acgtgaccgctgatggtagct	Protospacer
*************.*******

1189. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtgaccgctgacggtagct	CRISPR spacer
acgtgaccgctgatggtagct	Protospacer
*************.*******

1190. spacer 1.3|14439|21|CP027063|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 1, identity: 0.952

acgtgaccgctgacggtagct	CRISPR spacer
acgtgaccgctgatggtagct	Protospacer
*************.*******

1191. spacer 1.3|14439|21|CP027063|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 1, identity: 0.952

acgtgaccgctgacggtagct	CRISPR spacer
acgtgaccgctgatggtagct	Protospacer
*************.*******

1192. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1193. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1194. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1195. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtagct	Protospacer
*****************.***

1196. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1197. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1198. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtagct	Protospacer
*****************.***

1199. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1200. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1201. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtagct	Protospacer
*****************.***

1202. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1203. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1204. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1205. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1206. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtagct	Protospacer
*****************.***

1207. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtagct	Protospacer
*****************.***

1208. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1209. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1210. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1211. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1212. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtagct	Protospacer
*****************.***

1213. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1214. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1215. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtagct	Protospacer
*****************.***

1216. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1217. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1218. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtagct	Protospacer
*****************.***

1219. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1220. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1221. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtagct	Protospacer
*****************.***

1222. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1223. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1224. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtagct	Protospacer
*****************.***

1225. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1226. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1227. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtagct	Protospacer
*****************.***

1228. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1229. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1230. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtagct	Protospacer
*****************.***

1231. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1232. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1233. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtagct	Protospacer
*****************.***

1234. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1235. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1236. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtagct	Protospacer
*****************.***

1237. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1238. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1239. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtagct	Protospacer
*****************.***

1240. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1241. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1242. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtagct	Protospacer
*****************.***

1243. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1244. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1245. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtagct	Protospacer
*****************.***

1246. spacer 1.4|14481|21|CP027063|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1247. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1248. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1249. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtagct	Protospacer
*****************.***

1250. spacer 1.4|14481|21|CP027063|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1251. spacer 1.4|14481|21|CP027063|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1252. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1253. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1254. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtagct	Protospacer
*****************.***

1255. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1256. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1257. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtagct	Protospacer
*****************.***

1258. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1259. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1260. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtagct	Protospacer
*****************.***

1261. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1262. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1263. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1264. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtagct	Protospacer
*****************.***

1265. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1266. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1267. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1268. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtagct	Protospacer
*****************.***

1269. spacer 1.4|14481|21|CP027063|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1270. spacer 1.4|14481|21|CP027063|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1271. spacer 1.4|14481|21|CP027063|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtagct	Protospacer
*****************.***

1272. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1273. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1274. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtagct	Protospacer
*****************.***

1275. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccactgacggtggct	Protospacer
********.************

1276. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1277. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1278. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtagct	Protospacer
*****************.***

1279. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1280. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1281. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtagct	Protospacer
*****************.***

1282. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1283. spacer 1.4|14481|21|CP027063|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1284. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1285. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1286. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtagct	Protospacer
*****************.***

1287. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1288. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1289. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtagct	Protospacer
*****************.***

1290. spacer 1.4|14481|21|CP027063|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1291. spacer 1.4|14481|21|CP027063|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1292. spacer 1.4|14481|21|CP027063|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtagct	Protospacer
*****************.***

1293. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1294. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1295. spacer 1.4|14481|21|CP027063|CRT matches to MF185718 (Arthrobacter phage Colucci, complete genome) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggcc	Protospacer
********************.

1296. spacer 1.4|14481|21|CP027063|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
.********************

1297. spacer 1.4|14481|21|CP027063|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtagct	Protospacer
*****************.***

1298. spacer 1.4|14481|21|CP027063|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcggggccgctgacggtggct	Protospacer
*** *****************

1299. spacer 1.4|14481|21|CP027063|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtagct	Protospacer
*****************.***

1300. spacer 1.4|14481|21|CP027063|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcggggccgctgacggtggct	Protospacer
*** *****************

1301. spacer 1.4|14481|21|CP027063|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgtcggtggct	Protospacer
************ ********

1302. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtagct	Protospacer
*****************.***

1303. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtagct	Protospacer
*****************.***

1304. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcggggccgctgacggtggct	Protospacer
*** *****************

1305. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgtcggtggct	Protospacer
************ ********

1306. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgatggtggct	Protospacer
*************.*******

1307. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtagct	Protospacer
*****************.***

1308. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcggggccgctgacggtggct	Protospacer
*** *****************

1309. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgtcggtggct	Protospacer
************ ********

1310. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtagct	Protospacer
*****************.***

1311. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcggggccgctgacggtggct	Protospacer
*** *****************

1312. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcggggccgctgacggtggct	Protospacer
*** *****************

1313. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtagct	Protospacer
*****************.***

1314. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcggggccgctgacggtggct	Protospacer
*** *****************

1315. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgtcggtggct	Protospacer
************ ********

1316. spacer 1.4|14481|21|CP027063|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgtcggtggct	Protospacer
************ ********

1317. spacer 1.4|14481|21|CP027063|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcggggccgctgacggtggct	Protospacer
*** *****************

1318. spacer 1.4|14481|21|CP027063|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtagct	Protospacer
*****************.***

1319. spacer 1.4|14481|21|CP027063|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtagct	Protospacer
*****************.***

1320. spacer 1.4|14481|21|CP027063|CRT matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgatggtggct	Protospacer
*************.*******

1321. spacer 1.4|14481|21|CP027063|CRT matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgatggtggct	Protospacer
*************.*******

1322. spacer 1.4|14481|21|CP027063|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgatggtggct	Protospacer
*************.*******

1323. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgtcggtggct	Protospacer
************ ********

1324. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcggggccgctgacggtggct	Protospacer
*** *****************

1325. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtagct	Protospacer
*****************.***

1326. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcggggccgctgacggtggct	Protospacer
*** *****************

1327. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtagct	Protospacer
*****************.***

1328. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgtcggtggct	Protospacer
************ ********

1329. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcggggccgctgacggtggct	Protospacer
*** *****************

1330. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtagct	Protospacer
*****************.***

1331. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcggggccgctgacggtggct	Protospacer
*** *****************

1332. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcggggccgctgacggtggct	Protospacer
*** *****************

1333. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtagct	Protospacer
*****************.***

1334. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgtcggtggct	Protospacer
************ ********

1335. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcggggccgctgacggtggct	Protospacer
*** *****************

1336. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtagct	Protospacer
*****************.***

1337. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcggggccgctgacggtggct	Protospacer
*** *****************

1338. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcggggccgctgacggtggct	Protospacer
*** *****************

1339. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtagct	Protospacer
*****************.***

1340. spacer 1.4|14481|21|CP027063|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgatggtggct	Protospacer
*************.*******

1341. spacer 1.4|14481|21|CP027063|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgatggtggct	Protospacer
*************.*******

1342. spacer 1.4|14481|21|CP027063|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgacggtggct	CRISPR spacer
gcggggccgctgacggtggct	Protospacer
*** *****************

1343. spacer 1.5|14523|21|CP027063|CRT matches to MN200128 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-Vir-RC, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1344. spacer 1.5|14523|21|CP027063|CRT matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1345. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP024708 (Klebsiella pneumoniae strain cr-hvkp3 plasmid pPUTH1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1346. spacer 1.5|14523|21|CP027063|CRT matches to LR134211 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1347. spacer 1.5|14523|21|CP027063|CRT matches to NC_005249 (Klebsiella pneumoniae CG43 plasmid pLVPK, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1348. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1349. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP042975 (Klebsiella pneumoniae strain KPN55602 plasmid pK55602_1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1350. spacer 1.5|14523|21|CP027063|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1351. spacer 1.5|14523|21|CP027063|CRT matches to CP052363 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1352. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctt	Protospacer
********************.

1353. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1354. spacer 1.5|14523|21|CP027063|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctt	Protospacer
********************.

1355. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1356. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1357. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgtcggtgctc	Protospacer
************.********

1358. spacer 1.5|14523|21|CP027063|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1359. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1360. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP026587 (Klebsiella pneumoniae strain NUHL30457 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1361. spacer 1.5|14523|21|CP027063|CRT matches to NZ_LR745046 (Klebsiella pneumoniae isolate Kpn2166 plasmid pVIR_Kpn2166) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1362. spacer 1.5|14523|21|CP027063|CRT matches to NZ_LR745043 (Klebsiella pneumoniae isolate Klebsiella pneumoniae kpn154 plasmid pVIR_Kpn154) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1363. spacer 1.5|14523|21|CP027063|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1364. spacer 1.5|14523|21|CP027063|CRT matches to NC_017541 (Klebsiella pneumoniae KCTC 2242 plasmid pKCTC2242, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1365. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1366. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1367. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1368. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1369. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1370. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1371. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1372. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1373. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1374. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1375. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1376. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1377. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1378. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1379. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1380. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1381. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1382. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1383. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1384. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1385. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1386. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1387. spacer 1.5|14523|21|CP027063|CRT matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1388. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1389. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1390. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1391. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1392. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1393. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1394. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1395. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1396. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1397. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1398. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1399. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1400. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1401. spacer 1.5|14523|21|CP027063|CRT matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1402. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1403. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1404. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1405. spacer 1.5|14523|21|CP027063|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1406. spacer 1.5|14523|21|CP027063|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1407. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1408. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1409. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1410. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1411. spacer 1.5|14523|21|CP027063|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1412. spacer 1.5|14523|21|CP027063|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1413. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1414. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1415. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1416. spacer 1.5|14523|21|CP027063|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctt	Protospacer
********************.

1417. spacer 1.5|14523|21|CP027063|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1418. spacer 1.5|14523|21|CP027063|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1419. spacer 1.5|14523|21|CP027063|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1420. spacer 1.5|14523|21|CP027063|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1421. spacer 1.5|14523|21|CP027063|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1422. spacer 1.5|14523|21|CP027063|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1423. spacer 1.5|14523|21|CP027063|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1424. spacer 1.5|14523|21|CP027063|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1425. spacer 1.5|14523|21|CP027063|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1426. spacer 1.5|14523|21|CP027063|CRT matches to NZ_MK413719 (Klebsiella pneumoniae strain 362713 plasmid p362713-HI3, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1427. spacer 1.5|14523|21|CP027063|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1428. spacer 1.5|14523|21|CP027063|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1429. spacer 1.5|14523|21|CP027063|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1430. spacer 1.5|14523|21|CP027063|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1431. spacer 1.5|14523|21|CP027063|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1432. spacer 1.5|14523|21|CP027063|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1433. spacer 1.5|14523|21|CP027063|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1434. spacer 1.5|14523|21|CP027063|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgttgccggtgctc	Protospacer
*********.***********

1435. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgttgccggtgctc	Protospacer
*********.***********

1436. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1437. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgttgccggtgctc	Protospacer
*********.***********

1438. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1439. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgttgccggtgctc	Protospacer
*********.***********

1440. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgttgccggtgctc	Protospacer
*********.***********

1441. spacer 1.5|14523|21|CP027063|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgcaggtgctc	Protospacer
************* *******

1442. spacer 1.5|14523|21|CP027063|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgttgccggtgctc	Protospacer
*********.***********

1443. spacer 1.5|14523|21|CP027063|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1444. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP037442 (Klebsiella sp. PO552 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1445. spacer 1.5|14523|21|CP027063|CRT matches to MT035874 (Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1446. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP033955 (Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1447. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP034776 (Klebsiella pneumoniae strain 18CPO060 plasmid phvKP060, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1448. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgttgccggtgctc	Protospacer
*********.***********

1449. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1450. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1451. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1452. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1453. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgttgccggtgctc	Protospacer
*********.***********

1454. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgttgccggtgctc	Protospacer
*********.***********

1455. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgttgccggtgctc	Protospacer
*********.***********

1456. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgttgccggtgctc	Protospacer
*********.***********

1457. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1458. spacer 1.5|14523|21|CP027063|CRT matches to NZ_MH263654 (Klebsiella pneumoniae strain QL24 plasmid pKPN-QL24, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1459. spacer 1.5|14523|21|CP027063|CRT matches to NZ_MH263654 (Klebsiella pneumoniae strain QL24 plasmid pKPN-QL24, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1460. spacer 1.5|14523|21|CP027063|CRT matches to NZ_MH263654 (Klebsiella pneumoniae strain QL24 plasmid pKPN-QL24, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1461. spacer 1.6|14565|21|CP027063|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1462. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1463. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1464. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1465. spacer 1.6|14565|21|CP027063|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
gcggggccgctgacggtggct	Protospacer
.********************

1466. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1467. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1468. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1469. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1470. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1471. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1472. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1473. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1474. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1475. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1476. spacer 1.6|14565|21|CP027063|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
gcggggccgctgacggtggct	Protospacer
.********************

1477. spacer 1.6|14565|21|CP027063|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
gcggggccgctgacggtggct	Protospacer
.********************

1478. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
atggggccgctgacggtggct	Protospacer
*.*******************

1479. spacer 1.6|14565|21|CP027063|CRT matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
atggggccgctgacggtggct	Protospacer
*.*******************

1480. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1481. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
atggggccgctgacggtggct	Protospacer
*.*******************

1482. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
atggggccgctgacggtggct	Protospacer
*.*******************

1483. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
atggggccgctgacggtggct	Protospacer
*.*******************

1484. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
gcggggccgctgacggtggct	Protospacer
.********************

1485. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
gcggggccgctgacggtggct	Protospacer
.********************

1486. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
atggggccgctgacggtggct	Protospacer
*.*******************

1487. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
atggggccgctgacggtggct	Protospacer
*.*******************

1488. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1489. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgggggcgctgacggtggct	Protospacer
****** **************

1490. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1491. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1492. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1493. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1494. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
atggggccgctgacggtggct	Protospacer
*.*******************

1495. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
atggggccgctgacggtggct	Protospacer
*.*******************

1496. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1497. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
gcggggccgctgacggtggct	Protospacer
.********************

1498. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1499. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1500. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1501. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
gcggggccgctgacggtggct	Protospacer
.********************

1502. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
gcggggccgctgacggtggct	Protospacer
.********************

1503. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
gcggggccgctgacggtggct	Protospacer
.********************

1504. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
atggggccgctgacggtggct	Protospacer
*.*******************

1505. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
atggggccgctgacggtggct	Protospacer
*.*******************

1506. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
atggggccgctgacggtggct	Protospacer
*.*******************

1507. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
gcggggccgctgacggtggct	Protospacer
.********************

1508. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1509. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1510. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1511. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1512. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1513. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1514. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
atggggccgctgacggtggct	Protospacer
*.*******************

1515. spacer 1.6|14565|21|CP027063|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1516. spacer 1.6|14565|21|CP027063|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgggggcgctgacggtggct	Protospacer
****** **************

1517. spacer 1.6|14565|21|CP027063|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1518. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
atggggccgctgacggtggct	Protospacer
*.*******************

1519. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1520. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1521. spacer 1.6|14565|21|CP027063|CRT matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
atggggccgctgacggtggct	Protospacer
*.*******************

1522. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
atggggccgctgacggtggct	Protospacer
*.*******************

1523. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
atggggccgctgacggtggct	Protospacer
*.*******************

1524. spacer 1.6|14565|21|CP027063|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
atggggccgctgacggtggct	Protospacer
*.*******************

1525. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
atggggccgctgacggtggct	Protospacer
*.*******************

1526. spacer 1.6|14565|21|CP027063|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1527. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
atggggccgctgacggtggct	Protospacer
*.*******************

1528. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1529. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1530. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
atggggccgctgacggtggct	Protospacer
*.*******************

1531. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1532. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1533. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
atggggccgctgacggtggct	Protospacer
*.*******************

1534. spacer 1.6|14565|21|CP027063|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
atggggccgctgacggtggct	Protospacer
*.*******************

1535. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1536. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1537. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
gcggggccgctgacggtggct	Protospacer
.********************

1538. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
gcggggccgctgacggtggct	Protospacer
.********************

1539. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
gcggggccgctgacggtggct	Protospacer
.********************

1540. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
gcggggccgctgacggtggct	Protospacer
.********************

1541. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
gcggggccgctgacggtggct	Protospacer
.********************

1542. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
gcggggccgctgacggtggct	Protospacer
.********************

1543. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
atggggccgctgacggtggct	Protospacer
*.*******************

1544. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
atggggccgctgacggtggct	Protospacer
*.*******************

1545. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1546. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1547. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1548. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1549. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
atggggccgctgacggtggct	Protospacer
*.*******************

1550. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
atggggccgctgacggtggct	Protospacer
*.*******************

1551. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
atggggccgctgacggtggct	Protospacer
*.*******************

1552. spacer 1.6|14565|21|CP027063|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1553. spacer 1.6|14565|21|CP027063|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
atggggccgctgacggtggct	Protospacer
*.*******************

1554. spacer 1.6|14565|21|CP027063|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
atggggccgctgacggtggct	Protospacer
*.*******************

1555. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1556. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1557. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1558. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1559. spacer 1.6|14565|21|CP027063|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
atggggccgctgacggtggct	Protospacer
*.*******************

1560. spacer 1.6|14565|21|CP027063|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
atggggccgctgacggtggct	Protospacer
*.*******************

1561. spacer 1.6|14565|21|CP027063|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
atggggccgctgacggtggct	Protospacer
*.*******************

1562. spacer 1.6|14565|21|CP027063|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
atggggccgctgacggtggct	Protospacer
*.*******************

1563. spacer 1.6|14565|21|CP027063|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
gcggggccgctgacggtggct	Protospacer
.********************

1564. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1565. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1566. spacer 1.6|14565|21|CP027063|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
atggggccgctgacggtggct	Protospacer
*.*******************

1567. spacer 1.6|14565|21|CP027063|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
atggggccgctgacggtggct	Protospacer
*.*******************

1568. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
atggggccgctgacggtggct	Protospacer
*.*******************

1569. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
atggggccgctgacggtggct	Protospacer
*.*******************

1570. spacer 1.6|14565|21|CP027063|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1571. spacer 1.6|14565|21|CP027063|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1572. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1573. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1574. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1575. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1576. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
atggggccgctgacggtggct	Protospacer
*.*******************

1577. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1578. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1579. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
atggggccgctgacggtggct	Protospacer
*.*******************

1580. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
atggggccgctgacggtggct	Protospacer
*.*******************

1581. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1582. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1583. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1584. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1585. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1586. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1587. spacer 1.6|14565|21|CP027063|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
atggggccgctgacggtggct	Protospacer
*.*******************

1588. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1589. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1590. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1591. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1592. spacer 1.6|14565|21|CP027063|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1593. spacer 1.6|14565|21|CP027063|CRT matches to NZ_MK413719 (Klebsiella pneumoniae strain 362713 plasmid p362713-HI3, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
atggggccgctgacggtggct	Protospacer
*.*******************

1594. spacer 1.6|14565|21|CP027063|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1595. spacer 1.6|14565|21|CP027063|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.952

acggggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggct	Protospacer
*** *****************

1596. spacer 1.7|14607|21|CP027063|CRT matches to MN200128 (Klebsiella pneumoniae strain 17ZR-91 plasmid p17ZR-91-Vir-RC, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1597. spacer 1.7|14607|21|CP027063|CRT matches to MN200130 (Escherichia coli strain EC600 plasmid p17ZR-91-TC1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1598. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP024708 (Klebsiella pneumoniae strain cr-hvkp3 plasmid pPUTH1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1599. spacer 1.7|14607|21|CP027063|CRT matches to LR134211 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1600. spacer 1.7|14607|21|CP027063|CRT matches to NC_005249 (Klebsiella pneumoniae CG43 plasmid pLVPK, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1601. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1602. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP042975 (Klebsiella pneumoniae strain KPN55602 plasmid pK55602_1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1603. spacer 1.7|14607|21|CP027063|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1604. spacer 1.7|14607|21|CP027063|CRT matches to CP052363 (Klebsiella pneumoniae strain D16KP0122 plasmid pD16KP0122-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1605. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctt	Protospacer
********************.

1606. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1607. spacer 1.7|14607|21|CP027063|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctt	Protospacer
********************.

1608. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1609. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1610. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgtcggtgctc	Protospacer
************.********

1611. spacer 1.7|14607|21|CP027063|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1612. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1613. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP026587 (Klebsiella pneumoniae strain NUHL30457 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1614. spacer 1.7|14607|21|CP027063|CRT matches to NZ_LR745046 (Klebsiella pneumoniae isolate Kpn2166 plasmid pVIR_Kpn2166) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1615. spacer 1.7|14607|21|CP027063|CRT matches to NZ_LR745043 (Klebsiella pneumoniae isolate Klebsiella pneumoniae kpn154 plasmid pVIR_Kpn154) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1616. spacer 1.7|14607|21|CP027063|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1617. spacer 1.7|14607|21|CP027063|CRT matches to NC_017541 (Klebsiella pneumoniae KCTC 2242 plasmid pKCTC2242, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1618. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1619. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1620. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1621. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1622. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1623. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1624. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1625. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1626. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1627. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1628. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1629. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1630. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1631. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1632. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1633. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1634. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1635. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1636. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1637. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1638. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1639. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1640. spacer 1.7|14607|21|CP027063|CRT matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1641. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1642. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1643. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1644. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1645. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1646. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1647. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1648. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1649. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1650. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1651. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1652. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1653. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1654. spacer 1.7|14607|21|CP027063|CRT matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1655. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1656. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1657. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1658. spacer 1.7|14607|21|CP027063|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1659. spacer 1.7|14607|21|CP027063|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1660. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1661. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1662. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1663. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1664. spacer 1.7|14607|21|CP027063|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1665. spacer 1.7|14607|21|CP027063|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1666. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1667. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1668. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1669. spacer 1.7|14607|21|CP027063|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgccggtgctt	Protospacer
********************.

1670. spacer 1.7|14607|21|CP027063|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1671. spacer 1.7|14607|21|CP027063|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1672. spacer 1.7|14607|21|CP027063|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1673. spacer 1.7|14607|21|CP027063|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1674. spacer 1.7|14607|21|CP027063|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1675. spacer 1.7|14607|21|CP027063|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1676. spacer 1.7|14607|21|CP027063|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1677. spacer 1.7|14607|21|CP027063|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1678. spacer 1.7|14607|21|CP027063|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1679. spacer 1.7|14607|21|CP027063|CRT matches to NZ_MK413719 (Klebsiella pneumoniae strain 362713 plasmid p362713-HI3, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1680. spacer 1.7|14607|21|CP027063|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1681. spacer 1.7|14607|21|CP027063|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1682. spacer 1.7|14607|21|CP027063|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1683. spacer 1.7|14607|21|CP027063|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1684. spacer 1.7|14607|21|CP027063|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1685. spacer 1.7|14607|21|CP027063|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
gcgtggccgctgccggtgctc	Protospacer
.********************

1686. spacer 1.7|14607|21|CP027063|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1687. spacer 1.7|14607|21|CP027063|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgttgccggtgctc	Protospacer
*********.***********

1688. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgttgccggtgctc	Protospacer
*********.***********

1689. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1690. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgttgccggtgctc	Protospacer
*********.***********

1691. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1692. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgttgccggtgctc	Protospacer
*********.***********

1693. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgttgccggtgctc	Protospacer
*********.***********

1694. spacer 1.7|14607|21|CP027063|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgctgcaggtgctc	Protospacer
************* *******

1695. spacer 1.7|14607|21|CP027063|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgttgccggtgctc	Protospacer
*********.***********

1696. spacer 1.7|14607|21|CP027063|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1697. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP037442 (Klebsiella sp. PO552 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1698. spacer 1.7|14607|21|CP027063|CRT matches to MT035874 (Klebsiella pneumoniae strain KP18-3-8 plasmid pKP18-3-8_KPC_vir, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1699. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP033955 (Klebsiella pneumoniae strain L39_2 plasmid p2_L39, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1700. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP034776 (Klebsiella pneumoniae strain 18CPO060 plasmid phvKP060, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1701. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgttgccggtgctc	Protospacer
*********.***********

1702. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1703. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1704. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1705. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1706. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgttgccggtgctc	Protospacer
*********.***********

1707. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgttgccggtgctc	Protospacer
*********.***********

1708. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgttgccggtgctc	Protospacer
*********.***********

1709. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acgtggccgttgccggtgctc	Protospacer
*********.***********

1710. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1711. spacer 1.7|14607|21|CP027063|CRT matches to NZ_MH263654 (Klebsiella pneumoniae strain QL24 plasmid pKPN-QL24, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1712. spacer 1.7|14607|21|CP027063|CRT matches to NZ_MH263654 (Klebsiella pneumoniae strain QL24 plasmid pKPN-QL24, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1713. spacer 1.7|14607|21|CP027063|CRT matches to NZ_MH263654 (Klebsiella pneumoniae strain QL24 plasmid pKPN-QL24, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgccggtgctc	CRISPR spacer
acggggccgctgccggtgctc	Protospacer
*** *****************

1714. spacer 1.8|14649|21|CP027063|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1715. spacer 1.8|14649|21|CP027063|CRT matches to CP052329 (Klebsiella pneumoniae strain D17KP0032 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1716. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1717. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1718. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1719. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP050836 (Klebsiella pneumoniae strain Bckp021 plasmid pBckp021-2, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1720. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1721. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1722. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1723. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgaaggtggct	Protospacer
************* *******

1724. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP017986 (Klebsiella pneumoniae strain 825795-1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1725. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1726. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1727. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgaaggtggct	Protospacer
************* *******

1728. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1729. spacer 1.8|14649|21|CP027063|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1730. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1731. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1732. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1733. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgaaggtggct	Protospacer
************* *******

1734. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018714 (Klebsiella pneumoniae strain Kp_Goe_152021 plasmid pKp_Goe_021-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1735. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1736. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1737. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1738. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgaaggtggct	Protospacer
************* *******

1739. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018720 (Klebsiella pneumoniae strain KP_Goe_828304 plasmid pKp_Goe_304-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1740. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1741. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1742. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1743. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgaaggtggct	Protospacer
************* *******

1744. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018702 (Klebsiella pneumoniae strain Kp_Goe_827024 plasmid pKp_Goe_024-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1745. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1746. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1747. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1748. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1749. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acgtgaccgctgacggtggct	Protospacer
*****.***************

1750. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acgtgaccgctgacggtggct	Protospacer
*****.***************

1751. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1752. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP027063 (Klebsiella variicola strain WCHKV030666 plasmid pVir_030666, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1753. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1754. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1755. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1756. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP013713 (Klebsiella pneumoniae strain J1 plasmid 2, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1757. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1758. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1759. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1760. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP024875 (Klebsiella pneumoniae strain NH25 plasmid pNH25.1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1761. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP026172 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPN-bbef, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1762. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1763. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1764. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP019161 (Klebsiella pneumoniae strain GN-2 plasmid pGN-2, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1765. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1766. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1767. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgaaggtggct	Protospacer
************* *******

1768. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1769. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1770. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1771. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1772. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1773. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP026398 (Klebsiella pneumoniae strain KPNIH48 plasmid pKPN-edaa, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1774. spacer 1.8|14649|21|CP027063|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1775. spacer 1.8|14649|21|CP027063|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1776. spacer 1.8|14649|21|CP027063|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1777. spacer 1.8|14649|21|CP027063|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1778. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1779. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1780. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgaaggtggct	Protospacer
************* *******

1781. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1782. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1783. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1784. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acgtgaccgctgacggtggct	Protospacer
*****.***************

1785. spacer 1.8|14649|21|CP027063|CRT matches to CP052539 (Klebsiella pneumoniae strain B16KP0141 plasmid pB16KP0141-2, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1786. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1787. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1788. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1789. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgaaggtggct	Protospacer
************* *******

1790. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1791. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1792. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1793. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgactgtggct	Protospacer
************** ******

1794. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1795. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1796. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1797. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acgtgaccgctgacggtggct	Protospacer
*****.***************

1798. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1799. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1800. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1801. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgaaggtggct	Protospacer
************* *******

1802. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018313 (Klebsiella pneumoniae strain Kp_Goe_822579 plasmid pKp_Goe_579-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1803. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1804. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1805. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acgtgaccgctgacggtggct	Protospacer
*****.***************

1806. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1807. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1808. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acgtgaccgctgacggtggct	Protospacer
*****.***************

1809. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1810. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1811. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1812. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgaaggtggct	Protospacer
************* *******

1813. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018687 (Klebsiella pneumoniae strain Kp_Goe_149473 plasmid pKp_Goe_473-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1814. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1815. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1816. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgaaggtggct	Protospacer
************* *******

1817. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1818. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1819. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1820. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acgtgaccgctgacggtggct	Protospacer
*****.***************

1821. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1822. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1823. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1824. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acgtgaccgctgacggtggct	Protospacer
*****.***************

1825. spacer 1.8|14649|21|CP027063|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1826. spacer 1.8|14649|21|CP027063|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1827. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1828. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1829. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1830. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgaaggtggct	Protospacer
************* *******

1831. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018696 (Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1832. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1833. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1834. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1835. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgaaggtggct	Protospacer
************* *******

1836. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP018708 (Klebsiella pneumoniae strain Kp_Goe_827026 plasmid pKp_Goe_026-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1837. spacer 1.8|14649|21|CP027063|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1838. spacer 1.8|14649|21|CP027063|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1839. spacer 1.8|14649|21|CP027063|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acgtgaccgctgacggtggct	Protospacer
*****.***************

1840. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1841. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1842. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1843. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1844. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgaaggtggct	Protospacer
************* *******

1845. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP032223 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1846. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1847. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1848. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP050068 (Klebsiella aerogenes strain 035 plasmid p35, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1849. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP041093 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1850. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1851. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP023723 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1852. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1853. spacer 1.8|14649|21|CP027063|CRT matches to CP052236 (Klebsiella pneumoniae strain E17KP0029 plasmid pE17KP0029-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1854. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggct	Protospacer
.********************

1855. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acgtgaccgctgacggtggct	Protospacer
*****.***************

1856. spacer 1.8|14649|21|CP027063|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1857. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP025081 (Klebsiella pneumoniae strain SGH10 plasmid pSGH10, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1858. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP030924 (Klebsiella pneumoniae subsp. pneumoniae strain KC-Pl-HB1 plasmid pKC-Pl-HB1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1859. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP026022 (Klebsiella pneumoniae strain 11492 plasmid p11492-CTXM, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1860. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP014011 (Klebsiella pneumoniae subsp. pneumoniae strain RJF999 plasmid pRJF999, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1861. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP037743 (Klebsiella pneumoniae strain ST23 plasmid pDHQP1701672_hv, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1862. spacer 1.8|14649|21|CP027063|CRT matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1863. spacer 1.8|14649|21|CP027063|CRT matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1864. spacer 1.8|14649|21|CP027063|CRT matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1865. spacer 1.8|14649|21|CP027063|CRT matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1866. spacer 1.8|14649|21|CP027063|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1867. spacer 1.8|14649|21|CP027063|CRT matches to CP052432 (Klebsiella pneumoniae strain C16KP0122 plasmid pC16KP0122-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1868. spacer 1.8|14649|21|CP027063|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1869. spacer 1.8|14649|21|CP027063|CRT matches to CP052325 (Klebsiella pneumoniae strain E16KP0032 plasmid pE16KP0032-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1870. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP019049 (Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166b, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1871. spacer 1.8|14649|21|CP027063|CRT matches to MK347238 (Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1872. spacer 1.8|14649|21|CP027063|CRT matches to MK347238 (Klebsiella pneumoniae strain K239 plasmid pK239_rmpA2, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1873. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1874. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1875. spacer 1.8|14649|21|CP027063|CRT matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1876. spacer 1.8|14649|21|CP027063|CRT matches to NZ_LR134257 (Klebsiella aerogenes strain NCTC9644 plasmid 4, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1877. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1878. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1879. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP014009 (Klebsiella pneumoniae subsp. pneumoniae strain RJF293 plasmid pRJF293, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1880. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1881. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1882. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1883. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1884. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1885. spacer 1.8|14649|21|CP027063|CRT matches to LR134211 (Klebsiella aerogenes strain NCTC418 genome assembly, plasmid: 2) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1886. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1887. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1888. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1889. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1890. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1891. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1892. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1893. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP021961 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000006, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1894. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP032241 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1895. spacer 1.8|14649|21|CP027063|CRT matches to NC_006625 (Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 plasmid pK2044, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1896. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1897. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1898. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1899. spacer 1.8|14649|21|CP027063|CRT matches to NC_019789 (Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1900. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1901. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP009865 (Klebsiella pneumoniae subsp. pneumoniae strain KPNIH29 plasmid pKPN-80a, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1902. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1903. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP044036 (Klebsiella pneumoniae strain FDAARGOS_630 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1904. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1905. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1906. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1907. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP047193 (Klebsiella pneumoniae strain Kp36 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1908. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1909. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1910. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1911. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1912. spacer 1.8|14649|21|CP027063|CRT matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1913. spacer 1.8|14649|21|CP027063|CRT matches to MF943217 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_WCHKP13F2, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1914. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP032164 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1915. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1916. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1917. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP034681 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_296kb, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1918. spacer 1.8|14649|21|CP027063|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1919. spacer 1.8|14649|21|CP027063|CRT matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1920. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1921. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1922. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1923. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1924. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP040540 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-VIR, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1925. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1926. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1927. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1928. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP045675 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_2, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1929. spacer 1.8|14649|21|CP027063|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1930. spacer 1.8|14649|21|CP027063|CRT matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1931. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1932. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1933. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP052037 (Klebsiella pneumoniae strain KPN41053 plasmid pKPN41953, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1934. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1935. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP040595 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST15_NDM plasmid pKpvST15, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1936. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1937. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1938. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1939. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1940. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1941. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP028390 (Klebsiella pneumoniae strain WCHKP13F2 plasmid pVir_095132, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1942. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP034083 (Klebsiella pneumoniae subsp. pneumoniae strain R210-2 plasmid pR210-2-vir, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1943. spacer 1.8|14649|21|CP027063|CRT matches to CP050281 (Klebsiella pneumoniae strain 9949 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1944. spacer 1.8|14649|21|CP027063|CRT matches to CP029383 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pVir_020079, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1945. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1946. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1947. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP026012 (Klebsiella pneumoniae strain K2044 plasmid pK2044, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1948. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP026024 (Klebsiella pneumoniae strain 11420 plasmid p11420-HVKP, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1949. spacer 1.8|14649|21|CP027063|CRT matches to NZ_AP019549 (Klebsiella pneumoniae strain THC11 plasmid pTHC11-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1950. spacer 1.8|14649|21|CP027063|CRT matches to CP050276 (Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1951. spacer 1.8|14649|21|CP027063|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1952. spacer 1.8|14649|21|CP027063|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1953. spacer 1.8|14649|21|CP027063|CRT matches to MK649822 (Klebsiella pneumoniae strain 2579 plasmid p2579_1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1954. spacer 1.8|14649|21|CP027063|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1955. spacer 1.8|14649|21|CP027063|CRT matches to MK649825 (Klebsiella pneumoniae strain BA813 plasmid pBA813_1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1956. spacer 1.8|14649|21|CP027063|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1957. spacer 1.8|14649|21|CP027063|CRT matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1958. spacer 1.8|14649|21|CP027063|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1959. spacer 1.8|14649|21|CP027063|CRT matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1960. spacer 1.8|14649|21|CP027063|CRT matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1961. spacer 1.8|14649|21|CP027063|CRT matches to NZ_MK413722 (Klebsiella pneumoniae strain 332306 plasmid p332306-HI3, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1962. spacer 1.8|14649|21|CP027063|CRT matches to NC_017541 (Klebsiella pneumoniae KCTC 2242 plasmid pKCTC2242, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1963. spacer 1.8|14649|21|CP027063|CRT matches to NZ_MH255828 (Klebsiella pneumoniae subsp. pneumoniae strain SH9 plasmid pSH9-VIR, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1964. spacer 1.8|14649|21|CP027063|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1965. spacer 1.8|14649|21|CP027063|CRT matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1966. spacer 1.8|14649|21|CP027063|CRT matches to HG918041 (Klebsiella pneumoniae Kp15 plasmid pENVA complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1967. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP016815 (Klebsiella pneumoniae strain ED23 plasmid unamed, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1968. spacer 1.8|14649|21|CP027063|CRT matches to NZ_MG053312 (Klebsiella pneumoniae strain KP267 plasmid pVir-CR-HvKP267, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1969. spacer 1.8|14649|21|CP027063|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1970. spacer 1.8|14649|21|CP027063|CRT matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1971. spacer 1.8|14649|21|CP027063|CRT matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1972. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1973. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1974. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1975. spacer 1.8|14649|21|CP027063|CRT matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 1, identity: 0.952

acgtggccgctgacggtggct	CRISPR spacer
acggggccgctgacggtggct	Protospacer
*** *****************

1976. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 1, identity: 0.952

acgggaccgctgccggtagtc	CRISPR spacer
acggggccgctgccggtagtc	Protospacer
*****.***************

1977. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 1, identity: 0.952

acgggaccgctgccggtagtc	CRISPR spacer
acggggccgctgccggtagtc	Protospacer
*****.***************

1978. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP024582 (Roseomonas sp. FDAARGOS_362 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggccgctgtcggtggtc	CRISPR spacer
gcgtggcggctgtcggtggtc	Protospacer
******* *************

1979. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP023917 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

acaggggcgataccagtgacc	CRISPR spacer
acagggacgataccagtgacc	Protospacer
******.**************

1980. spacer 1.11|14775|21|CP027063|CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 1, identity: 0.952

acaggggcgataccagtgacc	CRISPR spacer
acaggggcgataccggtgacc	Protospacer
**************.******

1981. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtgatc	Protospacer
******************.**

1982. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP020848 (Klebsiella variicola strain KPN1481 plasmid pKPN1481-1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtgatc	Protospacer
******************.**

1983. spacer 1.12|14817|21|CP027063|CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgttgtcgctgctggtggtc	Protospacer
**** ****************

1984. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 1, identity: 0.952

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgttgtcgctgctggtggtc	Protospacer
**** ****************

1985. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtgatc	Protospacer
******************.**

1986. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP011314 (Klebsiella pneumoniae subsp. pneumoniae strain 234-12 plasmid pKpn23412-362, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtgatc	Protospacer
******************.**

1987. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtgatc	Protospacer
******************.**

1988. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtgatc	Protospacer
******************.**

1989. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP021699 (Klebsiella pneumoniae strain AR_0158 plasmid tig00000727, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtgatc	Protospacer
******************.**

1990. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP034054 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtgatc	Protospacer
******************.**

1991. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtgatc	Protospacer
******************.**

1992. spacer 1.12|14817|21|CP027063|CRT matches to NZ_CP034046 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtgatc	Protospacer
******************.**

1993. spacer 1.12|14817|21|CP027063|CRT matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.952

gcgtggtcgctgctggtggtc	CRISPR spacer
gcgtggtcgctgctggtgatc	Protospacer
******************.**

1994. spacer 1.5|14523|21|CP027063|CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.905

acgtggccgctgccggtgctc	CRISPR spacer
gtgtggccgctgccggtgctc	Protospacer
..*******************

1995. spacer 1.6|14565|21|CP027063|CRT matches to CP052400 (Klebsiella pneumoniae strain C17KP0039 plasmid pC17KP0039-1, complete sequence) position: , mismatch: 2, identity: 0.905

acggggccgctgacggtggct	CRISPR spacer
gaggggccgctgacggtggct	Protospacer
. *******************

1996. spacer 1.7|14607|21|CP027063|CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.905

acgtggccgctgccggtgctc	CRISPR spacer
gtgtggccgctgccggtgctc	Protospacer
..*******************

1997. spacer 1.8|14649|21|CP027063|CRT matches to CP052327 (Klebsiella pneumoniae strain E16KP0017 plasmid pE16K0017-1, complete sequence) position: , mismatch: 2, identity: 0.905

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggtc	Protospacer
*******************..

1998. spacer 1.8|14649|21|CP027063|CRT matches to CP052240 (Klebsiella pneumoniae strain E17KP0027 plasmid pE17KP0027-1, complete sequence) position: , mismatch: 2, identity: 0.905

acgtggccgctgacggtggct	CRISPR spacer
acgtggccgctgacggtggtc	Protospacer
*******************..

1999. spacer 1.8|14649|21|CP027063|CRT matches to MF185718 (Arthrobacter phage Colucci, complete genome) position: , mismatch: 2, identity: 0.905

acgtggccgctgacggtggct	CRISPR spacer
gcgtggccgctgacggtggcc	Protospacer
.*******************.

2000. spacer 1.9|14691|21|CP027063|CRT matches to NZ_CP030828 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750a, complete sequence) position: , mismatch: 2, identity: 0.905

acgggaccgctgccggtagtc	CRISPR spacer
gcgggaccgctgccggtagtt	Protospacer
.*******************.

2001. spacer 1.10|14733|21|CP027063|CRT matches to NZ_KX029332 (Klebsiella pneumoniae strain Kp84/11 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.905

gcgtggccgctgtcggtggtc	CRISPR spacer
gcgtggccgctgtcggtggct	Protospacer
*******************..

2002. spacer 1.10|14733|21|CP027063|CRT matches to NZ_LN824134 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_A_Kpneumoniae_MS6671) position: , mismatch: 2, identity: 0.905

gcgtggccgctgtcggtggtc	CRISPR spacer
gcgtggccgctgtcggtggct	Protospacer
*******************..

2003. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP015501 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 1, complete sequence) position: , mismatch: 2, identity: 0.905

gcgtggccgctgtcggtggtc	CRISPR spacer
gcgtggccgctgtcggtggct	Protospacer
*******************..

2004. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP042866 (Escherichia coli strain ATCC BAA-196 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.905

gcgtggccgctgtcggtggtc	CRISPR spacer
gcgtggccgctgtcggtggct	Protospacer
*******************..

2005. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 2, identity: 0.905

gcgtggccgctgtcggtggtc	CRISPR spacer
gcgtggccgctgtcggtggct	Protospacer
*******************..

2006. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP004000 (Klebsiella pneumoniae subsp. pneumoniae Kp13 plasmid pKP13f, complete sequence) position: , mismatch: 2, identity: 0.905

gcgtggccgctgtcggtggtc	CRISPR spacer
gcgtggccgctgtcggtggct	Protospacer
*******************..

2007. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP032208 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.905

gcgtggccgctgtcggtggtc	CRISPR spacer
gcgtggccgctgtcggtggct	Protospacer
*******************..

2008. spacer 1.10|14733|21|CP027063|CRT matches to NZ_CP027156 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed4) position: , mismatch: 2, identity: 0.905

gcgtggccgctgtcggtggtc	CRISPR spacer
gcgtggccgctgtcggtggct	Protospacer
*******************..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 162743 : 223896 56 Shigella_phage(50.0%) transposase,integrase attL 175631:175690|attR 201070:202299
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage