Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP018622 Virgibacillus dokdonensis strain 21D chromosome, complete genome 2 crisprs RT,csa3,WYL,DEDDh,cas3,DinG 2 5 8 1

Results visualization

1. CP018622
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP018622_1 485164-485663 Orphan I-C
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP018622_2 528348-528585 Orphan I-C
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP018622_2 2.1|528382|32|CP018622|CRISPRCasFinder 528382-528413 32 CP018622.1 15975-16006 1 0.969
CP018622_2 2.4|528385|31|CP018622|CRT 528385-528415 31 CP018622.1 15973-16003 1 0.968

1. spacer 2.1|528382|32|CP018622|CRISPRCasFinder matches to position: 15975-16006, mismatch: 1, identity: 0.969

agcaggctataaatctatcatgcatatacacg	CRISPR spacer
agcaggctatgaatctatcatgcatatacacg	Protospacer
**********.*********************

2. spacer 2.4|528385|31|CP018622|CRT matches to position: 15973-16003, mismatch: 1, identity: 0.968

aggctataaatctatcatgcatatacacgat	CRISPR spacer
aggctatgaatctatcatgcatatacacgat	Protospacer
*******.***********************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP018622_1 1.5|485466|33|CP018622|PILER-CR,CRISPRCasFinder,CRT 485466-485498 33 KT001914 Caulobacter phage Seuss, complete genome 6-38 6 0.818
CP018622_1 1.5|485466|33|CP018622|PILER-CR,CRISPRCasFinder,CRT 485466-485498 33 KT001914 Caulobacter phage Seuss, complete genome 83396-83428 6 0.818
CP018622_2 2.4|528385|31|CP018622|CRT 528385-528415 31 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 214490-214520 7 0.774
CP018622_2 2.4|528385|31|CP018622|CRT 528385-528415 31 KY695241 Wolbachia phage sr1WOdamA clone contig3 genomic sequence 9924-9954 7 0.774
CP018622_1 1.5|485466|33|CP018622|PILER-CR,CRISPRCasFinder,CRT 485466-485498 33 MK250021 Prevotella phage Lak-B2, complete genome 163199-163231 9 0.727
CP018622_1 1.5|485466|33|CP018622|PILER-CR,CRISPRCasFinder,CRT 485466-485498 33 MK250024 Prevotella phage Lak-B5, complete genome 157207-157239 9 0.727
CP018622_1 1.5|485466|33|CP018622|PILER-CR,CRISPRCasFinder,CRT 485466-485498 33 MK250028 Prevotella phage Lak-B9, complete genome 162090-162122 9 0.727
CP018622_1 1.5|485466|33|CP018622|PILER-CR,CRISPRCasFinder,CRT 485466-485498 33 MK250023 Prevotella phage Lak-B4, complete genome 163102-163134 9 0.727
CP018622_1 1.5|485466|33|CP018622|PILER-CR,CRISPRCasFinder,CRT 485466-485498 33 MK250025 Prevotella phage Lak-B6, complete genome 160400-160432 9 0.727
CP018622_1 1.5|485466|33|CP018622|PILER-CR,CRISPRCasFinder,CRT 485466-485498 33 MK250022 Prevotella phage Lak-B3, complete genome 160415-160447 9 0.727
CP018622_1 1.5|485466|33|CP018622|PILER-CR,CRISPRCasFinder,CRT 485466-485498 33 MK250027 Prevotella phage Lak-B8, complete genome 163313-163345 9 0.727
CP018622_1 1.5|485466|33|CP018622|PILER-CR,CRISPRCasFinder,CRT 485466-485498 33 MK250026 Prevotella phage Lak-B7, complete genome 163318-163350 9 0.727
CP018622_1 1.5|485466|33|CP018622|PILER-CR,CRISPRCasFinder,CRT 485466-485498 33 MK250020 Prevotella phage Lak-B1, complete genome 162070-162102 9 0.727
CP018622_1 1.7|485598|34|CP018622|CRISPRCasFinder,CRT 485598-485631 34 NZ_CP047395 Bacillus vietnamensis strain 151-6 plasmid p6, complete sequence 32511-32544 9 0.735
CP018622_2 2.1|528382|32|CP018622|CRISPRCasFinder 528382-528413 32 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 214492-214523 9 0.719
CP018622_2 2.1|528382|32|CP018622|CRISPRCasFinder 528382-528413 32 KY695241 Wolbachia phage sr1WOdamA clone contig3 genomic sequence 9926-9957 9 0.719
CP018622_1 1.3|485329|35|CP018622|PILER-CR,CRISPRCasFinder,CRT 485329-485363 35 NZ_CP037428 Myroides odoratimimus strain G13 plasmid pFM-G13, complete sequence 13980-14014 10 0.714
CP018622_2 2.1|528382|32|CP018622|CRISPRCasFinder 528382-528413 32 NZ_CP043831 Bacillus sp. BS98 plasmid unnamed1 1643-1674 10 0.688
CP018622_2 2.4|528385|31|CP018622|CRT 528385-528415 31 MK250029 Prevotella phage Lak-C1, complete genome 286426-286456 10 0.677
CP018622_2 2.4|528385|31|CP018622|CRT 528385-528415 31 MK250019 Prevotella phage Lak-A2, complete genome 241187-241217 10 0.677
CP018622_2 2.1|528382|32|CP018622|CRISPRCasFinder 528382-528413 32 MK250029 Prevotella phage Lak-C1, complete genome 286428-286459 11 0.656
CP018622_2 2.1|528382|32|CP018622|CRISPRCasFinder 528382-528413 32 MK250019 Prevotella phage Lak-A2, complete genome 241189-241220 11 0.656

1. spacer 1.5|485466|33|CP018622|PILER-CR,CRISPRCasFinder,CRT matches to KT001914 (Caulobacter phage Seuss, complete genome) position: , mismatch: 6, identity: 0.818

agtat-tatttttaaacaatatagtattttgaaa	CRISPR spacer
-atatatatttataaaaaatatagtattttgagt	Protospacer
 .*** ***** **** ***************. 

2. spacer 1.5|485466|33|CP018622|PILER-CR,CRISPRCasFinder,CRT matches to KT001914 (Caulobacter phage Seuss, complete genome) position: , mismatch: 6, identity: 0.818

agtat-tatttttaaacaatatagtattttgaaa	CRISPR spacer
-atatatatttataaaaaatatagtattttgagt	Protospacer
 .*** ***** **** ***************. 

3. spacer 2.4|528385|31|CP018622|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.774

aggctataaatctatcatgcatatacacgat	CRISPR spacer
acgctataaatctatcatgcaaatatgtttt	Protospacer
* ******************* ***...  *

4. spacer 2.4|528385|31|CP018622|CRT matches to KY695241 (Wolbachia phage sr1WOdamA clone contig3 genomic sequence) position: , mismatch: 7, identity: 0.774

aggctataaatctatcatgcatatacacgat	CRISPR spacer
gctctataaatttatcatgcatatgcaccct	Protospacer
.  ********.************.***  *

5. spacer 1.5|485466|33|CP018622|PILER-CR,CRISPRCasFinder,CRT matches to MK250021 (Prevotella phage Lak-B2, complete genome) position: , mismatch: 9, identity: 0.727

agtattatttttaaacaatatagtattttgaaa	CRISPR spacer
gatgatatttttaaagaatatagtaatttatat	Protospacer
..*. ********** ********* ***. * 

6. spacer 1.5|485466|33|CP018622|PILER-CR,CRISPRCasFinder,CRT matches to MK250024 (Prevotella phage Lak-B5, complete genome) position: , mismatch: 9, identity: 0.727

agtattatttttaaacaatatagtattttgaaa	CRISPR spacer
gatgatatttttaaagaatatagtaatttatat	Protospacer
..*. ********** ********* ***. * 

7. spacer 1.5|485466|33|CP018622|PILER-CR,CRISPRCasFinder,CRT matches to MK250028 (Prevotella phage Lak-B9, complete genome) position: , mismatch: 9, identity: 0.727

agtattatttttaaacaatatagtattttgaaa	CRISPR spacer
gatgatatttttaaagaatatagtaatttatat	Protospacer
..*. ********** ********* ***. * 

8. spacer 1.5|485466|33|CP018622|PILER-CR,CRISPRCasFinder,CRT matches to MK250023 (Prevotella phage Lak-B4, complete genome) position: , mismatch: 9, identity: 0.727

agtattatttttaaacaatatagtattttgaaa	CRISPR spacer
gatgatatttttaaagaatatagtaatttatat	Protospacer
..*. ********** ********* ***. * 

9. spacer 1.5|485466|33|CP018622|PILER-CR,CRISPRCasFinder,CRT matches to MK250025 (Prevotella phage Lak-B6, complete genome) position: , mismatch: 9, identity: 0.727

agtattatttttaaacaatatagtattttgaaa	CRISPR spacer
gatgatatttttaaagaatatagtaatttatat	Protospacer
..*. ********** ********* ***. * 

10. spacer 1.5|485466|33|CP018622|PILER-CR,CRISPRCasFinder,CRT matches to MK250022 (Prevotella phage Lak-B3, complete genome) position: , mismatch: 9, identity: 0.727

agtattatttttaaacaatatagtattttgaaa	CRISPR spacer
gatgatatttttaaagaatatagtaatttatat	Protospacer
..*. ********** ********* ***. * 

11. spacer 1.5|485466|33|CP018622|PILER-CR,CRISPRCasFinder,CRT matches to MK250027 (Prevotella phage Lak-B8, complete genome) position: , mismatch: 9, identity: 0.727

agtattatttttaaacaatatagtattttgaaa	CRISPR spacer
gatgatatttttaaagaatatagtaatttatat	Protospacer
..*. ********** ********* ***. * 

12. spacer 1.5|485466|33|CP018622|PILER-CR,CRISPRCasFinder,CRT matches to MK250026 (Prevotella phage Lak-B7, complete genome) position: , mismatch: 9, identity: 0.727

agtattatttttaaacaatatagtattttgaaa	CRISPR spacer
gatgatatttttaaagaatatagtaatttatat	Protospacer
..*. ********** ********* ***. * 

13. spacer 1.5|485466|33|CP018622|PILER-CR,CRISPRCasFinder,CRT matches to MK250020 (Prevotella phage Lak-B1, complete genome) position: , mismatch: 9, identity: 0.727

agtattatttttaaacaatatagtattttgaaa	CRISPR spacer
gatgatatttttaaagaatatagtaatttatat	Protospacer
..*. ********** ********* ***. * 

14. spacer 1.7|485598|34|CP018622|CRISPRCasFinder,CRT matches to NZ_CP047395 (Bacillus vietnamensis strain 151-6 plasmid p6, complete sequence) position: , mismatch: 9, identity: 0.735

acttttggcattaatattggtctaagaattagcg	CRISPR spacer
tcaattggcattaatactggtcttagaatatcgg	Protospacer
 *  ************.****** *****    *

15. spacer 2.1|528382|32|CP018622|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719

agcaggctataaatctatcatgcatatacacg	CRISPR spacer
tagacgctataaatctatcatgcaaatatgtt	Protospacer
 . * ******************* ***... 

16. spacer 2.1|528382|32|CP018622|CRISPRCasFinder matches to KY695241 (Wolbachia phage sr1WOdamA clone contig3 genomic sequence) position: , mismatch: 9, identity: 0.719

agcaggctataaatctatcatgcatatacacg	CRISPR spacer
tttgctctataaatttatcatgcatatgcacc	Protospacer
  ..  ********.************.*** 

17. spacer 1.3|485329|35|CP018622|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP037428 (Myroides odoratimimus strain G13 plasmid pFM-G13, complete sequence) position: , mismatch: 10, identity: 0.714

gatcaccataataaactgtttcaaaatctccacta	CRISPR spacer
tatcatcataatcaactgtttcaaaacgataagtt	Protospacer
 ****.****** *************.  . * * 

18. spacer 2.1|528382|32|CP018622|CRISPRCasFinder matches to NZ_CP043831 (Bacillus sp. BS98 plasmid unnamed1) position: , mismatch: 10, identity: 0.688

agcaggctataaatctatcatgcatatacacg	CRISPR spacer
cacaggctataaatctaccctgcattaaagga	Protospacer
 .***************.* *****  * . .

19. spacer 2.4|528385|31|CP018622|CRT matches to MK250029 (Prevotella phage Lak-C1, complete genome) position: , mismatch: 10, identity: 0.677

aggctataaatctatcatgcatatacacgat	CRISPR spacer
ctgctctaaatctatcttgcatatatttaca	Protospacer
  *** ********** ********. ..  

20. spacer 2.4|528385|31|CP018622|CRT matches to MK250019 (Prevotella phage Lak-A2, complete genome) position: , mismatch: 10, identity: 0.677

aggctataaatctatcatgcatatacacgat	CRISPR spacer
ctgctctaaatctatcttgcatatatttaca	Protospacer
  *** ********** ********. ..  

21. spacer 2.1|528382|32|CP018622|CRISPRCasFinder matches to MK250029 (Prevotella phage Lak-C1, complete genome) position: , mismatch: 11, identity: 0.656

agcaggctataaatctatcatgcatatacacg	CRISPR spacer
gttctgctctaaatctatcttgcatatattta	Protospacer
. .  *** ********** ********. ..

22. spacer 2.1|528382|32|CP018622|CRISPRCasFinder matches to MK250019 (Prevotella phage Lak-A2, complete genome) position: , mismatch: 11, identity: 0.656

agcaggctataaatctatcatgcatatacacg	CRISPR spacer
gttctgctctaaatctatcttgcatatattta	Protospacer
. .  *** ********** ********. ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 272 : 30133 47 Bacillus_phage(24.24%) portal,capsid,transposase,protease NA
DBSCAN-SWA_2 107287 : 114292 8 Streptococcus_phage(33.33%) protease NA
DBSCAN-SWA_3 1205219 : 1216428 12 Anoxybacillus_phage(42.86%) tail NA
DBSCAN-SWA_4 2228892 : 2296357 76 Bacillus_phage(23.68%) protease,terminase,portal,tail,plate NA
DBSCAN-SWA_5 3667405 : 3675489 8 uncultured_Caudovirales_phage(16.67%) NA NA
DBSCAN-SWA_6 3747548 : 3767840 24 Bacillus_phage(36.84%) holin,capsid,protease,portal,tail NA
DBSCAN-SWA_7 3771547 : 3786156 23 uncultured_Caudovirales_phage(45.45%) NA NA
DBSCAN-SWA_8 4251162 : 4263340 11 Paenibacillus_phage(44.44%) tail NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
CP018622.1|AUJ23154.1|23365_23485_-|hypothetical-protein 23365_23485_- 39 aa aa NA NA NA 272-30133 yes