Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP025492 Legionella sainthelensi strain LA01-117 plasmid pLA01-117_150k, complete sequence 0 crisprs DinG,WYL 0 0 0 0
CP025493 Legionella sainthelensi strain LA01-117 plasmid pLA01-117_113k, complete sequence 0 crisprs DEDDh,DinG 0 0 1 0
CP025491 Legionella sainthelensi strain LA01-117 chromosome, complete genome 2 crisprs cas3,WYL,DinG,DEDDh,csa3,RT 0 1 3 0

Results visualization

1. CP025493
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 86044 : 95086 7 Synechococcus_phage(33.33%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP025491
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025491_1 1396183-1396300 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025491_2 3029564-3029732 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP025491_2 2.2|3029662|44|CP025491|CRISPRCasFinder 3029662-3029705 44 NZ_LR134418 Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 9 257659-257702 2 0.955

1. spacer 2.2|3029662|44|CP025491|CRISPRCasFinder matches to NZ_LR134418 (Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 9) position: , mismatch: 2, identity: 0.955

atggtgaattaatgcaaagaaatacaataataaatttattttta	CRISPR spacer
atggtgaattaatgcaaataaatgcaataataaatttattttta	Protospacer
****************** ****.********************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1041004 : 1119234 51 Bacillus_phage(28.57%) transposase NA
DBSCAN-SWA_2 2003669 : 2010471 9 Acinetobacter_phage(42.86%) NA NA
DBSCAN-SWA_3 2540858 : 2550329 6 Bacillus_phage(16.67%) protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage