Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP030920 Escherichia coli strain KL53 plasmid pKL53-L, complete sequence 0 crisprs csa3,TnsE_C 0 0 2 0
CP030921 Escherichia coli strain KL53 plasmid pKL53-M, complete sequence 0 crisprs csa3,RT 0 0 1 0
CP030919 Escherichia coli strain KL53 chromosome, complete genome 6 crisprs WYL,DinG,cas3,DEDDh,c2c9_V-U4,csa3,cas2,cas1,cas8e,Cas14u_CAS-V 0 18 13 0
CP030922 Escherichia coli strain KL53 plasmid pKL53-S, complete sequence 0 crisprs DEDDh 0 0 4 0

Results visualization

1. CP030920
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1708 : 69649 57 Shigella_phage(18.75%) transposase,integrase NA
DBSCAN-SWA_2 82093 : 208055 109 Stx2-converting_phage(16.13%) protease,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP030919
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP030919_1 316920-317016 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP030919_2 1323511-1323634 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP030919_3 1988974-1989114 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP030919_4 2208175-2208301 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP030919_6 2733443-2734020 TypeI-E I-E
9 spacers
cas2,cas1,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP030919_7 2758305-2759126 Orphan I-E
13 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP030919_2 2.1|1323554|38|CP030919|CRISPRCasFinder 1323554-1323591 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 14210-14244 2 0.943
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 51848-51882 3 0.914
CP030919_6 6.1|2733472|32|CP030919|CRT 2733472-2733503 32 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 246937-246968 3 0.906
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 MG065686 UNVERIFIED: Campylobacter phage A18a, complete genome 110186-110220 4 0.886
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 MG065691 UNVERIFIED: Campylobacter phage A11a, complete genome 63903-63937 4 0.886
CP030919_6 6.5|2733716|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733716-2733747 32 JF974294 Aeromonas phage pIS4-A genomic sequence 2317-2348 4 0.875
CP030919_6 6.5|2733716|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733716-2733747 32 NC_021534 Vibrio phage pYD38-A genomic sequence 22947-22978 4 0.875
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 24794-24828 5 0.857
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 24907-24941 5 0.857
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 14119-14153 5 0.857
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 170873-170907 5 0.857
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 87173-87207 5 0.857
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 40381-40415 5 0.857
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP044308 Escherichia coli strain C27A plasmid pC27A-3, complete sequence 14051-14085 5 0.857
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229083-229117 5 0.857
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229184-229218 5 0.857
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229285-229319 5 0.857
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239577-239611 5 0.857
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239678-239712 5 0.857
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239779-239813 5 0.857
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230489-230523 5 0.857
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230590-230624 5 0.857
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230691-230725 5 0.857
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211459-211493 5 0.857
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211560-211594 5 0.857
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211661-211695 5 0.857
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 145331-145365 5 0.857
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NC_049343 Escherichia phage 500465-2, complete genome 31797-31831 5 0.857
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 17899-17933 5 0.857
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_AP023209 Escherichia coli strain TUM18781 plasmid pMTY18781-4, complete sequence 29-63 5 0.857
CP030919_6 6.5|2733716|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733716-2733747 32 NC_013059 Salmonella phage c341, complete genome 23302-23333 5 0.844
CP030919_6 6.5|2733716|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733716-2733747 32 FJ000341 Salmonella phage g341c, complete genome 23302-23333 5 0.844
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 61986-62020 6 0.829
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 210117-210151 6 0.829
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 11525-11559 6 0.829
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 82856-82890 6 0.829
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 102558-102592 6 0.829
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP044308 Escherichia coli strain C27A plasmid pC27A-3, complete sequence 115819-115853 6 0.829
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP019906 Escherichia coli strain MDR_56 plasmid unnamed5, complete sequence 9275-9309 6 0.829
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4179-4213 6 0.829
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 194003-194037 6 0.829
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 211730-211764 6 0.829
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 211930-211964 6 0.829
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229386-229420 6 0.829
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4178-4212 6 0.829
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 204497-204531 6 0.829
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 222224-222258 6 0.829
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 222424-222458 6 0.829
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239880-239914 6 0.829
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4178-4212 6 0.829
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 195331-195365 6 0.829
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 213058-213092 6 0.829
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 213258-213292 6 0.829
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230792-230826 6 0.829
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4178-4212 6 0.829
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 176286-176320 6 0.829
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 194013-194047 6 0.829
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 194213-194247 6 0.829
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211762-211796 6 0.829
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 93107-93141 6 0.829
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 12173-12207 6 0.829
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 MF374379 Escherichia phage DN1, complete genome 31172-31206 6 0.829
CP030919_7 7.7|2758700|32|CP030919|CRISPRCasFinder,CRT 2758700-2758731 32 NZ_AP019198 Aeromonas caviae strain GSH8M-1 plasmid pGSH8M-1-3, complete sequence 2591-2622 6 0.812
CP030919_7 7.7|2758700|32|CP030919|CRISPRCasFinder,CRT 2758700-2758731 32 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 564963-564994 6 0.812
CP030919_7 7.7|2758700|32|CP030919|CRISPRCasFinder,CRT 2758700-2758731 32 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 553238-553269 6 0.812
CP030919_7 7.7|2758700|32|CP030919|CRISPRCasFinder,CRT 2758700-2758731 32 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 513523-513554 6 0.812
CP030919_7 7.20|2758701|32|CP030919|PILER-CR 2758701-2758732 32 NZ_AP019198 Aeromonas caviae strain GSH8M-1 plasmid pGSH8M-1-3, complete sequence 2591-2622 6 0.812
CP030919_7 7.20|2758701|32|CP030919|PILER-CR 2758701-2758732 32 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 564963-564994 6 0.812
CP030919_7 7.20|2758701|32|CP030919|PILER-CR 2758701-2758732 32 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 553238-553269 6 0.812
CP030919_7 7.20|2758701|32|CP030919|PILER-CR 2758701-2758732 32 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 513523-513554 6 0.812
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 158422-158456 7 0.8
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 27041-27075 7 0.8
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 404133-404167 7 0.8
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 313606-313640 7 0.8
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP044308 Escherichia coli strain C27A plasmid pC27A-3, complete sequence 115003-115037 7 0.8
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 194096-194130 7 0.8
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 194282-194316 7 0.8
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 194189-194223 7 0.8
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 3336-3370 7 0.8
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 216142-216176 7 0.8
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 204590-204624 7 0.8
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 204776-204810 7 0.8
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 204683-204717 7 0.8
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 3335-3369 7 0.8
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 226636-226670 7 0.8
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 195424-195458 7 0.8
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 195610-195644 7 0.8
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 195517-195551 7 0.8
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 3335-3369 7 0.8
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 217470-217504 7 0.8
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 176379-176413 7 0.8
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 176565-176599 7 0.8
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 176472-176506 7 0.8
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 3335-3369 7 0.8
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 198425-198459 7 0.8
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 64358-64392 7 0.8
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 22622-22656 7 0.8
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 MG065686 UNVERIFIED: Campylobacter phage A18a, complete genome 141030-141064 7 0.8
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP044147 Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2 7456-7490 7 0.8
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP044147 Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2 6708-6742 7 0.8
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 CP044351 Escherichia coli strain 194195 plasmid p194195_1, complete sequence 84280-84314 7 0.8
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 CP044351 Escherichia coli strain 194195 plasmid p194195_1, complete sequence 83554-83588 7 0.8
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_AP023207 Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence 28008-28042 7 0.8
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 6873-6907 7 0.8
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 MG065691 UNVERIFIED: Campylobacter phage A11a, complete genome 33059-33093 7 0.8
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 27282-27316 7 0.8
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 27381-27415 7 0.8
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP053721 Escherichia coli strain CP131_Sichuan plasmid pCP131-IncHI1, complete sequence 198909-198943 7 0.8
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP044299 Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence 91418-91452 7 0.8
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 MT230312 Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence 103-137 7 0.8
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP019246 Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence 40305-40339 7 0.8
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_AP023209 Escherichia coli strain TUM18781 plasmid pMTY18781-4, complete sequence 19403-19437 7 0.8
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 MT230112 Escherichia coli strain DH5alpha plasmid pESBL112, complete sequence 108-142 7 0.8
CP030919_6 6.1|2733472|32|CP030919|CRT 2733472-2733503 32 NZ_CP015038 Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence 112768-112799 7 0.781
CP030919_6 6.9|2733960|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733960-2733991 32 NZ_CP046125 Enterococcus casseliflavus strain EC291 plasmid unnamed2, complete sequence 84014-84045 7 0.781
CP030919_6 6.9|2733960|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733960-2733991 32 NZ_CP023514 Enterococcus sp. FDAARGOS_375 plasmid unnamed1, complete sequence 67383-67414 7 0.781
CP030919_6 6.9|2733960|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733960-2733991 32 NZ_CP023514 Enterococcus sp. FDAARGOS_375 plasmid unnamed1, complete sequence 128875-128906 7 0.781
CP030919_6 6.9|2733960|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733960-2733991 32 MK448232 Klebsiella phage ST147-VIM1phi7.2, complete genome 14360-14391 7 0.781
CP030919_6 6.9|2733960|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733960-2733991 32 MK422450 Klebsiella phage ST13-OXA48phi12.4, complete genome 12269-12300 7 0.781
CP030919_7 7.2|2758395|32|CP030919|CRISPRCasFinder,CRT 2758395-2758426 32 NZ_MG299151 Shigella sonnei strain SH287-2 plasmid pSH287-2, complete sequence 51276-51307 7 0.781
CP030919_7 7.2|2758395|32|CP030919|CRISPRCasFinder,CRT 2758395-2758426 32 NZ_KY471628 Shigella sonnei strain SH15sh99 plasmid pSH15sh99, complete sequence 45716-45747 7 0.781
CP030919_7 7.2|2758395|32|CP030919|CRISPRCasFinder,CRT 2758395-2758426 32 NZ_MG299131 Shigella sonnei strain SH271-2 plasmid pSH271-2, complete sequence 51276-51307 7 0.781
CP030919_7 7.2|2758395|32|CP030919|CRISPRCasFinder,CRT 2758395-2758426 32 NZ_KY471629 Shigella sonnei strain SH15sh105 plasmid pSH15sh104, complete sequence 45716-45747 7 0.781
CP030919_7 7.2|2758395|32|CP030919|CRISPRCasFinder,CRT 2758395-2758426 32 NZ_MG299133 Shigella sonnei strain SH272-2 plasmid pSH272-2, complete sequence 51276-51307 7 0.781
CP030919_7 7.2|2758395|32|CP030919|CRISPRCasFinder,CRT 2758395-2758426 32 NZ_MG299128 Shigella sonnei strain SH262-2 plasmid pSH262-2, complete sequence 51276-51307 7 0.781
CP030919_7 7.2|2758395|32|CP030919|CRISPRCasFinder,CRT 2758395-2758426 32 NZ_MG299147 Shigella sonnei strain SH284-2 plasmid pSH284-2, complete sequence 51276-51307 7 0.781
CP030919_7 7.2|2758395|32|CP030919|CRISPRCasFinder,CRT 2758395-2758426 32 NC_018995 Escherichia coli plasmid pHUSEC41-1, complete sequence 29015-29046 7 0.781
CP030919_7 7.2|2758395|32|CP030919|CRISPRCasFinder,CRT 2758395-2758426 32 NZ_CP053235 Escherichia coli strain SCU-106 plasmid pSCU-106-1, complete sequence 78292-78323 7 0.781
CP030919_7 7.2|2758395|32|CP030919|CRISPRCasFinder,CRT 2758395-2758426 32 NZ_CP005999 Escherichia coli B7A plasmid pEB1, complete sequence 39563-39594 7 0.781
CP030919_7 7.2|2758395|32|CP030919|CRISPRCasFinder,CRT 2758395-2758426 32 KU932021 Escherichia coli plasmid pEC3I, complete sequence 51902-51933 7 0.781
CP030919_7 7.2|2758395|32|CP030919|CRISPRCasFinder,CRT 2758395-2758426 32 NZ_CP024154 Escherichia coli strain 14EC033 plasmid p14EC033g, complete sequence 18560-18591 7 0.781
CP030919_7 7.2|2758395|32|CP030919|CRISPRCasFinder,CRT 2758395-2758426 32 NC_011754 Escherichia coli ED1a plasmid pECOED, complete sequence 49240-49271 7 0.781
CP030919_7 7.2|2758395|32|CP030919|CRISPRCasFinder,CRT 2758395-2758426 32 NZ_CP015141 Escherichia coli strain Ecol_732 plasmid pEC732_3, complete sequence 81434-81465 7 0.781
CP030919_7 7.2|2758395|32|CP030919|CRISPRCasFinder,CRT 2758395-2758426 32 NZ_LR213460 Shigella sonnei strain AUSMDU00008333 isolate AUSMDU00008333 plasmid 3 28916-28947 7 0.781
CP030919_7 7.2|2758395|32|CP030919|CRISPRCasFinder,CRT 2758395-2758426 32 NZ_MH287044 Escherichia coli strain 5.1-R1 plasmid pCERC6, complete sequence 36182-36213 7 0.781
CP030919_7 7.2|2758395|32|CP030919|CRISPRCasFinder,CRT 2758395-2758426 32 NZ_MH618673 Escherichia coli strain 838B plasmid p838B-R, complete sequence 32230-32261 7 0.781
CP030919_7 7.7|2758700|32|CP030919|CRISPRCasFinder,CRT 2758700-2758731 32 NZ_CP020471 Rhodobacter blasticus strain 28/5 plasmid pRsa, complete sequence 155620-155651 7 0.781
CP030919_7 7.7|2758700|32|CP030919|CRISPRCasFinder,CRT 2758700-2758731 32 NZ_LN907829 Erwinia gerundensis isolate E_g_EM595 plasmid pEM02, complete sequence 28526-28557 7 0.781
CP030919_7 7.7|2758700|32|CP030919|CRISPRCasFinder,CRT 2758700-2758731 32 KU708004 Pseudomonas phage phiAH14a, complete genome 25584-25615 7 0.781
CP030919_7 7.12|2759005|32|CP030919|CRISPRCasFinder,CRT 2759005-2759036 32 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 2048602-2048633 7 0.781
CP030919_7 7.15|2758396|32|CP030919|PILER-CR 2758396-2758427 32 NZ_MG299151 Shigella sonnei strain SH287-2 plasmid pSH287-2, complete sequence 51276-51307 7 0.781
CP030919_7 7.15|2758396|32|CP030919|PILER-CR 2758396-2758427 32 NZ_KY471628 Shigella sonnei strain SH15sh99 plasmid pSH15sh99, complete sequence 45716-45747 7 0.781
CP030919_7 7.15|2758396|32|CP030919|PILER-CR 2758396-2758427 32 NZ_MG299131 Shigella sonnei strain SH271-2 plasmid pSH271-2, complete sequence 51276-51307 7 0.781
CP030919_7 7.15|2758396|32|CP030919|PILER-CR 2758396-2758427 32 NZ_KY471629 Shigella sonnei strain SH15sh105 plasmid pSH15sh104, complete sequence 45716-45747 7 0.781
CP030919_7 7.15|2758396|32|CP030919|PILER-CR 2758396-2758427 32 NZ_MG299133 Shigella sonnei strain SH272-2 plasmid pSH272-2, complete sequence 51276-51307 7 0.781
CP030919_7 7.15|2758396|32|CP030919|PILER-CR 2758396-2758427 32 NZ_MG299128 Shigella sonnei strain SH262-2 plasmid pSH262-2, complete sequence 51276-51307 7 0.781
CP030919_7 7.15|2758396|32|CP030919|PILER-CR 2758396-2758427 32 NZ_MG299147 Shigella sonnei strain SH284-2 plasmid pSH284-2, complete sequence 51276-51307 7 0.781
CP030919_7 7.15|2758396|32|CP030919|PILER-CR 2758396-2758427 32 NC_018995 Escherichia coli plasmid pHUSEC41-1, complete sequence 29015-29046 7 0.781
CP030919_7 7.15|2758396|32|CP030919|PILER-CR 2758396-2758427 32 NZ_CP053235 Escherichia coli strain SCU-106 plasmid pSCU-106-1, complete sequence 78292-78323 7 0.781
CP030919_7 7.15|2758396|32|CP030919|PILER-CR 2758396-2758427 32 NZ_CP005999 Escherichia coli B7A plasmid pEB1, complete sequence 39563-39594 7 0.781
CP030919_7 7.15|2758396|32|CP030919|PILER-CR 2758396-2758427 32 KU932021 Escherichia coli plasmid pEC3I, complete sequence 51902-51933 7 0.781
CP030919_7 7.15|2758396|32|CP030919|PILER-CR 2758396-2758427 32 NZ_CP024154 Escherichia coli strain 14EC033 plasmid p14EC033g, complete sequence 18560-18591 7 0.781
CP030919_7 7.15|2758396|32|CP030919|PILER-CR 2758396-2758427 32 NC_011754 Escherichia coli ED1a plasmid pECOED, complete sequence 49240-49271 7 0.781
CP030919_7 7.15|2758396|32|CP030919|PILER-CR 2758396-2758427 32 NZ_CP015141 Escherichia coli strain Ecol_732 plasmid pEC732_3, complete sequence 81434-81465 7 0.781
CP030919_7 7.15|2758396|32|CP030919|PILER-CR 2758396-2758427 32 NZ_LR213460 Shigella sonnei strain AUSMDU00008333 isolate AUSMDU00008333 plasmid 3 28916-28947 7 0.781
CP030919_7 7.15|2758396|32|CP030919|PILER-CR 2758396-2758427 32 NZ_MH287044 Escherichia coli strain 5.1-R1 plasmid pCERC6, complete sequence 36182-36213 7 0.781
CP030919_7 7.15|2758396|32|CP030919|PILER-CR 2758396-2758427 32 NZ_MH618673 Escherichia coli strain 838B plasmid p838B-R, complete sequence 32230-32261 7 0.781
CP030919_7 7.20|2758701|32|CP030919|PILER-CR 2758701-2758732 32 NZ_CP020471 Rhodobacter blasticus strain 28/5 plasmid pRsa, complete sequence 155620-155651 7 0.781
CP030919_7 7.20|2758701|32|CP030919|PILER-CR 2758701-2758732 32 NZ_LN907829 Erwinia gerundensis isolate E_g_EM595 plasmid pEM02, complete sequence 28526-28557 7 0.781
CP030919_7 7.20|2758701|32|CP030919|PILER-CR 2758701-2758732 32 KU708004 Pseudomonas phage phiAH14a, complete genome 25584-25615 7 0.781
CP030919_7 7.25|2759006|32|CP030919|PILER-CR 2759006-2759037 32 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 2048602-2048633 7 0.781
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 397088-397122 8 0.771
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 386522-386556 8 0.771
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP044308 Escherichia coli strain C27A plasmid pC27A-3, complete sequence 56045-56079 8 0.771
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP044308 Escherichia coli strain C27A plasmid pC27A-3, complete sequence 111818-111852 8 0.771
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP019906 Escherichia coli strain MDR_56 plasmid unnamed5, complete sequence 17871-17905 8 0.771
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 108-142 8 0.771
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 107-141 8 0.771
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 107-141 8 0.771
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 107-141 8 0.771
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_AP023207 Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence 31313-31347 8 0.771
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP044307 Escherichia coli strain C27A plasmid pC27A-2, complete sequence 18285-18319 8 0.771
CP030919_6 6.1|2733472|32|CP030919|CRT 2733472-2733503 32 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 1428097-1428128 8 0.75
CP030919_7 7.3|2758456|32|CP030919|CRISPRCasFinder,CRT 2758456-2758487 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1417960-1417991 8 0.75
CP030919_7 7.7|2758700|32|CP030919|CRISPRCasFinder,CRT 2758700-2758731 32 NZ_CP017750 Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence 63953-63984 8 0.75
CP030919_7 7.7|2758700|32|CP030919|CRISPRCasFinder,CRT 2758700-2758731 32 NZ_CP046332 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed2 75510-75541 8 0.75
CP030919_7 7.7|2758700|32|CP030919|CRISPRCasFinder,CRT 2758700-2758731 32 NZ_CP026545 Cupriavidus metallidurans strain Ni-2 plasmid unnamed1 22157-22188 8 0.75
CP030919_7 7.7|2758700|32|CP030919|CRISPRCasFinder,CRT 2758700-2758731 32 NC_020548 Azoarcus sp. KH32C plasmid pAZKH, complete sequence 612307-612338 8 0.75
CP030919_7 7.7|2758700|32|CP030919|CRISPRCasFinder,CRT 2758700-2758731 32 NC_006466 Cupriavidus metallidurans CH34 plasmid pMOL30, complete sequence 113480-113511 8 0.75
CP030919_7 7.7|2758700|32|CP030919|CRISPRCasFinder,CRT 2758700-2758731 32 NC_022001 Streptomyces collinus Tu 365 plasmid pSCO1, complete sequence 36018-36049 8 0.75
CP030919_7 7.16|2758457|32|CP030919|PILER-CR 2758457-2758488 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1417960-1417991 8 0.75
CP030919_7 7.20|2758701|32|CP030919|PILER-CR 2758701-2758732 32 NZ_CP017750 Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence 63953-63984 8 0.75
CP030919_7 7.20|2758701|32|CP030919|PILER-CR 2758701-2758732 32 NZ_CP046332 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed2 75510-75541 8 0.75
CP030919_7 7.20|2758701|32|CP030919|PILER-CR 2758701-2758732 32 NZ_CP026545 Cupriavidus metallidurans strain Ni-2 plasmid unnamed1 22157-22188 8 0.75
CP030919_7 7.20|2758701|32|CP030919|PILER-CR 2758701-2758732 32 NC_020548 Azoarcus sp. KH32C plasmid pAZKH, complete sequence 612307-612338 8 0.75
CP030919_7 7.20|2758701|32|CP030919|PILER-CR 2758701-2758732 32 NC_006466 Cupriavidus metallidurans CH34 plasmid pMOL30, complete sequence 113480-113511 8 0.75
CP030919_7 7.20|2758701|32|CP030919|PILER-CR 2758701-2758732 32 NC_022001 Streptomyces collinus Tu 365 plasmid pSCO1, complete sequence 36018-36049 8 0.75
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 MG065686 UNVERIFIED: Campylobacter phage A18a, complete genome 74476-74510 9 0.743
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 MG065686 UNVERIFIED: Campylobacter phage A18a, complete genome 6914-6948 9 0.743
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_AP023207 Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence 21767-21801 9 0.743
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 MG065691 UNVERIFIED: Campylobacter phage A11a, complete genome 99613-99647 9 0.743
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 MG065691 UNVERIFIED: Campylobacter phage A11a, complete genome 167175-167209 9 0.743
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 30213-30247 9 0.743
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229083-229131 9 0.816
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229184-229232 9 0.816
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229285-229333 9 0.816
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239577-239625 9 0.816
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239678-239726 9 0.816
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239779-239827 9 0.816
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230489-230537 9 0.816
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230590-230638 9 0.816
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230691-230739 9 0.816
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211459-211507 9 0.816
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211560-211608 9 0.816
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211661-211709 9 0.816
CP030919_6 6.1|2733472|32|CP030919|CRT 2733472-2733503 32 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 141278-141309 9 0.719
CP030919_6 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733594-2733625 32 MG065682 UNVERIFIED: Campylobacter phage A112b, complete genome 28803-28834 9 0.719
CP030919_6 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733594-2733625 32 LN881735 Escherichia phage slur12, complete genome 99901-99932 9 0.719
CP030919_6 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733594-2733625 32 MG065659 UNVERIFIED: Campylobacter phage C5, complete genome 72598-72629 9 0.719
CP030919_6 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733594-2733625 32 LR597647 Escherichia phage rV5_ev147 genome assembly, chromosome: 1 7892-7923 9 0.719
CP030919_6 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733594-2733625 32 MG065661 UNVERIFIED: Campylobacter phage C9, complete genome 87324-87355 9 0.719
CP030919_6 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733594-2733625 32 MG065655 UNVERIFIED: Campylobacter phage C2, complete genome 111970-112001 9 0.719
CP030919_6 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733594-2733625 32 MN850646 Escherichia phage nom, complete genome 6794-6825 9 0.719
CP030919_6 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733594-2733625 32 KR698074 Escherichia phage APCEc02, complete genome 130018-130049 9 0.719
CP030919_6 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733594-2733625 32 MG065666 UNVERIFIED: Campylobacter phage A12a, complete genome 107359-107390 9 0.719
CP030919_6 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733594-2733625 32 MK883717 Eschericha phage vB_EcoM-ECP26, complete genome 23242-23273 9 0.719
CP030919_6 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733594-2733625 32 LR694165 Escherichia phage rV5_ev156 genome assembly, chromosome: 1 7892-7923 9 0.719
CP030919_6 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733594-2733625 32 MG963916 Escherichia phage PDX, complete genome 14456-14487 9 0.719
CP030919_6 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733594-2733625 32 KP869102 Escherichia coli O157 typing phage 4, partial genome 34218-34249 9 0.719
CP030919_6 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733594-2733625 32 MG065658 UNVERIFIED: Campylobacter phage C7, complete genome 7788-7819 9 0.719
CP030919_6 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733594-2733625 32 NC_028248 Escherichia phage slur16, complete genome 41839-41870 9 0.719
CP030919_6 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733594-2733625 32 MG065654 UNVERIFIED: Campylobacter phage C15, complete genome 107386-107417 9 0.719
CP030919_6 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733594-2733625 32 MN850642 Escherichia phage navn, complete genome 125737-125768 9 0.719
CP030919_6 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733594-2733625 32 MK883718 Escherichia phage vB_EcoM-ECP32, complete genome 7836-7867 9 0.719
CP030919_6 6.7|2733838|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733838-2733869 32 NZ_CP034185 Deinococcus sp. S14-83 strain S14-83T plasmid unnamed1, complete sequence 234520-234551 9 0.719
CP030919_7 7.7|2758700|32|CP030919|CRISPRCasFinder,CRT 2758700-2758731 32 CP009871 Pantoea sp. PSNIH2 plasmid pPSP-cd6, complete sequence 57198-57229 9 0.719
CP030919_7 7.7|2758700|32|CP030919|CRISPRCasFinder,CRT 2758700-2758731 32 NZ_HG938356 Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence 525527-525558 9 0.719
CP030919_7 7.7|2758700|32|CP030919|CRISPRCasFinder,CRT 2758700-2758731 32 NZ_CP032704 Pantoea dispersa strain DSM 32899 plasmid unnamed2, complete sequence 75841-75872 9 0.719
CP030919_7 7.7|2758700|32|CP030919|CRISPRCasFinder,CRT 2758700-2758731 32 NC_016586 Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence 289058-289089 9 0.719
CP030919_7 7.13|2759066|32|CP030919|CRISPRCasFinder,CRT 2759066-2759097 32 NC_007105 Bacillus cereus E33L plasmid pE33L54, complete sequence 9931-9962 9 0.719
CP030919_7 7.13|2759066|32|CP030919|CRISPRCasFinder,CRT 2759066-2759097 32 NZ_CP009966 Bacillus cereus E33L plasmid pBCO_2, complete sequence 10500-10531 9 0.719
CP030919_7 7.20|2758701|32|CP030919|PILER-CR 2758701-2758732 32 CP009871 Pantoea sp. PSNIH2 plasmid pPSP-cd6, complete sequence 57198-57229 9 0.719
CP030919_7 7.20|2758701|32|CP030919|PILER-CR 2758701-2758732 32 NZ_HG938356 Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence 525527-525558 9 0.719
CP030919_7 7.20|2758701|32|CP030919|PILER-CR 2758701-2758732 32 NZ_CP032704 Pantoea dispersa strain DSM 32899 plasmid unnamed2, complete sequence 75841-75872 9 0.719
CP030919_7 7.20|2758701|32|CP030919|PILER-CR 2758701-2758732 32 NC_016586 Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence 289058-289089 9 0.719
CP030919_7 7.26|2759067|32|CP030919|PILER-CR 2759067-2759098 32 NC_007105 Bacillus cereus E33L plasmid pE33L54, complete sequence 9931-9962 9 0.719
CP030919_7 7.26|2759067|32|CP030919|PILER-CR 2759067-2759098 32 NZ_CP009966 Bacillus cereus E33L plasmid pBCO_2, complete sequence 10500-10531 9 0.719
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 MG065686 UNVERIFIED: Campylobacter phage A18a, complete genome 9677-9711 10 0.714
CP030919_3 3.1|1989027|35|CP030919|CRISPRCasFinder 1989027-1989061 35 MG065691 UNVERIFIED: Campylobacter phage A11a, complete genome 164412-164446 10 0.714
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229386-229434 10 0.796
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239880-239928 10 0.796
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230792-230840 10 0.796
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211762-211810 10 0.796
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_CP044147 Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2 7442-7490 10 0.796
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 CP044351 Escherichia coli strain 194195 plasmid p194195_1, complete sequence 84266-84314 10 0.796
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 386508-386556 10 0.796
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 14196-14244 10 0.796
CP030919_6 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733594-2733625 32 MG065677 UNVERIFIED: Campylobacter phage A13b, complete genome 39950-39981 10 0.688
CP030919_6 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733594-2733625 32 KP869112 Escherichia coli O157 typing phage 14, partial genome 125490-125521 10 0.688
CP030919_6 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733594-2733625 32 MK962749 Shigella phage CM1, complete genome 7839-7870 10 0.688
CP030919_6 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733594-2733625 32 MN850597 Escherichia phage isim, complete genome 41361-41392 10 0.688
CP030919_6 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733594-2733625 32 MN850578 Escherichia phage nomo, complete genome 14950-14981 10 0.688
CP030919_6 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733594-2733625 32 MN850626 Escherichia phage nimi, complete genome 75467-75498 10 0.688
CP030919_6 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733594-2733625 32 MG065644 UNVERIFIED: Campylobacter phage A147, complete genome 30845-30876 10 0.688
CP030919_6 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733594-2733625 32 MN850612 Escherichia phage magaca, complete genome 98013-98044 10 0.688
CP030919_6 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733594-2733625 32 LR699804 Escherichia phage rV5_ev146 genome assembly, chromosome: 1 9065-9096 10 0.688
CP030919_6 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733594-2733625 32 MG065647 UNVERIFIED: Campylobacter phage D#, complete genome 90009-90040 10 0.688
CP030919_6 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733594-2733625 32 NC_011041 Escherichia coli bacteriophage rv5, complete sequence 7837-7868 10 0.688
CP030919_6 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733594-2733625 32 MG065646 UNVERIFIED: Campylobacter phage D1, complete genome 122968-122999 10 0.688
CP030919_6 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733594-2733625 32 NC_022323 Escherichia phage 2 JES-2013, complete genome 7837-7868 10 0.688
CP030919_6 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733594-2733625 32 MG065635 UNVERIFIED: Campylobacter phage C12, complete genome 40854-40885 10 0.688
CP030919_6 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733594-2733625 32 MH752840 Escherichia phage vB_EcoM-Pr121LW, complete genome 96164-96195 10 0.688
CP030919_6 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733594-2733625 32 MG065674 UNVERIFIED: Campylobacter phage A140, complete genome 6285-6316 10 0.688
CP030919_6 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733594-2733625 32 KP869103 Escherichia coli O157 typing phage 5, complete genome 32688-32719 10 0.688
CP030919_6 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733594-2733625 32 MK373780 Escherichia phage vB_EcoM_HdK5, complete genome 39965-39996 10 0.688
CP030919_6 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733594-2733625 32 MG065662 UNVERIFIED: Campylobacter phage A142, complete genome 47401-47432 10 0.688
CP030919_6 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733594-2733625 32 MK327930 Escherichia phage EdH4, complete genome 39236-39267 10 0.688
CP030919_6 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733594-2733625 32 MG065672 UNVERIFIED: Campylobacter phage A141, complete genome 58568-58599 10 0.688
CP030919_6 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733594-2733625 32 MG065690 UNVERIFIED: Campylobacter phage A135, complete genome 49331-49362 10 0.688
CP030919_6 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733594-2733625 32 KT001917 Escherichia phage Murica, complete genome 7838-7869 10 0.688
CP030919_6 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733594-2733625 32 MN850627 Escherichia phage pangalan, complete genome 132490-132521 10 0.688
CP030919_6 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733594-2733625 32 MN850649 Escherichia phage nomine, complete genome 52411-52442 10 0.688
CP030919_6 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733594-2733625 32 MN850595 Escherichia phage naswa, complete genome 69467-69498 10 0.688
CP030919_6 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder 2733594-2733625 32 MN850576 Escherichia phage ime, complete genome 88668-88699 10 0.688
CP030919_7 7.7|2758700|32|CP030919|CRISPRCasFinder,CRT 2758700-2758731 32 NZ_HG938354 Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence 485869-485900 10 0.688
CP030919_7 7.7|2758700|32|CP030919|CRISPRCasFinder,CRT 2758700-2758731 32 NZ_CP031159 Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdA, complete sequence 103512-103543 10 0.688
CP030919_7 7.20|2758701|32|CP030919|PILER-CR 2758701-2758732 32 NZ_HG938354 Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence 485869-485900 10 0.688
CP030919_7 7.20|2758701|32|CP030919|PILER-CR 2758701-2758732 32 NZ_CP031159 Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdA, complete sequence 103512-103543 10 0.688
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 194003-194051 11 0.776
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 194096-194144 11 0.776
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 194282-194330 11 0.776
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 204497-204545 11 0.776
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 204590-204638 11 0.776
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 204776-204824 11 0.776
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 195331-195379 11 0.776
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 195424-195472 11 0.776
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 195610-195658 11 0.776
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 176286-176334 11 0.776
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 176379-176427 11 0.776
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 176565-176613 11 0.776
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 27282-27330 11 0.776
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 27381-27429 11 0.776
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 51834-51882 11 0.776
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_AP023209 Escherichia coli strain TUM18781 plasmid pMTY18781-4, complete sequence 19389-19437 11 0.776
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 211730-211778 12 0.755
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 211930-211978 12 0.755
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 194189-194237 12 0.755
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 222224-222272 12 0.755
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 222424-222472 12 0.755
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 204683-204731 12 0.755
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 213058-213106 12 0.755
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 213258-213306 12 0.755
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 195517-195565 12 0.755
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 194013-194061 12 0.755
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 194213-194261 12 0.755
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 176472-176520 12 0.755
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 11511-11559 12 0.755
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 397088-397136 12 0.755
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 404133-404181 12 0.755
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_AP023207 Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence 27994-28042 12 0.755
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_AP023207 Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence 31299-31347 12 0.755
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 MG065691 UNVERIFIED: Campylobacter phage A11a, complete genome 33059-33107 12 0.755
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 MG065686 UNVERIFIED: Campylobacter phage A18a, complete genome 141016-141064 12 0.755
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 MF374379 Escherichia phage DN1, complete genome 31158-31206 12 0.755
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 14105-14153 13 0.735
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 6859-6907 13 0.735
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NC_049343 Escherichia phage 500465-2, complete genome 31797-31845 13 0.735
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 MT230112 Escherichia coli strain DH5alpha plasmid pESBL112, complete sequence 94-142 13 0.735
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 82842-82890 14 0.714
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 313592-313640 14 0.714
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 MG065691 UNVERIFIED: Campylobacter phage A11a, complete genome 63889-63937 14 0.714
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 MG065686 UNVERIFIED: Campylobacter phage A18a, complete genome 110186-110234 14 0.714
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_CP053721 Escherichia coli strain CP131_Sichuan plasmid pCP131-IncHI1, complete sequence 198909-198957 14 0.714
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_CP019246 Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence 40305-40353 14 0.714
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_CP044299 Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence 91418-91466 14 0.714
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 102544-102592 15 0.694
CP030919_4 4.1|2208214|49|CP030919|CRISPRCasFinder 2208214-2208262 49 NZ_CP044308 Escherichia coli strain C27A plasmid pC27A-3, complete sequence 56031-56079 15 0.694

1. spacer 2.1|1323554|38|CP030919|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

2. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 2, identity: 0.943

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcaaccagc	Protospacer
**************************.**.*****

3. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 3, identity: 0.914

cggataaggcgttcacgccgcatccgacagccagc-	CRISPR spacer
cggataaggcgtttacgccgcatccggca-ccagct	Protospacer
*************.************.** ***** 

4. spacer 6.1|2733472|32|CP030919|CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 3, identity: 0.906

taagtgatatccatcatcgcatccagtgcgcc	CRISPR spacer
caagtgatgtccatcatcgcatccagtgcgtc	Protospacer
.*******.*********************.*

5. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to MG065686 (UNVERIFIED: Campylobacter phage A18a, complete genome) position: , mismatch: 4, identity: 0.886

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcaagaagc	Protospacer
**************************.**.  ***

6. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to MG065691 (UNVERIFIED: Campylobacter phage A11a, complete genome) position: , mismatch: 4, identity: 0.886

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcaagaagc	Protospacer
**************************.**.  ***

7. spacer 6.5|2733716|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to JF974294 (Aeromonas phage pIS4-A genomic sequence) position: , mismatch: 4, identity: 0.875

cacgccatcaacctcaaaccgcaaatcaacgt	CRISPR spacer
tcggccatctacctcaaaccgcaaatcaacgt	Protospacer
.  ****** **********************

8. spacer 6.5|2733716|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to NC_021534 (Vibrio phage pYD38-A genomic sequence) position: , mismatch: 4, identity: 0.875

cacgccatcaacctcaaaccgcaaatcaacgt	CRISPR spacer
tcggccatctacctcaaaccgcaaatcaacgt	Protospacer
.  ****** **********************

9. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 5, identity: 0.857

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgtttacgccgcatccgacatcaacg	Protospacer
*************.*************** * *  

10. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 5, identity: 0.857

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgtttacgccgcatccgacatcaatg	Protospacer
*************.*************** * *  

11. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 5, identity: 0.857

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgtttacgccgcatccggcaatcaac	Protospacer
*************.************.**..**.*

12. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 5, identity: 0.857

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccgacagtgcat	Protospacer
******************************.  ..

13. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 5, identity: 0.857

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcattcggt	Protospacer
**************************.** .*.*.

14. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 5, identity: 0.857

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgtttacgccgcatccggcaaaaagc	Protospacer
*************.************.**.  ***

15. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP044308 (Escherichia coli strain C27A plasmid pC27A-3, complete sequence) position: , mismatch: 5, identity: 0.857

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccgacaaaccat	Protospacer
*****************************. * ..

16. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 5, identity: 0.857

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcagtcgtg	Protospacer
**************************.***.*.  

17. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 5, identity: 0.857

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcagtcgtg	Protospacer
**************************.***.*.  

18. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 5, identity: 0.857

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcagtcgtg	Protospacer
**************************.***.*.  

19. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 5, identity: 0.857

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcagtcgtg	Protospacer
**************************.***.*.  

20. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 5, identity: 0.857

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcagtcgtg	Protospacer
**************************.***.*.  

21. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 5, identity: 0.857

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcagtcgtg	Protospacer
**************************.***.*.  

22. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 5, identity: 0.857

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcagtcgtg	Protospacer
**************************.***.*.  

23. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 5, identity: 0.857

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcagtcgtg	Protospacer
**************************.***.*.  

24. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 5, identity: 0.857

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcagtcgtg	Protospacer
**************************.***.*.  

25. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 5, identity: 0.857

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcagtcgtg	Protospacer
**************************.***.*.  

26. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 5, identity: 0.857

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcagtcgtg	Protospacer
**************************.***.*.  

27. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 5, identity: 0.857

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcagtcgtg	Protospacer
**************************.***.*.  

28. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 5, identity: 0.857

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgtccacgccgcatccgacagtcgag	Protospacer
************.*****************.*.. 

29. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NC_049343 (Escherichia phage 500465-2, complete genome) position: , mismatch: 5, identity: 0.857

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcaaacact	Protospacer
**************************.**. ** .

30. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 5, identity: 0.857

cggataaggcgttcacgccgcatccgac-agccagc	CRISPR spacer
cggataaggcgtttacgccgcatccggcaagtccg-	Protospacer
*************.************.* **.* * 

31. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_AP023209 (Escherichia coli strain TUM18781 plasmid pMTY18781-4, complete sequence) position: , mismatch: 5, identity: 0.857

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgctcgcgccgcatccgacaccgtgc	Protospacer
***********.**.************** *  **

32. spacer 6.5|2733716|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to NC_013059 (Salmonella phage c341, complete genome) position: , mismatch: 5, identity: 0.844

cacgccatcaacctcaaaccgcaaatcaacgt	CRISPR spacer
aacgccatcaacttcaaaccgcaaatcgatat	Protospacer
 ***********.**************.*..*

33. spacer 6.5|2733716|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to FJ000341 (Salmonella phage g341c, complete genome) position: , mismatch: 5, identity: 0.844

cacgccatcaacctcaaaccgcaaatcaacgt	CRISPR spacer
aacgccatcaacttcaaaccgcaaatcgatat	Protospacer
 ***********.**************.*..*

34. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 6, identity: 0.829

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccgacacggtat	Protospacer
*****************************    ..

35. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 6, identity: 0.829

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccgacatttgca	Protospacer
***************************** ...  

36. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 6, identity: 0.829

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcaaaaatt	Protospacer
**************************.**.  * .

37. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 6, identity: 0.829

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcattttac	Protospacer
**************************.** .. .*

38. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 6, identity: 0.829

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcattgact	Protospacer
**************************.** . * .

39. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP044308 (Escherichia coli strain C27A plasmid pC27A-3, complete sequence) position: , mismatch: 6, identity: 0.829

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcagttgtg	Protospacer
**************************.***...  

40. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP019906 (Escherichia coli strain MDR_56 plasmid unnamed5, complete sequence) position: , mismatch: 6, identity: 0.829

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccgacaaaacat	Protospacer
*****************************.   ..

41. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 6, identity: 0.829

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcagttgtg	Protospacer
**************************.***...  

42. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 6, identity: 0.829

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcatgaaca	Protospacer
**************************.**   *  

43. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 6, identity: 0.829

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcataaact	Protospacer
**************************.**   * .

44. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 6, identity: 0.829

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcataaact	Protospacer
**************************.**   * .

45. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 6, identity: 0.829

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgtttacgccgcatccggcagtcgtg	Protospacer
*************.************.***.*.  

46. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 6, identity: 0.829

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcagttgtg	Protospacer
**************************.***...  

47. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 6, identity: 0.829

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcatgaaca	Protospacer
**************************.**   *  

48. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 6, identity: 0.829

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcataaact	Protospacer
**************************.**   * .

49. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 6, identity: 0.829

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcataaact	Protospacer
**************************.**   * .

50. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 6, identity: 0.829

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgtttacgccgcatccggcagtcgtg	Protospacer
*************.************.***.*.  

51. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 6, identity: 0.829

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcagttgtg	Protospacer
**************************.***...  

52. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 6, identity: 0.829

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcatgaaca	Protospacer
**************************.**   *  

53. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 6, identity: 0.829

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcataaact	Protospacer
**************************.**   * .

54. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 6, identity: 0.829

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcataaact	Protospacer
**************************.**   * .

55. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 6, identity: 0.829

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgtttacgccgcatccggcagtcgtg	Protospacer
*************.************.***.*.  

56. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 6, identity: 0.829

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcagttgtg	Protospacer
**************************.***...  

57. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 6, identity: 0.829

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcatgaaca	Protospacer
**************************.**   *  

58. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 6, identity: 0.829

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcataaact	Protospacer
**************************.**   * .

59. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 6, identity: 0.829

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcataaact	Protospacer
**************************.**   * .

60. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 6, identity: 0.829

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgtttacgccgcatccggcagtcgtg	Protospacer
*************.************.***.*.  

61. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 6, identity: 0.829

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcaaaaaca	Protospacer
**************************.**.  *  

62. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 6, identity: 0.829

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgtccacgccgcatccggcgttcggc	Protospacer
************.*************.*. .*.**

63. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to MF374379 (Escherichia phage DN1, complete genome) position: , mismatch: 6, identity: 0.829

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcataaaca	Protospacer
**************************.**   *  

64. spacer 7.7|2758700|32|CP030919|CRISPRCasFinder,CRT matches to NZ_AP019198 (Aeromonas caviae strain GSH8M-1 plasmid pGSH8M-1-3, complete sequence) position: , mismatch: 6, identity: 0.812

cacgacgggcaggcgatcaccggcatgaccca	CRISPR spacer
cacgacgggcaggcgctcaccggccggaagct	Protospacer
*************** ********  **  * 

65. spacer 7.7|2758700|32|CP030919|CRISPRCasFinder,CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.812

cacgacgggcaggcgatcaccggc-atgaccca	CRISPR spacer
cacgacgggcaggcggtcacctgcgacgactt-	Protospacer
***************.***** ** *.***.. 

66. spacer 7.7|2758700|32|CP030919|CRISPRCasFinder,CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 6, identity: 0.812

cacgacgggcaggcgatcaccggc-atgaccca	CRISPR spacer
cacgacgggcaggcggtcacctgcgacgactt-	Protospacer
***************.***** ** *.***.. 

67. spacer 7.7|2758700|32|CP030919|CRISPRCasFinder,CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.812

cacgacgggcaggcgatcaccggc-atgaccca	CRISPR spacer
cacgacgggcaggcggtcacctgcgacgactt-	Protospacer
***************.***** ** *.***.. 

68. spacer 7.20|2758701|32|CP030919|PILER-CR matches to NZ_AP019198 (Aeromonas caviae strain GSH8M-1 plasmid pGSH8M-1-3, complete sequence) position: , mismatch: 6, identity: 0.812

cacgacgggcaggcgatcaccggcatgaccca	CRISPR spacer
cacgacgggcaggcgctcaccggccggaagct	Protospacer
*************** ********  **  * 

69. spacer 7.20|2758701|32|CP030919|PILER-CR matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.812

cacgacgggcaggcgatcaccggc-atgaccca	CRISPR spacer
cacgacgggcaggcggtcacctgcgacgactt-	Protospacer
***************.***** ** *.***.. 

70. spacer 7.20|2758701|32|CP030919|PILER-CR matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 6, identity: 0.812

cacgacgggcaggcgatcaccggc-atgaccca	CRISPR spacer
cacgacgggcaggcggtcacctgcgacgactt-	Protospacer
***************.***** ** *.***.. 

71. spacer 7.20|2758701|32|CP030919|PILER-CR matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.812

cacgacgggcaggcgatcaccggc-atgaccca	CRISPR spacer
cacgacgggcaggcggtcacctgcgacgactt-	Protospacer
***************.***** ** *.***.. 

72. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 7, identity: 0.8

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcaattgtg	Protospacer
**************************.**....  

73. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 7, identity: 0.8

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggtatgaacg	Protospacer
**************************..*   *  

74. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 7, identity: 0.8

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgtttacgccgcatccggcaagaaaa	Protospacer
*************.************.**.  *. 

75. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 7, identity: 0.8

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgtttacgccgcatccggcattttgt	Protospacer
*************.************.** .. *.

76. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP044308 (Escherichia coli strain C27A plasmid pC27A-3, complete sequence) position: , mismatch: 7, identity: 0.8

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgtttacgccgcatccggcagtggtg	Protospacer
*************.************.***. .  

77. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 7, identity: 0.8

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcaatggtg	Protospacer
**************************.**.. .  

78. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 7, identity: 0.8

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcaatggtg	Protospacer
**************************.**.. .  

79. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 7, identity: 0.8

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgtccacgccgcatccggcagtggtg	Protospacer
************.*************.***. .  

80. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 7, identity: 0.8

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgtttacgccgcatccggcagttgta	Protospacer
*************.************.***...  

81. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 7, identity: 0.8

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgctcgcgccgcatccgacattgatt	Protospacer
***********.**.************** . * .

82. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 7, identity: 0.8

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcaatggtg	Protospacer
**************************.**.. .  

83. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 7, identity: 0.8

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcaatggtg	Protospacer
**************************.**.. .  

84. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 7, identity: 0.8

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgtccacgccgcatccggcagtggtg	Protospacer
************.*************.***. .  

85. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 7, identity: 0.8

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgtttacgccgcatccggcagttgta	Protospacer
*************.************.***...  

86. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 7, identity: 0.8

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgctcgcgccgcatccgacattgatt	Protospacer
***********.**.************** . * .

87. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 7, identity: 0.8

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcaatggtg	Protospacer
**************************.**.. .  

88. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 7, identity: 0.8

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcaatggtg	Protospacer
**************************.**.. .  

89. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 7, identity: 0.8

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgtccacgccgcatccggcagtggtg	Protospacer
************.*************.***. .  

90. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 7, identity: 0.8

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgtttacgccgcatccggcagttgta	Protospacer
*************.************.***...  

91. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 7, identity: 0.8

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgctcgcgccgcatccgacattgatt	Protospacer
***********.**.************** . * .

92. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 7, identity: 0.8

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcaatggtg	Protospacer
**************************.**.. .  

93. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 7, identity: 0.8

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcaatggtg	Protospacer
**************************.**.. .  

94. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 7, identity: 0.8

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgtccacgccgcatccggcagtggtg	Protospacer
************.*************.***. .  

95. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 7, identity: 0.8

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgtttacgccgcatccggcagttgta	Protospacer
*************.************.***...  

96. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 7, identity: 0.8

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgctcgcgccgcatccgacattgatt	Protospacer
***********.**.************** . * .

97. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 7, identity: 0.8

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcgttcgtg	Protospacer
**************************.*. .*.  

98. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 7, identity: 0.8

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggaaaaggcgttcacgccgcatccggccactttc	Protospacer
**** *********************.* .*.  *

99. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to MG065686 (UNVERIFIED: Campylobacter phage A18a, complete genome) position: , mismatch: 7, identity: 0.8

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggatcaggcgttcacgccgcatccggcaaagtgt	Protospacer
***** ********************.**.   *.

100. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP044147 (Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2) position: , mismatch: 7, identity: 0.8

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcaattgtg	Protospacer
**************************.**....  

101. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP044147 (Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2) position: , mismatch: 7, identity: 0.8

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcattcacgccgcatccggcagttgtg	Protospacer
**********.***************.***...  

102. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to CP044351 (Escherichia coli strain 194195 plasmid p194195_1, complete sequence) position: , mismatch: 7, identity: 0.8

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcaattgtg	Protospacer
**************************.**....  

103. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to CP044351 (Escherichia coli strain 194195 plasmid p194195_1, complete sequence) position: , mismatch: 7, identity: 0.8

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcattcacgccgcatccggcagttgtg	Protospacer
**********.***************.***...  

104. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_AP023207 (Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence) position: , mismatch: 7, identity: 0.8

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcatttgag	Protospacer
**************************.** .... 

105. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 7, identity: 0.8

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcaaaacaa	Protospacer
**************************.**.   . 

106. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to MG065691 (UNVERIFIED: Campylobacter phage A11a, complete genome) position: , mismatch: 7, identity: 0.8

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggatcaggcgttcacgccgcatccggcaaagtgt	Protospacer
***** ********************.**.   *.

107. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 7, identity: 0.8

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcggttgtg	Protospacer
**************************.*.*...  

108. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 7, identity: 0.8

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcggttgtg	Protospacer
**************************.*.*...  

109. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP053721 (Escherichia coli strain CP131_Sichuan plasmid pCP131-IncHI1, complete sequence) position: , mismatch: 7, identity: 0.8

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
tggataaggcgttcacgccgcatccggcatgaaca	Protospacer
.*************************.**   *  

110. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP044299 (Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence) position: , mismatch: 7, identity: 0.8

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
tggataaggcgttcacgccgcatccggcatgaaca	Protospacer
.*************************.**   *  

111. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to MT230312 (Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence) position: , mismatch: 7, identity: 0.8

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacgccgcatccggcgatcgtg	Protospacer
**************************.*...*.  

112. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP019246 (Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence) position: , mismatch: 7, identity: 0.8

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgtttacgccgcatccggcataaaca	Protospacer
*************.************.**   *  

113. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_AP023209 (Escherichia coli strain TUM18781 plasmid pMTY18781-4, complete sequence) position: , mismatch: 7, identity: 0.8

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttcacaccgcatccggcataaaca	Protospacer
****************.*********.**   *  

114. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to MT230112 (Escherichia coli strain DH5alpha plasmid pESBL112, complete sequence) position: , mismatch: 7, identity: 0.8

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgtttacgccgcatccggcaacataa	Protospacer
*************.************.**.*  . 

115. spacer 6.1|2733472|32|CP030919|CRT matches to NZ_CP015038 (Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence) position: , mismatch: 7, identity: 0.781

taagtgat-atccatcatcgcatccagtgcgcc	CRISPR spacer
-ggttgatcgtccttcatcgcagccagtgcgcc	Protospacer
 .. **** .*** ******** **********

116. spacer 6.9|2733960|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP046125 (Enterococcus casseliflavus strain EC291 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

tcaaaggcaggacgcacaaatggagcagcagc	CRISPR spacer
gcaacaaaaggacgcacaaattgagcagctgc	Protospacer
 *** .. ************* ******* **

117. spacer 6.9|2733960|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP023514 (Enterococcus sp. FDAARGOS_375 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

tcaaaggcaggacgcacaaatggagcagcagc	CRISPR spacer
gcaacaaaaggacgcacaaattgagcagctgc	Protospacer
 *** .. ************* ******* **

118. spacer 6.9|2733960|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP023514 (Enterococcus sp. FDAARGOS_375 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

tcaaaggcaggacgcacaaatggagcagcagc	CRISPR spacer
gcaacaaaaggacgcacaaattgagcagctgc	Protospacer
 *** .. ************* ******* **

119. spacer 6.9|2733960|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to MK448232 (Klebsiella phage ST147-VIM1phi7.2, complete genome) position: , mismatch: 7, identity: 0.781

tcaaaggcaggacgcacaaatggagcagcagc	CRISPR spacer
tcaaaggcaggacgaacaaacggatgtgctgg	Protospacer
************** *****.***   ** * 

120. spacer 6.9|2733960|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to MK422450 (Klebsiella phage ST13-OXA48phi12.4, complete genome) position: , mismatch: 7, identity: 0.781

tcaaaggcaggacgcacaaatggagcagcagc	CRISPR spacer
tcaaaggcaggacgaacaaacggatgtgctgg	Protospacer
************** *****.***   ** * 

121. spacer 7.2|2758395|32|CP030919|CRISPRCasFinder,CRT matches to NZ_MG299151 (Shigella sonnei strain SH287-2 plasmid pSH287-2, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

122. spacer 7.2|2758395|32|CP030919|CRISPRCasFinder,CRT matches to NZ_KY471628 (Shigella sonnei strain SH15sh99 plasmid pSH15sh99, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

123. spacer 7.2|2758395|32|CP030919|CRISPRCasFinder,CRT matches to NZ_MG299131 (Shigella sonnei strain SH271-2 plasmid pSH271-2, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

124. spacer 7.2|2758395|32|CP030919|CRISPRCasFinder,CRT matches to NZ_KY471629 (Shigella sonnei strain SH15sh105 plasmid pSH15sh104, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

125. spacer 7.2|2758395|32|CP030919|CRISPRCasFinder,CRT matches to NZ_MG299133 (Shigella sonnei strain SH272-2 plasmid pSH272-2, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

126. spacer 7.2|2758395|32|CP030919|CRISPRCasFinder,CRT matches to NZ_MG299128 (Shigella sonnei strain SH262-2 plasmid pSH262-2, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

127. spacer 7.2|2758395|32|CP030919|CRISPRCasFinder,CRT matches to NZ_MG299147 (Shigella sonnei strain SH284-2 plasmid pSH284-2, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

128. spacer 7.2|2758395|32|CP030919|CRISPRCasFinder,CRT matches to NC_018995 (Escherichia coli plasmid pHUSEC41-1, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

129. spacer 7.2|2758395|32|CP030919|CRISPRCasFinder,CRT matches to NZ_CP053235 (Escherichia coli strain SCU-106 plasmid pSCU-106-1, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

130. spacer 7.2|2758395|32|CP030919|CRISPRCasFinder,CRT matches to NZ_CP005999 (Escherichia coli B7A plasmid pEB1, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

131. spacer 7.2|2758395|32|CP030919|CRISPRCasFinder,CRT matches to KU932021 (Escherichia coli plasmid pEC3I, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

132. spacer 7.2|2758395|32|CP030919|CRISPRCasFinder,CRT matches to NZ_CP024154 (Escherichia coli strain 14EC033 plasmid p14EC033g, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

133. spacer 7.2|2758395|32|CP030919|CRISPRCasFinder,CRT matches to NC_011754 (Escherichia coli ED1a plasmid pECOED, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

134. spacer 7.2|2758395|32|CP030919|CRISPRCasFinder,CRT matches to NZ_CP015141 (Escherichia coli strain Ecol_732 plasmid pEC732_3, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

135. spacer 7.2|2758395|32|CP030919|CRISPRCasFinder,CRT matches to NZ_LR213460 (Shigella sonnei strain AUSMDU00008333 isolate AUSMDU00008333 plasmid 3) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

136. spacer 7.2|2758395|32|CP030919|CRISPRCasFinder,CRT matches to NZ_MH287044 (Escherichia coli strain 5.1-R1 plasmid pCERC6, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

137. spacer 7.2|2758395|32|CP030919|CRISPRCasFinder,CRT matches to NZ_MH618673 (Escherichia coli strain 838B plasmid p838B-R, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

138. spacer 7.7|2758700|32|CP030919|CRISPRCasFinder,CRT matches to NZ_CP020471 (Rhodobacter blasticus strain 28/5 plasmid pRsa, complete sequence) position: , mismatch: 7, identity: 0.781

cacgacgggcaggcgatcaccggcatgaccca	CRISPR spacer
ttcgacgggcaggacatcaccggcatgaagcc	Protospacer
. ***********  *************  * 

139. spacer 7.7|2758700|32|CP030919|CRISPRCasFinder,CRT matches to NZ_LN907829 (Erwinia gerundensis isolate E_g_EM595 plasmid pEM02, complete sequence) position: , mismatch: 7, identity: 0.781

-cacgacgggcaggcgatcaccggcatgaccca	CRISPR spacer
gcacag-gggcaggcgatcaccagcatgacgag	Protospacer
 ***.. ***************.*******  .

140. spacer 7.7|2758700|32|CP030919|CRISPRCasFinder,CRT matches to KU708004 (Pseudomonas phage phiAH14a, complete genome) position: , mismatch: 7, identity: 0.781

cacgacgg--gcaggcgatcaccggcatgaccca	CRISPR spacer
--aggcggttgcaggcgatcaccggcatcatccc	Protospacer
   *.***  ****************** *.** 

141. spacer 7.12|2759005|32|CP030919|CRISPRCasFinder,CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 7, identity: 0.781

gctcgctgacggcggcttttttaaaccagagg	CRISPR spacer
ggcccttgtcggcggcttttttataccagacg	Protospacer
* .* .** ************** ****** *

142. spacer 7.15|2758396|32|CP030919|PILER-CR matches to NZ_MG299151 (Shigella sonnei strain SH287-2 plasmid pSH287-2, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

143. spacer 7.15|2758396|32|CP030919|PILER-CR matches to NZ_KY471628 (Shigella sonnei strain SH15sh99 plasmid pSH15sh99, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

144. spacer 7.15|2758396|32|CP030919|PILER-CR matches to NZ_MG299131 (Shigella sonnei strain SH271-2 plasmid pSH271-2, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

145. spacer 7.15|2758396|32|CP030919|PILER-CR matches to NZ_KY471629 (Shigella sonnei strain SH15sh105 plasmid pSH15sh104, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

146. spacer 7.15|2758396|32|CP030919|PILER-CR matches to NZ_MG299133 (Shigella sonnei strain SH272-2 plasmid pSH272-2, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

147. spacer 7.15|2758396|32|CP030919|PILER-CR matches to NZ_MG299128 (Shigella sonnei strain SH262-2 plasmid pSH262-2, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

148. spacer 7.15|2758396|32|CP030919|PILER-CR matches to NZ_MG299147 (Shigella sonnei strain SH284-2 plasmid pSH284-2, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

149. spacer 7.15|2758396|32|CP030919|PILER-CR matches to NC_018995 (Escherichia coli plasmid pHUSEC41-1, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

150. spacer 7.15|2758396|32|CP030919|PILER-CR matches to NZ_CP053235 (Escherichia coli strain SCU-106 plasmid pSCU-106-1, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

151. spacer 7.15|2758396|32|CP030919|PILER-CR matches to NZ_CP005999 (Escherichia coli B7A plasmid pEB1, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

152. spacer 7.15|2758396|32|CP030919|PILER-CR matches to KU932021 (Escherichia coli plasmid pEC3I, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

153. spacer 7.15|2758396|32|CP030919|PILER-CR matches to NZ_CP024154 (Escherichia coli strain 14EC033 plasmid p14EC033g, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

154. spacer 7.15|2758396|32|CP030919|PILER-CR matches to NC_011754 (Escherichia coli ED1a plasmid pECOED, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

155. spacer 7.15|2758396|32|CP030919|PILER-CR matches to NZ_CP015141 (Escherichia coli strain Ecol_732 plasmid pEC732_3, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

156. spacer 7.15|2758396|32|CP030919|PILER-CR matches to NZ_LR213460 (Shigella sonnei strain AUSMDU00008333 isolate AUSMDU00008333 plasmid 3) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

157. spacer 7.15|2758396|32|CP030919|PILER-CR matches to NZ_MH287044 (Escherichia coli strain 5.1-R1 plasmid pCERC6, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

158. spacer 7.15|2758396|32|CP030919|PILER-CR matches to NZ_MH618673 (Escherichia coli strain 838B plasmid p838B-R, complete sequence) position: , mismatch: 7, identity: 0.781

--gccgtctgcctccagcccagccctggatattt	CRISPR spacer
tggcc--ctgcctgcagctcagccctggataacg	Protospacer
  ***  ****** ****.************ . 

159. spacer 7.20|2758701|32|CP030919|PILER-CR matches to NZ_CP020471 (Rhodobacter blasticus strain 28/5 plasmid pRsa, complete sequence) position: , mismatch: 7, identity: 0.781

cacgacgggcaggcgatcaccggcatgaccca	CRISPR spacer
ttcgacgggcaggacatcaccggcatgaagcc	Protospacer
. ***********  *************  * 

160. spacer 7.20|2758701|32|CP030919|PILER-CR matches to NZ_LN907829 (Erwinia gerundensis isolate E_g_EM595 plasmid pEM02, complete sequence) position: , mismatch: 7, identity: 0.781

-cacgacgggcaggcgatcaccggcatgaccca	CRISPR spacer
gcacag-gggcaggcgatcaccagcatgacgag	Protospacer
 ***.. ***************.*******  .

161. spacer 7.20|2758701|32|CP030919|PILER-CR matches to KU708004 (Pseudomonas phage phiAH14a, complete genome) position: , mismatch: 7, identity: 0.781

cacgacgg--gcaggcgatcaccggcatgaccca	CRISPR spacer
--aggcggttgcaggcgatcaccggcatcatccc	Protospacer
   *.***  ****************** *.** 

162. spacer 7.25|2759006|32|CP030919|PILER-CR matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 7, identity: 0.781

gctcgctgacggcggcttttttaaaccagagg	CRISPR spacer
ggcccttgtcggcggcttttttataccagacg	Protospacer
* .* .** ************** ****** *

163. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 8, identity: 0.771

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgtttacgccgcatccggcaattgtg	Protospacer
*************.************.**....  

164. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 8, identity: 0.771

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgtttacgccgcatccggcacttgtg	Protospacer
*************.************.** ...  

165. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP044308 (Escherichia coli strain C27A plasmid pC27A-3, complete sequence) position: , mismatch: 8, identity: 0.771

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgtttacgccgcatccggcaatggtg	Protospacer
*************.************.**.. .  

166. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP044308 (Escherichia coli strain C27A plasmid pC27A-3, complete sequence) position: , mismatch: 8, identity: 0.771

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cgaataatgcgttcacgccgcatccgacctgaaaa	Protospacer
**.**** ********************    *. 

167. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP019906 (Escherichia coli strain MDR_56 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.771

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgttaacgccgcatccggccatgatg	Protospacer
************* ************.* .. *  

168. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.771

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cgaataatgcgttcacgccgcatccgacctgaaaa	Protospacer
**.**** ********************    *. 

169. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.771

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cgaataatgcgttcacgccgcatccgacctgaaaa	Protospacer
**.**** ********************    *. 

170. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.771

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cgaataatgcgttcacgccgcatccgacctgaaaa	Protospacer
**.**** ********************    *. 

171. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.771

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cgaataatgcgttcacgccgcatccgacctgaaaa	Protospacer
**.**** ********************    *. 

172. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_AP023207 (Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence) position: , mismatch: 8, identity: 0.771

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgtttacgccgcatccggcatttgct	Protospacer
*************.************.** ... .

173. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP044307 (Escherichia coli strain C27A plasmid pC27A-2, complete sequence) position: , mismatch: 8, identity: 0.771

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cgaataatgcgttcacgccgcatccgacctgaaaa	Protospacer
**.**** ********************    *. 

174. spacer 6.1|2733472|32|CP030919|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.75

taagtg---atatccatcatcgcatccagtgcgcc	CRISPR spacer
---gtgcgcccctccatcaccgcttccagtgcgcc	Protospacer
   ***    . *******.*** ***********

175. spacer 7.3|2758456|32|CP030919|CRISPRCasFinder,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tggttcactcacgcaacgtctgagcgcgttga	CRISPR spacer
cggggtaatcacgcaacgtccgaccgcgttgt	Protospacer
.**  .* ************.** ******* 

176. spacer 7.7|2758700|32|CP030919|CRISPRCasFinder,CRT matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

-cacgacgggcaggcgatcaccggcatgaccca	CRISPR spacer
gcgcag-gggcaggcgatcaccagcaggaccag	Protospacer
 *.*.. ***************.*** **** .

177. spacer 7.7|2758700|32|CP030919|CRISPRCasFinder,CRT matches to NZ_CP046332 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed2) position: , mismatch: 8, identity: 0.75

-cacgacgggcaggcgatcaccggcatgaccca	CRISPR spacer
gcgcag-gggcaggcgatcaccagcaggaccag	Protospacer
 *.*.. ***************.*** **** .

178. spacer 7.7|2758700|32|CP030919|CRISPRCasFinder,CRT matches to NZ_CP026545 (Cupriavidus metallidurans strain Ni-2 plasmid unnamed1) position: , mismatch: 8, identity: 0.75

-cacgacgggcaggcgatcaccggcatgaccca	CRISPR spacer
gcgcag-gggcaggcgatcaccagcaggaccag	Protospacer
 *.*.. ***************.*** **** .

179. spacer 7.7|2758700|32|CP030919|CRISPRCasFinder,CRT matches to NC_020548 (Azoarcus sp. KH32C plasmid pAZKH, complete sequence) position: , mismatch: 8, identity: 0.75

cacgacgggcaggcgatcaccggcatgaccca	CRISPR spacer
tcggtcaggtaggcgatcaccggcatcaccga	Protospacer
.  * *.**.**************** *** *

180. spacer 7.7|2758700|32|CP030919|CRISPRCasFinder,CRT matches to NC_006466 (Cupriavidus metallidurans CH34 plasmid pMOL30, complete sequence) position: , mismatch: 8, identity: 0.75

-cacgacgggcaggcgatcaccggcatgaccca	CRISPR spacer
gcgcag-gggcaggcgatcaccagcaggaccag	Protospacer
 *.*.. ***************.*** **** .

181. spacer 7.7|2758700|32|CP030919|CRISPRCasFinder,CRT matches to NC_022001 (Streptomyces collinus Tu 365 plasmid pSCO1, complete sequence) position: , mismatch: 8, identity: 0.75

cacgacgg--gcaggcgatcaccggcatgaccca	CRISPR spacer
--aggcagctccaggcgatcaccgacatggccca	Protospacer
   *.*.*   *************.****.****

182. spacer 7.16|2758457|32|CP030919|PILER-CR matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tggttcactcacgcaacgtctgagcgcgttga	CRISPR spacer
cggggtaatcacgcaacgtccgaccgcgttgt	Protospacer
.**  .* ************.** ******* 

183. spacer 7.20|2758701|32|CP030919|PILER-CR matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

-cacgacgggcaggcgatcaccggcatgaccca	CRISPR spacer
gcgcag-gggcaggcgatcaccagcaggaccag	Protospacer
 *.*.. ***************.*** **** .

184. spacer 7.20|2758701|32|CP030919|PILER-CR matches to NZ_CP046332 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed2) position: , mismatch: 8, identity: 0.75

-cacgacgggcaggcgatcaccggcatgaccca	CRISPR spacer
gcgcag-gggcaggcgatcaccagcaggaccag	Protospacer
 *.*.. ***************.*** **** .

185. spacer 7.20|2758701|32|CP030919|PILER-CR matches to NZ_CP026545 (Cupriavidus metallidurans strain Ni-2 plasmid unnamed1) position: , mismatch: 8, identity: 0.75

-cacgacgggcaggcgatcaccggcatgaccca	CRISPR spacer
gcgcag-gggcaggcgatcaccagcaggaccag	Protospacer
 *.*.. ***************.*** **** .

186. spacer 7.20|2758701|32|CP030919|PILER-CR matches to NC_020548 (Azoarcus sp. KH32C plasmid pAZKH, complete sequence) position: , mismatch: 8, identity: 0.75

cacgacgggcaggcgatcaccggcatgaccca	CRISPR spacer
tcggtcaggtaggcgatcaccggcatcaccga	Protospacer
.  * *.**.**************** *** *

187. spacer 7.20|2758701|32|CP030919|PILER-CR matches to NC_006466 (Cupriavidus metallidurans CH34 plasmid pMOL30, complete sequence) position: , mismatch: 8, identity: 0.75

-cacgacgggcaggcgatcaccggcatgaccca	CRISPR spacer
gcgcag-gggcaggcgatcaccagcaggaccag	Protospacer
 *.*.. ***************.*** **** .

188. spacer 7.20|2758701|32|CP030919|PILER-CR matches to NC_022001 (Streptomyces collinus Tu 365 plasmid pSCO1, complete sequence) position: , mismatch: 8, identity: 0.75

cacgacgg--gcaggcgatcaccggcatgaccca	CRISPR spacer
--aggcagctccaggcgatcaccgacatggccca	Protospacer
   *.*.*   *************.****.****

189. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to MG065686 (UNVERIFIED: Campylobacter phage A18a, complete genome) position: , mismatch: 9, identity: 0.743

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
tggataagacgttcacgccgcatccggtaatcttt	Protospacer
.*******.*****************..*..*  .

190. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to MG065686 (UNVERIFIED: Campylobacter phage A18a, complete genome) position: , mismatch: 9, identity: 0.743

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgcttacgccgcatccggcgctgccc	Protospacer
***********.*.************.*. .   *

191. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_AP023207 (Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence) position: , mismatch: 9, identity: 0.743

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgctcgcgccgcatccggcggtggtg	Protospacer
***********.**.***********.*.*. .  

192. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to MG065691 (UNVERIFIED: Campylobacter phage A11a, complete genome) position: , mismatch: 9, identity: 0.743

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
tggataagacgttcacgccgcatccggtaatcttt	Protospacer
.*******.*****************..*..*  .

193. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to MG065691 (UNVERIFIED: Campylobacter phage A11a, complete genome) position: , mismatch: 9, identity: 0.743

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cggataaggcgcttacgccgcatccggcgctgccc	Protospacer
***********.*.************.*. .   *

194. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 9, identity: 0.743

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cagataaggcgtttacgccgcatccggcatttgtg	Protospacer
*.***********.************.** ...  

195. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

196. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

197. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacgggtggcg	Protospacer
. **. **********.************************** * * .

198. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

199. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

200. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacgggtggcg	Protospacer
. **. **********.************************** * * .

201. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

202. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

203. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacgggtggcg	Protospacer
. **. **********.************************** * * .

204. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

205. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

206. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacgggtggcg	Protospacer
. **. **********.************************** * * .

207. spacer 6.1|2733472|32|CP030919|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 9, identity: 0.719

taagtgatatccatcatcgcatccagtgcgcc	CRISPR spacer
ctcatcgcatccatcatcggttccagtgcgcc	Protospacer
.  .* ..***********  ***********

208. spacer 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to MG065682 (UNVERIFIED: Campylobacter phage A112b, complete genome) position: , mismatch: 9, identity: 0.719

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactgct	Protospacer
 . .* ******* ********** *****  

209. spacer 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to LN881735 (Escherichia phage slur12, complete genome) position: , mismatch: 9, identity: 0.719

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactgct	Protospacer
 . .* ******* ********** *****  

210. spacer 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to MG065659 (UNVERIFIED: Campylobacter phage C5, complete genome) position: , mismatch: 9, identity: 0.719

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactgct	Protospacer
 . .* ******* ********** *****  

211. spacer 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to LR597647 (Escherichia phage rV5_ev147 genome assembly, chromosome: 1) position: , mismatch: 9, identity: 0.719

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactgct	Protospacer
 . .* ******* ********** *****  

212. spacer 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to MG065661 (UNVERIFIED: Campylobacter phage C9, complete genome) position: , mismatch: 9, identity: 0.719

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactgct	Protospacer
 . .* ******* ********** *****  

213. spacer 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to MG065655 (UNVERIFIED: Campylobacter phage C2, complete genome) position: , mismatch: 9, identity: 0.719

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactgct	Protospacer
 . .* ******* ********** *****  

214. spacer 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to MN850646 (Escherichia phage nom, complete genome) position: , mismatch: 9, identity: 0.719

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactgct	Protospacer
 . .* ******* ********** *****  

215. spacer 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to KR698074 (Escherichia phage APCEc02, complete genome) position: , mismatch: 9, identity: 0.719

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactgct	Protospacer
 . .* ******* ********** *****  

216. spacer 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to MG065666 (UNVERIFIED: Campylobacter phage A12a, complete genome) position: , mismatch: 9, identity: 0.719

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactgct	Protospacer
 . .* ******* ********** *****  

217. spacer 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to MK883717 (Eschericha phage vB_EcoM-ECP26, complete genome) position: , mismatch: 9, identity: 0.719

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactgtt	Protospacer
 . .* ******* ********** *****  

218. spacer 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to LR694165 (Escherichia phage rV5_ev156 genome assembly, chromosome: 1) position: , mismatch: 9, identity: 0.719

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactgct	Protospacer
 . .* ******* ********** *****  

219. spacer 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to MG963916 (Escherichia phage PDX, complete genome) position: , mismatch: 9, identity: 0.719

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactgct	Protospacer
 . .* ******* ********** *****  

220. spacer 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to KP869102 (Escherichia coli O157 typing phage 4, partial genome) position: , mismatch: 9, identity: 0.719

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactgct	Protospacer
 . .* ******* ********** *****  

221. spacer 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to MG065658 (UNVERIFIED: Campylobacter phage C7, complete genome) position: , mismatch: 9, identity: 0.719

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactgct	Protospacer
 . .* ******* ********** *****  

222. spacer 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to NC_028248 (Escherichia phage slur16, complete genome) position: , mismatch: 9, identity: 0.719

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactgct	Protospacer
 . .* ******* ********** *****  

223. spacer 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to MG065654 (UNVERIFIED: Campylobacter phage C15, complete genome) position: , mismatch: 9, identity: 0.719

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactgct	Protospacer
 . .* ******* ********** *****  

224. spacer 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to MN850642 (Escherichia phage navn, complete genome) position: , mismatch: 9, identity: 0.719

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactgct	Protospacer
 . .* ******* ********** *****  

225. spacer 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to MK883718 (Escherichia phage vB_EcoM-ECP32, complete genome) position: , mismatch: 9, identity: 0.719

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactgtt	Protospacer
 . .* ******* ********** *****  

226. spacer 6.7|2733838|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP034185 (Deinococcus sp. S14-83 strain S14-83T plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

gctgaatacaccagcgccgtctgatagagaaa	CRISPR spacer
accgaataatccagcgccgtctgatacaccgc	Protospacer
.*.*****  **************** *  . 

227. spacer 7.7|2758700|32|CP030919|CRISPRCasFinder,CRT matches to CP009871 (Pantoea sp. PSNIH2 plasmid pPSP-cd6, complete sequence) position: , mismatch: 9, identity: 0.719

-cacgacgggcaggcgatcaccggcatgaccca	CRISPR spacer
gcgcag-gggcaggcgataaccagcatgacaag	Protospacer
 *.*.. *********** ***.*******  .

228. spacer 7.7|2758700|32|CP030919|CRISPRCasFinder,CRT matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 9, identity: 0.719

cacgacgggcaggcgatcaccggcatgaccca	CRISPR spacer
ctctccgggctggcgatcgccggcatgagttt	Protospacer
* *  ***** *******.********* .. 

229. spacer 7.7|2758700|32|CP030919|CRISPRCasFinder,CRT matches to NZ_CP032704 (Pantoea dispersa strain DSM 32899 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

-cacgacgggcaggcgatcaccggcatgaccca	CRISPR spacer
gcgcag-gggcaggcgataaccagcatgacaag	Protospacer
 *.*.. *********** ***.*******  .

230. spacer 7.7|2758700|32|CP030919|CRISPRCasFinder,CRT matches to NC_016586 (Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence) position: , mismatch: 9, identity: 0.719

cacgacgggcaggcgatcaccggcatgaccca	CRISPR spacer
ttcaacgggcaggagatcaccggcttgggcac	Protospacer
. *.********* ********** **. *  

231. spacer 7.13|2759066|32|CP030919|CRISPRCasFinder,CRT matches to NC_007105 (Bacillus cereus E33L plasmid pE33L54, complete sequence) position: , mismatch: 9, identity: 0.719

agtgcaatagcacgtaaattacgtaaattagc	CRISPR spacer
gactcaatagcacgtagatttcgtaaacttgt	Protospacer
... ************.*** ******.* *.

232. spacer 7.13|2759066|32|CP030919|CRISPRCasFinder,CRT matches to NZ_CP009966 (Bacillus cereus E33L plasmid pBCO_2, complete sequence) position: , mismatch: 9, identity: 0.719

agtgcaatagcacgtaaattacgtaaattagc	CRISPR spacer
gactcaatagcacgtagatttcgtaaacttgt	Protospacer
... ************.*** ******.* *.

233. spacer 7.20|2758701|32|CP030919|PILER-CR matches to CP009871 (Pantoea sp. PSNIH2 plasmid pPSP-cd6, complete sequence) position: , mismatch: 9, identity: 0.719

-cacgacgggcaggcgatcaccggcatgaccca	CRISPR spacer
gcgcag-gggcaggcgataaccagcatgacaag	Protospacer
 *.*.. *********** ***.*******  .

234. spacer 7.20|2758701|32|CP030919|PILER-CR matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 9, identity: 0.719

cacgacgggcaggcgatcaccggcatgaccca	CRISPR spacer
ctctccgggctggcgatcgccggcatgagttt	Protospacer
* *  ***** *******.********* .. 

235. spacer 7.20|2758701|32|CP030919|PILER-CR matches to NZ_CP032704 (Pantoea dispersa strain DSM 32899 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

-cacgacgggcaggcgatcaccggcatgaccca	CRISPR spacer
gcgcag-gggcaggcgataaccagcatgacaag	Protospacer
 *.*.. *********** ***.*******  .

236. spacer 7.20|2758701|32|CP030919|PILER-CR matches to NC_016586 (Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence) position: , mismatch: 9, identity: 0.719

cacgacgggcaggcgatcaccggcatgaccca	CRISPR spacer
ttcaacgggcaggagatcaccggcttgggcac	Protospacer
. *.********* ********** **. *  

237. spacer 7.26|2759067|32|CP030919|PILER-CR matches to NC_007105 (Bacillus cereus E33L plasmid pE33L54, complete sequence) position: , mismatch: 9, identity: 0.719

agtgcaatagcacgtaaattacgtaaattagc	CRISPR spacer
gactcaatagcacgtagatttcgtaaacttgt	Protospacer
... ************.*** ******.* *.

238. spacer 7.26|2759067|32|CP030919|PILER-CR matches to NZ_CP009966 (Bacillus cereus E33L plasmid pBCO_2, complete sequence) position: , mismatch: 9, identity: 0.719

agtgcaatagcacgtaaattacgtaaattagc	CRISPR spacer
gactcaatagcacgtagatttcgtaaacttgt	Protospacer
... ************.*** ******.* *.

239. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to MG065686 (UNVERIFIED: Campylobacter phage A18a, complete genome) position: , mismatch: 10, identity: 0.714

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cgagtaaggtgttcacgccgcatccggcaagataa	Protospacer
**..*****.****************.**.   . 

240. spacer 3.1|1989027|35|CP030919|CRISPRCasFinder matches to MG065691 (UNVERIFIED: Campylobacter phage A11a, complete genome) position: , mismatch: 10, identity: 0.714

cggataaggcgttcacgccgcatccgacagccagc	CRISPR spacer
cgagtaaggtgttcacgccgcatccggcaagataa	Protospacer
**..*****.****************.**.   . 

241. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtaaacgccttatccggcctacggatggcg	Protospacer
. **. **********.****.********************* * * .

242. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtaaacgccttatccggcctacggatggcg	Protospacer
. **. **********.****.********************* * * .

243. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtaaacgccttatccggcctacggatggcg	Protospacer
. **. **********.****.********************* * * .

244. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtaaacgccttatccggcctacggatggcg	Protospacer
. **. **********.****.********************* * * .

245. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_CP044147 (Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacaattgccggatgcggcgtgaacgccttatccggcctacggttgagt	Protospacer
. *.. **********.**************************.* .* 

246. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to CP044351 (Escherichia coli strain 194195 plasmid p194195_1, complete sequence) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacaattgccggatgcggcgtgaacgccttatccggcctacggttgagt	Protospacer
. *.. **********.**************************.* .* 

247. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga--	CRISPR spacer
cacaagtgccggatgcggcgtaaacgccttatccggcctacg--ccagact	Protospacer
. *..***********.****.********************  .*.**  

248. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
gctggttgccggatgcggcgtgaacgccttatccggcctacattcggca	Protospacer
 *.** **********.************************. .. * *

249. spacer 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to MG065677 (UNVERIFIED: Campylobacter phage A13b, complete genome) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactatt	Protospacer
 . .* ******* ********** ****.  

250. spacer 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to KP869112 (Escherichia coli O157 typing phage 14, partial genome) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactact	Protospacer
 . .* ******* ********** ****.  

251. spacer 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to MK962749 (Shigella phage CM1, complete genome) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactact	Protospacer
 . .* ******* ********** ****.  

252. spacer 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to MN850597 (Escherichia phage isim, complete genome) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactact	Protospacer
 . .* ******* ********** ****.  

253. spacer 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to MN850578 (Escherichia phage nomo, complete genome) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactatt	Protospacer
 . .* ******* ********** ****.  

254. spacer 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to MN850626 (Escherichia phage nimi, complete genome) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactact	Protospacer
 . .* ******* ********** ****.  

255. spacer 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to MG065644 (UNVERIFIED: Campylobacter phage A147, complete genome) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactatt	Protospacer
 . .* ******* ********** ****.  

256. spacer 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to MN850612 (Escherichia phage magaca, complete genome) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactact	Protospacer
 . .* ******* ********** ****.  

257. spacer 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to LR699804 (Escherichia phage rV5_ev146 genome assembly, chromosome: 1) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactact	Protospacer
 . .* ******* ********** ****.  

258. spacer 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to MG065647 (UNVERIFIED: Campylobacter phage D#, complete genome) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactact	Protospacer
 . .* ******* ********** ****.  

259. spacer 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to NC_011041 (Escherichia coli bacteriophage rv5, complete sequence) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactact	Protospacer
 . .* ******* ********** ****.  

260. spacer 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to MG065646 (UNVERIFIED: Campylobacter phage D1, complete genome) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactact	Protospacer
 . .* ******* ********** ****.  

261. spacer 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to NC_022323 (Escherichia phage 2 JES-2013, complete genome) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactact	Protospacer
 . .* ******* ********** ****.  

262. spacer 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to MG065635 (UNVERIFIED: Campylobacter phage C12, complete genome) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactatt	Protospacer
 . .* ******* ********** ****.  

263. spacer 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to MH752840 (Escherichia phage vB_EcoM-Pr121LW, complete genome) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactact	Protospacer
 . .* ******* ********** ****.  

264. spacer 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to MG065674 (UNVERIFIED: Campylobacter phage A140, complete genome) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactatt	Protospacer
 . .* ******* ********** ****.  

265. spacer 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to KP869103 (Escherichia coli O157 typing phage 5, complete genome) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactact	Protospacer
 . .* ******* ********** ****.  

266. spacer 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to MK373780 (Escherichia phage vB_EcoM_HdK5, complete genome) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactact	Protospacer
 . .* ******* ********** ****.  

267. spacer 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to MG065662 (UNVERIFIED: Campylobacter phage A142, complete genome) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactatt	Protospacer
 . .* ******* ********** ****.  

268. spacer 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to MK327930 (Escherichia phage EdH4, complete genome) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactact	Protospacer
 . .* ******* ********** ****.  

269. spacer 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to MG065672 (UNVERIFIED: Campylobacter phage A141, complete genome) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactatt	Protospacer
 . .* ******* ********** ****.  

270. spacer 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to MG065690 (UNVERIFIED: Campylobacter phage A135, complete genome) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactatt	Protospacer
 . .* ******* ********** ****.  

271. spacer 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to KT001917 (Escherichia phage Murica, complete genome) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactact	Protospacer
 . .* ******* ********** ****.  

272. spacer 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to MN850627 (Escherichia phage pangalan, complete genome) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactact	Protospacer
 . .* ******* ********** ****.  

273. spacer 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to MN850649 (Escherichia phage nomine, complete genome) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactact	Protospacer
 . .* ******* ********** ****.  

274. spacer 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to MN850595 (Escherichia phage naswa, complete genome) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactact	Protospacer
 . .* ******* ********** ****.  

275. spacer 6.3|2733594|32|CP030919|CRT,PILER-CR,CRISPRCasFinder matches to MN850576 (Escherichia phage ime, complete genome) position: , mismatch: 10, identity: 0.688

gcaaataagctgcggttttatggctcactgaa	CRISPR spacer
cttgaaaagctgccgttttatggcacactact	Protospacer
 . .* ******* ********** ****.  

276. spacer 7.7|2758700|32|CP030919|CRISPRCasFinder,CRT matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 10, identity: 0.688

cacgacgggcaggcgatcaccggcatgaccca	CRISPR spacer
ctttccgggctggcgatcgccggcatgagttt	Protospacer
* .  ***** *******.********* .. 

277. spacer 7.7|2758700|32|CP030919|CRISPRCasFinder,CRT matches to NZ_CP031159 (Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdA, complete sequence) position: , mismatch: 10, identity: 0.688

cacgacgggcaggcgatcaccggcatgaccca	CRISPR spacer
accagcgggcacgcgatcaccggcctgagtac	Protospacer
  *..****** ************ *** .  

278. spacer 7.20|2758701|32|CP030919|PILER-CR matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 10, identity: 0.688

cacgacgggcaggcgatcaccggcatgaccca	CRISPR spacer
ctttccgggctggcgatcgccggcatgagttt	Protospacer
* .  ***** *******.********* .. 

279. spacer 7.20|2758701|32|CP030919|PILER-CR matches to NZ_CP031159 (Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdA, complete sequence) position: , mismatch: 10, identity: 0.688

cacgacgggcaggcgatcaccggcatgaccca	CRISPR spacer
accagcgggcacgcgatcaccggcctgagtac	Protospacer
  *..****** ************ *** .  

280. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgttcatgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
* .  .**********.*************************. * * .

281. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
. * . **********.*************************. * * .

282. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*************************. * * .

283. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgttcatgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
* .  .**********.*************************. * * .

284. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
. * . **********.*************************. * * .

285. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*************************. * * .

286. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgttcatgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
* .  .**********.*************************. * * .

287. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
. * . **********.*************************. * * .

288. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*************************. * * .

289. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgttcatgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
* .  .**********.*************************. * * .

290. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
. * . **********.*************************. * * .

291. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*************************. * * .

292. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacaaccgccggatgcggcgtgaacgccttatccggcctacgggtgagc	Protospacer
. *.. .*********.************************** * .* 

293. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacaaccgccggatgcggcgtgaacgccttatccggcctacgggtgagt	Protospacer
. *.. .*********.************************** * .* 

294. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agctggtgccggatgcggcgtaaacgccttatccggcctacaaatgcgc	Protospacer
  * ************.****.*******************.. *  * 

295. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_AP023209 (Escherichia coli strain TUM18781 plasmid pMTY18781-4, complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgtttatgccggatgcggtgtgaacgccttatccggcctacggatggcc	Protospacer
* .  .**********.*.************************ * *  

296. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

297. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

298. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccactgccggatgcggcgtggacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*****.*******************. * * .

299. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

300. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

301. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccactgccggatgcggcgtggacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*****.*******************. * * .

302. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

303. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

304. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccactgccggatgcggcgtggacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*****.*******************. * * .

305. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

306. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

307. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccactgccggatgcggcgtggacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*****.*******************. * * .

308. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
aatttttgccggatgcggcgtgaacgccttatccggcctacaacgggca	Protospacer
  .   **********.************************..*  * *

309. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga---	CRISPR spacer
cacaattgccggatgcggcgtaaacgccttatccggcctaca---tggataa	Protospacer
. *.. **********.****.*******************.   .***   

310. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
ttttcttgccggatgcggcgtaaacgccttatccggcctacaggacgtg	Protospacer
*..   **********.****.*******************.*  ** .

311. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_AP023207 (Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
ctcaaatgccggatgcggcgtgaacgccttatccggcctacgcacacta	Protospacer
..*...**********.*************************  .   *

312. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_AP023207 (Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agcaaatgccggatgcggcgtaaacgccttatccggcctacatttggca	Protospacer
  *...**********.****.*******************. .* * *

313. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to MG065691 (UNVERIFIED: Campylobacter phage A11a, complete genome) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
acactttgccggatgcggcgtgaacgcctgatccggcctacggtaagcc	Protospacer
 *    **********.************ *************.  *  

314. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to MG065686 (UNVERIFIED: Campylobacter phage A18a, complete genome) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
acactttgccggatgcggcgtgaacgcctgatccggcctacggtaagcc	Protospacer
 *    **********.************ *************.  *  

315. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to MF374379 (Escherichia phage DN1, complete genome) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgtttatgccggatgcggcgtgaacgccttatccggcctacaaaccgcg	Protospacer
* .  .**********.************************.. .** .

316. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 13, identity: 0.735

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
gttgattgccggatgcggcgtaaacgccttatccggcctacattcggca	Protospacer
 ..*. **********.****.*******************. .. * *

317. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 13, identity: 0.735

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
ttgttttgccggatgcggcgtgaacgccttatccggcctacaaaaccat	Protospacer
*.    **********.************************..  * . 

318. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NC_049343 (Escherichia phage 500465-2, complete genome) position: , mismatch: 13, identity: 0.735

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtgtttgccggatgcggcgtgaacgccttatccgacctacgtgtgacg	Protospacer
  .*  **********.******************.******  * . .

319. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to MT230112 (Escherichia coli strain DH5alpha plasmid pESBL112, complete sequence) position: , mismatch: 13, identity: 0.735

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
ttatgttgccggatgcggcgtaaacgccttatccggcctacaaaagcaa	Protospacer
*.  * **********.****.*******************..    .*

320. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 14, identity: 0.714

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
gtaaaatgccggatgcggcgtgaacgccttatccggcctacaaaccaag	Protospacer
 . ...**********.************************.. .*...

321. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 14, identity: 0.714

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
acaaaatgccggatgcggcgtaaacgccttatccggcctacaaaatcgt	Protospacer
 * ...**********.****.*******************..  . * 

322. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to MG065691 (UNVERIFIED: Campylobacter phage A11a, complete genome) position: , mismatch: 14, identity: 0.714

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
gcttcttgccggatgcggcgtgaacgccttatccggcctacaaaatcat	Protospacer
 *.   **********.************************..  . . 

323. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to MG065686 (UNVERIFIED: Campylobacter phage A18a, complete genome) position: , mismatch: 14, identity: 0.714

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
gcttcttgccggatgcggcgtgaacgccttatccggcctacaaaatcat	Protospacer
 *.   **********.************************..  . . 

324. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_CP053721 (Escherichia coli strain CP131_Sichuan plasmid pCP131-IncHI1, complete sequence) position: , mismatch: 14, identity: 0.714

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgttcatgccggatgcggcgtgaacgccttatccagcctacaaaattgt	Protospacer
* .  .**********.*****************.******..  . * 

325. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_CP019246 (Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence) position: , mismatch: 14, identity: 0.714

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgtttatgccggatgcggcgtaaacgccttatccggcctacaaaaagcg	Protospacer
* .  .**********.****.*******************..   * .

326. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_CP044299 (Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence) position: , mismatch: 14, identity: 0.714

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgttcatgccggatgcggcgtgaacgccttatccagcctacaaaattgt	Protospacer
* .  .**********.*****************.******..  . * 

327. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 15, identity: 0.694

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtcaatgccggatgcggcgtgaacgccttatccggcctacaaaagcat	Protospacer
  . ..**********.************************..    . 

328. spacer 4.1|2208214|49|CP030919|CRISPRCasFinder matches to NZ_CP044308 (Escherichia coli strain C27A plasmid pC27A-3, complete sequence) position: , mismatch: 15, identity: 0.694

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtaaacgccttatccggcctacaaaaaacg	Protospacer
. * . **********.****.*******************..   . .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 355 : 59140 57 Enterobacteria_phage(15.79%) protease,transposase,tail,capsid,integrase attL 16168:16181|attR 60005:60018
DBSCAN-SWA_2 664141 : 759324 89 Escherichia_phage(46.67%) tRNA,portal,protease,holin,plate,head,terminase,tail,capsid,integrase,lysis attL 669436:669453|attR 737230:737247
DBSCAN-SWA_3 1064701 : 1150713 100 Enterobacteria_phage(50.0%) tRNA,portal,holin,protease,transposase,terminase,tail,integrase attL 1060638:1060652|attR 1091184:1091198
DBSCAN-SWA_4 1397194 : 1444491 61 Enterobacteria_phage(28.12%) tail,protease,lysis,transposase NA
DBSCAN-SWA_5 1732450 : 1805768 87 Enterobacteria_phage(50.85%) tRNA,portal,holin,protease,transposase,terminase,tail NA
DBSCAN-SWA_6 1891466 : 1945035 40 Enterobacteria_phage(22.22%) integrase,transposase attL 1943246:1943259|attR 1944428:1944441
DBSCAN-SWA_7 1975482 : 1981800 7 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_8 2071777 : 2081218 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_9 2466734 : 2476524 10 Escherichia_phage(75.0%) transposase NA
DBSCAN-SWA_10 2596549 : 2612772 20 Salmonella_phage(84.21%) portal,integrase attL 2597565:2597602|attR 2613949:2613986
DBSCAN-SWA_11 2711394 : 2726078 13 Escherichia_phage(45.45%) integrase attL 2706785:2706798|attR 2723003:2723016
DBSCAN-SWA_12 3727722 : 3737241 11 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_13 4389253 : 4394016 8 Enterobacteria_phage(57.14%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. CP030921
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3983 : 52774 60 Escherichia_phage(15.79%) transposase,integrase attL 18475:18491|attR 57629:57645
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. CP030922
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 4633 5 Morganella_phage(50.0%) NA NA
DBSCAN-SWA_2 10070 : 10763 1 unidentified_phage(100.0%) NA NA
DBSCAN-SWA_3 14173 : 15271 1 Salmonella_phage(100.0%) NA NA
DBSCAN-SWA_4 51597 : 62879 15 Salmonella_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage