Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP024104 Bacillus cytotoxicus strain CH_23 chromosome, complete genome 3 crisprs cas3,csa3,WYL,DinG,cas6,cas8b2,cas7,cas5,cas2,cas1,cas9,cas4,DEDDh,cas14j 0 4 10 0
CP024105 Bacillus cytotoxicus strain CH_23 plasmid pCh23_53, complete sequence 0 crisprs NA 0 0 0 0
CP024106 Bacillus cytotoxicus strain CH_23 plasmid pCh23_67, complete sequence 0 crisprs TnsE_C 0 0 0 0

Results visualization

1. CP024104
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP024104_1 1577501-1577629 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP024104_2 2037713-2038144 orTypeII NA
6 spacers
cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP024104_3 2165612-2166364 Unclear I-A
11 spacers
cas6,cas8b2,cas7,cas5,cas3,cas4,cas1,cas2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP024104_2 2.2|2037815|30|CP024104|PILER-CR,CRISPRCasFinder,CRT 2037815-2037844 30 MN693012 Marine virus AFVG_117M3, complete genome 54240-54269 5 0.833
CP024104_2 2.1|2037749|30|CP024104|PILER-CR,CRISPRCasFinder,CRT 2037749-2037778 30 NZ_CP051687 Duganella sp. GN2-R2 plasmid unnamed2, complete sequence 5370-5399 7 0.767
CP024104_2 2.2|2037815|30|CP024104|PILER-CR,CRISPRCasFinder,CRT 2037815-2037844 30 CP002966 Emticicia oligotrophica DSM 17448 plasmid pEMTOL05, complete sequence 19362-19391 7 0.767
CP024104_2 2.3|2037881|30|CP024104|PILER-CR,CRISPRCasFinder,CRT 2037881-2037910 30 AP014136 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C47-MedDCM-OCT-S34-C10, *** SEQUENCING IN PROGRESS *** 6621-6650 7 0.767
CP024104_2 2.5|2038013|30|CP024104|PILER-CR,CRISPRCasFinder,CRT 2038013-2038042 30 NZ_CP016619 Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence 891211-891240 7 0.767
CP024104_2 2.3|2037881|30|CP024104|PILER-CR,CRISPRCasFinder,CRT 2037881-2037910 30 NZ_CP042421 Leuconostoc lactis strain CBA3622 plasmid unnamed1, complete sequence 41642-41671 8 0.733
CP024104_2 2.2|2037815|30|CP024104|PILER-CR,CRISPRCasFinder,CRT 2037815-2037844 30 NZ_CP053818 Vibrio cholerae strain SA7G plasmid pSA7G1, complete sequence 3264-3293 9 0.7
CP024104_2 2.3|2037881|30|CP024104|PILER-CR,CRISPRCasFinder,CRT 2037881-2037910 30 NZ_CP016596 Bacillus cereus strain K8 plasmid pBCM301, complete sequence 119389-119418 9 0.7
CP024104_2 2.3|2037881|30|CP024104|PILER-CR,CRISPRCasFinder,CRT 2037881-2037910 30 NZ_CP007513 Bacillus bombysepticus plasmid pBb, complete genome 512619-512648 9 0.7
CP024104_2 2.3|2037881|30|CP024104|PILER-CR,CRISPRCasFinder,CRT 2037881-2037910 30 NZ_CP010112 Bacillus thuringiensis serovar indiana strain HD521 plasmid pBTHD521-6, complete sequence 11573-11602 9 0.7
CP024104_2 2.3|2037881|30|CP024104|PILER-CR,CRISPRCasFinder,CRT 2037881-2037910 30 MH616843 Inoviridae sp. isolate ctbd25, complete genome 1309-1338 9 0.7

1. spacer 2.2|2037815|30|CP024104|PILER-CR,CRISPRCasFinder,CRT matches to MN693012 (Marine virus AFVG_117M3, complete genome) position: , mismatch: 5, identity: 0.833

aaagaccctacacataatgaatggaaatat	CRISPR spacer
acaggtcctacacataatcaatggaaagat	Protospacer
* **..************ ******** **

2. spacer 2.1|2037749|30|CP024104|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP051687 (Duganella sp. GN2-R2 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767

ccacctt--tgaaacgcgtctggatcaacgag	CRISPR spacer
--gacttggcgaaacgcgtctggatccacgat	Protospacer
  . ***  .**************** **** 

3. spacer 2.2|2037815|30|CP024104|PILER-CR,CRISPRCasFinder,CRT matches to CP002966 (Emticicia oligotrophica DSM 17448 plasmid pEMTOL05, complete sequence) position: , mismatch: 7, identity: 0.767

aaagaccctacacataatgaatggaaatat	CRISPR spacer
agggattgaacaaataatgaatggaaatat	Protospacer
*..**..  *** *****************

4. spacer 2.3|2037881|30|CP024104|PILER-CR,CRISPRCasFinder,CRT matches to AP014136 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C47-MedDCM-OCT-S34-C10, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.767

tacaaaaacaaatgaaattatcgatagccg	CRISPR spacer
tacaaaagcaaatgaaattgtcgcttgtgc	Protospacer
*******.***********.*** * *.  

5. spacer 2.5|2038013|30|CP024104|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016619 (Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767

tagccaaatttcaatgtcatcggaaataat	CRISPR spacer
aagccaaatttccatgtcatcggtgaggtt	Protospacer
 *********** ********** .* . *

6. spacer 2.3|2037881|30|CP024104|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042421 (Leuconostoc lactis strain CBA3622 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

tacaaaaacaaatgaaattatcgatagccg	CRISPR spacer
caaaaaaacaaatgaaaaaatcgataagtc	Protospacer
.* **************  *******. . 

7. spacer 2.2|2037815|30|CP024104|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053818 (Vibrio cholerae strain SA7G plasmid pSA7G1, complete sequence) position: , mismatch: 9, identity: 0.7

aaagaccctacacataatgaatggaaatat	CRISPR spacer
cgcgtaccgacacataatgaatggaaagtg	Protospacer
 . *  ** ******************   

8. spacer 2.3|2037881|30|CP024104|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016596 (Bacillus cereus strain K8 plasmid pBCM301, complete sequence) position: , mismatch: 9, identity: 0.7

tacaaaaacaaatgaaattatcgatagccg	CRISPR spacer
agaaaaaacacatgaaattatccataaagt	Protospacer
 . ******* *********** ***.   

9. spacer 2.3|2037881|30|CP024104|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007513 (Bacillus bombysepticus plasmid pBb, complete genome) position: , mismatch: 9, identity: 0.7

tacaaaaacaaatgaaattatcgatagccg	CRISPR spacer
agaaaaaacacatgaaattatccataaagt	Protospacer
 . ******* *********** ***.   

10. spacer 2.3|2037881|30|CP024104|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010112 (Bacillus thuringiensis serovar indiana strain HD521 plasmid pBTHD521-6, complete sequence) position: , mismatch: 9, identity: 0.7

tacaaaaacaaatgaaattatcgatagccg	CRISPR spacer
agaaaaaacacatgaaattatccataaagt	Protospacer
 . ******* *********** ***.   

11. spacer 2.3|2037881|30|CP024104|PILER-CR,CRISPRCasFinder,CRT matches to MH616843 (Inoviridae sp. isolate ctbd25, complete genome) position: , mismatch: 9, identity: 0.7

tacaaaaacaaatgaaattatcgatagccg	CRISPR spacer
agcaaaaacaaatgaaagtatcggtcttaa	Protospacer
 .*************** *****.*  . .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 269579 : 277557 6 uncultured_virus(33.33%) NA NA
DBSCAN-SWA_2 310526 : 318898 8 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_3 975801 : 1017040 50 Bacillus_phage(44.44%) capsid,terminase,head,portal,protease,tail NA
DBSCAN-SWA_4 1021752 : 1028253 12 uncultured_Caudovirales_phage(44.44%) holin NA
DBSCAN-SWA_5 1098860 : 1164947 58 Escherichia_phage(18.18%) bacteriocin,coat,integrase attL 1138558:1138585|attR 1167569:1167596
DBSCAN-SWA_6 1978382 : 1986515 9 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_7 2278047 : 2344211 54 Bacillus_phage(42.86%) holin,bacteriocin,transposase NA
DBSCAN-SWA_8 2348739 : 2392446 56 Bacillus_phage(46.67%) portal,integrase,capsid,tail attL 2339786:2339845|attR 2392536:2393057
DBSCAN-SWA_9 2742698 : 2817136 84 Bacillus_phage(78.72%) holin,tRNA,capsid,terminase,head,integrase,portal,protease,tail attL 2774240:2774257|attR 2823857:2823874
DBSCAN-SWA_10 3080667 : 3121649 56 Bacillus_phage(87.76%) holin,terminase,head,portal,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage