Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP015497 Lactobacillus helveticus strain FAM8105 plasmid pFAM8105, complete sequence 0 crisprs NA 0 0 0 0
CP015496 Lactobacillus helveticus strain FAM8105 chromosome, complete genome 3 crisprs cas14j,cas3,csa3,cas2,cas14k,cas5,cas8c,cas7,cas4,cas1,DEDDh,DinG,Cas14u_CAS-V 0 5 22 0

Results visualization

1. CP015496
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP015496_1 601821-603718 TypeV I-C
28 spacers
cas2,cas1,cas4,cas7,cas8c,cas5,cas3,cas14k

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP015496_2 752689-752779 Orphan I-B,III-A,III-B
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP015496_3 1706457-1706636 TypeV NA
2 spacers
cas14j,cas14k

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP015496_1 1.21|603187|34|CP015496|PILER-CR,CRISPRCasFinder,CRT 603187-603220 34 AP013456 Uncultured Mediterranean phage uvMED DNA, complete genome, group G17, isolate: uvMED-CGR-U-MedDCM-OCT-S23-C23 4052-4085 5 0.853
CP015496_1 1.23|603321|34|CP015496|PILER-CR,CRISPRCasFinder,CRT 603321-603354 34 NZ_CP015630 Borrelia turicatae strain BTE5EL plasmid lp159 117489-117522 8 0.765
CP015496_1 1.5|602120|34|CP015496|PILER-CR,CRISPRCasFinder,CRT 602120-602153 34 NZ_CP005961 Pseudomonas mandelii JR-1 plasmid unnamed, complete sequence 361010-361043 9 0.735
CP015496_1 1.13|602655|34|CP015496|PILER-CR,CRISPRCasFinder,CRT 602655-602688 34 AP013772 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C39-MedDCM-OCT-S34-C80, *** SEQUENCING IN PROGRESS *** 9086-9119 9 0.735
CP015496_1 1.13|602655|34|CP015496|PILER-CR,CRISPRCasFinder,CRT 602655-602688 34 AP013773 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C39-MedDCM-OCT-S42-C70, *** SEQUENCING IN PROGRESS *** 33585-33618 9 0.735
CP015496_1 1.13|602655|34|CP015496|PILER-CR,CRISPRCasFinder,CRT 602655-602688 34 AP013495 Uncultured Mediterranean phage uvMED DNA, complete genome, group G19, isolate: uvMED-CGR-C39-MedDCM-OCT-S27-C61 11025-11058 9 0.735
CP015496_1 1.13|602655|34|CP015496|PILER-CR,CRISPRCasFinder,CRT 602655-602688 34 AP014445 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C39-MedDCM-OCT-S35-C62, *** SEQUENCING IN PROGRESS ***, 4 ordered pieces 864-897 9 0.735
CP015496_1 1.21|603187|34|CP015496|PILER-CR,CRISPRCasFinder,CRT 603187-603220 34 NZ_CP012425 Spiroplasma kunkelii CR2-3x plasmid pSKU76, complete sequence 498-531 9 0.735
CP015496_1 1.5|602120|34|CP015496|PILER-CR,CRISPRCasFinder,CRT 602120-602153 34 NZ_KU254577 Pseudomonas aeruginosa strain HN39 plasmid pHN39-SIM, complete sequence 52522-52555 10 0.706
CP015496_1 1.5|602120|34|CP015496|PILER-CR,CRISPRCasFinder,CRT 602120-602153 34 MN310371 Pseudomonas monteilii strain QJ20133 plasmid pJ20133-VIM, complete sequence 50537-50570 10 0.706
CP015496_1 1.5|602120|34|CP015496|PILER-CR,CRISPRCasFinder,CRT 602120-602153 34 CP031732 Stenotrophomonas rhizophila strain GA1 plasmid unnamed3, complete sequence 73237-73270 10 0.706
CP015496_1 1.5|602120|34|CP015496|PILER-CR,CRISPRCasFinder,CRT 602120-602153 34 NC_022739 Pseudomonas sp. VLB120 plasmid pSTY, complete sequence 155256-155289 10 0.706
CP015496_1 1.25|603453|34|CP015496|PILER-CR,CRISPRCasFinder,CRT 603453-603486 34 NC_010181 Bacillus mycoides KBAB4 plasmid pBWB402, complete sequence 18000-18033 11 0.676

1. spacer 1.21|603187|34|CP015496|PILER-CR,CRISPRCasFinder,CRT matches to AP013456 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G17, isolate: uvMED-CGR-U-MedDCM-OCT-S23-C23) position: , mismatch: 5, identity: 0.853

ccattaaata-atcattacttgtattaaataaagt	CRISPR spacer
-aactaaatacatcattacctgtattaagtaaagt	Protospacer
  *.****** ********.********.******

2. spacer 1.23|603321|34|CP015496|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015630 (Borrelia turicatae strain BTE5EL plasmid lp159) position: , mismatch: 8, identity: 0.765

atcaaagctatcctgctattgctgatggctggtg	CRISPR spacer
atcaaagctatcctgcaattgctgttttactgta	Protospacer
**************** ******* *   . **.

3. spacer 1.5|602120|34|CP015496|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP005961 (Pseudomonas mandelii JR-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.735

atatgaattccttggctagggctttgagcactga	CRISPR spacer
aattgaattccttggccagggctttaagggatcg	Protospacer
*  *************.********.** . * .

4. spacer 1.13|602655|34|CP015496|PILER-CR,CRISPRCasFinder,CRT matches to AP013772 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C39-MedDCM-OCT-S34-C80, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.735

ttttgacttttgcttgttacgactaatcaggaaa	CRISPR spacer
tttggacttttgctagttacgactcagaacaagc	Protospacer
*** ********** ********* *  * .*. 

5. spacer 1.13|602655|34|CP015496|PILER-CR,CRISPRCasFinder,CRT matches to AP013773 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C39-MedDCM-OCT-S42-C70, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.735

ttttgacttttgcttgttacgactaatcaggaaa	CRISPR spacer
tttggacttttgctagttacgactcagaacaagc	Protospacer
*** ********** ********* *  * .*. 

6. spacer 1.13|602655|34|CP015496|PILER-CR,CRISPRCasFinder,CRT matches to AP013495 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G19, isolate: uvMED-CGR-C39-MedDCM-OCT-S27-C61) position: , mismatch: 9, identity: 0.735

ttttgacttttgcttgttacgactaatcaggaaa	CRISPR spacer
tttggacttttgctagttacgactcagaacaagc	Protospacer
*** ********** ********* *  * .*. 

7. spacer 1.13|602655|34|CP015496|PILER-CR,CRISPRCasFinder,CRT matches to AP014445 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C39-MedDCM-OCT-S35-C62, *** SEQUENCING IN PROGRESS ***, 4 ordered pieces) position: , mismatch: 9, identity: 0.735

ttttgacttttgcttgttacgactaatcaggaaa	CRISPR spacer
tttggacttttgctagttacgactcagaacaagc	Protospacer
*** ********** ********* *  * .*. 

8. spacer 1.21|603187|34|CP015496|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012425 (Spiroplasma kunkelii CR2-3x plasmid pSKU76, complete sequence) position: , mismatch: 9, identity: 0.735

ccattaaataatcattacttgtattaaataaagt	CRISPR spacer
catataaataatcattattagtattaaactcaat	Protospacer
*   *************.* ********.  *.*

9. spacer 1.5|602120|34|CP015496|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KU254577 (Pseudomonas aeruginosa strain HN39 plasmid pHN39-SIM, complete sequence) position: , mismatch: 10, identity: 0.706

atatgaattccttggctagggctttgagcactga	CRISPR spacer
agttgaattccttggccagggccttgagggaacg	Protospacer
*  *************.*****.***** .   .

10. spacer 1.5|602120|34|CP015496|PILER-CR,CRISPRCasFinder,CRT matches to MN310371 (Pseudomonas monteilii strain QJ20133 plasmid pJ20133-VIM, complete sequence) position: , mismatch: 10, identity: 0.706

atatgaattccttggctagggctttgagcactga	CRISPR spacer
agttgaattccttggccagggccttgagggaacg	Protospacer
*  *************.*****.***** .   .

11. spacer 1.5|602120|34|CP015496|PILER-CR,CRISPRCasFinder,CRT matches to CP031732 (Stenotrophomonas rhizophila strain GA1 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.706

atatgaattccttggctagggctttgagcactga	CRISPR spacer
agttgaattccttggccagggccttgagggaacg	Protospacer
*  *************.*****.***** .   .

12. spacer 1.5|602120|34|CP015496|PILER-CR,CRISPRCasFinder,CRT matches to NC_022739 (Pseudomonas sp. VLB120 plasmid pSTY, complete sequence) position: , mismatch: 10, identity: 0.706

atatgaattccttggctagggctttgagcactga	CRISPR spacer
aattgaattccttggccagggccttgagggaacg	Protospacer
*  *************.*****.***** .   .

13. spacer 1.25|603453|34|CP015496|PILER-CR,CRISPRCasFinder,CRT matches to NC_010181 (Bacillus mycoides KBAB4 plasmid pBWB402, complete sequence) position: , mismatch: 11, identity: 0.676

actaatgaagtaatcagtaaggtgttgggttaca	CRISPR spacer
gtataataagtaatcagtaaagtgttgagttgtt	Protospacer
..  *  *************.******.***.. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 10451 : 56775 40 Streptococcus_phage(53.85%) transposase,integrase attL 28563:28578|attR 59459:59474
DBSCAN-SWA_2 90842 : 129000 35 Corynebacterium_phage(16.67%) transposase,protease NA
DBSCAN-SWA_3 144505 : 209404 50 Lactobacillus_phage(14.29%) transposase,protease,tRNA NA
DBSCAN-SWA_4 217993 : 284309 55 Corynebacterium_phage(16.67%) transposase,tRNA NA
DBSCAN-SWA_5 367134 : 421717 53 Streptococcus_phage(31.82%) transposase,tRNA NA
DBSCAN-SWA_6 472292 : 588458 130 Lactobacillus_phage(63.64%) portal,transposase,tail,bacteriocin,capsid,terminase,head,tRNA,integrase attL 490710:490729|attR 531583:531602
DBSCAN-SWA_7 611452 : 669044 53 Tupanvirus(23.08%) transposase,protease,tRNA NA
DBSCAN-SWA_8 705781 : 757858 33 Corynebacterium_phage(50.0%) transposase NA
DBSCAN-SWA_9 800482 : 923840 99 Streptococcus_phage(13.89%) transposase,protease,integrase,tRNA attL 793603:793618|attR 923917:925514
DBSCAN-SWA_10 967322 : 1084787 101 Corynebacterium_phage(20.69%) transposase,integrase,tRNA attL 967389:967404|attR 1030888:1030903
DBSCAN-SWA_11 1100440 : 1159891 51 Corynebacterium_phage(23.08%) transposase,bacteriocin,integrase,tRNA attL 1121209:1121225|attR 1155208:1155224
DBSCAN-SWA_12 1196938 : 1343926 115 Corynebacterium_phage(16.67%) transposase,protease,tRNA NA
DBSCAN-SWA_13 1347722 : 1528977 180 Lactobacillus_phage(35.29%) holin,transposase,tail,capsid,terminase,integrase,tRNA attL 1336351:1336367|attR 1404551:1404567
DBSCAN-SWA_14 1555817 : 1603080 40 Streptococcus_phage(27.27%) transposase,protease NA
DBSCAN-SWA_15 1610117 : 1677511 54 Streptococcus_phage(21.43%) transposase NA
DBSCAN-SWA_16 1681195 : 1756069 56 Bacillus_phage(14.29%) transposase,tRNA NA
DBSCAN-SWA_17 1768628 : 1829676 50 Corynebacterium_phage(38.46%) transposase,integrase attL 1768492:1768551|attR 1794411:1796009
DBSCAN-SWA_18 1838977 : 1912506 55 Corynebacterium_phage(23.53%) transposase,protease,integrase,tRNA attL 1870882:1870941|attR 1921088:1922688
DBSCAN-SWA_19 1919603 : 1969746 49 Corynebacterium_phage(25.0%) transposase NA
DBSCAN-SWA_20 1996079 : 2037452 34 Corynebacterium_phage(12.5%) transposase NA
DBSCAN-SWA_21 2060058 : 2113779 40 Streptococcus_phage(35.71%) transposase,integrase attL 2059924:2059983|attR 2121516:2122891
DBSCAN-SWA_22 2120261 : 2182479 46 Corynebacterium_phage(28.57%) transposase,holin,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage