Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP033125 Acinetobacter wuhouensis strain WCHAW010062 plasmid p5_010062, complete sequence 0 crisprs NA 0 0 0 0
CP033122 Acinetobacter wuhouensis strain WCHAW010062 plasmid p2_010062, complete sequence 0 crisprs NA 0 0 0 0
CP033132 Acinetobacter wuhouensis strain WCHAW010062 plasmid pOXA653_010062, complete sequence 1 crisprs NA 0 1 0 0
CP033124 Acinetobacter wuhouensis strain WCHAW010062 plasmid p4_010062, complete sequence 0 crisprs NA 0 0 0 0
CP033131 Acinetobacter wuhouensis strain WCHAW010062 plasmid pOXA58_010062, complete sequence 0 crisprs WYL 0 0 0 0
CP033123 Acinetobacter wuhouensis strain WCHAW010062 plasmid p3_010062, complete sequence 0 crisprs NA 0 0 0 0
CP033127 Acinetobacter wuhouensis strain WCHAW010062 plasmid p7_010062, complete sequence 0 crisprs NA 0 0 0 0
CP033128 Acinetobacter wuhouensis strain WCHAW010062 plasmid p8_010062, complete sequence 0 crisprs NA 0 0 0 0
CP033130 Acinetobacter wuhouensis strain WCHAW010062 plasmid pOXA23_010062, complete sequence 0 crisprs DEDDh 0 0 1 0
CP033118 Acinetobacter wuhouensis strain WCHAW010062 plasmid p10_010062, complete sequence 0 crisprs NA 0 0 0 0
CP033126 Acinetobacter wuhouensis strain WCHAW010062 plasmid p6_010062, complete sequence 0 crisprs NA 0 0 0 0
CP033121 Acinetobacter wuhouensis strain WCHAW010062 plasmid p12_010062, complete sequence 0 crisprs NA 0 0 0 0
CP033133 Acinetobacter wuhouensis strain WCHAW010062 chromosome, complete genome 2 crisprs DEDDh,csa3,WYL,cas3,cas6f,cas7f,cas5f,cas8f,cas3f,cas1,TnsE_C 1 27 7 1
CP033119 Acinetobacter wuhouensis strain WCHAW010062 plasmid p1_010062, complete sequence 0 crisprs NA 0 0 0 0
CP033129 Acinetobacter wuhouensis strain WCHAW010062 plasmid p9_010062, complete sequence 0 crisprs NA 0 0 0 0
CP033120 Acinetobacter wuhouensis strain WCHAW010062 plasmid p11_010062, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. CP033132
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033132_1 8634-8729 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP044476 Acinetobacter schindleri strain HZE33-1 plasmid pHZE33-1-2, complete sequence 6018-6049 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP044476 Acinetobacter schindleri strain HZE33-1 plasmid pHZE33-1-2, complete sequence 6039-6070 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_LR026972 Acinetobacter baumannii strain KCRI-28 isolate RDK36_28 plasmid pKCRI-28-1, complete sequence 14314-14345 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_LR026972 Acinetobacter baumannii strain KCRI-28 isolate RDK36_28 plasmid pKCRI-28-1, complete sequence 14335-14366 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP023027 Acinetobacter baumannii strain 10042 plasmid pAba10042a, complete sequence 2706-2737 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP023027 Acinetobacter baumannii strain 10042 plasmid pAba10042a, complete sequence 2727-2758 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP020587 Acinetobacter nosocomialis strain SSA3 plasmid pSSA3_1, complete sequence 1572-1603 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP020587 Acinetobacter nosocomialis strain SSA3 plasmid pSSA3_1, complete sequence 1593-1624 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP021348 Acinetobacter baumannii strain B8300 plasmid pB8300, complete sequence 15134-15165 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP021348 Acinetobacter baumannii strain B8300 plasmid pB8300, complete sequence 15155-15186 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP023021 Acinetobacter baumannii strain 9201 plasmid pAba9201a, complete sequence 4058-4089 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP023021 Acinetobacter baumannii strain 9201 plasmid pAba9201a, complete sequence 4079-4110 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_KY499579 Acinetobacter pittii strain CCBH10253 plasmid pAP10253-1, complete sequence 6031-6062 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_KY499579 Acinetobacter pittii strain CCBH10253 plasmid pAP10253-1, complete sequence 6052-6083 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP027248 Acinetobacter pittii strain WCHAP100004 plasmid p2_100004, complete sequence 13480-13511 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP027248 Acinetobacter pittii strain WCHAP100004 plasmid p2_100004, complete sequence 13501-13532 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP028570 Acinetobacter pittii strain WCHAP005046 plasmid p2_005046, complete sequence 3684-3715 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP028570 Acinetobacter pittii strain WCHAP005046 plasmid p2_005046, complete sequence 3705-3736 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP031994 Acinetobacter haemolyticus strain 2126ch plasmid pAhaem2126chd, complete sequence 2307-2338 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP031994 Acinetobacter haemolyticus strain 2126ch plasmid pAhaem2126chd, complete sequence 2328-2359 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP044462 Acinetobacter indicus strain B18 plasmid pB18-7, complete sequence 3598-3629 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP044462 Acinetobacter indicus strain B18 plasmid pB18-7, complete sequence 3619-3650 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NC_010481 Acinetobacter baumannii plasmid pABIR, complete sequence 228-259 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NC_010481 Acinetobacter baumannii plasmid pABIR, complete sequence 249-280 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 CP033542 Acinetobacter pittii strain 2014S06-099 plasmid p2014S06-099-2, complete sequence 59-90 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 CP033542 Acinetobacter pittii strain 2014S06-099 plasmid p2014S06-099-2, complete sequence 80-111 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP038648 Acinetobacter baumannii strain ACN21 plasmid unnamed4, complete sequence 1817-1848 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP038648 Acinetobacter baumannii strain ACN21 plasmid unnamed4, complete sequence 1838-1869 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 CP033571 Acinetobacter pittii strain 2014N21-145 plasmid p2014N21-145-3, complete sequence 6654-6685 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 CP033571 Acinetobacter pittii strain 2014N21-145 plasmid p2014N21-145-3, complete sequence 6675-6706 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP033132 Acinetobacter wuhouensis strain WCHAW010062 plasmid pOXA653_010062, complete sequence 8645-8676 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP033132 Acinetobacter wuhouensis strain WCHAW010062 plasmid pOXA653_010062, complete sequence 8666-8697 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP033752 Acinetobacter baumannii strain FDAARGOS_540 plasmid unnamed2, complete sequence 9523-9554 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP033752 Acinetobacter baumannii strain FDAARGOS_540 plasmid unnamed2, complete sequence 9544-9575 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP027252 Acinetobacter pittii strain WCHAP100020 plasmid p2_100020, complete sequence 8103-8134 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP027252 Acinetobacter pittii strain WCHAP100020 plasmid p2_100020, complete sequence 8124-8155 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_LT984691 Acinetobacter baumannii isolate K50 plasmid II, complete sequence 9414-9445 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_LT984691 Acinetobacter baumannii isolate K50 plasmid II, complete sequence 9435-9466 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP029572 Acinetobacter baumannii strain DA33098 plasmid pDA33098-9-2, complete sequence 6928-6959 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP029572 Acinetobacter baumannii strain DA33098 plasmid pDA33098-9-2, complete sequence 6949-6980 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 MN461228 Acinetobacter pittii strain A2584 plasmid pA2584, complete sequence 3638-3669 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 MN461228 Acinetobacter pittii strain A2584 plasmid pA2584, complete sequence 3659-3690 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 MN481286 Acinetobacter baylyi strain A2702 plasmid pA2702, complete sequence 2718-2749 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 MN481286 Acinetobacter baylyi strain A2702 plasmid pA2702, complete sequence 2739-2770 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 MN495625 Acinetobacter baumannii strain A2485 plasmid pA2485, complete sequence 8318-8349 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 MN495625 Acinetobacter baumannii strain A2485 plasmid pA2485, complete sequence 8339-8370 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 MN495626 Acinetobacter baumannii strain A2503 plasmid pA2503, complete sequence 8318-8349 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 MN495626 Acinetobacter baumannii strain A2503 plasmid pA2503, complete sequence 8339-8370 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP051871 Acinetobacter baumannii strain Ab-D10a-a plasmid pAb-D10a-a_2, complete sequence 2122-2153 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP051871 Acinetobacter baumannii strain Ab-D10a-a plasmid pAb-D10a-a_2, complete sequence 2143-2174 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NC_013506 Acinetobacter baumannii plasmid pMMCU2, complete sequence 8537-8568 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NC_013506 Acinetobacter baumannii plasmid pMMCU2, complete sequence 8558-8589 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 MK978160 Acinetobacter lwoffii strain M2a plasmid pAVAci119, complete sequence 2818-2849 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 MK978160 Acinetobacter lwoffii strain M2a plasmid pAVAci119, complete sequence 2839-2870 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NC_013056 Acinetobacter calcoaceticus strain Acal H12O-07 plasmid pMMCU1, complete sequence 7752-7783 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NC_013056 Acinetobacter calcoaceticus strain Acal H12O-07 plasmid pMMCU1, complete sequence 7773-7804 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 CP042207 Acinetobacter baumannii strain DS002 plasmid pTS9900, complete sequence 8144-8175 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 CP042207 Acinetobacter baumannii strain DS002 plasmid pTS9900, complete sequence 8165-8196 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP042367 Acinetobacter pittii strain C54 plasmid pC54_003, complete sequence 10198-10229 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP042367 Acinetobacter pittii strain C54 plasmid pC54_003, complete sequence 10219-10250 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP018141 Acinetobacter larvae strain BRTC-1 plasmid pRW1, complete sequence 4129-4160 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP018141 Acinetobacter larvae strain BRTC-1 plasmid pRW1, complete sequence 4150-4181 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP038260 Acinetobacter baumannii strain 39741 plasmid pEH_gr3, complete sequence 10478-10509 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP038260 Acinetobacter baumannii strain 39741 plasmid pEH_gr3, complete sequence 10499-10530 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP049810 Acinetobacter pittii strain A1254 plasmid pA1254_4, complete sequence 7568-7599 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP049810 Acinetobacter pittii strain A1254 plasmid pA1254_4, complete sequence 7589-7620 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP015146 Acinetobacter pittii strain IEC338SC plasmid pIEC338SCOX, complete sequence 247-278 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP015146 Acinetobacter pittii strain IEC338SC plasmid pIEC338SCOX, complete sequence 268-299 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP051877 Acinetobacter baumannii strain Ab-B004d-c plasmid pAb-B004d-c_2, complete sequence 1389-1420 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP051877 Acinetobacter baumannii strain Ab-B004d-c plasmid pAb-B004d-c_2, complete sequence 1410-1441 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP031981 Acinetobacter haemolyticus strain AN4 plasmid pAhaemAN4c, complete sequence 759-790 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP031981 Acinetobacter haemolyticus strain AN4 plasmid pAhaemAN4c, complete sequence 780-811 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP026427 Acinetobacter sp. ACNIH1 plasmid unnamed, complete sequence 6952-6983 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP026427 Acinetobacter sp. ACNIH1 plasmid unnamed, complete sequence 6973-7004 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP014479 Acinetobacter pittii strain AP_882 plasmid pOXA58-AP_882, complete sequence 17984-18015 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP014479 Acinetobacter pittii strain AP_882 plasmid pOXA58-AP_882, complete sequence 18005-18036 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP016899 Acinetobacter soli strain GFJ2 plasmid pGFJ3, complete sequence 2195-2226 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP016899 Acinetobacter soli strain GFJ2 plasmid pGFJ3, complete sequence 2216-2247 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP051868 Acinetobacter baumannii strain Ab-C63 plasmid pAb-C63_2, complete sequence 7686-7717 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP051868 Acinetobacter baumannii strain Ab-C63 plasmid pAb-C63_2, complete sequence 7707-7738 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NC_019280 Acinetobacter baumannii plasmid pMMD, complete sequence 7703-7734 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NC_019280 Acinetobacter baumannii plasmid pMMD, complete sequence 7724-7755 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP023035 Acinetobacter baumannii strain 5845 plasmid pAba5845a, complete sequence 2972-3003 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP023035 Acinetobacter baumannii strain 5845 plasmid pAba5845a, complete sequence 2993-3024 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_KT022421 Acinetobacter baumannii strain ML plasmid pAB-ML, complete sequence 4250-4281 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_KT022421 Acinetobacter baumannii strain ML plasmid pAB-ML, complete sequence 4271-4302 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP032127 Acinetobacter chinensis strain WCHAc010005 plasmid p1_010005, complete sequence 18027-18058 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP032127 Acinetobacter chinensis strain WCHAc010005 plasmid p1_010005, complete sequence 18048-18079 0 1.0
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP015112 Acinetobacter sp. TGL-Y2 plasmid unnamed2, complete sequence 7417-7448 1 0.969
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP015112 Acinetobacter sp. TGL-Y2 plasmid unnamed2, complete sequence 7438-7469 1 0.969
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP032275 Acinetobacter sp. WCHAc010034 plasmid p7_010034, complete sequence 4788-4819 1 0.969
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP032275 Acinetobacter sp. WCHAc010034 plasmid p7_010034, complete sequence 4809-4840 1 0.969
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP010354 Acinetobacter johnsonii XBB1 plasmid pXBB1-3, complete sequence 8559-8590 1 0.969
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP010354 Acinetobacter johnsonii XBB1 plasmid pXBB1-3, complete sequence 8580-8611 1 0.969
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP050406 Acinetobacter baumannii strain VB2486 plasmid pVB2486_3, complete sequence 9450-9481 1 0.969
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP050406 Acinetobacter baumannii strain VB2486 plasmid pVB2486_3, complete sequence 9471-9502 1 0.969
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP035940 Acinetobacter cumulans strain WCHAc060092 plasmid p5_060092, complete sequence 3221-3252 1 0.969
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP035940 Acinetobacter cumulans strain WCHAc060092 plasmid p5_060092, complete sequence 3242-3273 1 0.969
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NC_014312 Klebsiella pneumoniae plasmid pKP048, complete sequence 33923-33954 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_KY399978 Vibrio cholerae O139 strain ICDC-211 plasmid pVC211, complete sequence 33736-33767 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_AP023051 Citrobacter portucalensis strain IOMTU157 plasmid pIOMTU157, complete sequence 137476-137507 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 MF399199 Acinetobacter baumannii strain D46 plasmid pD46-4, complete sequence 81897-81928 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP016764 Citrobacter freundii strain B38 plasmid pOZ181, complete sequence 208670-208701 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NC_021728 Acinetobacter baumannii BJAB07104 plasmid p2BJAB07104, complete sequence 14498-14529 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_KX443408 Klebsiella pneumoniae strain SC24 plasmid pKSC24, complete sequence 59126-59157 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_KU302802 Enterobacter cloacae strain SZECL1 plasmid pNDM1_SZ2 clone ST231, complete sequence 72945-72976 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_KX009507 Escherichia coli strain 06K2206 plasmid LM6771, complete sequence 30580-30611 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_KU302801 Enterobacter cloacae strain SZECL1 plasmid pNDM1_SZ1 clone ST231, complete sequence 72945-72976 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_KM083064 Vibrio cholerae strain ICDC-1447 plasmid pVC1447, complete sequence 11040-11071 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_KT225462 Klebsiella pneumoniae strain YDC676 plasmid pYDC676, complete sequence 15891-15922 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_KR091911 Salmonella enterica subsp. enterica serovar Corvallis strain RH-1238 plasmid pRH-1238, complete sequence 82195-82226 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP012428 Klebsiella pneumoniae strain KP5 plasmid pSg1-2, complete sequence 33092-33123 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP026156 Klebsiella pneumoniae strain B12(AN) plasmid pB12AN_1, complete sequence 5686-5717 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP040051 Acinetobacter baumannii strain VB16141 plasmid unnamed1, complete sequence 157830-157861 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NC_004464 Citrobacter freundii plasmid pCTX-M3, complete sequence 78331-78362 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NC_007682 Escherichia coli plasmid pMUR050, complete sequence 23523-23554 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP034201 Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence 269347-269378 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 CP052160 Klebsiella pneumoniae strain F16KP0084 plasmid pF16KP0084-2, complete sequence 1306-1337 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NC_021180 Klebsiella pneumoniae plasmid pNDM-1saitama01 DNA, complete sequence, strain: NDM-1saitama01 47233-47264 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 CP052311 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-2, complete sequence 123333-123364 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP027679 Salmonella enterica subsp. enterica serovar Corvallis strain 12-01738 plasmid pSE12-01738-2, complete sequence 71941-71972 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP021328 Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence 66516-66547 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP021328 Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence 379170-379201 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP029729 Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed1, complete sequence 192795-192826 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_LS992184 Citrobacter freundii isolate Citrobacter freundii str. U2785 plasmid 2, complete sequence 4269-4300 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_LS992184 Citrobacter freundii isolate Citrobacter freundii str. U2785 plasmid 2, complete sequence 172346-172377 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_KJ187752 Klebsiella pneumoniae strain 7433 plasmid pTR2, complete sequence 51083-51114 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 CP052145 Klebsiella pneumoniae strain F17KP0012 plasmid pF17KP0012-2, complete sequence 21151-21182 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_AP014650 Acinetobacter baumannii strain IOMTU433 plasmid pIOMTU433, complete sequence 1251-1282 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP044454 Acinetobacter indicus strain MMS9-2 plasmid pMMS9-2-4, complete sequence 6554-6585 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP033628 Klebsiella pneumoniae strain 4743 plasmid unnamed3, complete sequence 70170-70201 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP038646 Acinetobacter baumannii strain ACN21 plasmid unnamed2, complete sequence 1306-1337 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NC_018107 Klebsiella michiganensis E718 plasmid pKOX_R1, complete sequence 136022-136053 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NC_018107 Klebsiella michiganensis E718 plasmid pKOX_R1, complete sequence 353358-353389 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP012007 Acinetobacter baumannii strain Ab04-mff plasmid pAB04-1, complete sequence 115941-115972 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP020854 Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence 80036-80067 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 MN175387 Klebsiella pneumoniae strain KP-14-6 plasmid pKP-14-6-NDM-1, complete sequence 140438-140469 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP031563 Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence 213043-213074 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NC_019165 Klebsiella pneumoniae plasmid pKPN101-IT, complete sequence 73574-73605 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP012754 Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence 1992-2023 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 MH909331 Leclercia adecarboxylata plasmid p707804-NDM, complete sequence 140993-141024 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP031736 Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence 57768-57799 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP041083 Klebsiella pneumoniae strain Kp202 plasmid pKp202_1, complete sequence 123289-123320 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP022441 Klebsiella sp. LY plasmid unnamed3, complete sequence 252486-252517 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP036336 Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence 1306-1337 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NC_016974 Providencia stuartii plasmid pMR0211, complete sequence 129281-129312 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NC_017172 Acinetobacter baumannii MDR-ZJ06 plasmid pMDR-ZJ06, complete sequence 7220-7251 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 MN310378 Klebsiella pneumoniae strain A2293 plasmid pA2293-Ct2, complete sequence 64116-64147 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP035180 Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence 210601-210632 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 KU318419 Enterbacter aerogenes strain EA49 plasmid pEA49-KPC, complete sequence 2279-2310 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP021958 Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u 18918-18949 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_LT985387 Escherichia coli strain 694 genome assembly, plasmid: RCS55_pI 10636-10667 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP045003 Pseudomonas aeruginosa strain PAG5 plasmid pPAG5, complete sequence 96027-96058 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP036195 Klebsiella pneumoniae strain BA34918 plasmid pIncX3 46739-46770 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 LC508263 Klebsiella pneumoniae A1-3 plasmid pA1-3 DNA, complete sequence 75060-75091 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 225163-225194 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP050416 Acinetobacter baumannii strain PM193665 plasmid pPM193665_1, complete sequence 1306-1337 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NC_019063 Escherichia coli plasmid pNDM-HK, complete sequence 24804-24835 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP050426 Acinetobacter baumannii strain PM194188 plasmid pPM194122_1, complete sequence 1306-1337 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 LT009689 Klebsiella pneumoniae plasmid pIT-12C73, strain 12C73, complete sequence 71778-71809 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 CP040054 Acinetobacter baumannii strain VB35179 plasmid unnamed1, complete sequence 178122-178153 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP008933 Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence 204413-204444 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 MF344571 Pseudomonas aeruginosa plasmid pR31014-IMP, complete sequence 240182-240213 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP050433 Acinetobacter baumannii strain PM194229 plasmid pPM194229_1, complete sequence 1306-1337 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP050386 Acinetobacter baumannii strain VB82 plasmid pVB82_1, complete sequence 190142-190173 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP040726 Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence 117937-117968 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP029118 Escherichia coli strain AR435 plasmid unnamed5, complete sequence 117666-117697 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 MF344568 Pseudomonas aeruginosa plasmid p727-IMP, complete sequence 234138-234169 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 MF344570 Pseudomonas aeruginosa plasmid pA681-IMP, complete sequence 232207-232238 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP041052 Enterobacter hormaechei strain C126 plasmid pEnC126NDM, complete sequence 24288-24319 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP020068 Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence 260033-260064 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP028929 Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence 175110-175141 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 CP050162 Escherichia coli plasmid Carbapenemase(NDM-1)_IncA/C2, complete sequence 82577-82608 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP050380 Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence 186059-186090 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP031235 Escherichia coli strain Es_ST410_NW1_NDM_09_2017 plasmid pEsST410_NW_NDM, complete sequence 50975-51006 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP016921 Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence 59097-59128 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 CP050156 Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence 238004-238035 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 CP052423 Klebsiella pneumoniae strain C16KP0164 plasmid pC16KP0164-1, complete sequence 168984-169015 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP022612 Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence 131618-131649 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NC_019065 Escherichia coli plasmid pPG010208, complete sequence 20620-20651 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP026154 Klebsiella pneumoniae strain F10(AN) plasmid pF10AN_1, complete sequence 211170-211201 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP020902 Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence 85298-85329 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 LC536683 Klebsiella pneumoniae MyNCGM084 plasmid pMyNCGM084, complete sequence 23823-23854 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 LC542971 Escherichia coli IOMTU413 plasmid pIOMTU413 DNA, complete sequence 96278-96309 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 101394-101425 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_AP018748 Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence 116343-116374 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 KX957970 Vibrio parahaemolyticus plasmid pVPS43, complete sequence 110095-110126 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP021709 Klebsiella pneumoniae strain AR_0143 plasmid tig00000001_p1, complete sequence 82830-82861 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP021551 Proteus mirabilis strain AR_0159 plasmid tig00000137, complete sequence 96680-96711 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP023488 Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence 152490-152521 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 KX957969 Vibrio alginolyticus plasmid pVAS114, complete sequence 113977-114008 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP013115 Shewanella xiamenensis strain T17 plasmid pSx1, complete sequence 97345-97376 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 CP052205 Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-2, complete sequence 1306-1337 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP006799 Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence 1992-2023 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP012902 Escherichia coli strain N15-01078 plasmid pNDM15-1078, complete sequence 47690-47721 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP020596 Acinetobacter baumannii strain HWBA8 plasmid pHWBA8_1, complete sequence 9354-9385 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 208719-208750 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP032193 Salmonella enterica subsp. enterica serovar Senftenberg strain AR_0127 plasmid unnamed2, complete sequence 12765-12796 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP040260 Acinetobacter baumannii strain P7774 plasmid unnamed1, complete sequence 80809-80840 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NC_022589 Providencia rettgeri strain 09ACRGNY2001 plasmid pPrY2001, complete sequence 77049-77080 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 CP052352 Klebsiella pneumoniae strain D16KP0146 plasmid pD17KP0032-1, complete sequence 16262-16293 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP044337 Enterobacter hormaechei strain AKB48 plasmid unnamed2, complete sequence 53382-53413 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 CP007579 Acinetobacter baumannii AC30 plasmid pAC30b, complete sequence 6758-6789 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NC_019360 Citrobacter freundii plasmid pNDM-CIT, complete sequence 31352-31383 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP043933 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence 161706-161737 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 CP046598 Acinetobacter indicus strain FS42-2 plasmid pFS42-2-3, complete sequence 3413-3444 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP030345 Enterobacter hormaechei strain AR_038 plasmid unnamed1 10319-10350 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP030345 Enterobacter hormaechei strain AR_038 plasmid unnamed1 132235-132266 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_AP018830 Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence 189638-189669 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 CP052393 Klebsiella pneumoniae strain C17KP0040 plasmid pC17KP0040-1, complete sequence 16262-16293 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP026014 Klebsiella variicola strain 13450 plasmid p13450-1, complete sequence 52169-52200 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP026014 Klebsiella variicola strain 13450 plasmid p13450-1, complete sequence 263190-263221 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_AP018143 Escherichia coli strain M214 isolate M214 plasmid pM214_AC2, complete sequence 126288-126319 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_AP018145 Escherichia coli strain M216 isolate M216 plasmid pM216_AC2, complete sequence 145049-145080 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 CP052316 Klebsiella pneumoniae strain E16KP0093 plasmid pE16KP0093-1, complete sequence 1306-1337 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_LN831184 Vibrio cholerae isolate V. cholerae 116-14 plasmid pNDM-116-14, complete sequence 232232-232263 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_LN831185 Vibrio cholerae isolate V. cholerae 116-17a plasmid pNDM-116-17, complete sequence 74417-74448 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 MN937241 Enterobacter cloacae strain BSI034 plasmid pBSI034-MCR9, complete sequence 107980-108011 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_LT985241 Escherichia coli strain 721 plasmid RCS40_p, complete sequence 33073-33104 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 LC505604 Klebsiella pneumoniae A1-1 plasmid pKp1-1 genomic DNA, complete sequence 75060-75091 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 LC508722 Klebsiella pneumoniae A2-1 plasmid pA2-4 DNA, complete sequence 75060-75091 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_MN101852 Escherichia coli strain 13ZX28-TC-98 plasmid p13ZX28-TC-98, complete sequence 18954-18985 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_MK262712 Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence 174691-174722 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_MN101850 Escherichia coli strain 13ZX28 plasmid p13ZX28-272, complete sequence 214047-214078 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_MN101853 Escherichia coli strain 13ZX36 plasmid p13ZX36-200, complete sequence 140400-140431 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NC_019889 Klebsiella pneumoniae strain 601 plasmid pNDM-OM, complete sequence 62261-62292 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 MN657249 Enterobacteriaceae bacterium strain 1086-16 plasmid pKP39-T3, complete sequence 111158-111189 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 MN657250 Enterobacteriaceae bacterium strain 1083-16 plasmid pKP39-T4, complete sequence 111194-111225 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 MN657252 Enterobacteriaceae bacterium strain 21-16 plasmid pPS-T1, complete sequence 134420-134451 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 65657-65688 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_MH011352 Klebsiella pneumoniae strain 185 plasmid pNDM-185, complete sequence 180693-180724 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_MK413720 Enterobacter cloacae strain 12949 plasmid p12949-HI2, complete sequence 121318-121349 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP016215 Pseudomonas aeruginosa strain PA121617 plasmid pBM413, complete sequence 75770-75801 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 MN657241 Enterobacteriaceae bacterium strain 20-16 plasmid pCF104a-T3, complete sequence 132511-132542 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP012903 Providencia rettgeri strain N15-01091 plasmid pNDM15-1091, complete sequence 49446-49477 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_MH001166 Escherichia coli strain TAEC1 plasmid pNDM-TAEC1, complete sequence 159056-159087 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_MF344561 Klebsiella pneumoniae strain 11219 plasmid p11219-IMP, complete sequence 193045-193076 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_MF344561 Klebsiella pneumoniae strain 11219 plasmid p11219-IMP, complete sequence 294301-294332 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_MF344565 Klebsiella pneumoniae strain 19051 plasmid p19051-IMP, complete sequence 151708-151739 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_MF344565 Klebsiella pneumoniae strain 19051 plasmid p19051-IMP, complete sequence 287996-288027 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_MF344562 Klebsiella pneumoniae strain 12208 plasmid p12208-IMP, complete sequence 166624-166655 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_MF344562 Klebsiella pneumoniae strain 12208 plasmid p12208-IMP, complete sequence 302552-302583 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_MF344564 Klebsiella pneumoniae strain 13450 plasmid p13450-IMP, complete sequence 183933-183964 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_MF344564 Klebsiella pneumoniae strain 13450 plasmid p13450-IMP, complete sequence 317390-317421 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_MF344572 Enterobacter hormaechei strain 24845 plasmid p24845-Ct2, complete sequence 88579-88610 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_MG450360 Escherichia coli strain AMA566 plasmid pAMA566, complete sequence 134913-134944 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_MH892479 Citrobacter freundii strain 2262 plasmid pNDM-2262, complete sequence 150519-150550 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP049048 Enterobacter hormaechei strain Y233 plasmid p233-142, complete sequence 72812-72843 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NC_021732 Acinetobacter baumannii BJAB0868 plasmid p3BJAB0868, complete sequence 15627-15658 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP044468 Acinetobacter schindleri strain HZE23-1 plasmid pHZE23-1-5, complete sequence 5814-5845 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_KY883660 Pseudomonas putida strain SY153 plasmid pSY153-MDR, complete sequence 257700-257731 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_MF072965 Citrobacter freundii strain P10159 plasmid pP10159-5, complete sequence 138794-138825 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_MG288680 Klebsiella pneumoniae strain D610 plasmid pD610-HI2, complete sequence 121625-121656 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 247967-247998 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_MG288682 Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence 74577-74608 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 247998-248029 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_MF344582 Citrobacter freundii strain 525011 plasmid p525011-HI2, complete sequence 143388-143419 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP040068 Escherichia coli strain A1_181 plasmid p_unnamed1_KPC2, complete sequence 124572-124603 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP034406 Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence 244179-244210 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 MN661402 Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-IMP,KPC, complete sequence 279108-279139 7 0.781
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP032275 Acinetobacter sp. WCHAc010034 plasmid p7_010034, complete sequence 4767-4798 8 0.75
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP050406 Acinetobacter baumannii strain VB2486 plasmid pVB2486_3, complete sequence 9492-9523 8 0.75
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP035940 Acinetobacter cumulans strain WCHAc060092 plasmid p5_060092, complete sequence 3200-3231 8 0.75
CP033132_1 1.1|8666|32|CP033132|CRISPRCasFinder 8666-8697 32 NZ_CP033846 Klebsiella oxytoca strain FDAARGOS_500 plasmid unnamed2, complete sequence 381-412 10 0.688

1. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP044476 (Acinetobacter schindleri strain HZE33-1 plasmid pHZE33-1-2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

2. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP044476 (Acinetobacter schindleri strain HZE33-1 plasmid pHZE33-1-2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

3. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_LR026972 (Acinetobacter baumannii strain KCRI-28 isolate RDK36_28 plasmid pKCRI-28-1, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

4. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_LR026972 (Acinetobacter baumannii strain KCRI-28 isolate RDK36_28 plasmid pKCRI-28-1, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

5. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP023027 (Acinetobacter baumannii strain 10042 plasmid pAba10042a, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

6. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP023027 (Acinetobacter baumannii strain 10042 plasmid pAba10042a, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

7. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP020587 (Acinetobacter nosocomialis strain SSA3 plasmid pSSA3_1, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

8. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP020587 (Acinetobacter nosocomialis strain SSA3 plasmid pSSA3_1, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

9. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP021348 (Acinetobacter baumannii strain B8300 plasmid pB8300, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

10. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP021348 (Acinetobacter baumannii strain B8300 plasmid pB8300, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

11. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP023021 (Acinetobacter baumannii strain 9201 plasmid pAba9201a, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

12. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP023021 (Acinetobacter baumannii strain 9201 plasmid pAba9201a, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

13. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_KY499579 (Acinetobacter pittii strain CCBH10253 plasmid pAP10253-1, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

14. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_KY499579 (Acinetobacter pittii strain CCBH10253 plasmid pAP10253-1, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

15. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP027248 (Acinetobacter pittii strain WCHAP100004 plasmid p2_100004, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

16. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP027248 (Acinetobacter pittii strain WCHAP100004 plasmid p2_100004, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

17. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP028570 (Acinetobacter pittii strain WCHAP005046 plasmid p2_005046, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

18. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP028570 (Acinetobacter pittii strain WCHAP005046 plasmid p2_005046, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

19. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP031994 (Acinetobacter haemolyticus strain 2126ch plasmid pAhaem2126chd, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

20. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP031994 (Acinetobacter haemolyticus strain 2126ch plasmid pAhaem2126chd, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

21. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP044462 (Acinetobacter indicus strain B18 plasmid pB18-7, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

22. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP044462 (Acinetobacter indicus strain B18 plasmid pB18-7, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

23. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NC_010481 (Acinetobacter baumannii plasmid pABIR, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

24. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NC_010481 (Acinetobacter baumannii plasmid pABIR, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

25. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to CP033542 (Acinetobacter pittii strain 2014S06-099 plasmid p2014S06-099-2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

26. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to CP033542 (Acinetobacter pittii strain 2014S06-099 plasmid p2014S06-099-2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

27. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP038648 (Acinetobacter baumannii strain ACN21 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

28. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP038648 (Acinetobacter baumannii strain ACN21 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

29. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to CP033571 (Acinetobacter pittii strain 2014N21-145 plasmid p2014N21-145-3, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

30. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to CP033571 (Acinetobacter pittii strain 2014N21-145 plasmid p2014N21-145-3, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

31. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP033132 (Acinetobacter wuhouensis strain WCHAW010062 plasmid pOXA653_010062, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

32. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP033132 (Acinetobacter wuhouensis strain WCHAW010062 plasmid pOXA653_010062, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

33. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP033752 (Acinetobacter baumannii strain FDAARGOS_540 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

34. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP033752 (Acinetobacter baumannii strain FDAARGOS_540 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

35. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP027252 (Acinetobacter pittii strain WCHAP100020 plasmid p2_100020, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

36. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP027252 (Acinetobacter pittii strain WCHAP100020 plasmid p2_100020, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

37. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_LT984691 (Acinetobacter baumannii isolate K50 plasmid II, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

38. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_LT984691 (Acinetobacter baumannii isolate K50 plasmid II, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

39. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP029572 (Acinetobacter baumannii strain DA33098 plasmid pDA33098-9-2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

40. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP029572 (Acinetobacter baumannii strain DA33098 plasmid pDA33098-9-2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

41. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to MN461228 (Acinetobacter pittii strain A2584 plasmid pA2584, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

42. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to MN461228 (Acinetobacter pittii strain A2584 plasmid pA2584, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

43. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to MN481286 (Acinetobacter baylyi strain A2702 plasmid pA2702, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

44. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to MN481286 (Acinetobacter baylyi strain A2702 plasmid pA2702, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

45. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to MN495625 (Acinetobacter baumannii strain A2485 plasmid pA2485, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

46. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to MN495625 (Acinetobacter baumannii strain A2485 plasmid pA2485, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

47. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to MN495626 (Acinetobacter baumannii strain A2503 plasmid pA2503, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

48. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to MN495626 (Acinetobacter baumannii strain A2503 plasmid pA2503, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

49. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP051871 (Acinetobacter baumannii strain Ab-D10a-a plasmid pAb-D10a-a_2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

50. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP051871 (Acinetobacter baumannii strain Ab-D10a-a plasmid pAb-D10a-a_2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

51. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NC_013506 (Acinetobacter baumannii plasmid pMMCU2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

52. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NC_013506 (Acinetobacter baumannii plasmid pMMCU2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

53. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to MK978160 (Acinetobacter lwoffii strain M2a plasmid pAVAci119, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

54. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to MK978160 (Acinetobacter lwoffii strain M2a plasmid pAVAci119, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

55. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NC_013056 (Acinetobacter calcoaceticus strain Acal H12O-07 plasmid pMMCU1, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

56. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NC_013056 (Acinetobacter calcoaceticus strain Acal H12O-07 plasmid pMMCU1, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

57. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to CP042207 (Acinetobacter baumannii strain DS002 plasmid pTS9900, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

58. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to CP042207 (Acinetobacter baumannii strain DS002 plasmid pTS9900, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

59. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP042367 (Acinetobacter pittii strain C54 plasmid pC54_003, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

60. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP042367 (Acinetobacter pittii strain C54 plasmid pC54_003, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

61. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP018141 (Acinetobacter larvae strain BRTC-1 plasmid pRW1, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

62. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP018141 (Acinetobacter larvae strain BRTC-1 plasmid pRW1, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

63. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP038260 (Acinetobacter baumannii strain 39741 plasmid pEH_gr3, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

64. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP038260 (Acinetobacter baumannii strain 39741 plasmid pEH_gr3, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

65. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP049810 (Acinetobacter pittii strain A1254 plasmid pA1254_4, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

66. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP049810 (Acinetobacter pittii strain A1254 plasmid pA1254_4, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

67. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP015146 (Acinetobacter pittii strain IEC338SC plasmid pIEC338SCOX, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

68. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP015146 (Acinetobacter pittii strain IEC338SC plasmid pIEC338SCOX, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

69. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP051877 (Acinetobacter baumannii strain Ab-B004d-c plasmid pAb-B004d-c_2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

70. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP051877 (Acinetobacter baumannii strain Ab-B004d-c plasmid pAb-B004d-c_2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

71. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP031981 (Acinetobacter haemolyticus strain AN4 plasmid pAhaemAN4c, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

72. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP031981 (Acinetobacter haemolyticus strain AN4 plasmid pAhaemAN4c, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

73. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP026427 (Acinetobacter sp. ACNIH1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

74. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP026427 (Acinetobacter sp. ACNIH1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

75. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP014479 (Acinetobacter pittii strain AP_882 plasmid pOXA58-AP_882, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

76. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP014479 (Acinetobacter pittii strain AP_882 plasmid pOXA58-AP_882, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

77. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP016899 (Acinetobacter soli strain GFJ2 plasmid pGFJ3, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

78. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP016899 (Acinetobacter soli strain GFJ2 plasmid pGFJ3, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

79. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP051868 (Acinetobacter baumannii strain Ab-C63 plasmid pAb-C63_2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

80. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP051868 (Acinetobacter baumannii strain Ab-C63 plasmid pAb-C63_2, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

81. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NC_019280 (Acinetobacter baumannii plasmid pMMD, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

82. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NC_019280 (Acinetobacter baumannii plasmid pMMD, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

83. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP023035 (Acinetobacter baumannii strain 5845 plasmid pAba5845a, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

84. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP023035 (Acinetobacter baumannii strain 5845 plasmid pAba5845a, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

85. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_KT022421 (Acinetobacter baumannii strain ML plasmid pAB-ML, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

86. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_KT022421 (Acinetobacter baumannii strain ML plasmid pAB-ML, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

87. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP032127 (Acinetobacter chinensis strain WCHAc010005 plasmid p1_010005, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

88. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP032127 (Acinetobacter chinensis strain WCHAc010005 plasmid p1_010005, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgacggattgactac	Protospacer
********************************

89. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP015112 (Acinetobacter sp. TGL-Y2 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactaccaactatgacggattgactac	Protospacer
***********.********************

90. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP015112 (Acinetobacter sp. TGL-Y2 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactaccaactatgacggattgactac	Protospacer
***********.********************

91. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP032275 (Acinetobacter sp. WCHAc010034 plasmid p7_010034, complete sequence) position: , mismatch: 1, identity: 0.969

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgagggattgactac	Protospacer
******************** ***********

92. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP032275 (Acinetobacter sp. WCHAc010034 plasmid p7_010034, complete sequence) position: , mismatch: 1, identity: 0.969

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgagggattgactac	Protospacer
******************** ***********

93. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP010354 (Acinetobacter johnsonii XBB1 plasmid pXBB1-3, complete sequence) position: , mismatch: 1, identity: 0.969

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgagggattgactac	Protospacer
******************** ***********

94. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP010354 (Acinetobacter johnsonii XBB1 plasmid pXBB1-3, complete sequence) position: , mismatch: 1, identity: 0.969

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgagggattgactac	Protospacer
******************** ***********

95. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP050406 (Acinetobacter baumannii strain VB2486 plasmid pVB2486_3, complete sequence) position: , mismatch: 1, identity: 0.969

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgagggattgactac	Protospacer
******************** ***********

96. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP050406 (Acinetobacter baumannii strain VB2486 plasmid pVB2486_3, complete sequence) position: , mismatch: 1, identity: 0.969

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgagggattgactac	Protospacer
******************** ***********

97. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP035940 (Acinetobacter cumulans strain WCHAc060092 plasmid p5_060092, complete sequence) position: , mismatch: 1, identity: 0.969

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgagggattgactac	Protospacer
******************** ***********

98. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP035940 (Acinetobacter cumulans strain WCHAc060092 plasmid p5_060092, complete sequence) position: , mismatch: 1, identity: 0.969

ggattgactactaactatgacggattgactac	CRISPR spacer
ggattgactactaactatgagggattgactac	Protospacer
******************** ***********

99. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NC_014312 (Klebsiella pneumoniae plasmid pKP048, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

100. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_KY399978 (Vibrio cholerae O139 strain ICDC-211 plasmid pVC211, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

101. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_AP023051 (Citrobacter portucalensis strain IOMTU157 plasmid pIOMTU157, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

102. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to MF399199 (Acinetobacter baumannii strain D46 plasmid pD46-4, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

103. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP016764 (Citrobacter freundii strain B38 plasmid pOZ181, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

104. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NC_021728 (Acinetobacter baumannii BJAB07104 plasmid p2BJAB07104, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

105. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_KX443408 (Klebsiella pneumoniae strain SC24 plasmid pKSC24, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

106. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_KU302802 (Enterobacter cloacae strain SZECL1 plasmid pNDM1_SZ2 clone ST231, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

107. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_KX009507 (Escherichia coli strain 06K2206 plasmid LM6771, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

108. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_KU302801 (Enterobacter cloacae strain SZECL1 plasmid pNDM1_SZ1 clone ST231, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

109. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_KM083064 (Vibrio cholerae strain ICDC-1447 plasmid pVC1447, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

110. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_KT225462 (Klebsiella pneumoniae strain YDC676 plasmid pYDC676, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

111. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_KR091911 (Salmonella enterica subsp. enterica serovar Corvallis strain RH-1238 plasmid pRH-1238, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

112. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP012428 (Klebsiella pneumoniae strain KP5 plasmid pSg1-2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

113. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP026156 (Klebsiella pneumoniae strain B12(AN) plasmid pB12AN_1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

114. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP040051 (Acinetobacter baumannii strain VB16141 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

115. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NC_004464 (Citrobacter freundii plasmid pCTX-M3, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

116. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NC_007682 (Escherichia coli plasmid pMUR050, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

117. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP034201 (Klebsiella pneumoniae subsp. pneumoniae strain KpvST383_NDM_OXA-48 plasmid pKpvST383L, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

118. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to CP052160 (Klebsiella pneumoniae strain F16KP0084 plasmid pF16KP0084-2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

119. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NC_021180 (Klebsiella pneumoniae plasmid pNDM-1saitama01 DNA, complete sequence, strain: NDM-1saitama01) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

120. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to CP052311 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

121. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP027679 (Salmonella enterica subsp. enterica serovar Corvallis strain 12-01738 plasmid pSE12-01738-2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

122. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP021328 (Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

123. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP021328 (Raoultella ornithinolytica strain Ro24724 plasmid pRo24724, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

124. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP029729 (Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

125. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_LS992184 (Citrobacter freundii isolate Citrobacter freundii str. U2785 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

126. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_LS992184 (Citrobacter freundii isolate Citrobacter freundii str. U2785 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

127. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_KJ187752 (Klebsiella pneumoniae strain 7433 plasmid pTR2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

128. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to CP052145 (Klebsiella pneumoniae strain F17KP0012 plasmid pF17KP0012-2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

129. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_AP014650 (Acinetobacter baumannii strain IOMTU433 plasmid pIOMTU433, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

130. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP044454 (Acinetobacter indicus strain MMS9-2 plasmid pMMS9-2-4, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

131. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP033628 (Klebsiella pneumoniae strain 4743 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

132. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP038646 (Acinetobacter baumannii strain ACN21 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

133. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NC_018107 (Klebsiella michiganensis E718 plasmid pKOX_R1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

134. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NC_018107 (Klebsiella michiganensis E718 plasmid pKOX_R1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

135. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP012007 (Acinetobacter baumannii strain Ab04-mff plasmid pAB04-1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

136. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP020854 (Klebsiella pneumoniae strain KPN528 plasmid pKPN528-1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

137. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to MN175387 (Klebsiella pneumoniae strain KP-14-6 plasmid pKP-14-6-NDM-1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

138. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP031563 (Klebsiella pneumoniae strain 2-1 plasmid pKP21HI1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

139. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NC_019165 (Klebsiella pneumoniae plasmid pKPN101-IT, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

140. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP012754 (Klebsiella pneumoniae strain KP617 plasmid KP-p1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

141. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to MH909331 (Leclercia adecarboxylata plasmid p707804-NDM, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

142. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP031736 (Klebsiella pneumoniae subsp. pneumoniae strain Klebsiella pneumoniae plasmid pKPM502, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

143. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP041083 (Klebsiella pneumoniae strain Kp202 plasmid pKp202_1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

144. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP022441 (Klebsiella sp. LY plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

145. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP036336 (Klebsiella pneumoniae strain BP327 plasmid pIncHIB, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

146. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NC_016974 (Providencia stuartii plasmid pMR0211, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

147. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NC_017172 (Acinetobacter baumannii MDR-ZJ06 plasmid pMDR-ZJ06, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

148. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to MN310378 (Klebsiella pneumoniae strain A2293 plasmid pA2293-Ct2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

149. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP035180 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncFIB, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

150. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to KU318419 (Enterbacter aerogenes strain EA49 plasmid pEA49-KPC, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

151. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP021958 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000002_u) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

152. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_LT985387 (Escherichia coli strain 694 genome assembly, plasmid: RCS55_pI) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

153. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP045003 (Pseudomonas aeruginosa strain PAG5 plasmid pPAG5, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

154. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP036195 (Klebsiella pneumoniae strain BA34918 plasmid pIncX3) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

155. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to LC508263 (Klebsiella pneumoniae A1-3 plasmid pA1-3 DNA, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

156. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

157. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP050416 (Acinetobacter baumannii strain PM193665 plasmid pPM193665_1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

158. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NC_019063 (Escherichia coli plasmid pNDM-HK, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

159. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP050426 (Acinetobacter baumannii strain PM194188 plasmid pPM194122_1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

160. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to LT009689 (Klebsiella pneumoniae plasmid pIT-12C73, strain 12C73, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

161. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to CP040054 (Acinetobacter baumannii strain VB35179 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

162. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP008933 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-NDM, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

163. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to MF344571 (Pseudomonas aeruginosa plasmid pR31014-IMP, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

164. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP050433 (Acinetobacter baumannii strain PM194229 plasmid pPM194229_1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

165. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP050386 (Acinetobacter baumannii strain VB82 plasmid pVB82_1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

166. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP040726 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_virulence, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

167. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP029118 (Escherichia coli strain AR435 plasmid unnamed5, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

168. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to MF344568 (Pseudomonas aeruginosa plasmid p727-IMP, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

169. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to MF344570 (Pseudomonas aeruginosa plasmid pA681-IMP, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

170. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP041052 (Enterobacter hormaechei strain C126 plasmid pEnC126NDM, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

171. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP020068 (Klebsiella pneumoniae strain AR_0068 plasmid unitig_1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

172. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP028929 (Klebsiella pneumoniae strain AR_0153 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

173. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to CP050162 (Escherichia coli plasmid Carbapenemase(NDM-1)_IncA/C2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

174. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP050380 (Klebsiella pneumoniae strain 51015 plasmid p51015_NDM_1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

175. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP031235 (Escherichia coli strain Es_ST410_NW1_NDM_09_2017 plasmid pEsST410_NW_NDM, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

176. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP016921 (Klebsiella pneumoniae isolate 11 plasmid pIncHI1B_DHQP1300920, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

177. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to CP050156 (Klebsiella pneumoniae plasmid Carbapenemase(NDM-1)_IncH1B, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

178. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to CP052423 (Klebsiella pneumoniae strain C16KP0164 plasmid pC16KP0164-1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

179. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP022612 (Klebsiella pneumoniae strain CDC 0106 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

180. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NC_019065 (Escherichia coli plasmid pPG010208, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

181. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP026154 (Klebsiella pneumoniae strain F10(AN) plasmid pF10AN_1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

182. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP020902 (Klebsiella pneumoniae strain K66-45 plasmid pK66-45-1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

183. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to LC536683 (Klebsiella pneumoniae MyNCGM084 plasmid pMyNCGM084, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

184. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to LC542971 (Escherichia coli IOMTU413 plasmid pIOMTU413 DNA, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

185. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

186. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_AP018748 (Klebsiella pneumoniae strain KP33 plasmid pKP3301, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

187. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to KX957970 (Vibrio parahaemolyticus plasmid pVPS43, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

188. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP021709 (Klebsiella pneumoniae strain AR_0143 plasmid tig00000001_p1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

189. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP021551 (Proteus mirabilis strain AR_0159 plasmid tig00000137, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

190. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP023488 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_01, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

191. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to KX957969 (Vibrio alginolyticus plasmid pVAS114, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

192. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP013115 (Shewanella xiamenensis strain T17 plasmid pSx1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

193. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to CP052205 (Klebsiella pneumoniae strain F16KP0002 plasmid pF16KP0002-2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

194. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP006799 (Klebsiella pneumoniae subsp. pneumoniae PittNDM01 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

195. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP012902 (Escherichia coli strain N15-01078 plasmid pNDM15-1078, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

196. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP020596 (Acinetobacter baumannii strain HWBA8 plasmid pHWBA8_1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

197. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP031372 (Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

198. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP032193 (Salmonella enterica subsp. enterica serovar Senftenberg strain AR_0127 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

199. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP040260 (Acinetobacter baumannii strain P7774 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

200. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NC_022589 (Providencia rettgeri strain 09ACRGNY2001 plasmid pPrY2001, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

201. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to CP052352 (Klebsiella pneumoniae strain D16KP0146 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

202. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP044337 (Enterobacter hormaechei strain AKB48 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

203. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to CP007579 (Acinetobacter baumannii AC30 plasmid pAC30b, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

204. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NC_019360 (Citrobacter freundii plasmid pNDM-CIT, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

205. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP043933 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

206. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to CP046598 (Acinetobacter indicus strain FS42-2 plasmid pFS42-2-3, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

207. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP030345 (Enterobacter hormaechei strain AR_038 plasmid unnamed1) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

208. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP030345 (Enterobacter hormaechei strain AR_038 plasmid unnamed1) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

209. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_AP018830 (Enterobacter hormaechei subsp. xiangfangensis strain M206 plasmid pM206-NDM1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

210. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to CP052393 (Klebsiella pneumoniae strain C17KP0040 plasmid pC17KP0040-1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

211. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP026014 (Klebsiella variicola strain 13450 plasmid p13450-1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

212. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP026014 (Klebsiella variicola strain 13450 plasmid p13450-1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

213. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_AP018143 (Escherichia coli strain M214 isolate M214 plasmid pM214_AC2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

214. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_AP018145 (Escherichia coli strain M216 isolate M216 plasmid pM216_AC2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

215. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to CP052316 (Klebsiella pneumoniae strain E16KP0093 plasmid pE16KP0093-1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

216. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_LN831184 (Vibrio cholerae isolate V. cholerae 116-14 plasmid pNDM-116-14, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

217. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_LN831185 (Vibrio cholerae isolate V. cholerae 116-17a plasmid pNDM-116-17, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

218. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to MN937241 (Enterobacter cloacae strain BSI034 plasmid pBSI034-MCR9, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

219. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_LT985241 (Escherichia coli strain 721 plasmid RCS40_p, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

220. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to LC505604 (Klebsiella pneumoniae A1-1 plasmid pKp1-1 genomic DNA, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

221. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to LC508722 (Klebsiella pneumoniae A2-1 plasmid pA2-4 DNA, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

222. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_MN101852 (Escherichia coli strain 13ZX28-TC-98 plasmid p13ZX28-TC-98, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

223. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_MK262712 (Klebsiella pneumoniae strain KP18-29 plasmid p18-29-MDR, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

224. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_MN101850 (Escherichia coli strain 13ZX28 plasmid p13ZX28-272, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

225. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_MN101853 (Escherichia coli strain 13ZX36 plasmid p13ZX36-200, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

226. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NC_019889 (Klebsiella pneumoniae strain 601 plasmid pNDM-OM, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

227. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to MN657249 (Enterobacteriaceae bacterium strain 1086-16 plasmid pKP39-T3, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

228. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to MN657250 (Enterobacteriaceae bacterium strain 1083-16 plasmid pKP39-T4, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

229. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to MN657252 (Enterobacteriaceae bacterium strain 21-16 plasmid pPS-T1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

230. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

231. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_MH011352 (Klebsiella pneumoniae strain 185 plasmid pNDM-185, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

232. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_MK413720 (Enterobacter cloacae strain 12949 plasmid p12949-HI2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

233. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP016215 (Pseudomonas aeruginosa strain PA121617 plasmid pBM413, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

234. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to MN657241 (Enterobacteriaceae bacterium strain 20-16 plasmid pCF104a-T3, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

235. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP012903 (Providencia rettgeri strain N15-01091 plasmid pNDM15-1091, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

236. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_MH001166 (Escherichia coli strain TAEC1 plasmid pNDM-TAEC1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

237. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_MF344561 (Klebsiella pneumoniae strain 11219 plasmid p11219-IMP, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

238. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_MF344561 (Klebsiella pneumoniae strain 11219 plasmid p11219-IMP, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

239. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_MF344565 (Klebsiella pneumoniae strain 19051 plasmid p19051-IMP, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

240. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_MF344565 (Klebsiella pneumoniae strain 19051 plasmid p19051-IMP, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

241. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_MF344562 (Klebsiella pneumoniae strain 12208 plasmid p12208-IMP, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

242. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_MF344562 (Klebsiella pneumoniae strain 12208 plasmid p12208-IMP, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

243. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_MF344564 (Klebsiella pneumoniae strain 13450 plasmid p13450-IMP, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

244. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_MF344564 (Klebsiella pneumoniae strain 13450 plasmid p13450-IMP, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

245. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_MF344572 (Enterobacter hormaechei strain 24845 plasmid p24845-Ct2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

246. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_MG450360 (Escherichia coli strain AMA566 plasmid pAMA566, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

247. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_MH892479 (Citrobacter freundii strain 2262 plasmid pNDM-2262, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

248. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP049048 (Enterobacter hormaechei strain Y233 plasmid p233-142, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

249. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NC_021732 (Acinetobacter baumannii BJAB0868 plasmid p3BJAB0868, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

250. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP044468 (Acinetobacter schindleri strain HZE23-1 plasmid pHZE23-1-5, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

251. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_KY883660 (Pseudomonas putida strain SY153 plasmid pSY153-MDR, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

252. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_MF072965 (Citrobacter freundii strain P10159 plasmid pP10159-5, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

253. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_MG288680 (Klebsiella pneumoniae strain D610 plasmid pD610-HI2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

254. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

255. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_MG288682 (Klebsiella aerogenes strain E20 plasmid pE20-HI3, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

256. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

257. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_MF344582 (Citrobacter freundii strain 525011 plasmid p525011-HI2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

258. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP040068 (Escherichia coli strain A1_181 plasmid p_unnamed1_KPC2, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

259. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP034406 (Klebsiella pneumoniae strain NH34 plasmid pNH34.1, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

260. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to MN661402 (Klebsiella quasipneumoniae strain KP18-31 plasmid pKP18-31-IMP,KPC, complete sequence) position: , mismatch: 7, identity: 0.781

ggattgactactaactatgacggattgactac	CRISPR spacer
gaactagcaacgaactatgacgaattgactac	Protospacer
*.*.*..* ** **********.*********

261. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP032275 (Acinetobacter sp. WCHAc010034 plasmid p7_010034, complete sequence) position: , mismatch: 8, identity: 0.75

ggattgactactaactatgacggattgactac	CRISPR spacer
ctttcagctcctaactatgagggattgactac	Protospacer
   *...** ********** ***********

262. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP050406 (Acinetobacter baumannii strain VB2486 plasmid pVB2486_3, complete sequence) position: , mismatch: 8, identity: 0.75

ggattgactactaactatgacggattgactac	CRISPR spacer
ctttcagctcctaactatgagggattgactac	Protospacer
   *...** ********** ***********

263. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP035940 (Acinetobacter cumulans strain WCHAc060092 plasmid p5_060092, complete sequence) position: , mismatch: 8, identity: 0.75

ggattgactactaactatgacggattgactac	CRISPR spacer
ctttcagctcctaactatgagggattgactac	Protospacer
   *...** ********** ***********

264. spacer 1.1|8666|32|CP033132|CRISPRCasFinder matches to NZ_CP033846 (Klebsiella oxytoca strain FDAARGOS_500 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

ggattgactactaactatgacggattgactac	CRISPR spacer
acagcagaaactaaacatgacggattgactac	Protospacer
. * ...  ***** .****************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP033130
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 182415 : 238692 50 Leptospira_phage(20.0%) transposase,integrase attL 182340:182399|attR 240142:241423
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. CP033133
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033133_1 2675147-2676494 TypeI-F I-F
22 spacers
cas6f,cas7f,cas5f,cas8f,cas3f,cas1

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033133_2 2737409-2738878 Orphan I-F
24 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP033133_1 1.2|2675235|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675235-2675266 32 CP033133.1 2561516-2561547 0 1.0

1. spacer 1.2|2675235|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to position: 2561516-2561547, mismatch: 0, identity: 1.0

ctaactgttgaaaaagacattaaatctaaagc	CRISPR spacer
ctaactgttgaaaaagacattaaatctaaagc	Protospacer
********************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 MH047631 Microbacterium phage Triscuit, complete genome 54315-54346 3 0.906
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 MH047631 Microbacterium phage Triscuit, complete genome 54315-54346 3 0.906
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 MK977699 Gordonia Phage Lollipop1437, complete genome 64496-64527 4 0.875
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 NZ_CP017947 Bosea sp. Tri-49 plasmid unnamed1, complete sequence 34045-34076 4 0.875
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 MK977699 Gordonia Phage Lollipop1437, complete genome 64496-64527 4 0.875
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 NZ_CP017947 Bosea sp. Tri-49 plasmid unnamed1, complete sequence 34045-34076 4 0.875
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 MH019216 Streptomyces phage Wentworth, complete genome 44753-44784 5 0.844
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 MH019216 Streptomyces phage Wentworth, complete genome 44753-44784 5 0.844
CP033133_1 1.9|2675655|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675655-2675686 32 KP054477 Lactobacillus phage LfeInf, complete genome 84337-84368 6 0.812
CP033133_1 1.14|2675955|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675955-2675986 32 NZ_CP024774 Bacillus thuringiensis LM1212 plasmid pLM3, complete sequence 21475-21506 6 0.812
CP033133_1 1.14|2675955|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675955-2675986 32 NZ_CP041074 Bacillus tropicus strain LM1212-W3 plasmid p1, complete sequence 48243-48274 6 0.812
CP033133_1 1.16|2676075|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2676075-2676106 32 NZ_CP014487 Bacillus cereus strain FORC021 plasmid unnamed, complete sequence 8886-8917 6 0.812
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 NC_047973 Microbacterium phage Hyperion, complete genome 17104-17135 6 0.812
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 MN586025 Mycobacterium phage Mdavu, complete genome 1537-1568 6 0.812
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 KT281789 Mycobacterium phage Enkosi, complete genome 1537-1568 6 0.812
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 MH020245 Mycobacterium phage SgtBeansprout, complete genome 1537-1568 6 0.812
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 KX808132 Mycobacterium phage Amelie, complete genome 1537-1568 6 0.812
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 MH399770 Mycobacterium phage Biglebops, complete genome 1537-1568 6 0.812
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 MF472895 Mycobacterium phage Kimona, complete genome 26730-26761 6 0.812
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 MF919518 Mycobacterium phage LilPharaoh, complete genome 1537-1568 6 0.812
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 MN175604 Gordonia phage PhorbesPhlower, complete genome 3140-3171 6 0.812
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 NC_011370 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG203, complete sequence 307400-307431 6 0.812
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 NC_047973 Microbacterium phage Hyperion, complete genome 17104-17135 6 0.812
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 MN586025 Mycobacterium phage Mdavu, complete genome 1537-1568 6 0.812
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 KT281789 Mycobacterium phage Enkosi, complete genome 1537-1568 6 0.812
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 MH020245 Mycobacterium phage SgtBeansprout, complete genome 1537-1568 6 0.812
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 KX808132 Mycobacterium phage Amelie, complete genome 1537-1568 6 0.812
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 MH399770 Mycobacterium phage Biglebops, complete genome 1537-1568 6 0.812
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 MF472895 Mycobacterium phage Kimona, complete genome 26730-26761 6 0.812
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 MF919518 Mycobacterium phage LilPharaoh, complete genome 1537-1568 6 0.812
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 MN175604 Gordonia phage PhorbesPhlower, complete genome 3140-3171 6 0.812
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 NC_011370 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG203, complete sequence 307400-307431 6 0.812
CP033133_1 1.2|2675235|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675235-2675266 32 NZ_CP028863 Borreliella garinii strain 20047 plasmid lp28-4, complete sequence 29690-29721 7 0.781
CP033133_1 1.2|2675235|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675235-2675266 32 NZ_CP039089 Piscirickettsia salmonis strain Psal-111 plasmid unnamed2, complete sequence 1323-1354 7 0.781
CP033133_1 1.2|2675235|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675235-2675266 32 NZ_CP013669 Piscirickettsia salmonis LF-89 = ATCC VR-1361 plasmid pPSLF89-4, complete sequence 57107-57138 7 0.781
CP033133_1 1.2|2675235|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675235-2675266 32 NZ_CP013798 Piscirickettsia salmonis strain AY6532B plasmid p2PS9, complete sequence 58520-58551 7 0.781
CP033133_1 1.2|2675235|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675235-2675266 32 NZ_CP013978 Piscirickettsia salmonis strain CGR02 plasmid pPSCRG02-4, complete sequence 34757-34788 7 0.781
CP033133_1 1.2|2675235|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675235-2675266 32 NZ_CP012509 Piscirickettsia salmonis strain PM32597B1 plasmid pPSB1-1, complete sequence 16366-16397 7 0.781
CP033133_1 1.2|2675235|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675235-2675266 32 NZ_CP013789 Piscirickettsia salmonis strain PM58386B plasmid p3PS7, complete sequence 46438-46469 7 0.781
CP033133_1 1.2|2675235|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675235-2675266 32 NZ_CP013822 Piscirickettsia salmonis strain PM25344B plasmid p1PS14, complete sequence 16384-16415 7 0.781
CP033133_1 1.2|2675235|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675235-2675266 32 NZ_CP013817 Piscirickettsia salmonis strain AY3800B plasmid p1PS10, complete sequence 45397-45428 7 0.781
CP033133_1 1.2|2675235|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675235-2675266 32 NZ_CP013793 Piscirickettsia salmonis strain AY6297B plasmid p2PS8, complete sequence 45392-45423 7 0.781
CP033133_1 1.2|2675235|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675235-2675266 32 NZ_CP039052 Piscirickettsia salmonis strain Psal-081 plasmid unnamed2, complete sequence 1323-1354 7 0.781
CP033133_1 1.2|2675235|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675235-2675266 32 NZ_CP013945 Piscirickettsia salmonis strain PSCGR01 plasmid pPSCRG01-4, complete sequence 10357-10388 7 0.781
CP033133_1 1.2|2675235|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675235-2675266 32 NZ_CP039057 Piscirickettsia salmonis strain Psal-098 plasmid unnamed2, complete sequence 1323-1354 7 0.781
CP033133_1 1.2|2675235|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675235-2675266 32 NZ_CP038933 Piscirickettsia salmonis strain Psal-025 plasmid unnamed1, complete sequence 87111-87142 7 0.781
CP033133_1 1.2|2675235|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675235-2675266 32 NZ_CP038901 Piscirickettsia salmonis strain Psal-006b plasmid unnamed3, complete sequence 1323-1354 7 0.781
CP033133_1 1.2|2675235|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675235-2675266 32 NZ_CP013809 Piscirickettsia salmonis strain PM31429B plasmid p3PS12, complete sequence 46435-46466 7 0.781
CP033133_1 1.2|2675235|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675235-2675266 32 NZ_CP013784 Piscirickettsia salmonis strain PM49811B plasmid p3PS6, complete sequence 46426-46457 7 0.781
CP033133_1 1.11|2675775|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675775-2675806 32 NZ_CP039703 Clostridium butyricum strain 29-1 plasmid p-butyl_plas_29-1, complete sequence 370951-370982 7 0.781
CP033133_1 1.11|2675775|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675775-2675806 32 NZ_CP039706 Clostridium butyricum strain 4-1 plasmid p-butyl_plas_4-1, complete sequence 305032-305063 7 0.781
CP033133_1 1.11|2675775|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675775-2675806 32 NZ_CP033246 Clostridium butyricum strain CFSA3987 plasmid pCFSA3987, complete sequence 8035-8066 7 0.781
CP033133_1 1.11|2675775|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675775-2675806 32 NZ_CP033248 Clostridium butyricum strain CFSA3989 plasmid pCFSA3989, complete sequence 8076-8107 7 0.781
CP033133_1 1.11|2675775|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675775-2675806 32 NZ_AP019717 Clostridium butyricum strain NBRC 13949 plasmid pCBU1, complete sequence 340042-340073 7 0.781
CP033133_1 1.14|2675955|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675955-2675986 32 MH133207 Acinetobacter phage vB_AbaM_B9, complete genome 47283-47314 7 0.781
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 NC_010850 Rhodococcus sp. NS1 plasmid pNSL1, complete sequence 75097-75128 7 0.781
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 MN204496 Streptomyces phage Kardashian, complete genome 8965-8996 7 0.781
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 MN444877 Microbacterium phage Antares, complete genome 14357-14388 7 0.781
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5767451-5767482 7 0.781
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 MN585986 Microbacterium phage Ariadne, complete genome 15965-15996 7 0.781
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 MN586007 Microbacterium phage Smarties, complete genome 15965-15996 7 0.781
CP033133_2 2.24|2738819|32|CP033133|CRISPRCasFinder,CRT 2738819-2738850 32 NZ_CP033574 Shewanella algae strain KC-Na-R1 plasmid pKC-Na-R1, complete sequence 99040-99071 7 0.781
CP033133_2 2.24|2738819|32|CP033133|CRISPRCasFinder,CRT 2738819-2738850 32 NZ_CP015139 Escherichia coli strain Ecol_732 plasmid pEC732_IMP14, complete sequence 17986-18017 7 0.781
CP033133_2 2.24|2738819|32|CP033133|CRISPRCasFinder,CRT 2738819-2738850 32 NC_019380 Aeromonas hydrophila plasmid pR148, complete sequence 109186-109217 7 0.781
CP033133_2 2.24|2738819|32|CP033133|CRISPRCasFinder,CRT 2738819-2738850 32 NZ_MF627444 Vibrio parahaemolyticus strain Vb0267 plasmid pVb0267, complete sequence 113759-113790 7 0.781
CP033133_2 2.24|2738819|32|CP033133|CRISPRCasFinder,CRT 2738819-2738850 32 NZ_KY863418 Enterobacter asburiae strain AMA 497 plasmid pOXA436, complete sequence 126529-126560 7 0.781
CP033133_2 2.24|2738819|32|CP033133|CRISPRCasFinder,CRT 2738819-2738850 32 NZ_KY863418 Enterobacter asburiae strain AMA 497 plasmid pOXA436, complete sequence 149000-149031 7 0.781
CP033133_2 2.24|2738819|32|CP033133|CRISPRCasFinder,CRT 2738819-2738850 32 NZ_MF627445 Vibrio parahaemolyticus strain Vb0499 plasmid pVb0499, complete sequence 113756-113787 7 0.781
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 NC_010850 Rhodococcus sp. NS1 plasmid pNSL1, complete sequence 75097-75128 7 0.781
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 MN204496 Streptomyces phage Kardashian, complete genome 8965-8996 7 0.781
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 MN444877 Microbacterium phage Antares, complete genome 14357-14388 7 0.781
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5767451-5767482 7 0.781
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 MN585986 Microbacterium phage Ariadne, complete genome 15965-15996 7 0.781
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 MN586007 Microbacterium phage Smarties, complete genome 15965-15996 7 0.781
CP033133_2 2.48|2738820|32|CP033133|PILER-CR 2738820-2738851 32 NZ_CP033574 Shewanella algae strain KC-Na-R1 plasmid pKC-Na-R1, complete sequence 99040-99071 7 0.781
CP033133_2 2.48|2738820|32|CP033133|PILER-CR 2738820-2738851 32 NZ_CP015139 Escherichia coli strain Ecol_732 plasmid pEC732_IMP14, complete sequence 17986-18017 7 0.781
CP033133_2 2.48|2738820|32|CP033133|PILER-CR 2738820-2738851 32 NC_019380 Aeromonas hydrophila plasmid pR148, complete sequence 109186-109217 7 0.781
CP033133_2 2.48|2738820|32|CP033133|PILER-CR 2738820-2738851 32 NZ_MF627444 Vibrio parahaemolyticus strain Vb0267 plasmid pVb0267, complete sequence 113759-113790 7 0.781
CP033133_2 2.48|2738820|32|CP033133|PILER-CR 2738820-2738851 32 NZ_KY863418 Enterobacter asburiae strain AMA 497 plasmid pOXA436, complete sequence 126529-126560 7 0.781
CP033133_2 2.48|2738820|32|CP033133|PILER-CR 2738820-2738851 32 NZ_KY863418 Enterobacter asburiae strain AMA 497 plasmid pOXA436, complete sequence 149000-149031 7 0.781
CP033133_2 2.48|2738820|32|CP033133|PILER-CR 2738820-2738851 32 NZ_MF627445 Vibrio parahaemolyticus strain Vb0499 plasmid pVb0499, complete sequence 113756-113787 7 0.781
CP033133_1 1.2|2675235|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675235-2675266 32 NZ_CP009417 Jeotgalibacillus malaysiensis strain malaysiensis plasmid unnamed, complete sequence 333236-333267 8 0.75
CP033133_1 1.2|2675235|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675235-2675266 32 NZ_CP015439 Anoxybacillus amylolyticus strain DSM 15939 plasmid pDSM15939_1, complete sequence 103258-103289 8 0.75
CP033133_1 1.2|2675235|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675235-2675266 32 NZ_CP022536 Spiroplasma corruscae strain EC-1 plasmid unnamed, complete sequence 11939-11970 8 0.75
CP033133_1 1.7|2675535|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675535-2675566 32 NZ_KX518745 Escherichia coli strain HYEC7 plasmid pHYEC7-mcr1, complete sequence 86468-86499 8 0.75
CP033133_1 1.7|2675535|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675535-2675566 32 LC511659 Escherichia coli 2017.15.03CC plasmid p2017.15.03CC DNA, complete genome 93678-93709 8 0.75
CP033133_1 1.7|2675535|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675535-2675566 32 NZ_CP017632 Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence 105332-105363 8 0.75
CP033133_1 1.7|2675535|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675535-2675566 32 NZ_MH781719 Klebsiella pneumoniae strain SCKLB684 plasmid pSCKLB684-mcr, complete sequence 82136-82167 8 0.75
CP033133_1 1.11|2675775|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675775-2675806 32 NZ_CP013238 Clostridium butyricum strain CDC_51208 plasmid pNPD4_2, complete sequence 485533-485564 8 0.75
CP033133_1 1.18|2676195|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2676195-2676226 32 NZ_CP015592 Bacillus cereus strain AR156 plasmid pAR460, complete sequence 145354-145385 8 0.75
CP033133_2 2.3|2737557|32|CP033133|CRISPRCasFinder,CRT 2737557-2737588 32 JN377903 Aeromonas phage Aes512 DNA polymerase subunit, putative GIY-YIG homing endonuclease, DNA polymerase subunit, putative VSR endonuclease, DNA polymerase subunit, dCMP hydroxymethylase, initiator of head vertex, and DNA primase-helicase subunit genes, complete cds 5436-5467 8 0.75
CP033133_2 2.3|2737557|32|CP033133|CRISPRCasFinder,CRT 2737557-2737588 32 MH179477 Aeromonas phage 60AhydR15PP, complete genome 86248-86279 8 0.75
CP033133_2 2.3|2737557|32|CP033133|CRISPRCasFinder,CRT 2737557-2737588 32 NC_008208 Aeromonas phage 25, complete genome 19178-19209 8 0.75
CP033133_2 2.3|2737557|32|CP033133|CRISPRCasFinder,CRT 2737557-2737588 32 JN377900 Aeromonas phage Aes144 DNA polymerase subunits, putative VSR endonuclease, DNA polymerase subunit, dCMP hydroxymethylase, and initiator of head vertex genes, complete cds 4615-4646 8 0.75
CP033133_2 2.3|2737557|32|CP033133|CRISPRCasFinder,CRT 2737557-2737588 32 AY303350 Aeromonas phage 25 gp46 recombination endonuclease subunit (46) gene, partial cds; conserved hypothetical protein (45.2), RNA polymerase binding protein (rpbA), sliding clamp (45), clamp loader subunit (44), clamp loader subunit (62), RegA (regA), core DNA polymerase of replisome (43A), GIY-YIG endonuclease (helc25), and core DNA polymerase of replisome (43B) genes, complete cds; and hypothetical protein (43.-1) gene, partial cds 7346-7377 8 0.75
CP033133_2 2.3|2737557|32|CP033133|CRISPRCasFinder,CRT 2737557-2737588 32 NC_014635 Aeromonas phage phiAS4, complete genome 151827-151858 8 0.75
CP033133_2 2.3|2737557|32|CP033133|CRISPRCasFinder,CRT 2737557-2737588 32 DQ529280 Aeromonas salmonicida bacteriophage 25, complete genome 19178-19209 8 0.75
CP033133_2 2.3|2737557|32|CP033133|CRISPRCasFinder,CRT 2737557-2737588 32 JN377896 Aeromonas phage Aes002 DNA polymerase subunit, putative GIY-YIG homing endonuclease, DNA polymerase subunit, dCMP hydroxymethylase, and initiator of head vertex genes, complete cds 3902-3933 8 0.75
CP033133_2 2.3|2737557|32|CP033133|CRISPRCasFinder,CRT 2737557-2737588 32 JN377897 Aeromonas phage Aes007 DNA polymerase subunit, putative HNH homing endonuclease, DNA polymerase, dCMP hydroxymethylase, and initiator of head vertex genes, complete cds 3673-3704 8 0.75
CP033133_2 2.3|2737557|32|CP033133|CRISPRCasFinder,CRT 2737557-2737588 32 JN377898 Aeromonas phage Aes120 DNA polymerase subunit, putative GIY-YIG homing endonuclease, DNA polymerase subunit, dCMP hydroxymethylase, initiator of head vertex, and putative HNH homing endonuclease genes, complete cds 3911-3942 8 0.75
CP033133_2 2.3|2737557|32|CP033133|CRISPRCasFinder,CRT 2737557-2737588 32 JN377905 Aeromonas phage Aes516 clone contig 13 genomic sequence 35886-35917 8 0.75
CP033133_2 2.3|2737557|32|CP033133|CRISPRCasFinder,CRT 2737557-2737588 32 JN377902 Aeromonas phage Aes509 DNA polymerase subunits, putative VSR endonuclease, DNA polymerase subunit, dCMP hydroxymethylase, initiator of head vertex, and putative HNH homing endonuclease genes, complete cds 4481-4512 8 0.75
CP033133_2 2.3|2737557|32|CP033133|CRISPRCasFinder,CRT 2737557-2737588 32 JN377904 Aeromonas phage Aes517 DNA polymerase subunit, truncated putative GIY-YIG homing endonuclease, hypothetical protein, DNA polymerase subunit, putative VSR endonuclease, DNA polymerase subunit, dCMP hydroxymethylase, and initiator of head vertex genes, complete cds 5426-5457 8 0.75
CP033133_2 2.3|2737557|32|CP033133|CRISPRCasFinder,CRT 2737557-2737588 32 MH179476 Aeromonas phage 50AhydR13PP, complete genome 46251-46282 8 0.75
CP033133_2 2.3|2737557|32|CP033133|CRISPRCasFinder,CRT 2737557-2737588 32 NC_019543 Aeromonas phage Aes508, complete genome 18314-18345 8 0.75
CP033133_2 2.10|2737977|32|CP033133|CRISPRCasFinder,CRT 2737977-2738008 32 MG592671 Vibrio phage 2.275.O._10N.286.54.E11, partial genome 125274-125305 8 0.75
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 NC_021229 Arthrobacter nicotinovorans pAO1 megaplasmid sequence, strain ATCC 49919 162781-162812 8 0.75
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 NZ_CP053566 Pseudonocardia sp. Gen01 plasmid unnamed2, complete sequence 12049-12080 8 0.75
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 NZ_CP053566 Pseudonocardia sp. Gen01 plasmid unnamed2, complete sequence 24169-24200 8 0.75
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 JN968479 Haloarcula hispanica icosahedral virus 2, complete genome 2943-2974 8 0.75
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 MK494117 Mycobacterium phage Miramae, complete genome 28724-28755 8 0.75
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 NC_042118 Microbacterium phage Koji, complete genome 3201-3232 8 0.75
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 MK494129 Mycobacterium phage AvatarAhPeg, complete genome 29062-29093 8 0.75
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 KX579975 Mycobacterium phage Mundrea, complete genome 28544-28575 8 0.75
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 NC_008712 Paenarthrobacter aurescens TC1 plasmid pTC1, complete sequence 148824-148855 8 0.75
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 NZ_CP010990 Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence 25182-25213 8 0.75
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 115268-115299 8 0.75
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 MN284895 Mycobacterium phage Marshawn, complete genome 38218-38249 8 0.75
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 MG009575 Mycobacterium phage Kumao, complete genome 6340-6371 8 0.75
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 MN813693 Mycobacterium phage Imvubu, complete genome 9160-9191 8 0.75
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 NZ_CP043499 Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence 708011-708042 8 0.75
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 521310-521341 8 0.75
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 MN096355 Mycobacterium phage Purky, complete genome 6404-6435 8 0.75
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 MN694766 Marine virus AFVG_250M151, complete genome 26228-26259 8 0.75
CP033133_2 2.16|2738338|32|CP033133|CRISPRCasFinder,CRT 2738338-2738369 32 MH616818 Inoviridae sp. isolate ctba29, complete genome 204-235 8 0.75
CP033133_2 2.16|2738338|32|CP033133|CRISPRCasFinder,CRT 2738338-2738369 32 MH617467 Inoviridae sp. isolate ctba17, complete genome 180-211 8 0.75
CP033133_2 2.16|2738338|32|CP033133|CRISPRCasFinder,CRT 2738338-2738369 32 MH412654 Synechococcus phage S-T4, complete genome 143060-143091 8 0.75
CP033133_2 2.27|2737558|32|CP033133|PILER-CR 2737558-2737589 32 JN377903 Aeromonas phage Aes512 DNA polymerase subunit, putative GIY-YIG homing endonuclease, DNA polymerase subunit, putative VSR endonuclease, DNA polymerase subunit, dCMP hydroxymethylase, initiator of head vertex, and DNA primase-helicase subunit genes, complete cds 5436-5467 8 0.75
CP033133_2 2.27|2737558|32|CP033133|PILER-CR 2737558-2737589 32 MH179477 Aeromonas phage 60AhydR15PP, complete genome 86248-86279 8 0.75
CP033133_2 2.27|2737558|32|CP033133|PILER-CR 2737558-2737589 32 NC_008208 Aeromonas phage 25, complete genome 19178-19209 8 0.75
CP033133_2 2.27|2737558|32|CP033133|PILER-CR 2737558-2737589 32 JN377900 Aeromonas phage Aes144 DNA polymerase subunits, putative VSR endonuclease, DNA polymerase subunit, dCMP hydroxymethylase, and initiator of head vertex genes, complete cds 4615-4646 8 0.75
CP033133_2 2.27|2737558|32|CP033133|PILER-CR 2737558-2737589 32 AY303350 Aeromonas phage 25 gp46 recombination endonuclease subunit (46) gene, partial cds; conserved hypothetical protein (45.2), RNA polymerase binding protein (rpbA), sliding clamp (45), clamp loader subunit (44), clamp loader subunit (62), RegA (regA), core DNA polymerase of replisome (43A), GIY-YIG endonuclease (helc25), and core DNA polymerase of replisome (43B) genes, complete cds; and hypothetical protein (43.-1) gene, partial cds 7346-7377 8 0.75
CP033133_2 2.27|2737558|32|CP033133|PILER-CR 2737558-2737589 32 NC_014635 Aeromonas phage phiAS4, complete genome 151827-151858 8 0.75
CP033133_2 2.27|2737558|32|CP033133|PILER-CR 2737558-2737589 32 DQ529280 Aeromonas salmonicida bacteriophage 25, complete genome 19178-19209 8 0.75
CP033133_2 2.27|2737558|32|CP033133|PILER-CR 2737558-2737589 32 JN377896 Aeromonas phage Aes002 DNA polymerase subunit, putative GIY-YIG homing endonuclease, DNA polymerase subunit, dCMP hydroxymethylase, and initiator of head vertex genes, complete cds 3902-3933 8 0.75
CP033133_2 2.27|2737558|32|CP033133|PILER-CR 2737558-2737589 32 JN377897 Aeromonas phage Aes007 DNA polymerase subunit, putative HNH homing endonuclease, DNA polymerase, dCMP hydroxymethylase, and initiator of head vertex genes, complete cds 3673-3704 8 0.75
CP033133_2 2.27|2737558|32|CP033133|PILER-CR 2737558-2737589 32 JN377898 Aeromonas phage Aes120 DNA polymerase subunit, putative GIY-YIG homing endonuclease, DNA polymerase subunit, dCMP hydroxymethylase, initiator of head vertex, and putative HNH homing endonuclease genes, complete cds 3911-3942 8 0.75
CP033133_2 2.27|2737558|32|CP033133|PILER-CR 2737558-2737589 32 JN377905 Aeromonas phage Aes516 clone contig 13 genomic sequence 35886-35917 8 0.75
CP033133_2 2.27|2737558|32|CP033133|PILER-CR 2737558-2737589 32 JN377902 Aeromonas phage Aes509 DNA polymerase subunits, putative VSR endonuclease, DNA polymerase subunit, dCMP hydroxymethylase, initiator of head vertex, and putative HNH homing endonuclease genes, complete cds 4481-4512 8 0.75
CP033133_2 2.27|2737558|32|CP033133|PILER-CR 2737558-2737589 32 JN377904 Aeromonas phage Aes517 DNA polymerase subunit, truncated putative GIY-YIG homing endonuclease, hypothetical protein, DNA polymerase subunit, putative VSR endonuclease, DNA polymerase subunit, dCMP hydroxymethylase, and initiator of head vertex genes, complete cds 5426-5457 8 0.75
CP033133_2 2.27|2737558|32|CP033133|PILER-CR 2737558-2737589 32 MH179476 Aeromonas phage 50AhydR13PP, complete genome 46251-46282 8 0.75
CP033133_2 2.27|2737558|32|CP033133|PILER-CR 2737558-2737589 32 NC_019543 Aeromonas phage Aes508, complete genome 18314-18345 8 0.75
CP033133_2 2.34|2737978|32|CP033133|PILER-CR 2737978-2738009 32 MG592671 Vibrio phage 2.275.O._10N.286.54.E11, partial genome 125274-125305 8 0.75
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 NC_021229 Arthrobacter nicotinovorans pAO1 megaplasmid sequence, strain ATCC 49919 162781-162812 8 0.75
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 NZ_CP053566 Pseudonocardia sp. Gen01 plasmid unnamed2, complete sequence 12049-12080 8 0.75
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 NZ_CP053566 Pseudonocardia sp. Gen01 plasmid unnamed2, complete sequence 24169-24200 8 0.75
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 JN968479 Haloarcula hispanica icosahedral virus 2, complete genome 2943-2974 8 0.75
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 MK494117 Mycobacterium phage Miramae, complete genome 28724-28755 8 0.75
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 NC_042118 Microbacterium phage Koji, complete genome 3201-3232 8 0.75
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 MK494129 Mycobacterium phage AvatarAhPeg, complete genome 29062-29093 8 0.75
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 KX579975 Mycobacterium phage Mundrea, complete genome 28544-28575 8 0.75
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 NC_008712 Paenarthrobacter aurescens TC1 plasmid pTC1, complete sequence 148824-148855 8 0.75
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 NZ_CP010990 Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence 25182-25213 8 0.75
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 115268-115299 8 0.75
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 MN284895 Mycobacterium phage Marshawn, complete genome 38218-38249 8 0.75
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 MG009575 Mycobacterium phage Kumao, complete genome 6340-6371 8 0.75
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 MN813693 Mycobacterium phage Imvubu, complete genome 9160-9191 8 0.75
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 NZ_CP043499 Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence 708011-708042 8 0.75
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 521310-521341 8 0.75
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 MN096355 Mycobacterium phage Purky, complete genome 6404-6435 8 0.75
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 MN694766 Marine virus AFVG_250M151, complete genome 26228-26259 8 0.75
CP033133_2 2.40|2738339|32|CP033133|PILER-CR 2738339-2738370 32 MH616818 Inoviridae sp. isolate ctba29, complete genome 204-235 8 0.75
CP033133_2 2.40|2738339|32|CP033133|PILER-CR 2738339-2738370 32 MH617467 Inoviridae sp. isolate ctba17, complete genome 180-211 8 0.75
CP033133_2 2.40|2738339|32|CP033133|PILER-CR 2738339-2738370 32 MH412654 Synechococcus phage S-T4, complete genome 143060-143091 8 0.75
CP033133_1 1.2|2675235|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675235-2675266 32 NC_007581 Clostridium phage c-st, complete genome 102767-102798 9 0.719
CP033133_1 1.2|2675235|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675235-2675266 32 ACSJ01000013 Clostridium phage D-1873 CLG.Contig165, whole genome shotgun sequence 4789-4820 9 0.719
CP033133_1 1.2|2675235|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675235-2675266 32 AP008983 Clostridium phage c-st genomic DNA, complete genome 102767-102798 9 0.719
CP033133_1 1.9|2675655|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675655-2675686 32 NZ_CP009363 Yersinia frederiksenii Y225 plasmid unnsmrf, complete sequence 39918-39949 9 0.719
CP033133_1 1.9|2675655|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675655-2675686 32 MK554696 Fusobacterium phage Fnu1, complete genome 37516-37547 9 0.719
CP033133_1 1.10|2675715|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675715-2675746 32 NZ_CP045339 Vibrio sp. THAF190c plasmid pTHAF190c_a, complete sequence 955621-955652 9 0.719
CP033133_1 1.10|2675715|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675715-2675746 32 MG945269 UNVERIFIED: Microviridae sp. isolate 3358-17112, partial genome 3166-3197 9 0.719
CP033133_1 1.10|2675715|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675715-2675746 32 KP399678 Listeria phage vB_LmoS_293, complete genome 40469-40500 9 0.719
CP033133_1 1.12|2675835|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675835-2675866 32 MN994499 Phage NBEco005, complete genome 40901-40932 9 0.719
CP033133_1 1.14|2675955|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675955-2675986 32 NZ_CP017832 Butyrivibrio hungatei strain MB2003 plasmid pNP144, complete sequence 139844-139875 9 0.719
CP033133_1 1.17|2676135|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2676135-2676166 32 KX130865 Shigella phage SHSML-52-1, complete genome 156251-156282 9 0.719
CP033133_1 1.17|2676135|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2676135-2676166 32 MK373782 Escherichia phage vB_EcoM_KAW3E185, complete genome 51018-51049 9 0.719
CP033133_1 1.18|2676195|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2676195-2676226 32 NZ_CP053657 Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence 35992-36023 9 0.719
CP033133_1 1.20|2676315|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2676315-2676346 32 MN693554 Marine virus AFVG_25M30, complete genome 6494-6525 9 0.719
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 MN444877 Microbacterium phage Antares, complete genome 14438-14469 9 0.719
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 NZ_LR134465 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence 108052-108083 9 0.719
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 MH590600 Microbacterium phage KaiHaiDragon, complete genome 14114-14145 9 0.719
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 MK977698 Microbacterium phage Busephilis, complete genome 14169-14200 9 0.719
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 MK875798 Microbacterium phage Piperis, complete genome 14195-14226 9 0.719
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 MT818415 Microbacterium phage Scumberland, complete genome 14445-14476 9 0.719
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 NC_011758 Methylorubrum extorquens CM4 plasmid pCMU01, complete sequence 290336-290367 9 0.719
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 NC_031254 Arthrobacter phage Kitkat, complete genome 11920-11951 9 0.719
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 NC_031231 Arthrobacter phage KellEzio, complete genome 11799-11830 9 0.719
CP033133_2 2.16|2738338|32|CP033133|CRISPRCasFinder,CRT 2738338-2738369 32 NZ_CP022299 Acinetobacter johnsonii strain IC001 plasmid pIC001A, complete sequence 56468-56499 9 0.719
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 MN444877 Microbacterium phage Antares, complete genome 14438-14469 9 0.719
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 NZ_LR134465 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence 108052-108083 9 0.719
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 MH590600 Microbacterium phage KaiHaiDragon, complete genome 14114-14145 9 0.719
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 MK977698 Microbacterium phage Busephilis, complete genome 14169-14200 9 0.719
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 MK875798 Microbacterium phage Piperis, complete genome 14195-14226 9 0.719
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 MT818415 Microbacterium phage Scumberland, complete genome 14445-14476 9 0.719
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 NC_011758 Methylorubrum extorquens CM4 plasmid pCMU01, complete sequence 290336-290367 9 0.719
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 NC_031254 Arthrobacter phage Kitkat, complete genome 11920-11951 9 0.719
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 NC_031231 Arthrobacter phage KellEzio, complete genome 11799-11830 9 0.719
CP033133_2 2.40|2738339|32|CP033133|PILER-CR 2738339-2738370 32 NZ_CP022299 Acinetobacter johnsonii strain IC001 plasmid pIC001A, complete sequence 56468-56499 9 0.719
CP033133_1 1.2|2675235|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675235-2675266 32 NZ_CP030790 Vibrio campbellii strain DS40M4 plasmid unnamed1, complete sequence 44728-44759 10 0.688
CP033133_1 1.2|2675235|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675235-2675266 32 NZ_CP015865 Vibrio campbellii CAIM 519 = NBRC 15631 strain ATCC 25920, CAIM 519T plasmid unnamed, complete sequence 57476-57507 10 0.688
CP033133_1 1.3|2675295|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675295-2675326 32 MT430910 Streptococcus phage smHBZ8, complete genome 470-501 10 0.688
CP033133_1 1.9|2675655|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675655-2675686 32 NC_017401 Borreliella burgdorferi N40 plasmid N40_cp26, complete sequence 12857-12888 10 0.688
CP033133_1 1.9|2675655|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675655-2675686 32 NC_017395 Borreliella burgdorferi JD1 plasmid JD1 cp26, complete sequence 12882-12913 10 0.688
CP033133_1 1.9|2675655|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675655-2675686 32 NZ_CP031398 Borreliella burgdorferi strain MM1 plasmid plsm_cp26, complete sequence 12836-12867 10 0.688
CP033133_1 1.9|2675655|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675655-2675686 32 NC_011724 Borreliella burgdorferi ZS7 plasmid ZS7_cp26, complete sequence 12877-12908 10 0.688
CP033133_1 1.9|2675655|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675655-2675686 32 NC_001903 Borreliella burgdorferi B31 plasmid cp26, complete sequence 12876-12907 10 0.688
CP033133_1 1.9|2675655|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675655-2675686 32 NZ_CP019755 Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp26, complete sequence 12876-12907 10 0.688
CP033133_1 1.9|2675655|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675655-2675686 32 NZ_CP017202 Borreliella burgdorferi strain B331 plasmid B331_cp26, complete sequence 12859-12890 10 0.688
CP033133_1 1.9|2675655|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675655-2675686 32 NC_019225 Borrelia burgdorferi plasmid cp26, complete sequence 12867-12898 10 0.688
CP033133_1 1.10|2675715|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675715-2675746 32 NC_008758 Polaromonas naphthalenivorans CJ2 plasmid pPNAP02, complete sequence 166216-166247 10 0.688
CP033133_1 1.11|2675775|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675775-2675806 32 NZ_CP047086 Bacillus paranthracis strain BC307 plasmid pCE1, complete sequence 57614-57645 10 0.688
CP033133_1 1.11|2675775|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675775-2675806 32 NZ_CP041978 Bacillus pacificus strain NCCP 15909 plasmid unnamed1, complete sequence 43215-43246 10 0.688
CP033133_1 1.11|2675775|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675775-2675806 32 NZ_CP031272 Staphylococcus caprae strain 26D plasmid unnamed1, complete sequence 28026-28057 10 0.688
CP033133_1 1.11|2675775|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675775-2675806 32 NC_005707 Bacillus cereus ATCC 10987 plasmid pBc10987, complete sequence 8690-8721 10 0.688
CP033133_1 1.11|2675775|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675775-2675806 32 CP041980 Bacillus paranthracis strain NCCP 15910 plasmid unnamed, complete sequence 27606-27637 10 0.688
CP033133_1 1.12|2675835|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675835-2675866 32 MT833282 Escherichia coli phage vB_EcoM_Shy, complete genome 57248-57279 10 0.688
CP033133_1 1.12|2675835|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675835-2675866 32 MN994503 Phage NBSal004, complete genome 41022-41053 10 0.688
CP033133_1 1.14|2675955|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675955-2675986 32 NZ_LR134433 Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 24 35518-35549 10 0.688
CP033133_1 1.14|2675955|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675955-2675986 32 MT366947 Bacillus phage Hyb2phi3Ts-SPbeta, complete genome 95946-95977 10 0.688
CP033133_1 1.14|2675955|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675955-2675986 32 KY030782 Bacillus phage phi3T, complete genome 95941-95972 10 0.688
CP033133_1 1.14|2675955|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675955-2675986 32 NC_001884 Bacillus phage SPBc2, complete genome 105364-105395 10 0.688
CP033133_1 1.14|2675955|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675955-2675986 32 AF020713 Bacteriophage SPBc2 complete genome 105364-105395 10 0.688
CP033133_1 1.14|2675955|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675955-2675986 32 MT366946 Bacillus phage Hyb1phi3Ts-SPbeta, complete genome 98545-98576 10 0.688
CP033133_1 1.14|2675955|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675955-2675986 32 MT366948 Bacillus phage Hyb3phi3Ts-SPbeta, complete genome 94693-94724 10 0.688
CP033133_1 1.14|2675955|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675955-2675986 32 MT601274 Bacillus phage vB_BsuS-Goe13, complete genome 95886-95917 10 0.688
CP033133_1 1.14|2675955|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675955-2675986 32 MT366945 Bacillus phage phi3Ts, complete genome 95946-95977 10 0.688
CP033133_1 1.15|2676015|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2676015-2676046 32 NC_030948 Ralstonia phage RSP15 DNA, complete genome 14764-14795 10 0.688
CP033133_1 1.18|2676195|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2676195-2676226 32 NZ_CP031072 Bacillus mycoides strain BPN401 plasmid pl395, complete sequence 222161-222192 10 0.688
CP033133_2 2.2|2737497|32|CP033133|CRISPRCasFinder,CRT 2737497-2737528 32 EU399241 Halomonas phage phiHAP-1, complete genome 32554-32585 10 0.688
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4477888-4477919 10 0.688
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 465009-465040 10 0.688
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 NC_001387 Streptomyces lividans plasmid pIJ101, complete sequence 8636-8667 10 0.688
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 NC_001425 Streptomyces flavovirens plasmid pSN22 DNA, complete sequence 9345-9376 10 0.688
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 MG770216 Mycobacterium phage Rem711, complete genome 39699-39730 10 0.688
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 AY320035 Bacteriophage VWB, complete genome 27931-27962 10 0.688
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 NC_005345 Streptomyces phage VWB, complete genome 27931-27962 10 0.688
CP033133_2 2.17|2738398|32|CP033133|CRISPRCasFinder,CRT 2738398-2738429 32 NZ_CP038867 Vagococcus sp. CF-49 plasmid punnamed2, complete sequence 6497-6528 10 0.688
CP033133_2 2.26|2737498|32|CP033133|PILER-CR 2737498-2737529 32 EU399241 Halomonas phage phiHAP-1, complete genome 32554-32585 10 0.688
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4477888-4477919 10 0.688
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 465009-465040 10 0.688
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 NC_001387 Streptomyces lividans plasmid pIJ101, complete sequence 8636-8667 10 0.688
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 NC_001425 Streptomyces flavovirens plasmid pSN22 DNA, complete sequence 9345-9376 10 0.688
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 MG770216 Mycobacterium phage Rem711, complete genome 39699-39730 10 0.688
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 AY320035 Bacteriophage VWB, complete genome 27931-27962 10 0.688
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 NC_005345 Streptomyces phage VWB, complete genome 27931-27962 10 0.688
CP033133_2 2.41|2738399|32|CP033133|PILER-CR 2738399-2738430 32 NZ_CP038867 Vagococcus sp. CF-49 plasmid punnamed2, complete sequence 6497-6528 10 0.688
CP033133_1 1.9|2675655|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675655-2675686 32 NC_018983 Borrelia burgdorferi 297 plasmid 297_cp26, complete sequence 12876-12907 11 0.656
CP033133_1 1.11|2675775|32|CP033133|PILER-CR,CRISPRCasFinder,CRT 2675775-2675806 32 NZ_CP020558 Paenibacillus larvae subsp. pulvifaciens strain SAG 10367 plasmid pPLP3, complete sequence 51118-51149 11 0.656
CP033133_2 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT 2738037-2738068 32 NZ_CP032131 Acinetobacter chinensis strain WCHAc010005 plasmid p5_010005, complete sequence 791-822 12 0.625
CP033133_2 2.35|2738038|32|CP033133|PILER-CR 2738038-2738069 32 NZ_CP032131 Acinetobacter chinensis strain WCHAc010005 plasmid p5_010005, complete sequence 791-822 12 0.625

1. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to MH047631 (Microbacterium phage Triscuit, complete genome) position: , mismatch: 3, identity: 0.906

-acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gacgagct-cgaggacgacgaagccgacgacga	Protospacer
 ******* **********.* ***********

2. spacer 2.35|2738038|32|CP033133|PILER-CR matches to MH047631 (Microbacterium phage Triscuit, complete genome) position: , mismatch: 3, identity: 0.906

-acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gacgagct-cgaggacgacgaagccgacgacga	Protospacer
 ******* **********.* ***********

3. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to MK977699 (Gordonia Phage Lollipop1437, complete genome) position: , mismatch: 4, identity: 0.875

acgagc-tacgaggacgacaacgccgacgacga	CRISPR spacer
-cgcgcgtacgacgacgacaacgccgacgccga	Protospacer
 ** ** ***** **************** ***

4. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to NZ_CP017947 (Bosea sp. Tri-49 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.875

-acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gacgag-gacgaggacgacgacgacgacgacga	Protospacer
 *****  ***********.*** *********

5. spacer 2.35|2738038|32|CP033133|PILER-CR matches to MK977699 (Gordonia Phage Lollipop1437, complete genome) position: , mismatch: 4, identity: 0.875

acgagc-tacgaggacgacaacgccgacgacga	CRISPR spacer
-cgcgcgtacgacgacgacaacgccgacgccga	Protospacer
 ** ** ***** **************** ***

6. spacer 2.35|2738038|32|CP033133|PILER-CR matches to NZ_CP017947 (Bosea sp. Tri-49 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.875

-acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gacgag-gacgaggacgacgacgacgacgacga	Protospacer
 *****  ***********.*** *********

7. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to MH019216 (Streptomyces phage Wentworth, complete genome) position: , mismatch: 5, identity: 0.844

-acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gacgaggc-cgaggacgacgacgccgaggacga	Protospacer
 ***** . **********.******* *****

8. spacer 2.35|2738038|32|CP033133|PILER-CR matches to MH019216 (Streptomyces phage Wentworth, complete genome) position: , mismatch: 5, identity: 0.844

-acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gacgaggc-cgaggacgacgacgccgaggacga	Protospacer
 ***** . **********.******* *****

9. spacer 1.9|2675655|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to KP054477 (Lactobacillus phage LfeInf, complete genome) position: , mismatch: 6, identity: 0.812

aactgtctttttattctttgataatgaattgc--	CRISPR spacer
tgctgtctatttattcttagataatga--tgcta	Protospacer
 .****** ********* ********  ***  

10. spacer 1.14|2675955|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024774 (Bacillus thuringiensis LM1212 plasmid pLM3, complete sequence) position: , mismatch: 6, identity: 0.812

gattccgacaatttattttcattatttgaaaa	CRISPR spacer
gttgctgccactttattttcattttttgaaaa	Protospacer
* * *.* ** ************ ********

11. spacer 1.14|2675955|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041074 (Bacillus tropicus strain LM1212-W3 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.812

gattccgacaatttattttcattatttgaaaa	CRISPR spacer
gttgctgccactttattttcattttttgaaaa	Protospacer
* * *.* ** ************ ********

12. spacer 1.16|2676075|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014487 (Bacillus cereus strain FORC021 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

gttcttcttgttcgggttgatctt-tgtcttca	CRISPR spacer
tttcttcttgttcaggttgttcttgcgccttc-	Protospacer
 ************.***** **** .*.**** 

13. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to NC_047973 (Microbacterium phage Hyperion, complete genome) position: , mismatch: 6, identity: 0.812

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
accgacgacgaggacgacaaggccgaggacga	Protospacer
** ..* ************* ***** *****

14. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to MN586025 (Mycobacterium phage Mdavu, complete genome) position: , mismatch: 6, identity: 0.812

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
tcggccgacgaggacgacgaccccgacgacga	Protospacer
 **. * ***********.** **********

15. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to KT281789 (Mycobacterium phage Enkosi, complete genome) position: , mismatch: 6, identity: 0.812

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
tcggccgacgaggacgacgaccccgacgacga	Protospacer
 **. * ***********.** **********

16. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to MH020245 (Mycobacterium phage SgtBeansprout, complete genome) position: , mismatch: 6, identity: 0.812

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
tcggccgacgaggacgacgaccccgacgacga	Protospacer
 **. * ***********.** **********

17. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to KX808132 (Mycobacterium phage Amelie, complete genome) position: , mismatch: 6, identity: 0.812

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
tcggccgacgaggacgacgaccccgacgacga	Protospacer
 **. * ***********.** **********

18. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to MH399770 (Mycobacterium phage Biglebops, complete genome) position: , mismatch: 6, identity: 0.812

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
tcggccgacgaggacgacgaccccgacgacga	Protospacer
 **. * ***********.** **********

19. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to MF472895 (Mycobacterium phage Kimona, complete genome) position: , mismatch: 6, identity: 0.812

acgagct----acgaggacgacaacgccgacgacga	CRISPR spacer
----gctctggacgaggccgacaacgccgactacga	Protospacer
    ***    ****** ************* ****

20. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to MF919518 (Mycobacterium phage LilPharaoh, complete genome) position: , mismatch: 6, identity: 0.812

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
tcggccgacgaggacgacgaccccgacgacga	Protospacer
 **. * ***********.** **********

21. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to MN175604 (Gordonia phage PhorbesPhlower, complete genome) position: , mismatch: 6, identity: 0.812

acgagcta-cgaggacgacaacgccgacgacga	CRISPR spacer
-ccagtgatcgaggacgagaatgccgacgacga	Protospacer
 * **. * ********* **.***********

22. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to NC_011370 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG203, complete sequence) position: , mismatch: 6, identity: 0.812

acgagctac--gaggacgacaacgccgacgacga	CRISPR spacer
--gaggtgccagaggacgacagcgacgacgacga	Protospacer
  *** *.*  **********.** *********

23. spacer 2.35|2738038|32|CP033133|PILER-CR matches to NC_047973 (Microbacterium phage Hyperion, complete genome) position: , mismatch: 6, identity: 0.812

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
accgacgacgaggacgacaaggccgaggacga	Protospacer
** ..* ************* ***** *****

24. spacer 2.35|2738038|32|CP033133|PILER-CR matches to MN586025 (Mycobacterium phage Mdavu, complete genome) position: , mismatch: 6, identity: 0.812

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
tcggccgacgaggacgacgaccccgacgacga	Protospacer
 **. * ***********.** **********

25. spacer 2.35|2738038|32|CP033133|PILER-CR matches to KT281789 (Mycobacterium phage Enkosi, complete genome) position: , mismatch: 6, identity: 0.812

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
tcggccgacgaggacgacgaccccgacgacga	Protospacer
 **. * ***********.** **********

26. spacer 2.35|2738038|32|CP033133|PILER-CR matches to MH020245 (Mycobacterium phage SgtBeansprout, complete genome) position: , mismatch: 6, identity: 0.812

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
tcggccgacgaggacgacgaccccgacgacga	Protospacer
 **. * ***********.** **********

27. spacer 2.35|2738038|32|CP033133|PILER-CR matches to KX808132 (Mycobacterium phage Amelie, complete genome) position: , mismatch: 6, identity: 0.812

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
tcggccgacgaggacgacgaccccgacgacga	Protospacer
 **. * ***********.** **********

28. spacer 2.35|2738038|32|CP033133|PILER-CR matches to MH399770 (Mycobacterium phage Biglebops, complete genome) position: , mismatch: 6, identity: 0.812

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
tcggccgacgaggacgacgaccccgacgacga	Protospacer
 **. * ***********.** **********

29. spacer 2.35|2738038|32|CP033133|PILER-CR matches to MF472895 (Mycobacterium phage Kimona, complete genome) position: , mismatch: 6, identity: 0.812

acgagct----acgaggacgacaacgccgacgacga	CRISPR spacer
----gctctggacgaggccgacaacgccgactacga	Protospacer
    ***    ****** ************* ****

30. spacer 2.35|2738038|32|CP033133|PILER-CR matches to MF919518 (Mycobacterium phage LilPharaoh, complete genome) position: , mismatch: 6, identity: 0.812

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
tcggccgacgaggacgacgaccccgacgacga	Protospacer
 **. * ***********.** **********

31. spacer 2.35|2738038|32|CP033133|PILER-CR matches to MN175604 (Gordonia phage PhorbesPhlower, complete genome) position: , mismatch: 6, identity: 0.812

acgagcta-cgaggacgacaacgccgacgacga	CRISPR spacer
-ccagtgatcgaggacgagaatgccgacgacga	Protospacer
 * **. * ********* **.***********

32. spacer 2.35|2738038|32|CP033133|PILER-CR matches to NC_011370 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG203, complete sequence) position: , mismatch: 6, identity: 0.812

acgagctac--gaggacgacaacgccgacgacga	CRISPR spacer
--gaggtgccagaggacgacagcgacgacgacga	Protospacer
  *** *.*  **********.** *********

33. spacer 1.2|2675235|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028863 (Borreliella garinii strain 20047 plasmid lp28-4, complete sequence) position: , mismatch: 7, identity: 0.781

ctaactgttgaaaaagacattaaatctaaagc	CRISPR spacer
aaaacctatgaaataaacattaaatctaaagc	Protospacer
  ***.  ***** *.****************

34. spacer 1.2|2675235|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039089 (Piscirickettsia salmonis strain Psal-111 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

ctaactgttgaaaaagacattaaat--ctaaagc	CRISPR spacer
tcaacttttgaaaaagccattaaatagcttaa--	Protospacer
..**** ********* ********  ** **  

35. spacer 1.2|2675235|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013669 (Piscirickettsia salmonis LF-89 = ATCC VR-1361 plasmid pPSLF89-4, complete sequence) position: , mismatch: 7, identity: 0.781

ctaactgttgaaaaagacattaaat--ctaaagc	CRISPR spacer
tcaacttttgaaaaagccattaaatagcttaa--	Protospacer
..**** ********* ********  ** **  

36. spacer 1.2|2675235|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013798 (Piscirickettsia salmonis strain AY6532B plasmid p2PS9, complete sequence) position: , mismatch: 7, identity: 0.781

ctaactgttgaaaaagacattaaat--ctaaagc	CRISPR spacer
tcaacttttgaaaaagccattaaatagcttaa--	Protospacer
..**** ********* ********  ** **  

37. spacer 1.2|2675235|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013978 (Piscirickettsia salmonis strain CGR02 plasmid pPSCRG02-4, complete sequence) position: , mismatch: 7, identity: 0.781

ctaactgttgaaaaagacattaaat--ctaaagc	CRISPR spacer
tcaacttttgaaaaagccattaaatagcttaa--	Protospacer
..**** ********* ********  ** **  

38. spacer 1.2|2675235|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012509 (Piscirickettsia salmonis strain PM32597B1 plasmid pPSB1-1, complete sequence) position: , mismatch: 7, identity: 0.781

ctaactgttgaaaaagacattaaat--ctaaagc	CRISPR spacer
tcaacttttgaaaaagccattaaatagcttaa--	Protospacer
..**** ********* ********  ** **  

39. spacer 1.2|2675235|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013789 (Piscirickettsia salmonis strain PM58386B plasmid p3PS7, complete sequence) position: , mismatch: 7, identity: 0.781

ctaactgttgaaaaagacattaaat--ctaaagc	CRISPR spacer
tcaacttttgaaaaagccattaaatagcttaa--	Protospacer
..**** ********* ********  ** **  

40. spacer 1.2|2675235|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013822 (Piscirickettsia salmonis strain PM25344B plasmid p1PS14, complete sequence) position: , mismatch: 7, identity: 0.781

ctaactgttgaaaaagacattaaat--ctaaagc	CRISPR spacer
tcaacttttgaaaaagccattaaatagcttaa--	Protospacer
..**** ********* ********  ** **  

41. spacer 1.2|2675235|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013817 (Piscirickettsia salmonis strain AY3800B plasmid p1PS10, complete sequence) position: , mismatch: 7, identity: 0.781

ctaactgttgaaaaagacattaaat--ctaaagc	CRISPR spacer
tcaacttttgaaaaagccattaaatagcttaa--	Protospacer
..**** ********* ********  ** **  

42. spacer 1.2|2675235|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013793 (Piscirickettsia salmonis strain AY6297B plasmid p2PS8, complete sequence) position: , mismatch: 7, identity: 0.781

ctaactgttgaaaaagacattaaat--ctaaagc	CRISPR spacer
tcaacttttgaaaaagccattaaatagcttaa--	Protospacer
..**** ********* ********  ** **  

43. spacer 1.2|2675235|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039052 (Piscirickettsia salmonis strain Psal-081 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

ctaactgttgaaaaagacattaaat--ctaaagc	CRISPR spacer
tcaacttttgaaaaagccattaaatagcttaa--	Protospacer
..**** ********* ********  ** **  

44. spacer 1.2|2675235|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013945 (Piscirickettsia salmonis strain PSCGR01 plasmid pPSCRG01-4, complete sequence) position: , mismatch: 7, identity: 0.781

ctaactgttgaaaaagacattaaat--ctaaagc	CRISPR spacer
tcaacttttgaaaaagccattaaatagcttaa--	Protospacer
..**** ********* ********  ** **  

45. spacer 1.2|2675235|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039057 (Piscirickettsia salmonis strain Psal-098 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

ctaactgttgaaaaagacattaaat--ctaaagc	CRISPR spacer
tcaacttttgaaaaagccattaaatagcttaa--	Protospacer
..**** ********* ********  ** **  

46. spacer 1.2|2675235|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038933 (Piscirickettsia salmonis strain Psal-025 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

ctaactgttgaaaaagacattaaat--ctaaagc	CRISPR spacer
tcaacttttgaaaaagccattaaatagcttaa--	Protospacer
..**** ********* ********  ** **  

47. spacer 1.2|2675235|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038901 (Piscirickettsia salmonis strain Psal-006b plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781

ctaactgttgaaaaagacattaaat--ctaaagc	CRISPR spacer
tcaacttttgaaaaagccattaaatagcttaa--	Protospacer
..**** ********* ********  ** **  

48. spacer 1.2|2675235|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013809 (Piscirickettsia salmonis strain PM31429B plasmid p3PS12, complete sequence) position: , mismatch: 7, identity: 0.781

ctaactgttgaaaaagacattaaat--ctaaagc	CRISPR spacer
tcaacttttgaaaaagccattaaatagcttaa--	Protospacer
..**** ********* ********  ** **  

49. spacer 1.2|2675235|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013784 (Piscirickettsia salmonis strain PM49811B plasmid p3PS6, complete sequence) position: , mismatch: 7, identity: 0.781

ctaactgttgaaaaagacattaaat--ctaaagc	CRISPR spacer
tcaacttttgaaaaagccattaaatagcttaa--	Protospacer
..**** ********* ********  ** **  

50. spacer 1.11|2675775|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039703 (Clostridium butyricum strain 29-1 plasmid p-butyl_plas_29-1, complete sequence) position: , mismatch: 7, identity: 0.781

aatttaaaagtaaaaaaagaactcccccctgt	CRISPR spacer
aagttaaaagtaaaaaaagaaatccgctactt	Protospacer
** ****************** *** *. . *

51. spacer 1.11|2675775|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039706 (Clostridium butyricum strain 4-1 plasmid p-butyl_plas_4-1, complete sequence) position: , mismatch: 7, identity: 0.781

aatttaaaagtaaaaaaagaactcccccctgt	CRISPR spacer
aagttaaaagtaaaaaaagaaatccgctactt	Protospacer
** ****************** *** *. . *

52. spacer 1.11|2675775|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033246 (Clostridium butyricum strain CFSA3987 plasmid pCFSA3987, complete sequence) position: , mismatch: 7, identity: 0.781

aatttaaaagtaaaaaaagaactcccccctgt	CRISPR spacer
aagttaaaagtaaaaaaagaaatccgctactt	Protospacer
** ****************** *** *. . *

53. spacer 1.11|2675775|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033248 (Clostridium butyricum strain CFSA3989 plasmid pCFSA3989, complete sequence) position: , mismatch: 7, identity: 0.781

aatttaaaagtaaaaaaagaactcccccctgt	CRISPR spacer
aagttaaaagtaaaaaaagaaatccgctactt	Protospacer
** ****************** *** *. . *

54. spacer 1.11|2675775|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP019717 (Clostridium butyricum strain NBRC 13949 plasmid pCBU1, complete sequence) position: , mismatch: 7, identity: 0.781

aatttaaaagtaaaaaaagaactcccccctgt	CRISPR spacer
aagttaaaagtaaaaaaagaaatccgctactt	Protospacer
** ****************** *** *. . *

55. spacer 1.14|2675955|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to MH133207 (Acinetobacter phage vB_AbaM_B9, complete genome) position: , mismatch: 7, identity: 0.781

gattccg-acaatttattttcattatttgaaaa	CRISPR spacer
-ttactgcataatttatcttcatcatttgaaaa	Protospacer
  * *.* *.*******.*****.*********

56. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to NC_010850 (Rhodococcus sp. NS1 plasmid pNSL1, complete sequence) position: , mismatch: 7, identity: 0.781

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
ttgctcgccgaggacgacaacgccgacgtcga	Protospacer
 .*  *  ******************** ***

57. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to MN204496 (Streptomyces phage Kardashian, complete genome) position: , mismatch: 7, identity: 0.781

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gaggacgacgaggacgacgacaccgacgacga	Protospacer
. *..* ***********.**.**********

58. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to MN444877 (Microbacterium phage Antares, complete genome) position: , mismatch: 7, identity: 0.781

---acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
ggcgcgg---acgaggacgaggacgccgacgacga	Protospacer
   .**.   ********** .*************

59. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.781

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
acggtggtcgacgacgacagcgccgacgacga	Protospacer
***.    *** *******.************

60. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to MN585986 (Microbacterium phage Ariadne, complete genome) position: , mismatch: 7, identity: 0.781

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gagaacggcgacgacgagaacgccgacgacga	Protospacer
. **.* .*** ***** **************

61. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to MN586007 (Microbacterium phage Smarties, complete genome) position: , mismatch: 7, identity: 0.781

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gagaacggcgacgacgagaacgccgacgacga	Protospacer
. **.* .*** ***** **************

62. spacer 2.24|2738819|32|CP033133|CRISPRCasFinder,CRT matches to NZ_CP033574 (Shewanella algae strain KC-Na-R1 plasmid pKC-Na-R1, complete sequence) position: , mismatch: 7, identity: 0.781

-gcgttttattgacataatccgataatatctct	CRISPR spacer
aatgctgt-ttgagataatccgataatctctct	Protospacer
 ..*.* * **** ************* *****

63. spacer 2.24|2738819|32|CP033133|CRISPRCasFinder,CRT matches to NZ_CP015139 (Escherichia coli strain Ecol_732 plasmid pEC732_IMP14, complete sequence) position: , mismatch: 7, identity: 0.781

-gcgttttattgacataatccgataatatctct	CRISPR spacer
aatgctgt-ttgagataatccgataatctctct	Protospacer
 ..*.* * **** ************* *****

64. spacer 2.24|2738819|32|CP033133|CRISPRCasFinder,CRT matches to NC_019380 (Aeromonas hydrophila plasmid pR148, complete sequence) position: , mismatch: 7, identity: 0.781

-gcgttttattgacataatccgataatatctct	CRISPR spacer
aatgctgt-ttgagataatccgataatctctct	Protospacer
 ..*.* * **** ************* *****

65. spacer 2.24|2738819|32|CP033133|CRISPRCasFinder,CRT matches to NZ_MF627444 (Vibrio parahaemolyticus strain Vb0267 plasmid pVb0267, complete sequence) position: , mismatch: 7, identity: 0.781

-gcgttttattgacataatccgataatatctct	CRISPR spacer
aatgctgt-ttgagataatccgataatctctct	Protospacer
 ..*.* * **** ************* *****

66. spacer 2.24|2738819|32|CP033133|CRISPRCasFinder,CRT matches to NZ_KY863418 (Enterobacter asburiae strain AMA 497 plasmid pOXA436, complete sequence) position: , mismatch: 7, identity: 0.781

-gcgttttattgacataatccgataatatctct	CRISPR spacer
aatgctgt-ttgagataatccgataatctctct	Protospacer
 ..*.* * **** ************* *****

67. spacer 2.24|2738819|32|CP033133|CRISPRCasFinder,CRT matches to NZ_KY863418 (Enterobacter asburiae strain AMA 497 plasmid pOXA436, complete sequence) position: , mismatch: 7, identity: 0.781

-gcgttttattgacataatccgataatatctct	CRISPR spacer
aatgctgt-ttgagataatccgataatctctct	Protospacer
 ..*.* * **** ************* *****

68. spacer 2.24|2738819|32|CP033133|CRISPRCasFinder,CRT matches to NZ_MF627445 (Vibrio parahaemolyticus strain Vb0499 plasmid pVb0499, complete sequence) position: , mismatch: 7, identity: 0.781

-gcgttttattgacataatccgataatatctct	CRISPR spacer
aatgctgt-ttgagataatccgataatctctct	Protospacer
 ..*.* * **** ************* *****

69. spacer 2.35|2738038|32|CP033133|PILER-CR matches to NC_010850 (Rhodococcus sp. NS1 plasmid pNSL1, complete sequence) position: , mismatch: 7, identity: 0.781

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
ttgctcgccgaggacgacaacgccgacgtcga	Protospacer
 .*  *  ******************** ***

70. spacer 2.35|2738038|32|CP033133|PILER-CR matches to MN204496 (Streptomyces phage Kardashian, complete genome) position: , mismatch: 7, identity: 0.781

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gaggacgacgaggacgacgacaccgacgacga	Protospacer
. *..* ***********.**.**********

71. spacer 2.35|2738038|32|CP033133|PILER-CR matches to MN444877 (Microbacterium phage Antares, complete genome) position: , mismatch: 7, identity: 0.781

---acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
ggcgcgg---acgaggacgaggacgccgacgacga	Protospacer
   .**.   ********** .*************

72. spacer 2.35|2738038|32|CP033133|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.781

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
acggtggtcgacgacgacagcgccgacgacga	Protospacer
***.    *** *******.************

73. spacer 2.35|2738038|32|CP033133|PILER-CR matches to MN585986 (Microbacterium phage Ariadne, complete genome) position: , mismatch: 7, identity: 0.781

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gagaacggcgacgacgagaacgccgacgacga	Protospacer
. **.* .*** ***** **************

74. spacer 2.35|2738038|32|CP033133|PILER-CR matches to MN586007 (Microbacterium phage Smarties, complete genome) position: , mismatch: 7, identity: 0.781

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gagaacggcgacgacgagaacgccgacgacga	Protospacer
. **.* .*** ***** **************

75. spacer 2.48|2738820|32|CP033133|PILER-CR matches to NZ_CP033574 (Shewanella algae strain KC-Na-R1 plasmid pKC-Na-R1, complete sequence) position: , mismatch: 7, identity: 0.781

-gcgttttattgacataatccgataatatctct	CRISPR spacer
aatgctgt-ttgagataatccgataatctctct	Protospacer
 ..*.* * **** ************* *****

76. spacer 2.48|2738820|32|CP033133|PILER-CR matches to NZ_CP015139 (Escherichia coli strain Ecol_732 plasmid pEC732_IMP14, complete sequence) position: , mismatch: 7, identity: 0.781

-gcgttttattgacataatccgataatatctct	CRISPR spacer
aatgctgt-ttgagataatccgataatctctct	Protospacer
 ..*.* * **** ************* *****

77. spacer 2.48|2738820|32|CP033133|PILER-CR matches to NC_019380 (Aeromonas hydrophila plasmid pR148, complete sequence) position: , mismatch: 7, identity: 0.781

-gcgttttattgacataatccgataatatctct	CRISPR spacer
aatgctgt-ttgagataatccgataatctctct	Protospacer
 ..*.* * **** ************* *****

78. spacer 2.48|2738820|32|CP033133|PILER-CR matches to NZ_MF627444 (Vibrio parahaemolyticus strain Vb0267 plasmid pVb0267, complete sequence) position: , mismatch: 7, identity: 0.781

-gcgttttattgacataatccgataatatctct	CRISPR spacer
aatgctgt-ttgagataatccgataatctctct	Protospacer
 ..*.* * **** ************* *****

79. spacer 2.48|2738820|32|CP033133|PILER-CR matches to NZ_KY863418 (Enterobacter asburiae strain AMA 497 plasmid pOXA436, complete sequence) position: , mismatch: 7, identity: 0.781

-gcgttttattgacataatccgataatatctct	CRISPR spacer
aatgctgt-ttgagataatccgataatctctct	Protospacer
 ..*.* * **** ************* *****

80. spacer 2.48|2738820|32|CP033133|PILER-CR matches to NZ_KY863418 (Enterobacter asburiae strain AMA 497 plasmid pOXA436, complete sequence) position: , mismatch: 7, identity: 0.781

-gcgttttattgacataatccgataatatctct	CRISPR spacer
aatgctgt-ttgagataatccgataatctctct	Protospacer
 ..*.* * **** ************* *****

81. spacer 2.48|2738820|32|CP033133|PILER-CR matches to NZ_MF627445 (Vibrio parahaemolyticus strain Vb0499 plasmid pVb0499, complete sequence) position: , mismatch: 7, identity: 0.781

-gcgttttattgacataatccgataatatctct	CRISPR spacer
aatgctgt-ttgagataatccgataatctctct	Protospacer
 ..*.* * **** ************* *****

82. spacer 1.2|2675235|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009417 (Jeotgalibacillus malaysiensis strain malaysiensis plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

ctaactgttgaaaaagacattaaatctaaagc	CRISPR spacer
tgtatttttgaaaaatacattaaatccaaaga	Protospacer
.  *.* ******** **********.**** 

83. spacer 1.2|2675235|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015439 (Anoxybacillus amylolyticus strain DSM 15939 plasmid pDSM15939_1, complete sequence) position: , mismatch: 8, identity: 0.75

ctaactgttgaaaaagacattaaatctaaagc-----	CRISPR spacer
ataactattgaaaaagacaata-----aaagctgata	Protospacer
 *****.************ **     *****     

84. spacer 1.2|2675235|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022536 (Spiroplasma corruscae strain EC-1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

ctaactg---ttgaaaaagacattaaatctaaagc	CRISPR spacer
---aatgaaattggaaaagaaattaaatctaaaaa	Protospacer
   * **   ***.****** ************. 

85. spacer 1.7|2675535|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KX518745 (Escherichia coli strain HYEC7 plasmid pHYEC7-mcr1, complete sequence) position: , mismatch: 8, identity: 0.75

agtcagctaaattatcattggatgccacacct	CRISPR spacer
aatatgactaattatcattgcatgccagacct	Protospacer
*.*  * . *********** ****** ****

86. spacer 1.7|2675535|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to LC511659 (Escherichia coli 2017.15.03CC plasmid p2017.15.03CC DNA, complete genome) position: , mismatch: 8, identity: 0.75

agtcagctaaattatcattggatgccacacct	CRISPR spacer
aatatgactaattatcattgcatgccagacct	Protospacer
*.*  * . *********** ****** ****

87. spacer 1.7|2675535|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017632 (Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence) position: , mismatch: 8, identity: 0.75

agtcagctaaattatcattggatgccacacct	CRISPR spacer
aatatgactaattatcattgcatgccagacct	Protospacer
*.*  * . *********** ****** ****

88. spacer 1.7|2675535|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH781719 (Klebsiella pneumoniae strain SCKLB684 plasmid pSCKLB684-mcr, complete sequence) position: , mismatch: 8, identity: 0.75

agtcagctaaattatcattggatgccacacct	CRISPR spacer
aatatgactaattatcattgcatgccagacct	Protospacer
*.*  * . *********** ****** ****

89. spacer 1.11|2675775|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013238 (Clostridium butyricum strain CDC_51208 plasmid pNPD4_2, complete sequence) position: , mismatch: 8, identity: 0.75

aatttaaaagtaaaaaaagaactcccccctgt	CRISPR spacer
aagttaaaagtaaaaaaagaaatccgttactt	Protospacer
** ****************** *** .. . *

90. spacer 1.18|2676195|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015592 (Bacillus cereus strain AR156 plasmid pAR460, complete sequence) position: , mismatch: 8, identity: 0.75

tgcgctagagcaattattagaaagtgtgggtt	CRISPR spacer
aaaggtagagcaatttttagaaagtgtggtca	Protospacer
 . * ********** ************* . 

91. spacer 2.3|2737557|32|CP033133|CRISPRCasFinder,CRT matches to JN377903 (Aeromonas phage Aes512 DNA polymerase subunit, putative GIY-YIG homing endonuclease, DNA polymerase subunit, putative VSR endonuclease, DNA polymerase subunit, dCMP hydroxymethylase, initiator of head vertex, and DNA primase-helicase subunit genes, complete cds) position: , mismatch: 8, identity: 0.75

aaacagaatgatctaaataagcttttcgataa	CRISPR spacer
aagtttatggatataaataagctttttgataa	Protospacer
**..  *  *** *************.*****

92. spacer 2.3|2737557|32|CP033133|CRISPRCasFinder,CRT matches to MH179477 (Aeromonas phage 60AhydR15PP, complete genome) position: , mismatch: 8, identity: 0.75

aaacagaatgatctaaataagcttttcgataa	CRISPR spacer
aagtttatggatataaataagctttttgataa	Protospacer
**..  *  *** *************.*****

93. spacer 2.3|2737557|32|CP033133|CRISPRCasFinder,CRT matches to NC_008208 (Aeromonas phage 25, complete genome) position: , mismatch: 8, identity: 0.75

aaacagaatgatctaaataagcttttcgataa	CRISPR spacer
aagtttatggatataaataagctttttgataa	Protospacer
**..  *  *** *************.*****

94. spacer 2.3|2737557|32|CP033133|CRISPRCasFinder,CRT matches to JN377900 (Aeromonas phage Aes144 DNA polymerase subunits, putative VSR endonuclease, DNA polymerase subunit, dCMP hydroxymethylase, and initiator of head vertex genes, complete cds) position: , mismatch: 8, identity: 0.75

aaacagaatgatctaaataagcttttcgataa	CRISPR spacer
aagtttatggatataaataagctttttgataa	Protospacer
**..  *  *** *************.*****

95. spacer 2.3|2737557|32|CP033133|CRISPRCasFinder,CRT matches to AY303350 (Aeromonas phage 25 gp46 recombination endonuclease subunit (46) gene, partial cds; conserved hypothetical protein (45.2), RNA polymerase binding protein (rpbA), sliding clamp (45), clamp loader subunit (44), clamp loader subunit (62), RegA (regA), core DNA polymerase of replisome (43A), GIY-YIG endonuclease (helc25), and core DNA polymerase of replisome (43B) genes, complete cds; and hypothetical protein (43.-1) gene, partial cds) position: , mismatch: 8, identity: 0.75

aaacagaatgatctaaataagcttttcgataa	CRISPR spacer
aagtttatggatataaataagctttttgataa	Protospacer
**..  *  *** *************.*****

96. spacer 2.3|2737557|32|CP033133|CRISPRCasFinder,CRT matches to NC_014635 (Aeromonas phage phiAS4, complete genome) position: , mismatch: 8, identity: 0.75

aaacagaatgatctaaataagcttttcgataa	CRISPR spacer
aagtttatggatataaataagctttttgataa	Protospacer
**..  *  *** *************.*****

97. spacer 2.3|2737557|32|CP033133|CRISPRCasFinder,CRT matches to DQ529280 (Aeromonas salmonicida bacteriophage 25, complete genome) position: , mismatch: 8, identity: 0.75

aaacagaatgatctaaataagcttttcgataa	CRISPR spacer
aagtttatggatataaataagctttttgataa	Protospacer
**..  *  *** *************.*****

98. spacer 2.3|2737557|32|CP033133|CRISPRCasFinder,CRT matches to JN377896 (Aeromonas phage Aes002 DNA polymerase subunit, putative GIY-YIG homing endonuclease, DNA polymerase subunit, dCMP hydroxymethylase, and initiator of head vertex genes, complete cds) position: , mismatch: 8, identity: 0.75

aaacagaatgatctaaataagcttttcgataa	CRISPR spacer
aagtttatggatataaataagctttttgataa	Protospacer
**..  *  *** *************.*****

99. spacer 2.3|2737557|32|CP033133|CRISPRCasFinder,CRT matches to JN377897 (Aeromonas phage Aes007 DNA polymerase subunit, putative HNH homing endonuclease, DNA polymerase, dCMP hydroxymethylase, and initiator of head vertex genes, complete cds) position: , mismatch: 8, identity: 0.75

aaacagaatgatctaaataagcttttcgataa	CRISPR spacer
aagtttatggatataaataagctttttgataa	Protospacer
**..  *  *** *************.*****

100. spacer 2.3|2737557|32|CP033133|CRISPRCasFinder,CRT matches to JN377898 (Aeromonas phage Aes120 DNA polymerase subunit, putative GIY-YIG homing endonuclease, DNA polymerase subunit, dCMP hydroxymethylase, initiator of head vertex, and putative HNH homing endonuclease genes, complete cds) position: , mismatch: 8, identity: 0.75

aaacagaatgatctaaataagcttttcgataa	CRISPR spacer
aagtttatggatataaataagctttttgataa	Protospacer
**..  *  *** *************.*****

101. spacer 2.3|2737557|32|CP033133|CRISPRCasFinder,CRT matches to JN377905 (Aeromonas phage Aes516 clone contig 13 genomic sequence) position: , mismatch: 8, identity: 0.75

aaacagaatgatctaaataagcttttcgataa	CRISPR spacer
aagtttatggatataaataagctttttgataa	Protospacer
**..  *  *** *************.*****

102. spacer 2.3|2737557|32|CP033133|CRISPRCasFinder,CRT matches to JN377902 (Aeromonas phage Aes509 DNA polymerase subunits, putative VSR endonuclease, DNA polymerase subunit, dCMP hydroxymethylase, initiator of head vertex, and putative HNH homing endonuclease genes, complete cds) position: , mismatch: 8, identity: 0.75

aaacagaatgatctaaataagcttttcgataa	CRISPR spacer
aagtttatggatataaataagctttttgataa	Protospacer
**..  *  *** *************.*****

103. spacer 2.3|2737557|32|CP033133|CRISPRCasFinder,CRT matches to JN377904 (Aeromonas phage Aes517 DNA polymerase subunit, truncated putative GIY-YIG homing endonuclease, hypothetical protein, DNA polymerase subunit, putative VSR endonuclease, DNA polymerase subunit, dCMP hydroxymethylase, and initiator of head vertex genes, complete cds) position: , mismatch: 8, identity: 0.75

aaacagaatgatctaaataagcttttcgataa	CRISPR spacer
aagtttatggatataaataagctttttgataa	Protospacer
**..  *  *** *************.*****

104. spacer 2.3|2737557|32|CP033133|CRISPRCasFinder,CRT matches to MH179476 (Aeromonas phage 50AhydR13PP, complete genome) position: , mismatch: 8, identity: 0.75

aaacagaatgatctaaataagcttttcgataa	CRISPR spacer
aagtttatggatataaataagctttttgataa	Protospacer
**..  *  *** *************.*****

105. spacer 2.3|2737557|32|CP033133|CRISPRCasFinder,CRT matches to NC_019543 (Aeromonas phage Aes508, complete genome) position: , mismatch: 8, identity: 0.75

aaacagaatgatctaaataagcttttcgataa	CRISPR spacer
aagtttatggatataaataagctttttgataa	Protospacer
**..  *  *** *************.*****

106. spacer 2.10|2737977|32|CP033133|CRISPRCasFinder,CRT matches to MG592671 (Vibrio phage 2.275.O._10N.286.54.E11, partial genome) position: , mismatch: 8, identity: 0.75

catatttcaactcaatgccatcgtagccactt--	CRISPR spacer
aatatgtcaacttaatgccatcgtg--tactgga	Protospacer
 **** ******.***********.  .***   

107. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to NC_021229 (Arthrobacter nicotinovorans pAO1 megaplasmid sequence, strain ATCC 49919) position: , mismatch: 8, identity: 0.75

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
ttctgggacgaggacgacaacgtcgactacga	Protospacer
 .  *  ***************.**** ****

108. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to NZ_CP053566 (Pseudonocardia sp. Gen01 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gacgacgacgaggacgaccacggcgacgacga	Protospacer
.  ..* *********** *** *********

109. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to NZ_CP053566 (Pseudonocardia sp. Gen01 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gacgacgacgaggacgaccacggcgacgacga	Protospacer
.  ..* *********** *** *********

110. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to JN968479 (Haloarcula hispanica icosahedral virus 2, complete genome) position: , mismatch: 8, identity: 0.75

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gtcggctacgaggccgacaaggccgacgccaa	Protospacer
.. .********* ****** ******* *.*

111. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to MK494117 (Mycobacterium phage Miramae, complete genome) position: , mismatch: 8, identity: 0.75

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gccttggacgaggccgacaacgccgactacga	Protospacer
.*     ****** ************* ****

112. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to NC_042118 (Microbacterium phage Koji, complete genome) position: , mismatch: 8, identity: 0.75

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gaggactacgaggacgacaccgacgacgaccc	Protospacer
. *..************** ** *******  

113. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to MK494129 (Mycobacterium phage AvatarAhPeg, complete genome) position: , mismatch: 8, identity: 0.75

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gccttggacgaggccgacaacgccgactacga	Protospacer
.*     ****** ************* ****

114. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to KX579975 (Mycobacterium phage Mundrea, complete genome) position: , mismatch: 8, identity: 0.75

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gccctggacgaggccgacaacgccgactacga	Protospacer
.*     ****** ************* ****

115. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to NC_008712 (Paenarthrobacter aurescens TC1 plasmid pTC1, complete sequence) position: , mismatch: 8, identity: 0.75

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gcgagcgacgaggacgccaacgccgtctatat	Protospacer
.***** ********* ******** * *.. 

116. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to NZ_CP010990 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence) position: , mismatch: 8, identity: 0.75

acgagcta--cgaggacgacaacgccgacgacga	CRISPR spacer
--ggcccggccgaggacgaccccgccgacgacga	Protospacer
  *. *..  **********  ************

117. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.75

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
cagtaccgcgaggacgacgatgccgacgacga	Protospacer
  * .*..**********.*.***********

118. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to MN284895 (Mycobacterium phage Marshawn, complete genome) position: , mismatch: 8, identity: 0.75

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gccgacgacgaggccgaccacgccgacgacgg	Protospacer
.* ..* ****** **** ************.

119. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to MG009575 (Mycobacterium phage Kumao, complete genome) position: , mismatch: 8, identity: 0.75

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gcgctctacgaggactactacgccgacgagtt	Protospacer
.**  ********** ** **********   

120. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to MN813693 (Mycobacterium phage Imvubu, complete genome) position: , mismatch: 8, identity: 0.75

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
aacgacgacgaggacggcaacgccgacggcgc	Protospacer
*  ..* *********.***********.** 

121. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gaaatcgaagaggacgacaacggcgacgaaga	Protospacer
. .* * * ************* ****** **

122. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
agcaccgccgtgtacgacaacgccgacgacgg	Protospacer
*  * *  ** * ******************.

123. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to MN096355 (Mycobacterium phage Purky, complete genome) position: , mismatch: 8, identity: 0.75

acgagctac-gaggacgacaacgccgacgacga	CRISPR spacer
-cagcccgcggaggacgtcgacgccgacgacga	Protospacer
 *.. *..* ******* *.*************

124. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to MN694766 (Marine virus AFVG_250M151, complete genome) position: , mismatch: 8, identity: 0.75

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gagcccgaagaggacgacgacgacgacgacga	Protospacer
. *  * * *********.*** *********

125. spacer 2.16|2738338|32|CP033133|CRISPRCasFinder,CRT matches to MH616818 (Inoviridae sp. isolate ctba29, complete genome) position: , mismatch: 8, identity: 0.75

gtgcttcatcatagataagaacagaaccgaaa	CRISPR spacer
gacattcatcataaataacaacagaaccagca	Protospacer
*   *********.**** *********.. *

126. spacer 2.16|2738338|32|CP033133|CRISPRCasFinder,CRT matches to MH617467 (Inoviridae sp. isolate ctba17, complete genome) position: , mismatch: 8, identity: 0.75

gtgcttcatcatagataagaacagaaccgaaa	CRISPR spacer
gcgcttcatcaaagataagcacagagtctgga	Protospacer
*.********* ******* *****..* ..*

127. spacer 2.16|2738338|32|CP033133|CRISPRCasFinder,CRT matches to MH412654 (Synechococcus phage S-T4, complete genome) position: , mismatch: 8, identity: 0.75

gtgcttcatcatagataagaacagaaccgaaa	CRISPR spacer
ttgtatcatcataaattagaacagaaccatta	Protospacer
 **. ********.** ***********.  *

128. spacer 2.27|2737558|32|CP033133|PILER-CR matches to JN377903 (Aeromonas phage Aes512 DNA polymerase subunit, putative GIY-YIG homing endonuclease, DNA polymerase subunit, putative VSR endonuclease, DNA polymerase subunit, dCMP hydroxymethylase, initiator of head vertex, and DNA primase-helicase subunit genes, complete cds) position: , mismatch: 8, identity: 0.75

aaacagaatgatctaaataagcttttcgataa	CRISPR spacer
aagtttatggatataaataagctttttgataa	Protospacer
**..  *  *** *************.*****

129. spacer 2.27|2737558|32|CP033133|PILER-CR matches to MH179477 (Aeromonas phage 60AhydR15PP, complete genome) position: , mismatch: 8, identity: 0.75

aaacagaatgatctaaataagcttttcgataa	CRISPR spacer
aagtttatggatataaataagctttttgataa	Protospacer
**..  *  *** *************.*****

130. spacer 2.27|2737558|32|CP033133|PILER-CR matches to NC_008208 (Aeromonas phage 25, complete genome) position: , mismatch: 8, identity: 0.75

aaacagaatgatctaaataagcttttcgataa	CRISPR spacer
aagtttatggatataaataagctttttgataa	Protospacer
**..  *  *** *************.*****

131. spacer 2.27|2737558|32|CP033133|PILER-CR matches to JN377900 (Aeromonas phage Aes144 DNA polymerase subunits, putative VSR endonuclease, DNA polymerase subunit, dCMP hydroxymethylase, and initiator of head vertex genes, complete cds) position: , mismatch: 8, identity: 0.75

aaacagaatgatctaaataagcttttcgataa	CRISPR spacer
aagtttatggatataaataagctttttgataa	Protospacer
**..  *  *** *************.*****

132. spacer 2.27|2737558|32|CP033133|PILER-CR matches to AY303350 (Aeromonas phage 25 gp46 recombination endonuclease subunit (46) gene, partial cds; conserved hypothetical protein (45.2), RNA polymerase binding protein (rpbA), sliding clamp (45), clamp loader subunit (44), clamp loader subunit (62), RegA (regA), core DNA polymerase of replisome (43A), GIY-YIG endonuclease (helc25), and core DNA polymerase of replisome (43B) genes, complete cds; and hypothetical protein (43.-1) gene, partial cds) position: , mismatch: 8, identity: 0.75

aaacagaatgatctaaataagcttttcgataa	CRISPR spacer
aagtttatggatataaataagctttttgataa	Protospacer
**..  *  *** *************.*****

133. spacer 2.27|2737558|32|CP033133|PILER-CR matches to NC_014635 (Aeromonas phage phiAS4, complete genome) position: , mismatch: 8, identity: 0.75

aaacagaatgatctaaataagcttttcgataa	CRISPR spacer
aagtttatggatataaataagctttttgataa	Protospacer
**..  *  *** *************.*****

134. spacer 2.27|2737558|32|CP033133|PILER-CR matches to DQ529280 (Aeromonas salmonicida bacteriophage 25, complete genome) position: , mismatch: 8, identity: 0.75

aaacagaatgatctaaataagcttttcgataa	CRISPR spacer
aagtttatggatataaataagctttttgataa	Protospacer
**..  *  *** *************.*****

135. spacer 2.27|2737558|32|CP033133|PILER-CR matches to JN377896 (Aeromonas phage Aes002 DNA polymerase subunit, putative GIY-YIG homing endonuclease, DNA polymerase subunit, dCMP hydroxymethylase, and initiator of head vertex genes, complete cds) position: , mismatch: 8, identity: 0.75

aaacagaatgatctaaataagcttttcgataa	CRISPR spacer
aagtttatggatataaataagctttttgataa	Protospacer
**..  *  *** *************.*****

136. spacer 2.27|2737558|32|CP033133|PILER-CR matches to JN377897 (Aeromonas phage Aes007 DNA polymerase subunit, putative HNH homing endonuclease, DNA polymerase, dCMP hydroxymethylase, and initiator of head vertex genes, complete cds) position: , mismatch: 8, identity: 0.75

aaacagaatgatctaaataagcttttcgataa	CRISPR spacer
aagtttatggatataaataagctttttgataa	Protospacer
**..  *  *** *************.*****

137. spacer 2.27|2737558|32|CP033133|PILER-CR matches to JN377898 (Aeromonas phage Aes120 DNA polymerase subunit, putative GIY-YIG homing endonuclease, DNA polymerase subunit, dCMP hydroxymethylase, initiator of head vertex, and putative HNH homing endonuclease genes, complete cds) position: , mismatch: 8, identity: 0.75

aaacagaatgatctaaataagcttttcgataa	CRISPR spacer
aagtttatggatataaataagctttttgataa	Protospacer
**..  *  *** *************.*****

138. spacer 2.27|2737558|32|CP033133|PILER-CR matches to JN377905 (Aeromonas phage Aes516 clone contig 13 genomic sequence) position: , mismatch: 8, identity: 0.75

aaacagaatgatctaaataagcttttcgataa	CRISPR spacer
aagtttatggatataaataagctttttgataa	Protospacer
**..  *  *** *************.*****

139. spacer 2.27|2737558|32|CP033133|PILER-CR matches to JN377902 (Aeromonas phage Aes509 DNA polymerase subunits, putative VSR endonuclease, DNA polymerase subunit, dCMP hydroxymethylase, initiator of head vertex, and putative HNH homing endonuclease genes, complete cds) position: , mismatch: 8, identity: 0.75

aaacagaatgatctaaataagcttttcgataa	CRISPR spacer
aagtttatggatataaataagctttttgataa	Protospacer
**..  *  *** *************.*****

140. spacer 2.27|2737558|32|CP033133|PILER-CR matches to JN377904 (Aeromonas phage Aes517 DNA polymerase subunit, truncated putative GIY-YIG homing endonuclease, hypothetical protein, DNA polymerase subunit, putative VSR endonuclease, DNA polymerase subunit, dCMP hydroxymethylase, and initiator of head vertex genes, complete cds) position: , mismatch: 8, identity: 0.75

aaacagaatgatctaaataagcttttcgataa	CRISPR spacer
aagtttatggatataaataagctttttgataa	Protospacer
**..  *  *** *************.*****

141. spacer 2.27|2737558|32|CP033133|PILER-CR matches to MH179476 (Aeromonas phage 50AhydR13PP, complete genome) position: , mismatch: 8, identity: 0.75

aaacagaatgatctaaataagcttttcgataa	CRISPR spacer
aagtttatggatataaataagctttttgataa	Protospacer
**..  *  *** *************.*****

142. spacer 2.27|2737558|32|CP033133|PILER-CR matches to NC_019543 (Aeromonas phage Aes508, complete genome) position: , mismatch: 8, identity: 0.75

aaacagaatgatctaaataagcttttcgataa	CRISPR spacer
aagtttatggatataaataagctttttgataa	Protospacer
**..  *  *** *************.*****

143. spacer 2.34|2737978|32|CP033133|PILER-CR matches to MG592671 (Vibrio phage 2.275.O._10N.286.54.E11, partial genome) position: , mismatch: 8, identity: 0.75

catatttcaactcaatgccatcgtagccactt--	CRISPR spacer
aatatgtcaacttaatgccatcgtg--tactgga	Protospacer
 **** ******.***********.  .***   

144. spacer 2.35|2738038|32|CP033133|PILER-CR matches to NC_021229 (Arthrobacter nicotinovorans pAO1 megaplasmid sequence, strain ATCC 49919) position: , mismatch: 8, identity: 0.75

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
ttctgggacgaggacgacaacgtcgactacga	Protospacer
 .  *  ***************.**** ****

145. spacer 2.35|2738038|32|CP033133|PILER-CR matches to NZ_CP053566 (Pseudonocardia sp. Gen01 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gacgacgacgaggacgaccacggcgacgacga	Protospacer
.  ..* *********** *** *********

146. spacer 2.35|2738038|32|CP033133|PILER-CR matches to NZ_CP053566 (Pseudonocardia sp. Gen01 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gacgacgacgaggacgaccacggcgacgacga	Protospacer
.  ..* *********** *** *********

147. spacer 2.35|2738038|32|CP033133|PILER-CR matches to JN968479 (Haloarcula hispanica icosahedral virus 2, complete genome) position: , mismatch: 8, identity: 0.75

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gtcggctacgaggccgacaaggccgacgccaa	Protospacer
.. .********* ****** ******* *.*

148. spacer 2.35|2738038|32|CP033133|PILER-CR matches to MK494117 (Mycobacterium phage Miramae, complete genome) position: , mismatch: 8, identity: 0.75

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gccttggacgaggccgacaacgccgactacga	Protospacer
.*     ****** ************* ****

149. spacer 2.35|2738038|32|CP033133|PILER-CR matches to NC_042118 (Microbacterium phage Koji, complete genome) position: , mismatch: 8, identity: 0.75

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gaggactacgaggacgacaccgacgacgaccc	Protospacer
. *..************** ** *******  

150. spacer 2.35|2738038|32|CP033133|PILER-CR matches to MK494129 (Mycobacterium phage AvatarAhPeg, complete genome) position: , mismatch: 8, identity: 0.75

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gccttggacgaggccgacaacgccgactacga	Protospacer
.*     ****** ************* ****

151. spacer 2.35|2738038|32|CP033133|PILER-CR matches to KX579975 (Mycobacterium phage Mundrea, complete genome) position: , mismatch: 8, identity: 0.75

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gccctggacgaggccgacaacgccgactacga	Protospacer
.*     ****** ************* ****

152. spacer 2.35|2738038|32|CP033133|PILER-CR matches to NC_008712 (Paenarthrobacter aurescens TC1 plasmid pTC1, complete sequence) position: , mismatch: 8, identity: 0.75

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gcgagcgacgaggacgccaacgccgtctatat	Protospacer
.***** ********* ******** * *.. 

153. spacer 2.35|2738038|32|CP033133|PILER-CR matches to NZ_CP010990 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence) position: , mismatch: 8, identity: 0.75

acgagcta--cgaggacgacaacgccgacgacga	CRISPR spacer
--ggcccggccgaggacgaccccgccgacgacga	Protospacer
  *. *..  **********  ************

154. spacer 2.35|2738038|32|CP033133|PILER-CR matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.75

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
cagtaccgcgaggacgacgatgccgacgacga	Protospacer
  * .*..**********.*.***********

155. spacer 2.35|2738038|32|CP033133|PILER-CR matches to MN284895 (Mycobacterium phage Marshawn, complete genome) position: , mismatch: 8, identity: 0.75

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gccgacgacgaggccgaccacgccgacgacgg	Protospacer
.* ..* ****** **** ************.

156. spacer 2.35|2738038|32|CP033133|PILER-CR matches to MG009575 (Mycobacterium phage Kumao, complete genome) position: , mismatch: 8, identity: 0.75

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gcgctctacgaggactactacgccgacgagtt	Protospacer
.**  ********** ** **********   

157. spacer 2.35|2738038|32|CP033133|PILER-CR matches to MN813693 (Mycobacterium phage Imvubu, complete genome) position: , mismatch: 8, identity: 0.75

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
aacgacgacgaggacggcaacgccgacggcgc	Protospacer
*  ..* *********.***********.** 

158. spacer 2.35|2738038|32|CP033133|PILER-CR matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gaaatcgaagaggacgacaacggcgacgaaga	Protospacer
. .* * * ************* ****** **

159. spacer 2.35|2738038|32|CP033133|PILER-CR matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
agcaccgccgtgtacgacaacgccgacgacgg	Protospacer
*  * *  ** * ******************.

160. spacer 2.35|2738038|32|CP033133|PILER-CR matches to MN096355 (Mycobacterium phage Purky, complete genome) position: , mismatch: 8, identity: 0.75

acgagctac-gaggacgacaacgccgacgacga	CRISPR spacer
-cagcccgcggaggacgtcgacgccgacgacga	Protospacer
 *.. *..* ******* *.*************

161. spacer 2.35|2738038|32|CP033133|PILER-CR matches to MN694766 (Marine virus AFVG_250M151, complete genome) position: , mismatch: 8, identity: 0.75

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gagcccgaagaggacgacgacgacgacgacga	Protospacer
. *  * * *********.*** *********

162. spacer 2.40|2738339|32|CP033133|PILER-CR matches to MH616818 (Inoviridae sp. isolate ctba29, complete genome) position: , mismatch: 8, identity: 0.75

gtgcttcatcatagataagaacagaaccgaaa	CRISPR spacer
gacattcatcataaataacaacagaaccagca	Protospacer
*   *********.**** *********.. *

163. spacer 2.40|2738339|32|CP033133|PILER-CR matches to MH617467 (Inoviridae sp. isolate ctba17, complete genome) position: , mismatch: 8, identity: 0.75

gtgcttcatcatagataagaacagaaccgaaa	CRISPR spacer
gcgcttcatcaaagataagcacagagtctgga	Protospacer
*.********* ******* *****..* ..*

164. spacer 2.40|2738339|32|CP033133|PILER-CR matches to MH412654 (Synechococcus phage S-T4, complete genome) position: , mismatch: 8, identity: 0.75

gtgcttcatcatagataagaacagaaccgaaa	CRISPR spacer
ttgtatcatcataaattagaacagaaccatta	Protospacer
 **. ********.** ***********.  *

165. spacer 1.2|2675235|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NC_007581 (Clostridium phage c-st, complete genome) position: , mismatch: 9, identity: 0.719

ctaactgttgaaaaagacattaaatctaaagc	CRISPR spacer
ataactattgaaaaagactttaaaaaacaact	Protospacer
 *****.*********** *****    ** .

166. spacer 1.2|2675235|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to ACSJ01000013 (Clostridium phage D-1873 CLG.Contig165, whole genome shotgun sequence) position: , mismatch: 9, identity: 0.719

ctaactgttgaaaaagacattaaatctaaagc	CRISPR spacer
ataactattgaaaaagactttaaaaaacaact	Protospacer
 *****.*********** *****    ** .

167. spacer 1.2|2675235|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to AP008983 (Clostridium phage c-st genomic DNA, complete genome) position: , mismatch: 9, identity: 0.719

ctaactgttgaaaaagacattaaatctaaagc	CRISPR spacer
ataactattgaaaaagactttaaaaaacaact	Protospacer
 *****.*********** *****    ** .

168. spacer 1.9|2675655|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009363 (Yersinia frederiksenii Y225 plasmid unnsmrf, complete sequence) position: , mismatch: 9, identity: 0.719

aactgtctttttattctttgataatgaattgc	CRISPR spacer
taaatcctttttatacttggataatgaatttt	Protospacer
 *   .******** *** *********** .

169. spacer 1.9|2675655|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to MK554696 (Fusobacterium phage Fnu1, complete genome) position: , mismatch: 9, identity: 0.719

aactgtctttttattctttgataatgaattgc	CRISPR spacer
ttcctcctttttattttttgataattaattat	Protospacer
  *. .*********.********* ****..

170. spacer 1.10|2675715|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045339 (Vibrio sp. THAF190c plasmid pTHAF190c_a, complete sequence) position: , mismatch: 9, identity: 0.719

ccacatgctccgatttttcggggctttttaat	CRISPR spacer
ctcaacactccgatttttccggggtttttagg	Protospacer
*.  *..************ *** ******. 

171. spacer 1.10|2675715|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to MG945269 (UNVERIFIED: Microviridae sp. isolate 3358-17112, partial genome) position: , mismatch: 9, identity: 0.719

ccacatgctccgatttttcggggctttttaat	CRISPR spacer
aacaaagccccgatttctcggggctttttttt	Protospacer
    * **.*******.************  *

172. spacer 1.10|2675715|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to KP399678 (Listeria phage vB_LmoS_293, complete genome) position: , mismatch: 9, identity: 0.719

-ccacatgctccgatttttcggggctttttaat	CRISPR spacer
gttata-gctccgatatctcggggcttttttga	Protospacer
 ..*.* ******** *.************ . 

173. spacer 1.12|2675835|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to MN994499 (Phage NBEco005, complete genome) position: , mismatch: 9, identity: 0.719

gataaattatcttgacagtgatatttgattaa	CRISPR spacer
tttaaagtatcttgacagtaatattgaagaag	Protospacer
  **** ************.***** .*  *.

174. spacer 1.14|2675955|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017832 (Butyrivibrio hungatei strain MB2003 plasmid pNP144, complete sequence) position: , mismatch: 9, identity: 0.719

gattccgacaatttattttcattatttgaaaa	CRISPR spacer
gggtggtgaaatttagtttcattatttaaaaa	Protospacer
*. *   . ****** ***********.****

175. spacer 1.17|2676135|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to KX130865 (Shigella phage SHSML-52-1, complete genome) position: , mismatch: 9, identity: 0.719

ttgtcgagcttctgaattaactacactgacat	CRISPR spacer
ttgacgagcttctgaataaactaggacgtgaa	Protospacer
*** ************* ***** . .*  * 

176. spacer 1.17|2676135|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to MK373782 (Escherichia phage vB_EcoM_KAW3E185, complete genome) position: , mismatch: 9, identity: 0.719

ttgtcgagcttctgaattaactacactgacat	CRISPR spacer
ttgacgagcttctgaataaactaggacgtgaa	Protospacer
*** ************* ***** . .*  * 

177. spacer 1.18|2676195|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053657 (Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence) position: , mismatch: 9, identity: 0.719

tgcgctagagcaattattagaaagtgtgggtt	CRISPR spacer
aaaggtagagcaatttttagaaagtatggtca	Protospacer
 . * ********** *********.*** . 

178. spacer 1.20|2676315|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to MN693554 (Marine virus AFVG_25M30, complete genome) position: , mismatch: 9, identity: 0.719

cttccagtacaacatttaagaaatattctttg	CRISPR spacer
actggcacacaccatttaagaaattttctttg	Protospacer
 .*   ..*** ************ *******

179. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to MN444877 (Microbacterium phage Antares, complete genome) position: , mismatch: 9, identity: 0.719

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gccgactccgaggacgacaacgccgccgagac	Protospacer
.* ..** ***************** *** . 

180. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 9, identity: 0.719

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gccgtggccgaggacgacatcgccgacgagga	Protospacer
.* .    *********** ********* **

181. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to MH590600 (Microbacterium phage KaiHaiDragon, complete genome) position: , mismatch: 9, identity: 0.719

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gccgactccgaggacgacaacgccgccgagac	Protospacer
.* ..** ***************** *** . 

182. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to MK977698 (Microbacterium phage Busephilis, complete genome) position: , mismatch: 9, identity: 0.719

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gccgactccgaggacgacaacgccgccgagac	Protospacer
.* ..** ***************** *** . 

183. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to MK875798 (Microbacterium phage Piperis, complete genome) position: , mismatch: 9, identity: 0.719

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gccgactccgaggacgacaacgccgccgagac	Protospacer
.* ..** ***************** *** . 

184. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to MT818415 (Microbacterium phage Scumberland, complete genome) position: , mismatch: 9, identity: 0.719

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gccgactccgaggacgacaacgccgccgagac	Protospacer
.* ..** ***************** *** . 

185. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to NC_011758 (Methylorubrum extorquens CM4 plasmid pCMU01, complete sequence) position: , mismatch: 9, identity: 0.719

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
cccggctacgcggacgactacgccgacatggt	Protospacer
 * .****** ******* ********.  * 

186. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to NC_031254 (Arthrobacter phage Kitkat, complete genome) position: , mismatch: 9, identity: 0.719

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gatgactcggaggacgacgacgccgacgagga	Protospacer
.  ..**  *********.********** **

187. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to NC_031231 (Arthrobacter phage KellEzio, complete genome) position: , mismatch: 9, identity: 0.719

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gacgactcggaggacgacgacaccgacgacga	Protospacer
.  ..**  *********.**.**********

188. spacer 2.16|2738338|32|CP033133|CRISPRCasFinder,CRT matches to NZ_CP022299 (Acinetobacter johnsonii strain IC001 plasmid pIC001A, complete sequence) position: , mismatch: 9, identity: 0.719

gtgcttcatcatagataagaacagaaccgaaa	CRISPR spacer
gcgcttcatcatagacaagtacagattcaggc	Protospacer
*.*************.*** ***** .*... 

189. spacer 2.35|2738038|32|CP033133|PILER-CR matches to MN444877 (Microbacterium phage Antares, complete genome) position: , mismatch: 9, identity: 0.719

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gccgactccgaggacgacaacgccgccgagac	Protospacer
.* ..** ***************** *** . 

190. spacer 2.35|2738038|32|CP033133|PILER-CR matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 9, identity: 0.719

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gccgtggccgaggacgacatcgccgacgagga	Protospacer
.* .    *********** ********* **

191. spacer 2.35|2738038|32|CP033133|PILER-CR matches to MH590600 (Microbacterium phage KaiHaiDragon, complete genome) position: , mismatch: 9, identity: 0.719

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gccgactccgaggacgacaacgccgccgagac	Protospacer
.* ..** ***************** *** . 

192. spacer 2.35|2738038|32|CP033133|PILER-CR matches to MK977698 (Microbacterium phage Busephilis, complete genome) position: , mismatch: 9, identity: 0.719

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gccgactccgaggacgacaacgccgccgagac	Protospacer
.* ..** ***************** *** . 

193. spacer 2.35|2738038|32|CP033133|PILER-CR matches to MK875798 (Microbacterium phage Piperis, complete genome) position: , mismatch: 9, identity: 0.719

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gccgactccgaggacgacaacgccgccgagac	Protospacer
.* ..** ***************** *** . 

194. spacer 2.35|2738038|32|CP033133|PILER-CR matches to MT818415 (Microbacterium phage Scumberland, complete genome) position: , mismatch: 9, identity: 0.719

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gccgactccgaggacgacaacgccgccgagac	Protospacer
.* ..** ***************** *** . 

195. spacer 2.35|2738038|32|CP033133|PILER-CR matches to NC_011758 (Methylorubrum extorquens CM4 plasmid pCMU01, complete sequence) position: , mismatch: 9, identity: 0.719

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
cccggctacgcggacgactacgccgacatggt	Protospacer
 * .****** ******* ********.  * 

196. spacer 2.35|2738038|32|CP033133|PILER-CR matches to NC_031254 (Arthrobacter phage Kitkat, complete genome) position: , mismatch: 9, identity: 0.719

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gatgactcggaggacgacgacgccgacgagga	Protospacer
.  ..**  *********.********** **

197. spacer 2.35|2738038|32|CP033133|PILER-CR matches to NC_031231 (Arthrobacter phage KellEzio, complete genome) position: , mismatch: 9, identity: 0.719

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gacgactcggaggacgacgacaccgacgacga	Protospacer
.  ..**  *********.**.**********

198. spacer 2.40|2738339|32|CP033133|PILER-CR matches to NZ_CP022299 (Acinetobacter johnsonii strain IC001 plasmid pIC001A, complete sequence) position: , mismatch: 9, identity: 0.719

gtgcttcatcatagataagaacagaaccgaaa	CRISPR spacer
gcgcttcatcatagacaagtacagattcaggc	Protospacer
*.*************.*** ***** .*... 

199. spacer 1.2|2675235|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030790 (Vibrio campbellii strain DS40M4 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ctaactgttgaaaaagacattaaatctaaagc	CRISPR spacer
tcaagtgttaaaaaagacattaaattaatgat	Protospacer
..** ****.***************. * ...

200. spacer 1.2|2675235|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015865 (Vibrio campbellii CAIM 519 = NBRC 15631 strain ATCC 25920, CAIM 519T plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ctaactgttgaaaaagacattaaatctaaagc	CRISPR spacer
tcaagtgttaaaaaagacattaaattaatgat	Protospacer
..** ****.***************. * ...

201. spacer 1.3|2675295|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to MT430910 (Streptococcus phage smHBZ8, complete genome) position: , mismatch: 10, identity: 0.688

cactttgaagcaagcagaaccaatgtttaaaa	CRISPR spacer
tgacaagaagcaagcagaactaatgtataagg	Protospacer
.. .  **************.***** ***..

202. spacer 1.9|2675655|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NC_017401 (Borreliella burgdorferi N40 plasmid N40_cp26, complete sequence) position: , mismatch: 10, identity: 0.688

aactgtctttttattctttgataatgaattgc	CRISPR spacer
caacctctttttattctttgaacatgaaagta	Protospacer
 * . ****************  *****    

203. spacer 1.9|2675655|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NC_017395 (Borreliella burgdorferi JD1 plasmid JD1 cp26, complete sequence) position: , mismatch: 10, identity: 0.688

aactgtctttttattctttgataatgaattgc	CRISPR spacer
caacctctttttattctttgaacatgaaagta	Protospacer
 * . ****************  *****    

204. spacer 1.9|2675655|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031398 (Borreliella burgdorferi strain MM1 plasmid plsm_cp26, complete sequence) position: , mismatch: 10, identity: 0.688

aactgtctttttattctttgataatgaattgc	CRISPR spacer
caacctctttttattctttgaacatgaaagta	Protospacer
 * . ****************  *****    

205. spacer 1.9|2675655|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NC_011724 (Borreliella burgdorferi ZS7 plasmid ZS7_cp26, complete sequence) position: , mismatch: 10, identity: 0.688

aactgtctttttattctttgataatgaattgc	CRISPR spacer
caacctctttttattctttgaacatgaaagta	Protospacer
 * . ****************  *****    

206. spacer 1.9|2675655|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NC_001903 (Borreliella burgdorferi B31 plasmid cp26, complete sequence) position: , mismatch: 10, identity: 0.688

aactgtctttttattctttgataatgaattgc	CRISPR spacer
caacctctttttattctttgaacatgaaagta	Protospacer
 * . ****************  *****    

207. spacer 1.9|2675655|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019755 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_cp26, complete sequence) position: , mismatch: 10, identity: 0.688

aactgtctttttattctttgataatgaattgc	CRISPR spacer
caacctctttttattctttgaacatgaaagta	Protospacer
 * . ****************  *****    

208. spacer 1.9|2675655|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017202 (Borreliella burgdorferi strain B331 plasmid B331_cp26, complete sequence) position: , mismatch: 10, identity: 0.688

aactgtctttttattctttgataatgaattgc	CRISPR spacer
caacctctttttattctttgaacatgaaagta	Protospacer
 * . ****************  *****    

209. spacer 1.9|2675655|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NC_019225 (Borrelia burgdorferi plasmid cp26, complete sequence) position: , mismatch: 10, identity: 0.688

aactgtctttttattctttgataatgaattgc	CRISPR spacer
caacctctttttattctttgaacatgaaagta	Protospacer
 * . ****************  *****    

210. spacer 1.10|2675715|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NC_008758 (Polaromonas naphthalenivorans CJ2 plasmid pPNAP02, complete sequence) position: , mismatch: 10, identity: 0.688

ccacatgctccgatttttcggggctttttaat	CRISPR spacer
gtttgagctccgagttttcggggttttttgct	Protospacer
 . .. ******* *********.*****. *

211. spacer 1.11|2675775|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047086 (Bacillus paranthracis strain BC307 plasmid pCE1, complete sequence) position: , mismatch: 10, identity: 0.688

aatttaaaagtaaaaaaagaactcccccctgt	CRISPR spacer
aatttaaaaataaaaaaaggacttgtagaaat	Protospacer
*********.*********.***. .    .*

212. spacer 1.11|2675775|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041978 (Bacillus pacificus strain NCCP 15909 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

aatttaaaagtaaaaaaagaactcccccctgt	CRISPR spacer
aatttaaaaataaaaaaaggacttgtagaaat	Protospacer
*********.*********.***. .    .*

213. spacer 1.11|2675775|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031272 (Staphylococcus caprae strain 26D plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

aatttaaaagtaaaaaaagaactcccccctgt	CRISPR spacer
aattttaaagtaaataaagaactaaattaact	Protospacer
***** ******** ********   ..   *

214. spacer 1.11|2675775|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NC_005707 (Bacillus cereus ATCC 10987 plasmid pBc10987, complete sequence) position: , mismatch: 10, identity: 0.688

aatttaaaagtaaaaaaagaactcccccctgt	CRISPR spacer
aatttaaaaataaaaaaaggacttgtagaaat	Protospacer
*********.*********.***. .    .*

215. spacer 1.11|2675775|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to CP041980 (Bacillus paranthracis strain NCCP 15910 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

aatttaaaagtaaaaaaagaactcccccctgt	CRISPR spacer
aatttaaaaataaaaaaaggacttgtagaaat	Protospacer
*********.*********.***. .    .*

216. spacer 1.12|2675835|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to MT833282 (Escherichia coli phage vB_EcoM_Shy, complete genome) position: , mismatch: 10, identity: 0.688

gataaattatcttgacagtgatatttgattaa	CRISPR spacer
tttaaagtatcttgacagtaatattgaagagg	Protospacer
  **** ************.***** .*  ..

217. spacer 1.12|2675835|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to MN994503 (Phage NBSal004, complete genome) position: , mismatch: 10, identity: 0.688

gataaattatcttgacagtgatatttgattaa	CRISPR spacer
tttaaagtatcttgacagtaatattgaagagg	Protospacer
  **** ************.***** .*  ..

218. spacer 1.14|2675955|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134433 (Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 24) position: , mismatch: 10, identity: 0.688

gattccgacaatttattttcattatttgaaaa	CRISPR spacer
cgctatatgaatttaatttcattatctgaaaa	Protospacer
 ..* ..  ****** *********.******

219. spacer 1.14|2675955|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to MT366947 (Bacillus phage Hyb2phi3Ts-SPbeta, complete genome) position: , mismatch: 10, identity: 0.688

gattccgacaatttattttcattatttgaaaa	CRISPR spacer
tgaacaaacaatttatttttattatttaaatg	Protospacer
 .  * .************.*******.** .

220. spacer 1.14|2675955|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to KY030782 (Bacillus phage phi3T, complete genome) position: , mismatch: 10, identity: 0.688

gattccgacaatttattttcattatttgaaaa	CRISPR spacer
tgaacaaacaatttatttttattatttaaatg	Protospacer
 .  * .************.*******.** .

221. spacer 1.14|2675955|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NC_001884 (Bacillus phage SPBc2, complete genome) position: , mismatch: 10, identity: 0.688

gattccgacaatttattttcattatttgaaaa	CRISPR spacer
tgaacaaacaatttatttttattatttaaatg	Protospacer
 .  * .************.*******.** .

222. spacer 1.14|2675955|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to AF020713 (Bacteriophage SPBc2 complete genome) position: , mismatch: 10, identity: 0.688

gattccgacaatttattttcattatttgaaaa	CRISPR spacer
tgaacaaacaatttatttttattatttaaatg	Protospacer
 .  * .************.*******.** .

223. spacer 1.14|2675955|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to MT366946 (Bacillus phage Hyb1phi3Ts-SPbeta, complete genome) position: , mismatch: 10, identity: 0.688

gattccgacaatttattttcattatttgaaaa	CRISPR spacer
tgaacaaacaatttatttttattatttaaatg	Protospacer
 .  * .************.*******.** .

224. spacer 1.14|2675955|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to MT366948 (Bacillus phage Hyb3phi3Ts-SPbeta, complete genome) position: , mismatch: 10, identity: 0.688

gattccgacaatttattttcattatttgaaaa	CRISPR spacer
tgaacaaacaatttatttttattatttaaatg	Protospacer
 .  * .************.*******.** .

225. spacer 1.14|2675955|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to MT601274 (Bacillus phage vB_BsuS-Goe13, complete genome) position: , mismatch: 10, identity: 0.688

gattccgacaatttattttcattatttgaaaa	CRISPR spacer
tgaacaaacaatttatttttattatttaaatg	Protospacer
 .  * .************.*******.** .

226. spacer 1.14|2675955|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to MT366945 (Bacillus phage phi3Ts, complete genome) position: , mismatch: 10, identity: 0.688

gattccgacaatttattttcattatttgaaaa	CRISPR spacer
tgaacaaacaatttatttttattatttaaatg	Protospacer
 .  * .************.*******.** .

227. spacer 1.15|2676015|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NC_030948 (Ralstonia phage RSP15 DNA, complete genome) position: , mismatch: 10, identity: 0.688

atgaaaacctaccttggcttgttgggtactta	CRISPR spacer
gtccttgtctaccttggcttgttgggcaattc	Protospacer
.*    ..******************.* ** 

228. spacer 1.18|2676195|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031072 (Bacillus mycoides strain BPN401 plasmid pl395, complete sequence) position: , mismatch: 10, identity: 0.688

tgcgctagagcaattattagaaagtgtgggtt	CRISPR spacer
aaaagtagagcaatttttagaaaatgtggtca	Protospacer
 . . ********** *******.***** . 

229. spacer 2.2|2737497|32|CP033133|CRISPRCasFinder,CRT matches to EU399241 (Halomonas phage phiHAP-1, complete genome) position: , mismatch: 10, identity: 0.688

gtcactttgcaccaatcgcctggccacatgac	CRISPR spacer
cgtgctttgcatcagtcgcctggccaccttcg	Protospacer
  ..*******.**.************ *   

230. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.688

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
ctcatggtcgaggtcgagaacgccgacgacgt	Protospacer
 . *    ***** *** ************* 

231. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 10, identity: 0.688

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gactccgacgaggacgacagcgccgacaaccg	Protospacer
.    * ************.*******.** .

232. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to NC_001387 (Streptomyces lividans plasmid pIJ101, complete sequence) position: , mismatch: 10, identity: 0.688

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gacgacgaccaggacgacgacgccgacgaccg	Protospacer
.  ..* ** ********.*********** .

233. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to NC_001425 (Streptomyces flavovirens plasmid pSN22 DNA, complete sequence) position: , mismatch: 10, identity: 0.688

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gacgacgaccaggacgacgacgccgacgaccg	Protospacer
.  ..* ** ********.*********** .

234. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to MG770216 (Mycobacterium phage Rem711, complete genome) position: , mismatch: 10, identity: 0.688

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gacgacgccgacgacgacaacgccgtcgacgc	Protospacer
.  ..*  *** ************* ***** 

235. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to AY320035 (Bacteriophage VWB, complete genome) position: , mismatch: 10, identity: 0.688

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gacgacgaccaggacgacgacgccgacgactc	Protospacer
.  ..* ** ********.***********  

236. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to NC_005345 (Streptomyces phage VWB, complete genome) position: , mismatch: 10, identity: 0.688

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gacgacgaccaggacgacgacgccgacgactc	Protospacer
.  ..* ** ********.***********  

237. spacer 2.17|2738398|32|CP033133|CRISPRCasFinder,CRT matches to NZ_CP038867 (Vagococcus sp. CF-49 plasmid punnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

tccacgatctaaaaaccatgcttgtccccaaa	CRISPR spacer
tacaccctctaaaaaccatgcttgttgtagct	Protospacer
* ***  ******************. . .  

238. spacer 2.26|2737498|32|CP033133|PILER-CR matches to EU399241 (Halomonas phage phiHAP-1, complete genome) position: , mismatch: 10, identity: 0.688

gtcactttgcaccaatcgcctggccacatgac	CRISPR spacer
cgtgctttgcatcagtcgcctggccaccttcg	Protospacer
  ..*******.**.************ *   

239. spacer 2.35|2738038|32|CP033133|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.688

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
ctcatggtcgaggtcgagaacgccgacgacgt	Protospacer
 . *    ***** *** ************* 

240. spacer 2.35|2738038|32|CP033133|PILER-CR matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 10, identity: 0.688

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gactccgacgaggacgacagcgccgacaaccg	Protospacer
.    * ************.*******.** .

241. spacer 2.35|2738038|32|CP033133|PILER-CR matches to NC_001387 (Streptomyces lividans plasmid pIJ101, complete sequence) position: , mismatch: 10, identity: 0.688

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gacgacgaccaggacgacgacgccgacgaccg	Protospacer
.  ..* ** ********.*********** .

242. spacer 2.35|2738038|32|CP033133|PILER-CR matches to NC_001425 (Streptomyces flavovirens plasmid pSN22 DNA, complete sequence) position: , mismatch: 10, identity: 0.688

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gacgacgaccaggacgacgacgccgacgaccg	Protospacer
.  ..* ** ********.*********** .

243. spacer 2.35|2738038|32|CP033133|PILER-CR matches to MG770216 (Mycobacterium phage Rem711, complete genome) position: , mismatch: 10, identity: 0.688

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gacgacgccgacgacgacaacgccgtcgacgc	Protospacer
.  ..*  *** ************* ***** 

244. spacer 2.35|2738038|32|CP033133|PILER-CR matches to AY320035 (Bacteriophage VWB, complete genome) position: , mismatch: 10, identity: 0.688

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gacgacgaccaggacgacgacgccgacgactc	Protospacer
.  ..* ** ********.***********  

245. spacer 2.35|2738038|32|CP033133|PILER-CR matches to NC_005345 (Streptomyces phage VWB, complete genome) position: , mismatch: 10, identity: 0.688

acgagctacgaggacgacaacgccgacgacga	CRISPR spacer
gacgacgaccaggacgacgacgccgacgactc	Protospacer
.  ..* ** ********.***********  

246. spacer 2.41|2738399|32|CP033133|PILER-CR matches to NZ_CP038867 (Vagococcus sp. CF-49 plasmid punnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

tccacgatctaaaaaccatgcttgtccccaaa	CRISPR spacer
tacaccctctaaaaaccatgcttgttgtagct	Protospacer
* ***  ******************. . .  

247. spacer 1.9|2675655|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NC_018983 (Borrelia burgdorferi 297 plasmid 297_cp26, complete sequence) position: , mismatch: 11, identity: 0.656

aactgtctttttattctttgataatgaattgc	CRISPR spacer
cgacctctttttattctttgaatatgaaagta	Protospacer
 . . ****************  *****    

248. spacer 1.11|2675775|32|CP033133|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020558 (Paenibacillus larvae subsp. pulvifaciens strain SAG 10367 plasmid pPLP3, complete sequence) position: , mismatch: 11, identity: 0.656

aatttaaaagtaaaaaaagaactcccccctgt	CRISPR spacer
aatataaaagtaaaaatagaacttgaaataaa	Protospacer
*** ************ ******.    . . 

249. spacer 2.11|2738037|32|CP033133|CRISPRCasFinder,CRT matches to NZ_CP032131 (Acinetobacter chinensis strain WCHAc010005 plasmid p5_010005, complete sequence) position: , mismatch: 12, identity: 0.625

acgagctacgaggacgacaacgccgacgacga---	CRISPR spacer
---aattttatggacgacgacaacgacgacgacga	Protospacer
   *..* .. *******.**. *********   

250. spacer 2.35|2738038|32|CP033133|PILER-CR matches to NZ_CP032131 (Acinetobacter chinensis strain WCHAc010005 plasmid p5_010005, complete sequence) position: , mismatch: 12, identity: 0.625

acgagctacgaggacgacaacgccgacgacga---	CRISPR spacer
---aattttatggacgacgacaacgacgacgacga	Protospacer
   *..* .. *******.**. *********   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 13590 : 55814 34 Escherichia_phage(25.0%) tRNA,transposase,plate NA
DBSCAN-SWA_2 1716768 : 1760488 52 Acinetobacter_phage(47.83%) integrase,transposase,terminase,protease,tRNA attL 1729086:1729101|attR 1746300:1746315
DBSCAN-SWA_3 1981033 : 1995248 14 Pseudomonas_phage(62.5%) NA NA
DBSCAN-SWA_4 2005598 : 2017441 18 Acinetobacter_phage(45.45%) integrase attL 2011118:2011131|attR 2020747:2020760
DBSCAN-SWA_5 2513880 : 2632958 115 Pseudomonas_phage(30.56%) tail,transposase,head,protease,tRNA NA
DBSCAN-SWA_6 2922534 : 2992290 51 Klosneuvirus(20.0%) tRNA,transposase NA
DBSCAN-SWA_7 3774086 : 3798816 28 Faecalibacterium_phage(40.0%) transposase,integrase attL 3783416:3783430|attR 3803354:3803368
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
CP033133.1|AYO54948.1|2592970_2593207_+|hypothetical-protein 2592970_2593207_+ 78 aa aa NA HTH_8 NA 2513880-2632958 yes