Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP035179 Klebsiella pneumoniae strain BA33875 chromosome, complete genome 3 crisprs DEDDh,DinG,cas3,csa3,WYL,RT 0 1 9 0
CP035180 Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence 0 crisprs RT,csa3 0 0 2 0
CP035181 Klebsiella pneumoniae strain BA33875 plasmid pBA33875_KPC2, complete sequence 0 crisprs NA 0 0 0 0
CP035182 Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncR, complete sequence 0 crisprs RT 0 0 0 0

Results visualization

1. CP035179
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP035179_1 439983-440087 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP035179_2 480339-480440 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP035179_4 4840966-4841074 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP035179_3 3.1|2337712|27|CP035179|CRISPRCasFinder 2337712-2337738 27 MN013086 Klebsiella phage vB_Kpn_Chronis, complete genome 33543-33569 1 0.963
CP035179_3 3.1|2337712|27|CP035179|CRISPRCasFinder 2337712-2337738 27 NZ_LR134256 Klebsiella aerogenes strain NCTC9644 plasmid 3, complete sequence 1565-1591 1 0.963
CP035179_3 3.1|2337712|27|CP035179|CRISPRCasFinder 2337712-2337738 27 NC_017077 Selenomonas ruminantium subsp. lactilytica TAM6421 plasmid pSRC7, complete sequence 20760-20786 5 0.815

1. spacer 3.1|2337712|27|CP035179|CRISPRCasFinder matches to MN013086 (Klebsiella phage vB_Kpn_Chronis, complete genome) position: , mismatch: 1, identity: 0.963

ctccacctccgcaggcattggtacgac	CRISPR spacer
atccacctccgcaggcattggtacgac	Protospacer
 **************************

2. spacer 3.1|2337712|27|CP035179|CRISPRCasFinder matches to NZ_LR134256 (Klebsiella aerogenes strain NCTC9644 plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.963

ctccacctccgcaggcattggtacgac	CRISPR spacer
ctccacctccgcaggcattggtactac	Protospacer
************************ **

3. spacer 3.1|2337712|27|CP035179|CRISPRCasFinder matches to NC_017077 (Selenomonas ruminantium subsp. lactilytica TAM6421 plasmid pSRC7, complete sequence) position: , mismatch: 5, identity: 0.815

ctccacctccgcaggcattggtacgac	CRISPR spacer
tggcacctccgcaggcattggtgcggc	Protospacer
.  *******************.**.*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 172801 : 300944 138 Enterobacteria_phage(24.1%) integrase,protease,holin,head,terminase,tail,portal,capsid,plate,tRNA attL 219862:219880|attR 257602:257620
DBSCAN-SWA_2 1106904 : 1113333 7 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_3 1819780 : 1829243 8 Brazilian_cedratvirus(16.67%) protease,tRNA NA
DBSCAN-SWA_4 2305460 : 2349925 64 Cronobacter_phage(24.0%) integrase,head,terminase,lysis,tRNA,coat attL 2302413:2302458|attR 2346998:2347043
DBSCAN-SWA_5 4835742 : 4896625 68 Salmonella_phage(81.4%) integrase,holin,head,terminase,tail,lysis,portal,capsid,plate,tRNA attL 4849943:4849989|attR 4885251:4885297
DBSCAN-SWA_6 5003630 : 5054486 61 Salmonella_phage(42.11%) integrase,holin,tail,terminase,capsid attL 5003368:5003382|attR 5033110:5033124
DBSCAN-SWA_7 5061682 : 5068901 8 Salmonella_phage(57.14%) holin NA
DBSCAN-SWA_8 5433021 : 5439924 6 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_9 5481110 : 5489485 6 Escherichia_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP035180
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 126399 : 194749 60 Bacillus_phage(20.0%) transposase,integrase attL 178993:179008|attR 196326:196341
DBSCAN-SWA_2 211924 : 220929 8 Escherichia_phage(100.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage