Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP032143 Acinetobacter sp. WCHA52 strain WCHAc010052 chromosome, complete genome 2 crisprs cas3,DEDDh,csa3,WYL,cas6f,cas5,cas7f,cas1 0 60 4 0
CP032141 Acinetobacter sp. WCHA52 strain WCHAc010052 plasmid p4_010052, complete sequence 0 crisprs NA 0 0 0 0
CP032139 Acinetobacter sp. WCHA52 strain WCHAc010052 plasmid p2_010052, complete sequence 1 crisprs NA 0 1 0 0
CP032138 Acinetobacter sp. WCHA52 strain WCHAc010052 plasmid p1_010052, complete sequence 0 crisprs NA 0 0 0 0
CP032142 Acinetobacter sp. WCHA52 strain WCHAc010052 plasmid pNDM1_010052, complete sequence 0 crisprs NA 0 0 0 0
CP032140 Acinetobacter sp. WCHA52 strain WCHAc010052 plasmid p3_010052, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. CP032143
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032143_1 2046293-2048781 Orphan I-F
41 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032143_2 2199861-2202710 Unclear I-F
47 spacers
cas6f,cas5,cas7f,cas1

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP032143_1 1.15|2047162|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2047162-2047193 32 MH617262 Inoviridae sp. isolate ctcg5, complete genome 6395-6426 1 0.969
CP032143_2 2.6|2200189|32|CP032143|CRISPRCasFinder,CRT 2200189-2200220 32 NZ_MK715471 Arcobacter cryaerophilus strain M830MA plasmid pM830MA, complete sequence 111482-111513 4 0.875
CP032143_2 2.53|2200191|32|CP032143|PILER-CR 2200191-2200222 32 NZ_MK715471 Arcobacter cryaerophilus strain M830MA plasmid pM830MA, complete sequence 111482-111513 4 0.875
CP032143_1 1.31|2048122|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2048122-2048153 32 CP011076 Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence 266525-266556 6 0.812
CP032143_2 2.6|2200189|32|CP032143|CRISPRCasFinder,CRT 2200189-2200220 32 NZ_CP026551 Citrobacter sp. SL156 plasmid unnamed2 80732-80763 6 0.812
CP032143_2 2.6|2200189|32|CP032143|CRISPRCasFinder,CRT 2200189-2200220 32 NZ_CP017222 Escherichia coli strain FAM21845 plasmid pFAM21845_2, complete sequence 37682-37713 6 0.812
CP032143_2 2.6|2200189|32|CP032143|CRISPRCasFinder,CRT 2200189-2200220 32 NC_019013 Escherichia coli strain G3/10 plasmid pSYM1, complete sequence 10192-10223 6 0.812
CP032143_2 2.6|2200189|32|CP032143|CRISPRCasFinder,CRT 2200189-2200220 32 CP052139 Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-1, complete sequence 96704-96735 6 0.812
CP032143_2 2.6|2200189|32|CP032143|CRISPRCasFinder,CRT 2200189-2200220 32 NC_019254 Shigella sp. MO17 plasmid pMO17_54, complete sequence 16205-16236 6 0.812
CP032143_2 2.6|2200189|32|CP032143|CRISPRCasFinder,CRT 2200189-2200220 32 MN699848 Citrobacter pasteurii strain 175G8 plasmid pCfr-OXA-198, complete sequence 136961-136992 6 0.812
CP032143_2 2.6|2200189|32|CP032143|CRISPRCasFinder,CRT 2200189-2200220 32 NZ_CP049048 Enterobacter hormaechei strain Y233 plasmid p233-142, complete sequence 108888-108919 6 0.812
CP032143_2 2.26|2201391|32|CP032143|CRISPRCasFinder,CRT 2201391-2201422 32 NZ_CP031069 Bacillus sp. JAS24-2 plasmid pl626, complete sequence 269648-269679 6 0.812
CP032143_2 2.26|2201391|32|CP032143|CRISPRCasFinder,CRT 2201391-2201422 32 NZ_CP014283 Bacillus thuringiensis strain Bt185 plasmid pBT1850636, complete sequence 539298-539329 6 0.812
CP032143_2 2.26|2201391|32|CP032143|CRISPRCasFinder,CRT 2201391-2201422 32 NZ_CP032614 Bacillus thuringiensis strain QZL38 plasmid p.1, complete sequence 228482-228513 6 0.812
CP032143_2 2.26|2201391|32|CP032143|CRISPRCasFinder,CRT 2201391-2201422 32 NZ_CP053657 Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence 51037-51068 6 0.812
CP032143_2 2.31|2201691|32|CP032143|CRISPRCasFinder,CRT 2201691-2201722 32 AP014070 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C2-MedDCM-OCT-S42-C71, *** SEQUENCING IN PROGRESS *** 31118-31149 6 0.812
CP032143_2 2.31|2201691|32|CP032143|CRISPRCasFinder,CRT 2201691-2201722 32 AP014069 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C2-MedDCM-OCT-S40-C35, *** SEQUENCING IN PROGRESS *** 24845-24876 6 0.812
CP032143_2 2.53|2200191|32|CP032143|PILER-CR 2200191-2200222 32 NZ_CP026551 Citrobacter sp. SL156 plasmid unnamed2 80732-80763 6 0.812
CP032143_2 2.53|2200191|32|CP032143|PILER-CR 2200191-2200222 32 NZ_CP017222 Escherichia coli strain FAM21845 plasmid pFAM21845_2, complete sequence 37682-37713 6 0.812
CP032143_2 2.53|2200191|32|CP032143|PILER-CR 2200191-2200222 32 NC_019013 Escherichia coli strain G3/10 plasmid pSYM1, complete sequence 10192-10223 6 0.812
CP032143_2 2.53|2200191|32|CP032143|PILER-CR 2200191-2200222 32 CP052139 Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-1, complete sequence 96704-96735 6 0.812
CP032143_2 2.53|2200191|32|CP032143|PILER-CR 2200191-2200222 32 NC_019254 Shigella sp. MO17 plasmid pMO17_54, complete sequence 16205-16236 6 0.812
CP032143_2 2.53|2200191|32|CP032143|PILER-CR 2200191-2200222 32 MN699848 Citrobacter pasteurii strain 175G8 plasmid pCfr-OXA-198, complete sequence 136961-136992 6 0.812
CP032143_2 2.53|2200191|32|CP032143|PILER-CR 2200191-2200222 32 NZ_CP049048 Enterobacter hormaechei strain Y233 plasmid p233-142, complete sequence 108888-108919 6 0.812
CP032143_2 2.73|2201393|32|CP032143|PILER-CR 2201393-2201424 32 NZ_CP031069 Bacillus sp. JAS24-2 plasmid pl626, complete sequence 269648-269679 6 0.812
CP032143_2 2.73|2201393|32|CP032143|PILER-CR 2201393-2201424 32 NZ_CP014283 Bacillus thuringiensis strain Bt185 plasmid pBT1850636, complete sequence 539298-539329 6 0.812
CP032143_2 2.73|2201393|32|CP032143|PILER-CR 2201393-2201424 32 NZ_CP032614 Bacillus thuringiensis strain QZL38 plasmid p.1, complete sequence 228482-228513 6 0.812
CP032143_2 2.73|2201393|32|CP032143|PILER-CR 2201393-2201424 32 NZ_CP053657 Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence 51037-51068 6 0.812
CP032143_2 2.78|2201693|32|CP032143|PILER-CR 2201693-2201724 32 AP014070 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C2-MedDCM-OCT-S42-C71, *** SEQUENCING IN PROGRESS *** 31118-31149 6 0.812
CP032143_2 2.78|2201693|32|CP032143|PILER-CR 2201693-2201724 32 AP014069 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C2-MedDCM-OCT-S40-C35, *** SEQUENCING IN PROGRESS *** 24845-24876 6 0.812
CP032143_1 1.11|2046922|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046922-2046953 32 NZ_CP050185 Bacillus thuringiensis strain HER1410 plasmid pLUSID2, complete sequence 146786-146817 7 0.781
CP032143_1 1.21|2047522|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2047522-2047553 32 NZ_CP030128 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed2, complete sequence 4327-4358 7 0.781
CP032143_1 1.35|2048362|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2048362-2048393 32 NZ_CP012423 Spiroplasma kunkelii CR2-3x plasmid pSKU226, complete sequence 8630-8661 7 0.781
CP032143_2 2.6|2200189|32|CP032143|CRISPRCasFinder,CRT 2200189-2200220 32 AP013427 Uncultured Mediterranean phage uvMED DNA, complete genome, group G16, isolate: uvMED-CGR-C57A-MedDCM-OCT-S25-C28 4961-4992 7 0.781
CP032143_2 2.6|2200189|32|CP032143|CRISPRCasFinder,CRT 2200189-2200220 32 NC_021803 Cellulophaga phage phi13:2, complete genome 11467-11498 7 0.781
CP032143_2 2.6|2200189|32|CP032143|CRISPRCasFinder,CRT 2200189-2200220 32 AP013428 Uncultured Mediterranean phage uvMED DNA, complete genome, group G16, isolate: uvMED-CGR-C57A-MedDCM-OCT-S39-C32 20958-20989 7 0.781
CP032143_2 2.46|2202591|32|CP032143|CRISPRCasFinder,CRT 2202591-2202622 32 KX912252 Pseudoalteromonas phage PHS3, complete genome 28699-28730 7 0.781
CP032143_2 2.53|2200191|32|CP032143|PILER-CR 2200191-2200222 32 AP013427 Uncultured Mediterranean phage uvMED DNA, complete genome, group G16, isolate: uvMED-CGR-C57A-MedDCM-OCT-S25-C28 4961-4992 7 0.781
CP032143_2 2.53|2200191|32|CP032143|PILER-CR 2200191-2200222 32 NC_021803 Cellulophaga phage phi13:2, complete genome 11467-11498 7 0.781
CP032143_2 2.53|2200191|32|CP032143|PILER-CR 2200191-2200222 32 AP013428 Uncultured Mediterranean phage uvMED DNA, complete genome, group G16, isolate: uvMED-CGR-C57A-MedDCM-OCT-S39-C32 20958-20989 7 0.781
CP032143_2 2.93|2202593|32|CP032143|PILER-CR 2202593-2202624 32 KX912252 Pseudoalteromonas phage PHS3, complete genome 28699-28730 7 0.781
CP032143_1 1.3|2046441|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046441-2046472 32 NZ_CP030854 Runella sp. HYN0085 plasmid unnamed4, complete sequence 29114-29145 8 0.75
CP032143_1 1.5|2046562|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046562-2046593 32 NC_010627 Paraburkholderia phymatum STM815 plasmid pBPHY02, complete sequence 116998-117029 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MK719709 Rheinheimera phage vB_RspM_Barba5A, complete genome 41960-41991 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MK719748 Rheinheimera phage vB_RspM_Barba29S, complete genome 43114-43145 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497264 Rheinheimera phage vB_RspM_barba12-8G, complete genome 65791-65822 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MK719716 Rheinheimera phage vB_RspM_Barba10A, complete genome 42065-42096 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497235 Rheinheimera phage vB_RspM_barba10-9H, complete genome 24198-24229 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497268 Rheinheimera phage vB_RspM_barba12-9B, complete genome 57599-57630 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497226 Rheinheimera phage vB_RspM_barba10-8B, complete genome 34871-34902 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MK719713 Rheinheimera phage vB_RspM_Barba8A, complete genome 41960-41991 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497239 Rheinheimera phage vB_RspM_barba12-6A, complete genome 42238-42269 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497232 Rheinheimera phage vB_RspM_barba10-9E, complete genome 29217-29248 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MK719753 Rheinheimera phage vB_RspM_Barba34A, complete genome 42065-42096 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497261 Rheinheimera phage vB_RspM_barba12-8C, complete genome 52054-52085 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497273 Rheinheimera phage vB_RspM_barba12-9G, complete genome 14825-14856 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MK719746 Rheinheimera phage vB_RspM_Barba28S, complete genome 42065-42096 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497255 Rheinheimera phage vB_RspM_barba12-7G, complete genome 15916-15947 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MK719734 Rheinheimera phage vB_RspM_Barba21S, complete genome 42509-42540 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497254 Rheinheimera phage vB_RspM_barba12-7F, complete genome 16216-16247 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497238 Rheinheimera phage vB_RspM_barba11-8A, complete genome 15916-15947 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MK719744 Rheinheimera phage vB_RspM_Barba27S, complete genome 42065-42096 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MK719717 Rheinheimera phage vB_RspM_Barba10S, complete genome 42193-42224 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497256 Rheinheimera phage vB_RspM_barba12-7H, complete genome 71138-71169 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MK719732 Rheinheimera phage vB_RspM_Barba20S, complete genome 43159-43190 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497247 Rheinheimera phage vB_RspM_barba12-6I, complete genome 15723-15754 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497263 Rheinheimera phage vB_RspM_barba12-8F, complete genome 15916-15947 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497242 Rheinheimera phage vB_RspM_barba12-6D, complete genome 22960-22991 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497246 Rheinheimera phage vB_RspM_barba12-6H, complete genome 29155-29186 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MK719711 Rheinheimera phage vB_RspM_Barba6A, complete genome 42056-42087 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497260 Rheinheimera phage vB_RspM_barba12-8B, complete genome 26817-26848 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497278 Rheinheimera phage vB_RspM_barba13-8A, complete genome 42891-42922 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497250 Rheinheimera phage vB_RspM_barba12-7B, complete genome 14344-14375 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MK719750 Rheinheimera phage vB_RspM_Barba31A, complete genome 46657-46688 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MK719727 Rheinheimera phage vB_RspM_Barba17A, complete genome 42066-42097 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MK719743 Rheinheimera phage vB_RspM_Barba26S, complete genome 42066-42097 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MK719724 Rheinheimera phage vB_RspM_Barba15A, complete genome 43404-43435 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497276 Rheinheimera phage vB_RspM_barba13-4A, complete genome 79490-79521 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497234 Rheinheimera phage vB_RspM_barba10-9G, complete genome 15922-15953 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MK719708 Rheinheimera phage vB_RspM_Barba4S, complete genome 42124-42155 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497249 Rheinheimera phage vB_RspM_barba12-7A, complete genome 15916-15947 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 NC_048191 Rheinheimera phage vB_RspM_Barba21A, complete genome 42132-42163 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497269 Rheinheimera phage vB_RspM_barba12-9C, complete genome 45020-45051 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497272 Rheinheimera phage vB_RspM_barba12-9F, complete genome 1053-1084 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497248 Rheinheimera phage vB_RspM_barba12-6J, complete genome 15916-15947 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497225 Rheinheimera phage vB_RspM_barba10-8A, complete genome 56312-56343 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MK719725 Rheinheimera phage vB_RspM_Barba15S, complete genome 42027-42058 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MK719712 Rheinheimera phage vB_RspM_Barba7A, complete genome 42065-42096 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497274 Rheinheimera phage vB_RspM_barba12-9I, complete genome 79490-79521 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497228 Rheinheimera phage vB_RspM_barba10-9A, complete genome 16093-16124 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497271 Rheinheimera phage vB_RspM_barba12-9E, complete genome 16022-16053 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MK719704 Rheinheimera phage vB_RspM_Barba2S, complete genome 42065-42096 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497244 Rheinheimera phage vB_RspM_barba12-6F, complete genome 53748-53779 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MK719705 Rheinheimera phage vB_RspM_Barba3A, complete genome 42728-42759 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MK719706 Rheinheimera phage vB_RspM_Barba3S, complete genome 42065-42096 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 NC_048188 Rheinheimera phage vB_RspM_Barba8S, complete genome 43263-43294 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MK719735 Rheinheimera phage vB_RspM_Barba22A, complete genome 42066-42097 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MK719751 Rheinheimera phage vB_RspM_Barba32A, complete genome 42065-42096 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 NC_048189 Rheinheimera phage vB_RspM_Barba18A, complete genome 42066-42097 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MK719707 Rheinheimera phage vB_RspM_Barba4A, complete genome 42051-42082 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497277 Rheinheimera phage vB_RspM_barba13-6A, complete genome 57593-57624 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MK719721 Rheinheimera phage vB_RspM_Barba13A, complete genome 42066-42097 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497233 Rheinheimera phage vB_RspM_barba10-9F, complete genome 14459-14490 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497257 Rheinheimera phage vB_RspM_barba12-7I, complete genome 22779-22810 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MK719701 Rheinheimera phage vB_RspM_Barba1A, complete genome 41964-41995 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MK719722 Rheinheimera phage vB_RspM_Barba14A, complete genome 42056-42087 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497241 Rheinheimera phage vB_RspM_barba12-6C, complete genome 57765-57796 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497252 Rheinheimera phage vB_RspM_barba12-7D, complete genome 57599-57630 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497227 Rheinheimera phage vB_RspM_barba10-8D, complete genome 56312-56343 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MK719738 Rheinheimera phage vB_RspM_Barba23S, complete genome 42066-42097 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MK719737 Rheinheimera phage vB_RspM_Barba23A, complete genome 41952-41983 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MK719703 Rheinheimera phage vB_RspM_Barba2A, complete genome 42076-42107 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497266 Rheinheimera phage vB_RspM_barba12-8I, complete genome 48400-48431 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MK719739 Rheinheimera phage vB_RspM_Barba24S, complete genome 42064-42095 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497270 Rheinheimera phage vB_RspM_barba12-9D, complete genome 27219-27250 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MK719715 Rheinheimera phage vB_RspM_Barba9A, complete genome 42122-42153 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MK719741 Rheinheimera phage vB_RspM_Barba25S, complete genome 42079-42110 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497240 Rheinheimera phage vB_RspM_barba12-6B, complete genome 57724-57755 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MK719754 Rheinheimera phage vB_RspM_Barba35A, complete genome 41930-41961 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MK719720 Rheinheimera phage vB_RspM_Barba12S, complete genome 42066-42097 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MK719749 Rheinheimera phage vB_RspM_Barba30A, complete genome 41961-41992 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MK719752 Rheinheimera phage vB_RspM_Barba33A, complete genome 42065-42096 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MK719728 Rheinheimera phage vB_RspM_Barba17S, complete genome 43219-43250 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497253 Rheinheimera phage vB_RspM_barba12-7E, complete genome 53797-53828 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497258 Rheinheimera phage vB_RspM_barba12-7J, complete genome 56312-56343 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MK719702 Rheinheimera phage vB_RspM_Barba1S, complete genome 42065-42096 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497229 Rheinheimera phage vB_RspM_barba10-9B, complete genome 16539-16570 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 NC_048190 Rheinheimera phage vB_RspM_Barba19A, complete genome 46648-46679 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MK719718 Rheinheimera phage vB_RspM_Barba11S, complete genome 42077-42108 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MK719719 Rheinheimera phage vB_RspM_Barba12A, complete genome 42065-42096 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MK719745 Rheinheimera phage vB_RspM_Barba28A, complete genome 41994-42025 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497230 Rheinheimera phage vB_RspM_barba10-9C, complete genome 65791-65822 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497251 Rheinheimera phage vB_RspM_barba12-7C, complete genome 15916-15947 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MK719740 Rheinheimera phage vB_RspM_Barba25A, complete genome 42008-42039 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 NC_048187 Rheinheimera phage vB_RspM_Barba5S, complete genome 44089-44120 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MK719726 Rheinheimera phage vB_RspM_Barba16S, complete genome 42067-42098 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497259 Rheinheimera phage vB_RspM_barba12-8A, complete genome 22918-22949 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497267 Rheinheimera phage vB_RspM_barba12-9A, complete genome 16070-16101 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497237 Rheinheimera phage vB_RspM_barba10-9J, complete genome 53155-53186 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MK719742 Rheinheimera phage vB_RspM_Barba26A, complete genome 42715-42746 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497275 Rheinheimera phage vB_RspM_barba12-9J, complete genome 15916-15947 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MK719736 Rheinheimera phage vB_RspM_Barba22S, complete genome 42066-42097 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497224 Rheinheimera phage vB_RspM_barba1-3A, complete genome 15916-15947 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497236 Rheinheimera phage vB_RspM_barba10-9I, complete genome 71879-71910 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497245 Rheinheimera phage vB_RspM_barba12-6G, complete genome 22960-22991 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497262 Rheinheimera phage vB_RspM_barba12-8E, complete genome 2721-2752 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497243 Rheinheimera phage vB_RspM_barba12-6E, complete genome 51266-51297 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MK719747 Rheinheimera phage vB_RspM_Barba29A, complete genome 42066-42097 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497265 Rheinheimera phage vB_RspM_barba12-8H, complete genome 22633-22664 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497279 Rheinheimera phage vB_RspM_barba5-7A, complete genome 15916-15947 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MK719723 Rheinheimera phage vB_RspM_Barba14S, complete genome 42036-42067 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MT497231 Rheinheimera phage vB_RspM_barba10-9D, complete genome 14344-14375 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 MK719731 Rheinheimera phage vB_RspM_Barba20A, complete genome 42066-42097 8 0.75
CP032143_1 1.11|2046922|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046922-2046953 32 NZ_AP017918 Candidatus Azobacteroides pseudotrichonymphae plasmid pAPPJ4 DNA, complete sequence, phylotype ProJPt-1 4950-4981 8 0.75
CP032143_1 1.11|2046922|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046922-2046953 32 MK448940 Streptococcus phage Javan444, complete genome 8206-8237 8 0.75
CP032143_1 1.26|2047822|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2047822-2047853 32 MN855763 Myoviridae sp. isolate 210, complete genome 104930-104961 8 0.75
CP032143_1 1.31|2048122|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2048122-2048153 32 JQ680349 Unidentified phage clone 1013_scaffold24 genomic sequence 14835-14866 8 0.75
CP032143_1 1.36|2048422|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2048422-2048453 32 NC_031922 Synechococcus phage S-CAM9 isolate 1109NB16, complete genome 84123-84154 8 0.75
CP032143_1 1.36|2048422|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2048422-2048453 32 KU686204 Synechococcus phage S-CAM9 isolate 0808SB05, complete genome 84105-84136 8 0.75
CP032143_1 1.36|2048422|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2048422-2048453 32 KU686205 Synechococcus phage S-CAM9 isolate 0908SB82, complete genome 84105-84136 8 0.75
CP032143_1 1.37|2048482|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2048482-2048513 32 NZ_CP020948 Rhizobium sp. CIAT894 plasmid pRheCIAT894a, complete sequence 76753-76784 8 0.75
CP032143_1 1.39|2048602|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2048602-2048633 32 MN480762 Streptococcus salivarius strain NU10 plasmid pSsal-NU10, complete sequence 104246-104277 8 0.75
CP032143_2 2.5|2200129|32|CP032143|CRISPRCasFinder,CRT 2200129-2200160 32 NC_047805 Yersinia phage fHe-Yen3-01, complete genome 10804-10835 8 0.75
CP032143_2 2.6|2200189|32|CP032143|CRISPRCasFinder,CRT 2200189-2200220 32 AY766464 Lactococcus phage TP712, complete sequence 31150-31181 8 0.75
CP032143_2 2.6|2200189|32|CP032143|CRISPRCasFinder,CRT 2200189-2200220 32 KC821622 Cellulophaga phage phi46:3, complete genome 12204-12235 8 0.75
CP032143_2 2.6|2200189|32|CP032143|CRISPRCasFinder,CRT 2200189-2200220 32 NC_021794 Cellulophaga phage phi18:3, complete genome 13441-13472 8 0.75
CP032143_2 2.6|2200189|32|CP032143|CRISPRCasFinder,CRT 2200189-2200220 32 NC_005006 Staphylococcus epidermidis ATCC 12228 plasmid pSE-12228-03, complete sequence 2384-2415 8 0.75
CP032143_2 2.6|2200189|32|CP032143|CRISPRCasFinder,CRT 2200189-2200220 32 MN693193 Marine virus AFVG_25M440, complete genome 9500-9531 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 LN881734 Escherichia phage slur11, complete genome 20426-20457 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 AP018814 Enterobacteria phage T6 DNA, complete genome 30099-30130 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MN895435 Escherichia phage teqhal, complete genome 8338-8369 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MG781191 Escherichia phage vB_EcoM-fHoEco02, complete genome 31193-31224 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MT764206 Escherichia phage JEP6, complete genome 104899-104930 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MN895437 Escherichia phage teqskov, complete genome 152054-152085 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MH837626 Escherichia phage vB_vPM_PD112, complete genome 103779-103810 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MN716856 Yersinia phage vB_YepM_ZN18, complete genome 85799-85830 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 KY290975 Escherichia phage YUEEL01, complete genome 31113-31144 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 NC_019399 Enterobacteria phage vB_EcoM_ACG-C40, complete genome 32833-32864 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 KM606997 Enterobacteria phage RB7, complete genome 29989-30020 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 LN881736 Escherichia phage slur14, complete genome 140999-141030 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 KU925172 Escherichia phage PE37, complete genome 132010-132041 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MH051915 Enterobacteria phage vB_EcoM_IME339, complete genome 136323-136354 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 LR215722 Yersinia phage fPS-2 genome assembly, chromosome: I 31491-31522 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 NC_025449 Escherichia phage ECML-134, complete genome 30005-30036 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MH751506 Escherichia phage T2, complete genome 30511-30542 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 X00769 Bacteriophage T4 genes 45, 44, 62, regA, 43 (5' end) 29-60 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 NC_042129 Escherichia phage slur03, complete genome 138650-138681 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MH809535 Yersinia phage PYPS2T, complete genome 107781-107812 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 NC_042077 Shigella phage Sf21, complete genome 30444-30475 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 LN881732 Escherichia phage slur07, complete genome 132226-132257 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MN508618 UNVERIFIED: Escherichia phage ES26, complete genome 137368-137399 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 KM607002 Enterobacteria phage RB55, complete genome 32575-32606 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 KY608967 UNVERIFIED: Escherichia phage CF2, complete genome 126592-126623 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MF001354 Salmonella phage SG1, partial genome 145043-145074 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MT176425 Citrobacter phage PhiZZ23, complete genome 31566-31597 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 NC_042039 Shigella phage Sf22, complete genome 143288-143319 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MF327009 Shigella phage Sf25, complete genome 126247-126278 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 AP018813 Enterobacteria phage T2 DNA, complete genome 30508-30539 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MN580668 Salmonella phage pSe_SNUABM_01, complete genome 32436-32467 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MK373781 Escherichia phage vB_EcoM_KAW1E185, complete genome 31087-31118 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 NC_025829 Shigella phage pSs-1, complete genome 35288-35319 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 LN881737 Escherichia phage slur13, complete genome 42248-42279 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 LR597657 Escherichia phage T4_ev240 genome assembly, chromosome: 1 29999-30030 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 NC_030953 Shigella phage SHFML-11, complete genome 147993-148024 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MN508614 UNVERIFIED: Escherichia phage ES12, complete genome 137017-137048 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 KJ477684 Enterobacteria phage T4 strain wild, complete genome 32597-32628 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MG781190 Escherichia phage vB_EcoM-fFiEco06, complete genome 31193-31224 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 LR215723 Yersinia phage fPS-90 genome assembly, chromosome: I 31610-31641 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MH550421 Enterobacteria phage T6, complete genome 30105-30136 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 KM606996 Enterobacteria phage RB6, complete genome 29988-30019 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 AP018932 Escherichia phage KIT03 DNA, complete sequence 30957-30988 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 NC_025448 Enterobacteria phage RB27, complete genome 30935-30966 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 KJ668714 Escherichia phage e11/2, complete genome 32614-32645 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 HM137666 Enterobacteria phage T4T, complete genome 32597-32628 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MN895438 Escherichia phage teqdroes, complete genome 23409-23440 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 KP869105 Escherichia coli O157 typing phage 7, partial genome 49601-49632 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MF158046 Shigella phage Sf23, complete genome 120677-120708 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MN022785 Escherichia virus VEc20, complete genome 30662-30693 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MT682709 Escherichia phage vB_EcoM_SP1, complete genome 137940-137971 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 NC_000866 Enterobacteria phage T4, complete genome 32610-32641 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MT682714 Escherichia phage vB_EcoM_Lutter, complete genome 31809-31840 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 LR746311 Shigella phage vB_SsoM_113 genome assembly, chromosome: 1 39764-39795 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MK962750 Shigella phage CM8, complete genome 29977-30008 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MH553563 Enterobacteria phage RB18, complete genome 31120-31151 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MN895436 Escherichia phage teqsoen, complete genome 16262-16293 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 KM606995 Enterobacteria phage RB5, complete genome 29988-30019 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MT682710 Escherichia phage vB_EcoM_FT, complete genome 140483-140514 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MG775043 Citrobacter phage vB_CroM_CrRp10, complete genome 5760-5791 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MN781580 Shigella virus KRT47, complete genome 31345-31376 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 LN881726 Escherichia phage slur02, complete genome 102367-102398 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MK373785 Escherichia phage vB_EcoM_OE5505, complete genome 32273-32304 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 NC_042078 Shigella phage Sf24, complete genome 126480-126511 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MH992121 UNVERIFIED: Escherichia phage MLF4, partial genome 127058-127089 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MT682712 Escherichia phage vB_EcoM_F1, complete genome 32192-32223 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MK373779 Escherichia phage vB_EcoM_G9062, complete genome 32002-32033 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MT179807 Escherichia phage vB_EcoM_IME537, complete genome 108362-108393 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 KX828711 Shigella phage SH7, complete genome 29642-29673 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MN508616 UNVERIFIED: Escherichia phage ES19, complete genome 137468-137499 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 KJ477686 Enterobacteria phage T4 strain GT7, complete genome 32597-32628 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MT446387 UNVERIFIED: Escherichia virus TH09, complete genome 125908-125939 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MK327946 Escherichia phage vB_EcoM_G4507, complete genome 30961-30992 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MK327944 Escherichia phage vB_EcoM_G2540-3, complete genome 32037-32068 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 FJ839692 Enterobacteria phage RB14, complete genome 30073-30104 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 KX452694 UNVERIFIED: Escherichia phage KPN1 genomic sequence 22092-22123 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MH355584 Escherichia phage vB_EcoM_JB75, complete genome 135776-135807 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 KM606994 Enterobacteria phage RB3, complete genome 29989-30020 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 M15080 Bacteriophage T4 genes 45.1 (encoding RNA polymerase-binding protein) and 45.2 914-945 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 M10160 Bacteriophage T4 genes 55, alpha-gt, 47, 46, 45, 44, 62, regA, and 43 7541-7572 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MK977694 Escherichia phage vB_EcoM-Sa45lw, complete genome 30900-30931 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 LR877332 Shigella phage vB_SsoM_JK08 genome assembly, chromosome: 1 31412-31443 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 KX130862 Shigella phage SHFML-26, complete genome 95721-95752 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 KU867876 Escherichia phage vB_EcoM-UFV13, complete genome 31118-31149 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MK327929 Escherichia phage D5505, complete genome 30564-30595 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MK327936 Escherichia phage vB_EcoM_G2540, complete genome 32424-32455 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MK327939 Escherichia phage vB_EcoM_G4498, complete genome 31585-31616 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 NC_031030 Escherichia phage UFV-AREG1, complete genome 30767-30798 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MN508617 UNVERIFIED: Escherichia phage ES21, complete genome 137483-137514 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 FJ839693 Enterobacteria phage RB51, complete genome 31270-31301 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 KM607004 Enterobacteria phage RB68, complete genome 31270-31301 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MN994497 Phage NBEco003, complete genome 135731-135762 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MK962755 Shigella phage JK38, complete genome 30816-30847 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MH243439 Escherichia phage vB_EcoM_NBG2, complete genome 29620-29651 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MK327945 Escherichia phage vB_EcoM_G4500, complete genome 31512-31543 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MF001360 Escherichia phage ECO4, partial genome 41430-41461 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 KJ477685 Enterobacteria phage T4 strain 147, complete genome 32597-32628 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MK886800 Escherichia phage EcNP1, complete genome 9338-9369 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 LR215724 Yersinia phage fPS-65 genome assembly, chromosome: I 31988-32019 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MK327940 Escherichia phage vB_EcoM_G29, complete genome 31512-31543 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 LN881733 Escherichia phage slur08, complete genome 135897-135928 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 AP011113 Enterobacteria phage AR1 DNA, complete genome 30574-30605 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MK373786 Escherichia phage vB_EcoM_R5505, complete genome 31076-31107 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 LC348380 Escherichia phage T2 DNA, complete sequence 30520-30551 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MT176424 Citrobacter phage PhiZZ6, complete genome 31105-31136 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 NC_027404 Yersinia phage PST, complete genome 29970-30001 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 NC_008515 Bacteriophage RB32, complete genome 30209-30240 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MK962752 Shigella phage JK23, complete genome 32370-32401 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 KT184312 Enterobacteria phage Kha5h, complete genome 56556-56587 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 HE956711 Yersinia phage phiD1 complete genome 31444-31475 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MG867727 Escherichia phage vB_EcoM-G28, complete genome 32093-32124 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 KF925357 Escherichia phage HY01, complete genome 30776-30807 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 KR233165 Escherichia phage PEC04, complete genome 38488-38519 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 NC_015457 Shigella phage Shfl2, complete genome 30907-30938 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 KM607001 Enterobacteria phage RB33, complete genome 30328-30359 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 LC348379 Escherichia phage PP01 DNA, complete sequence 31100-31131 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MK327942 Escherichia phage vB_EcoM_G50, complete genome 31482-31513 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MK327928 Escherichia phage vB_EcoM_G2133, complete genome 31010-31041 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MT176426 Serratia phage PhiZZ30, complete genome 31568-31599 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 KX452698 UNVERIFIED: Shigella phage KPN5 genomic sequence 33517-33548 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 KT184308 Enterobacteria phage Aplg8, complete genome 143546-143577 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MK373787 Escherichia phage vB_EcoM_G8, complete genome 30989-31020 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 LR597660 Escherichia phage T4_ev151 genome assembly, chromosome: 1 29905-29936 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MN895434 Escherichia phage teqhad, complete genome 36305-36336 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MH992510 Escherichia phage vB_EcoM_DalCa, complete genome 30936-30967 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 KM607003 Enterobacteria phage RB59, complete genome 32575-32606 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 LN881729 Escherichia phage slur04, complete genome 16880-16911 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 HM997020 Escherichia phage wV7, complete genome 30909-30940 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MH051916 Enterobacteria phage vB_EcoM_IME340, complete genome 137688-137719 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 MT932213 Escherichia phage VEc74, complete genome 29744-29775 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 JN202312 Enterobacteria phage ime09, complete genome 31299-31330 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 KM606999 Enterobacteria phage RB10, complete genome 29988-30019 8 0.75
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 KM606998 Enterobacteria phage RB9, complete genome 29989-30020 8 0.75
CP032143_2 2.18|2200911|32|CP032143|CRISPRCasFinder,CRT 2200911-2200942 32 AP014358 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S39-C94, *** SEQUENCING IN PROGRESS *** 15410-15441 8 0.75
CP032143_2 2.28|2201511|32|CP032143|CRISPRCasFinder,CRT 2201511-2201542 32 NC_042028 Acinetobacter phage AB1, complete genome 13002-13033 8 0.75
CP032143_2 2.33|2201811|32|CP032143|CRISPRCasFinder,CRT 2201811-2201842 32 KJ019135 Synechococcus phage ACG-2014a isolate Syn7803C101, complete genome 33677-33708 8 0.75
CP032143_2 2.33|2201811|32|CP032143|CRISPRCasFinder,CRT 2201811-2201842 32 KJ019114 Synechococcus phage ACG-2014a isolate Syn7803US60, complete genome 33583-33614 8 0.75
CP032143_2 2.33|2201811|32|CP032143|CRISPRCasFinder,CRT 2201811-2201842 32 KJ019138 Synechococcus phage ACG-2014a isolate Syn7803C107, complete genome 33595-33626 8 0.75
CP032143_2 2.33|2201811|32|CP032143|CRISPRCasFinder,CRT 2201811-2201842 32 KJ019122 Synechococcus phage ACG-2014a isolate Syn7803US79, complete genome 33582-33613 8 0.75
CP032143_2 2.33|2201811|32|CP032143|CRISPRCasFinder,CRT 2201811-2201842 32 KJ019055 Synechococcus phage ACG-2014a isolate Syn7803C86, complete genome 33677-33708 8 0.75
CP032143_2 2.33|2201811|32|CP032143|CRISPRCasFinder,CRT 2201811-2201842 32 KJ019038 Synechococcus phage ACG-2014a isolate Syn7803C59, complete genome 33582-33613 8 0.75
CP032143_2 2.33|2201811|32|CP032143|CRISPRCasFinder,CRT 2201811-2201842 32 KJ019068 Synechococcus phage ACG-2014a isolate Syn7803US102, complete genome 33582-33613 8 0.75
CP032143_2 2.33|2201811|32|CP032143|CRISPRCasFinder,CRT 2201811-2201842 32 KJ019137 Synechococcus phage ACG-2014a isolate Syn7803C104, complete genome 33677-33708 8 0.75
CP032143_2 2.33|2201811|32|CP032143|CRISPRCasFinder,CRT 2201811-2201842 32 KJ019157 Synechococcus phage ACG-2014a isolate Syn7803C31, complete genome 33677-33708 8 0.75
CP032143_2 2.33|2201811|32|CP032143|CRISPRCasFinder,CRT 2201811-2201842 32 KJ019087 Synechococcus phage ACG-2014a isolate Syn7803US19, complete genome 33582-33613 8 0.75
CP032143_2 2.33|2201811|32|CP032143|CRISPRCasFinder,CRT 2201811-2201842 32 KJ019076 Synechococcus phage ACG-2014a isolate Syn7803US112, complete genome 33582-33613 8 0.75
CP032143_2 2.33|2201811|32|CP032143|CRISPRCasFinder,CRT 2201811-2201842 32 KJ019065 Synechococcus phage ACG-2014a isolate Syn7803C99, complete genome 33582-33613 8 0.75
CP032143_2 2.33|2201811|32|CP032143|CRISPRCasFinder,CRT 2201811-2201842 32 KJ019026 Synechococcus phage ACG-2014a isolate Syn7803C42, complete genome 33588-33619 8 0.75
CP032143_2 2.33|2201811|32|CP032143|CRISPRCasFinder,CRT 2201811-2201842 32 KJ019081 Synechococcus phage ACG-2014a isolate Syn7803US117, complete genome 33583-33614 8 0.75
CP032143_2 2.33|2201811|32|CP032143|CRISPRCasFinder,CRT 2201811-2201842 32 KJ019033 Synechococcus phage ACG-2014a isolate Syn7803C53, complete genome 33582-33613 8 0.75
CP032143_2 2.33|2201811|32|CP032143|CRISPRCasFinder,CRT 2201811-2201842 32 NC_023584 Synechococcus phage S-MbCM100, complete genome 34377-34408 8 0.75
CP032143_2 2.33|2201811|32|CP032143|CRISPRCasFinder,CRT 2201811-2201842 32 KJ019153 Synechococcus phage ACG-2014a isolate Syn7803C26, complete genome 33582-33613 8 0.75
CP032143_2 2.33|2201811|32|CP032143|CRISPRCasFinder,CRT 2201811-2201842 32 KJ019158 Synechococcus phage ACG-2014a isolate Syn7803C33, complete genome 33582-33613 8 0.75
CP032143_2 2.33|2201811|32|CP032143|CRISPRCasFinder,CRT 2201811-2201842 32 KJ019067 Synechococcus phage ACG-2014a isolate Syn7803US101, complete genome 33583-33614 8 0.75
CP032143_2 2.33|2201811|32|CP032143|CRISPRCasFinder,CRT 2201811-2201842 32 KJ019039 Synechococcus phage ACG-2014a isolate Syn7803C60, complete genome 33582-33613 8 0.75
CP032143_2 2.33|2201811|32|CP032143|CRISPRCasFinder,CRT 2201811-2201842 32 KJ019030 Synechococcus phage ACG-2014a isolate Syn7803C47, complete genome 33582-33613 8 0.75
CP032143_2 2.33|2201811|32|CP032143|CRISPRCasFinder,CRT 2201811-2201842 32 KJ019163 Synechococcus phage ACG-2014a isolate Syn7803C38, complete genome 33582-33613 8 0.75
CP032143_2 2.33|2201811|32|CP032143|CRISPRCasFinder,CRT 2201811-2201842 32 KJ019116 Synechococcus phage ACG-2014a isolate Syn7803US62, complete genome 33394-33425 8 0.75
CP032143_2 2.33|2201811|32|CP032143|CRISPRCasFinder,CRT 2201811-2201842 32 KJ019088 Synechococcus phage ACG-2014a isolate Syn7803US1, complete genome 33573-33604 8 0.75
CP032143_2 2.33|2201811|32|CP032143|CRISPRCasFinder,CRT 2201811-2201842 32 KJ019084 Synechococcus phage ACG-2014a isolate Syn7803US123, complete genome 33581-33612 8 0.75
CP032143_2 2.33|2201811|32|CP032143|CRISPRCasFinder,CRT 2201811-2201842 32 NZ_CP030933 Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence 661478-661509 8 0.75
CP032143_2 2.37|2202051|32|CP032143|CRISPRCasFinder,CRT 2202051-2202082 32 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 172605-172636 8 0.75
CP032143_2 2.52|2200131|32|CP032143|PILER-CR 2200131-2200162 32 NC_047805 Yersinia phage fHe-Yen3-01, complete genome 10804-10835 8 0.75
CP032143_2 2.53|2200191|32|CP032143|PILER-CR 2200191-2200222 32 AY766464 Lactococcus phage TP712, complete sequence 31150-31181 8 0.75
CP032143_2 2.53|2200191|32|CP032143|PILER-CR 2200191-2200222 32 KC821622 Cellulophaga phage phi46:3, complete genome 12204-12235 8 0.75
CP032143_2 2.53|2200191|32|CP032143|PILER-CR 2200191-2200222 32 NC_021794 Cellulophaga phage phi18:3, complete genome 13441-13472 8 0.75
CP032143_2 2.53|2200191|32|CP032143|PILER-CR 2200191-2200222 32 NC_005006 Staphylococcus epidermidis ATCC 12228 plasmid pSE-12228-03, complete sequence 2384-2415 8 0.75
CP032143_2 2.53|2200191|32|CP032143|PILER-CR 2200191-2200222 32 MN693193 Marine virus AFVG_25M440, complete genome 9500-9531 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 LN881734 Escherichia phage slur11, complete genome 20426-20457 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 AP018814 Enterobacteria phage T6 DNA, complete genome 30099-30130 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MN895435 Escherichia phage teqhal, complete genome 8338-8369 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MG781191 Escherichia phage vB_EcoM-fHoEco02, complete genome 31193-31224 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MT764206 Escherichia phage JEP6, complete genome 104899-104930 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MN895437 Escherichia phage teqskov, complete genome 152054-152085 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MH837626 Escherichia phage vB_vPM_PD112, complete genome 103779-103810 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MN716856 Yersinia phage vB_YepM_ZN18, complete genome 85799-85830 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 KY290975 Escherichia phage YUEEL01, complete genome 31113-31144 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 NC_019399 Enterobacteria phage vB_EcoM_ACG-C40, complete genome 32833-32864 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 KM606997 Enterobacteria phage RB7, complete genome 29989-30020 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 LN881736 Escherichia phage slur14, complete genome 140999-141030 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 KU925172 Escherichia phage PE37, complete genome 132010-132041 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MH051915 Enterobacteria phage vB_EcoM_IME339, complete genome 136323-136354 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 LR215722 Yersinia phage fPS-2 genome assembly, chromosome: I 31491-31522 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 NC_025449 Escherichia phage ECML-134, complete genome 30005-30036 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MH751506 Escherichia phage T2, complete genome 30511-30542 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 X00769 Bacteriophage T4 genes 45, 44, 62, regA, 43 (5' end) 29-60 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 NC_042129 Escherichia phage slur03, complete genome 138650-138681 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MH809535 Yersinia phage PYPS2T, complete genome 107781-107812 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 NC_042077 Shigella phage Sf21, complete genome 30444-30475 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 LN881732 Escherichia phage slur07, complete genome 132226-132257 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MN508618 UNVERIFIED: Escherichia phage ES26, complete genome 137368-137399 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 KM607002 Enterobacteria phage RB55, complete genome 32575-32606 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 KY608967 UNVERIFIED: Escherichia phage CF2, complete genome 126592-126623 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MF001354 Salmonella phage SG1, partial genome 145043-145074 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MT176425 Citrobacter phage PhiZZ23, complete genome 31566-31597 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 NC_042039 Shigella phage Sf22, complete genome 143288-143319 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MF327009 Shigella phage Sf25, complete genome 126247-126278 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 AP018813 Enterobacteria phage T2 DNA, complete genome 30508-30539 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MN580668 Salmonella phage pSe_SNUABM_01, complete genome 32436-32467 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MK373781 Escherichia phage vB_EcoM_KAW1E185, complete genome 31087-31118 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 NC_025829 Shigella phage pSs-1, complete genome 35288-35319 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 LN881737 Escherichia phage slur13, complete genome 42248-42279 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 LR597657 Escherichia phage T4_ev240 genome assembly, chromosome: 1 29999-30030 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 NC_030953 Shigella phage SHFML-11, complete genome 147993-148024 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MN508614 UNVERIFIED: Escherichia phage ES12, complete genome 137017-137048 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 KJ477684 Enterobacteria phage T4 strain wild, complete genome 32597-32628 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MG781190 Escherichia phage vB_EcoM-fFiEco06, complete genome 31193-31224 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 LR215723 Yersinia phage fPS-90 genome assembly, chromosome: I 31610-31641 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MH550421 Enterobacteria phage T6, complete genome 30105-30136 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 KM606996 Enterobacteria phage RB6, complete genome 29988-30019 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 AP018932 Escherichia phage KIT03 DNA, complete sequence 30957-30988 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 NC_025448 Enterobacteria phage RB27, complete genome 30935-30966 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 KJ668714 Escherichia phage e11/2, complete genome 32614-32645 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 HM137666 Enterobacteria phage T4T, complete genome 32597-32628 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MN895438 Escherichia phage teqdroes, complete genome 23409-23440 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 KP869105 Escherichia coli O157 typing phage 7, partial genome 49601-49632 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MF158046 Shigella phage Sf23, complete genome 120677-120708 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MN022785 Escherichia virus VEc20, complete genome 30662-30693 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MT682709 Escherichia phage vB_EcoM_SP1, complete genome 137940-137971 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 NC_000866 Enterobacteria phage T4, complete genome 32610-32641 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MT682714 Escherichia phage vB_EcoM_Lutter, complete genome 31809-31840 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 LR746311 Shigella phage vB_SsoM_113 genome assembly, chromosome: 1 39764-39795 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MK962750 Shigella phage CM8, complete genome 29977-30008 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MH553563 Enterobacteria phage RB18, complete genome 31120-31151 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MN895436 Escherichia phage teqsoen, complete genome 16262-16293 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 KM606995 Enterobacteria phage RB5, complete genome 29988-30019 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MT682710 Escherichia phage vB_EcoM_FT, complete genome 140483-140514 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MG775043 Citrobacter phage vB_CroM_CrRp10, complete genome 5760-5791 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MN781580 Shigella virus KRT47, complete genome 31345-31376 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 LN881726 Escherichia phage slur02, complete genome 102367-102398 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MK373785 Escherichia phage vB_EcoM_OE5505, complete genome 32273-32304 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 NC_042078 Shigella phage Sf24, complete genome 126480-126511 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MH992121 UNVERIFIED: Escherichia phage MLF4, partial genome 127058-127089 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MT682712 Escherichia phage vB_EcoM_F1, complete genome 32192-32223 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MK373779 Escherichia phage vB_EcoM_G9062, complete genome 32002-32033 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MT179807 Escherichia phage vB_EcoM_IME537, complete genome 108362-108393 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 KX828711 Shigella phage SH7, complete genome 29642-29673 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MN508616 UNVERIFIED: Escherichia phage ES19, complete genome 137468-137499 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 KJ477686 Enterobacteria phage T4 strain GT7, complete genome 32597-32628 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MT446387 UNVERIFIED: Escherichia virus TH09, complete genome 125908-125939 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MK327946 Escherichia phage vB_EcoM_G4507, complete genome 30961-30992 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MK327944 Escherichia phage vB_EcoM_G2540-3, complete genome 32037-32068 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 FJ839692 Enterobacteria phage RB14, complete genome 30073-30104 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 KX452694 UNVERIFIED: Escherichia phage KPN1 genomic sequence 22092-22123 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MH355584 Escherichia phage vB_EcoM_JB75, complete genome 135776-135807 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 KM606994 Enterobacteria phage RB3, complete genome 29989-30020 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 M15080 Bacteriophage T4 genes 45.1 (encoding RNA polymerase-binding protein) and 45.2 914-945 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 M10160 Bacteriophage T4 genes 55, alpha-gt, 47, 46, 45, 44, 62, regA, and 43 7541-7572 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MK977694 Escherichia phage vB_EcoM-Sa45lw, complete genome 30900-30931 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 LR877332 Shigella phage vB_SsoM_JK08 genome assembly, chromosome: 1 31412-31443 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 KX130862 Shigella phage SHFML-26, complete genome 95721-95752 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 KU867876 Escherichia phage vB_EcoM-UFV13, complete genome 31118-31149 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MK327929 Escherichia phage D5505, complete genome 30564-30595 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MK327936 Escherichia phage vB_EcoM_G2540, complete genome 32424-32455 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MK327939 Escherichia phage vB_EcoM_G4498, complete genome 31585-31616 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 NC_031030 Escherichia phage UFV-AREG1, complete genome 30767-30798 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MN508617 UNVERIFIED: Escherichia phage ES21, complete genome 137483-137514 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 FJ839693 Enterobacteria phage RB51, complete genome 31270-31301 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 KM607004 Enterobacteria phage RB68, complete genome 31270-31301 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MN994497 Phage NBEco003, complete genome 135731-135762 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MK962755 Shigella phage JK38, complete genome 30816-30847 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MH243439 Escherichia phage vB_EcoM_NBG2, complete genome 29620-29651 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MK327945 Escherichia phage vB_EcoM_G4500, complete genome 31512-31543 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MF001360 Escherichia phage ECO4, partial genome 41430-41461 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 KJ477685 Enterobacteria phage T4 strain 147, complete genome 32597-32628 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MK886800 Escherichia phage EcNP1, complete genome 9338-9369 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 LR215724 Yersinia phage fPS-65 genome assembly, chromosome: I 31988-32019 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MK327940 Escherichia phage vB_EcoM_G29, complete genome 31512-31543 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 LN881733 Escherichia phage slur08, complete genome 135897-135928 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 AP011113 Enterobacteria phage AR1 DNA, complete genome 30574-30605 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MK373786 Escherichia phage vB_EcoM_R5505, complete genome 31076-31107 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 LC348380 Escherichia phage T2 DNA, complete sequence 30520-30551 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MT176424 Citrobacter phage PhiZZ6, complete genome 31105-31136 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 NC_027404 Yersinia phage PST, complete genome 29970-30001 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 NC_008515 Bacteriophage RB32, complete genome 30209-30240 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MK962752 Shigella phage JK23, complete genome 32370-32401 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 KT184312 Enterobacteria phage Kha5h, complete genome 56556-56587 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 HE956711 Yersinia phage phiD1 complete genome 31444-31475 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MG867727 Escherichia phage vB_EcoM-G28, complete genome 32093-32124 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 KF925357 Escherichia phage HY01, complete genome 30776-30807 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 KR233165 Escherichia phage PEC04, complete genome 38488-38519 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 NC_015457 Shigella phage Shfl2, complete genome 30907-30938 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 KM607001 Enterobacteria phage RB33, complete genome 30328-30359 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 LC348379 Escherichia phage PP01 DNA, complete sequence 31100-31131 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MK327942 Escherichia phage vB_EcoM_G50, complete genome 31482-31513 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MK327928 Escherichia phage vB_EcoM_G2133, complete genome 31010-31041 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MT176426 Serratia phage PhiZZ30, complete genome 31568-31599 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 KX452698 UNVERIFIED: Shigella phage KPN5 genomic sequence 33517-33548 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 KT184308 Enterobacteria phage Aplg8, complete genome 143546-143577 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MK373787 Escherichia phage vB_EcoM_G8, complete genome 30989-31020 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 LR597660 Escherichia phage T4_ev151 genome assembly, chromosome: 1 29905-29936 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MN895434 Escherichia phage teqhad, complete genome 36305-36336 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MH992510 Escherichia phage vB_EcoM_DalCa, complete genome 30936-30967 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 KM607003 Enterobacteria phage RB59, complete genome 32575-32606 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 LN881729 Escherichia phage slur04, complete genome 16880-16911 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 HM997020 Escherichia phage wV7, complete genome 30909-30940 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MH051916 Enterobacteria phage vB_EcoM_IME340, complete genome 137688-137719 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 MT932213 Escherichia phage VEc74, complete genome 29744-29775 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 JN202312 Enterobacteria phage ime09, complete genome 31299-31330 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 KM606999 Enterobacteria phage RB10, complete genome 29988-30019 8 0.75
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 KM606998 Enterobacteria phage RB9, complete genome 29989-30020 8 0.75
CP032143_2 2.65|2200913|32|CP032143|PILER-CR 2200913-2200944 32 AP014358 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S39-C94, *** SEQUENCING IN PROGRESS *** 15410-15441 8 0.75
CP032143_2 2.75|2201513|32|CP032143|PILER-CR 2201513-2201544 32 NC_042028 Acinetobacter phage AB1, complete genome 13002-13033 8 0.75
CP032143_2 2.80|2201813|32|CP032143|PILER-CR 2201813-2201844 32 KJ019135 Synechococcus phage ACG-2014a isolate Syn7803C101, complete genome 33677-33708 8 0.75
CP032143_2 2.80|2201813|32|CP032143|PILER-CR 2201813-2201844 32 KJ019114 Synechococcus phage ACG-2014a isolate Syn7803US60, complete genome 33583-33614 8 0.75
CP032143_2 2.80|2201813|32|CP032143|PILER-CR 2201813-2201844 32 KJ019138 Synechococcus phage ACG-2014a isolate Syn7803C107, complete genome 33595-33626 8 0.75
CP032143_2 2.80|2201813|32|CP032143|PILER-CR 2201813-2201844 32 KJ019122 Synechococcus phage ACG-2014a isolate Syn7803US79, complete genome 33582-33613 8 0.75
CP032143_2 2.80|2201813|32|CP032143|PILER-CR 2201813-2201844 32 KJ019055 Synechococcus phage ACG-2014a isolate Syn7803C86, complete genome 33677-33708 8 0.75
CP032143_2 2.80|2201813|32|CP032143|PILER-CR 2201813-2201844 32 KJ019038 Synechococcus phage ACG-2014a isolate Syn7803C59, complete genome 33582-33613 8 0.75
CP032143_2 2.80|2201813|32|CP032143|PILER-CR 2201813-2201844 32 KJ019068 Synechococcus phage ACG-2014a isolate Syn7803US102, complete genome 33582-33613 8 0.75
CP032143_2 2.80|2201813|32|CP032143|PILER-CR 2201813-2201844 32 KJ019137 Synechococcus phage ACG-2014a isolate Syn7803C104, complete genome 33677-33708 8 0.75
CP032143_2 2.80|2201813|32|CP032143|PILER-CR 2201813-2201844 32 KJ019157 Synechococcus phage ACG-2014a isolate Syn7803C31, complete genome 33677-33708 8 0.75
CP032143_2 2.80|2201813|32|CP032143|PILER-CR 2201813-2201844 32 KJ019087 Synechococcus phage ACG-2014a isolate Syn7803US19, complete genome 33582-33613 8 0.75
CP032143_2 2.80|2201813|32|CP032143|PILER-CR 2201813-2201844 32 KJ019076 Synechococcus phage ACG-2014a isolate Syn7803US112, complete genome 33582-33613 8 0.75
CP032143_2 2.80|2201813|32|CP032143|PILER-CR 2201813-2201844 32 KJ019065 Synechococcus phage ACG-2014a isolate Syn7803C99, complete genome 33582-33613 8 0.75
CP032143_2 2.80|2201813|32|CP032143|PILER-CR 2201813-2201844 32 KJ019026 Synechococcus phage ACG-2014a isolate Syn7803C42, complete genome 33588-33619 8 0.75
CP032143_2 2.80|2201813|32|CP032143|PILER-CR 2201813-2201844 32 KJ019081 Synechococcus phage ACG-2014a isolate Syn7803US117, complete genome 33583-33614 8 0.75
CP032143_2 2.80|2201813|32|CP032143|PILER-CR 2201813-2201844 32 KJ019033 Synechococcus phage ACG-2014a isolate Syn7803C53, complete genome 33582-33613 8 0.75
CP032143_2 2.80|2201813|32|CP032143|PILER-CR 2201813-2201844 32 NC_023584 Synechococcus phage S-MbCM100, complete genome 34377-34408 8 0.75
CP032143_2 2.80|2201813|32|CP032143|PILER-CR 2201813-2201844 32 KJ019153 Synechococcus phage ACG-2014a isolate Syn7803C26, complete genome 33582-33613 8 0.75
CP032143_2 2.80|2201813|32|CP032143|PILER-CR 2201813-2201844 32 KJ019158 Synechococcus phage ACG-2014a isolate Syn7803C33, complete genome 33582-33613 8 0.75
CP032143_2 2.80|2201813|32|CP032143|PILER-CR 2201813-2201844 32 KJ019067 Synechococcus phage ACG-2014a isolate Syn7803US101, complete genome 33583-33614 8 0.75
CP032143_2 2.80|2201813|32|CP032143|PILER-CR 2201813-2201844 32 KJ019039 Synechococcus phage ACG-2014a isolate Syn7803C60, complete genome 33582-33613 8 0.75
CP032143_2 2.80|2201813|32|CP032143|PILER-CR 2201813-2201844 32 KJ019030 Synechococcus phage ACG-2014a isolate Syn7803C47, complete genome 33582-33613 8 0.75
CP032143_2 2.80|2201813|32|CP032143|PILER-CR 2201813-2201844 32 KJ019163 Synechococcus phage ACG-2014a isolate Syn7803C38, complete genome 33582-33613 8 0.75
CP032143_2 2.80|2201813|32|CP032143|PILER-CR 2201813-2201844 32 KJ019116 Synechococcus phage ACG-2014a isolate Syn7803US62, complete genome 33394-33425 8 0.75
CP032143_2 2.80|2201813|32|CP032143|PILER-CR 2201813-2201844 32 KJ019088 Synechococcus phage ACG-2014a isolate Syn7803US1, complete genome 33573-33604 8 0.75
CP032143_2 2.80|2201813|32|CP032143|PILER-CR 2201813-2201844 32 KJ019084 Synechococcus phage ACG-2014a isolate Syn7803US123, complete genome 33581-33612 8 0.75
CP032143_2 2.80|2201813|32|CP032143|PILER-CR 2201813-2201844 32 NZ_CP030933 Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence 661478-661509 8 0.75
CP032143_2 2.84|2202053|32|CP032143|PILER-CR 2202053-2202084 32 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 172605-172636 8 0.75
CP032143_1 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046682-2046713 32 NZ_CP011513 Paenibacillus peoriae strain HS311 plasmid unnamed, complete sequence 74310-74341 9 0.719
CP032143_1 1.11|2046922|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046922-2046953 32 KU686209 Synechococcus phage S-CAM22 isolate 1209TA19, complete genome 59824-59855 9 0.719
CP032143_1 1.11|2046922|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046922-2046953 32 KU686208 Synechococcus phage S-CAM22 isolate 0310NB44, complete genome 59874-59905 9 0.719
CP032143_1 1.11|2046922|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046922-2046953 32 KU686207 Synechococcus phage S-CAM22 isolate 0210CC35, complete genome 59710-59741 9 0.719
CP032143_1 1.15|2047162|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2047162-2047193 32 MN693441 Marine virus AFVG_25M481, complete genome 10438-10469 9 0.719
CP032143_1 1.15|2047162|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2047162-2047193 32 MN693170 Marine virus AFVG_25M480, complete genome 49609-49640 9 0.719
CP032143_1 1.24|2047702|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2047702-2047733 32 MH356730 Staphylococcus phage VB-SauS-SA2, complete genome 32868-32899 9 0.719
CP032143_1 1.35|2048362|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2048362-2048393 32 NZ_CP039706 Clostridium butyricum strain 4-1 plasmid p-butyl_plas_4-1, complete sequence 561718-561749 9 0.719
CP032143_1 1.35|2048362|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2048362-2048393 32 NZ_CP033246 Clostridium butyricum strain CFSA3987 plasmid pCFSA3987, complete sequence 324326-324357 9 0.719
CP032143_1 1.35|2048362|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2048362-2048393 32 NZ_CP033248 Clostridium butyricum strain CFSA3989 plasmid pCFSA3989, complete sequence 324366-324397 9 0.719
CP032143_1 1.35|2048362|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2048362-2048393 32 NZ_CP013238 Clostridium butyricum strain CDC_51208 plasmid pNPD4_2, complete sequence 242558-242589 9 0.719
CP032143_1 1.35|2048362|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2048362-2048393 32 MF360958 Salicola phage SCTP-2, complete genome 370740-370771 9 0.719
CP032143_1 1.36|2048422|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2048422-2048453 32 NC_004719 Streptomyces avermitilis MA-4680 = NBRC 14893 plasmid SAP1, complete sequence 71837-71868 9 0.719
CP032143_2 2.5|2200129|32|CP032143|CRISPRCasFinder,CRT 2200129-2200160 32 MH412654 Synechococcus phage S-T4, complete genome 54968-54999 9 0.719
CP032143_2 2.6|2200189|32|CP032143|CRISPRCasFinder,CRT 2200189-2200220 32 NC_021789 Cellulophaga phage phi19:3, complete genome 14182-14213 9 0.719
CP032143_2 2.6|2200189|32|CP032143|CRISPRCasFinder,CRT 2200189-2200220 32 NZ_CP044979 Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence 486183-486214 9 0.719
CP032143_2 2.8|2200309|32|CP032143|CRISPRCasFinder,CRT 2200309-2200340 32 NZ_CP046537 Acinetobacter baumannii strain XL380 plasmid unnamed, complete sequence 32216-32247 9 0.719
CP032143_2 2.20|2201031|32|CP032143|CRISPRCasFinder,CRT 2201031-2201062 32 MG945171 UNVERIFIED: Microviridae sp. isolate 430-1801, partial genome 2863-2894 9 0.719
CP032143_2 2.29|2201571|32|CP032143|CRISPRCasFinder,CRT 2201571-2201602 32 MN871446 UNVERIFIED: Serratia phage KpLz-2_45, complete genome 224241-224272 9 0.719
CP032143_2 2.29|2201571|32|CP032143|CRISPRCasFinder,CRT 2201571-2201602 32 MN871452 UNVERIFIED: Serratia phage KpZh_1, complete genome 45941-45972 9 0.719
CP032143_2 2.29|2201571|32|CP032143|CRISPRCasFinder,CRT 2201571-2201602 32 MN871447 UNVERIFIED: Serratia phage KpLz_1_41, complete genome 292620-292651 9 0.719
CP032143_2 2.29|2201571|32|CP032143|CRISPRCasFinder,CRT 2201571-2201602 32 MN871449 UNVERIFIED: Serratia phage KpXa_1, complete genome 269568-269599 9 0.719
CP032143_2 2.29|2201571|32|CP032143|CRISPRCasFinder,CRT 2201571-2201602 32 MN871453 UNVERIFIED: Serratia phage KpZh_LPS_45, complete genome 212545-212576 9 0.719
CP032143_2 2.29|2201571|32|CP032143|CRISPRCasFinder,CRT 2201571-2201602 32 MN871451 UNVERIFIED: Serratia phage KpYy_2_45, complete genome 16014-16045 9 0.719
CP032143_2 2.29|2201571|32|CP032143|CRISPRCasFinder,CRT 2201571-2201602 32 MN871448 UNVERIFIED: Serratia phage KpSz_1, complete genome 16099-16130 9 0.719
CP032143_2 2.36|2201991|32|CP032143|CRISPRCasFinder,CRT 2201991-2202022 32 AB797215 Klebsiella phage 0507-KN2-1 DNA, complete genome 106703-106734 9 0.719
CP032143_2 2.36|2201991|32|CP032143|CRISPRCasFinder,CRT 2201991-2202022 32 MG428990 Klebsiella phage Menlow, complete genome 39032-39063 9 0.719
CP032143_2 2.36|2201991|32|CP032143|CRISPRCasFinder,CRT 2201991-2202022 32 MN045230 Klebsiella phage Magnus, complete genome 40278-40309 9 0.719
CP032143_2 2.36|2201991|32|CP032143|CRISPRCasFinder,CRT 2201991-2202022 32 MK373783 Escherichia phage vB_EcoM_KWBSE43-6, complete genome 107436-107467 9 0.719
CP032143_2 2.36|2201991|32|CP032143|CRISPRCasFinder,CRT 2201991-2202022 32 NC_042047 Serratia phage vB_Sru_IME250, complete genome 85122-85153 9 0.719
CP032143_2 2.37|2202051|32|CP032143|CRISPRCasFinder,CRT 2202051-2202082 32 NC_031245 Bacillus phage SP-15, complete genome 100676-100707 9 0.719
CP032143_2 2.41|2202291|32|CP032143|CRISPRCasFinder,CRT 2202291-2202322 32 NZ_CP053657 Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence 168072-168103 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 MT585306 Flavobacterium phage FCOV-F43, complete genome 39234-39265 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 MT585275 Flavobacterium phage FCOV-F4, complete genome 39229-39260 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 MT585280 Flavobacterium phage FCOV-F12, complete genome 39234-39265 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 MK756088 Flavobacterium phage FCOV-F25, complete genome 39229-39260 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 KY951963 Flavobacterium phage FCV-3, complete genome 39261-39292 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 MT585285 Flavobacterium phage FCOV-F19, complete genome 39234-39265 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 MK756089 Flavobacterium phage FCOV-F27, complete genome 39280-39311 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 MT585297 Flavobacterium phage FCOV-F33, complete genome 39234-39265 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 MT585274 Flavobacterium phage FCOV-F3, complete genome 39231-39262 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 MT585315 Flavobacterium phage V189, complete genome 39234-39265 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 MT585277 Flavobacterium phage FCOV-F8, complete genome 39232-39263 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 MT585300 Flavobacterium phage FCOV-F36, complete genome 39232-39263 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 KY979242 Flavobacterium phage V182, complete genome 39247-39278 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 MK756084 Flavobacterium phage FCOV-F6, complete genome 39272-39303 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 KY979243 Flavobacterium phage VK20, complete genome 39261-39292 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 MT585273 Flavobacterium phage FCOV-F1, complete genome 39231-39262 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 MT585298 Flavobacterium phage FCOV-F34, complete genome 39232-39263 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 MT585286 Flavobacterium phage FCOV-F20, complete genome 39234-39265 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 MT585296 Flavobacterium phage FCOV-F32, complete genome 39231-39262 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 KY979246 Flavobacterium phage VK52, complete genome 39261-39292 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 MT585314 Flavobacterium phage V188, complete genome 39234-39265 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 MT585287 Flavobacterium phage FCOV-F21, complete genome 39234-39265 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 KY992519 Flavobacterium phage V175, complete genome 39252-39283 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 MT585299 Flavobacterium phage FCOV-F35, complete genome 39232-39263 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 MT585279 Flavobacterium phage FCOV-F11, complete genome 39231-39262 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 MT585295 Flavobacterium phage FCOV-F31, complete genome 39231-39262 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 MT585304 Flavobacterium phage FCOV-F41, complete genome 39234-39265 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 MT585288 Flavobacterium phage FCOV-F22, complete genome 39232-39263 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 MT585309 Flavobacterium phage FCOV-F48, complete genome 39232-39263 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 MT585293 Flavobacterium phage FCOV-F29, complete genome 39231-39262 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 MT585291 Flavobacterium phage FCOV-F26, complete genome 39231-39262 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 MT585302 Flavobacterium phage FCOV-F39, complete genome 39234-39265 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 MT585284 Flavobacterium phage FCOV-F18, complete genome 39234-39265 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 MT585305 Flavobacterium phage FCOV-F42, complete genome 39234-39265 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 MT585290 Flavobacterium phage FCOV-F24, complete genome 39231-39262 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 MT585311 Flavobacterium phage V183, complete genome 39234-39265 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 MT585278 Flavobacterium phage FCOV-F10, complete genome 39231-39262 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 MT585294 Flavobacterium phage FCOV-F30, complete genome 39234-39265 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 KY951964 Flavobacterium phage FCV-11, complete genome 39261-39292 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 MT585283 Flavobacterium phage FCOV-F17, complete genome 39234-39265 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 MT585301 Flavobacterium phage FCOV-F38, complete genome 39232-39263 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 KY979236 Flavobacterium phage FCV-10, complete genome 39261-39292 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 KY979237 Flavobacterium phage FCV-16, complete genome 39261-39292 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 MT585303 Flavobacterium phage FCOV-F40, complete genome 39232-39263 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 KY979241 Flavobacterium phage V165, complete genome 39249-39280 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 KY979238 Flavoibacterium phage FCV-20, complete genome 39261-39292 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 MK756083 Flavobacterium phage FCOV-F2, complete genome 39231-39262 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 MK756085 Flavobacterium phage FCOV-F9, complete genome 39275-39306 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 KY992520 Flavobacterium phage V181, complete genome 39249-39280 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 MT585308 Flavobacterium phage FCOV-F47, complete genome 39234-39265 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 MT431535 Flavobacterium phage FCV-1.01, complete genome 39166-39197 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 KY979244 Flavobacterium phage VK42, complete genome 39261-39292 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 MT585292 Flavobacterium phage FCOV-F28, complete genome 39234-39265 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 NC_041845 Flavobacterium phage FCV-1, complete genome 39259-39290 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 MT585276 Flavobacterium phage FCOV-F7, complete genome 39231-39262 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 MT585289 Flavobacterium phage FCOV-F23, complete genome 39234-39265 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 MK756090 Flavobacterium phage FCOV-F37, complete genome 39247-39278 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 MT585312 Flavobacterium phage V184, complete genome 39234-39265 9 0.719
CP032143_2 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT 2202351-2202382 32 MT585307 Flavobacterium phage FCOV-F44, complete genome 39234-39265 9 0.719
CP032143_2 2.45|2202531|32|CP032143|CRISPRCasFinder,CRT 2202531-2202562 32 NZ_CP011375 Moraxella bovoculi strain 58069 plasmid unnamed, complete sequence 334-365 9 0.719
CP032143_2 2.45|2202531|32|CP032143|CRISPRCasFinder,CRT 2202531-2202562 32 LC494302 Escherichia phage SP27 DNA, complete genome 553-584 9 0.719
CP032143_2 2.45|2202531|32|CP032143|CRISPRCasFinder,CRT 2202531-2202562 32 MK817115 Escherichia phage vB_EcoM_phAPEC6, complete genome 128833-128864 9 0.719
CP032143_2 2.45|2202531|32|CP032143|CRISPRCasFinder,CRT 2202531-2202562 32 NC_027364 Escherichia phage PBECO 4, complete genome 284104-284135 9 0.719
CP032143_2 2.45|2202531|32|CP032143|CRISPRCasFinder,CRT 2202531-2202562 32 MH383160 Escherichia phage UB, complete genome 349172-349203 9 0.719
CP032143_2 2.45|2202531|32|CP032143|CRISPRCasFinder,CRT 2202531-2202562 32 MK327931 Escherichia phage vB_EcoM_G17, complete genome 154319-154350 9 0.719
CP032143_2 2.45|2202531|32|CP032143|CRISPRCasFinder,CRT 2202531-2202562 32 LT603033 Escherichia phage vB_Eco_slurp01 genome assembly, chromosome: I 289036-289067 9 0.719
CP032143_2 2.45|2202531|32|CP032143|CRISPRCasFinder,CRT 2202531-2202562 32 KM507819 Escherichia phage 121Q, complete genome 553-584 9 0.719
CP032143_2 2.45|2202531|32|CP032143|CRISPRCasFinder,CRT 2202531-2202562 32 MK250021 Prevotella phage Lak-B2, complete genome 541985-542016 9 0.719
CP032143_2 2.45|2202531|32|CP032143|CRISPRCasFinder,CRT 2202531-2202562 32 MK250024 Prevotella phage Lak-B5, complete genome 535676-535707 9 0.719
CP032143_2 2.45|2202531|32|CP032143|CRISPRCasFinder,CRT 2202531-2202562 32 MK250028 Prevotella phage Lak-B9, complete genome 542184-542215 9 0.719
CP032143_2 2.45|2202531|32|CP032143|CRISPRCasFinder,CRT 2202531-2202562 32 MK250023 Prevotella phage Lak-B4, complete genome 542699-542730 9 0.719
CP032143_2 2.45|2202531|32|CP032143|CRISPRCasFinder,CRT 2202531-2202562 32 MK250025 Prevotella phage Lak-B6, complete genome 538787-538818 9 0.719
CP032143_2 2.45|2202531|32|CP032143|CRISPRCasFinder,CRT 2202531-2202562 32 MK250022 Prevotella phage Lak-B3, complete genome 538877-538908 9 0.719
CP032143_2 2.45|2202531|32|CP032143|CRISPRCasFinder,CRT 2202531-2202562 32 MK250027 Prevotella phage Lak-B8, complete genome 543809-543840 9 0.719
CP032143_2 2.45|2202531|32|CP032143|CRISPRCasFinder,CRT 2202531-2202562 32 MK250026 Prevotella phage Lak-B7, complete genome 542839-542870 9 0.719
CP032143_2 2.45|2202531|32|CP032143|CRISPRCasFinder,CRT 2202531-2202562 32 MK250020 Prevotella phage Lak-B1, complete genome 540102-540133 9 0.719
CP032143_2 2.52|2200131|32|CP032143|PILER-CR 2200131-2200162 32 MH412654 Synechococcus phage S-T4, complete genome 54968-54999 9 0.719
CP032143_2 2.53|2200191|32|CP032143|PILER-CR 2200191-2200222 32 NC_021789 Cellulophaga phage phi19:3, complete genome 14182-14213 9 0.719
CP032143_2 2.53|2200191|32|CP032143|PILER-CR 2200191-2200222 32 NZ_CP044979 Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence 486183-486214 9 0.719
CP032143_2 2.55|2200311|32|CP032143|PILER-CR 2200311-2200342 32 NZ_CP046537 Acinetobacter baumannii strain XL380 plasmid unnamed, complete sequence 32216-32247 9 0.719
CP032143_2 2.67|2201033|32|CP032143|PILER-CR 2201033-2201064 32 MG945171 UNVERIFIED: Microviridae sp. isolate 430-1801, partial genome 2863-2894 9 0.719
CP032143_2 2.76|2201573|32|CP032143|PILER-CR 2201573-2201604 32 MN871446 UNVERIFIED: Serratia phage KpLz-2_45, complete genome 224241-224272 9 0.719
CP032143_2 2.76|2201573|32|CP032143|PILER-CR 2201573-2201604 32 MN871452 UNVERIFIED: Serratia phage KpZh_1, complete genome 45941-45972 9 0.719
CP032143_2 2.76|2201573|32|CP032143|PILER-CR 2201573-2201604 32 MN871447 UNVERIFIED: Serratia phage KpLz_1_41, complete genome 292620-292651 9 0.719
CP032143_2 2.76|2201573|32|CP032143|PILER-CR 2201573-2201604 32 MN871449 UNVERIFIED: Serratia phage KpXa_1, complete genome 269568-269599 9 0.719
CP032143_2 2.76|2201573|32|CP032143|PILER-CR 2201573-2201604 32 MN871453 UNVERIFIED: Serratia phage KpZh_LPS_45, complete genome 212545-212576 9 0.719
CP032143_2 2.76|2201573|32|CP032143|PILER-CR 2201573-2201604 32 MN871451 UNVERIFIED: Serratia phage KpYy_2_45, complete genome 16014-16045 9 0.719
CP032143_2 2.76|2201573|32|CP032143|PILER-CR 2201573-2201604 32 MN871448 UNVERIFIED: Serratia phage KpSz_1, complete genome 16099-16130 9 0.719
CP032143_2 2.83|2201993|32|CP032143|PILER-CR 2201993-2202024 32 AB797215 Klebsiella phage 0507-KN2-1 DNA, complete genome 106703-106734 9 0.719
CP032143_2 2.83|2201993|32|CP032143|PILER-CR 2201993-2202024 32 MG428990 Klebsiella phage Menlow, complete genome 39032-39063 9 0.719
CP032143_2 2.83|2201993|32|CP032143|PILER-CR 2201993-2202024 32 MN045230 Klebsiella phage Magnus, complete genome 40278-40309 9 0.719
CP032143_2 2.83|2201993|32|CP032143|PILER-CR 2201993-2202024 32 MK373783 Escherichia phage vB_EcoM_KWBSE43-6, complete genome 107436-107467 9 0.719
CP032143_2 2.83|2201993|32|CP032143|PILER-CR 2201993-2202024 32 NC_042047 Serratia phage vB_Sru_IME250, complete genome 85122-85153 9 0.719
CP032143_2 2.84|2202053|32|CP032143|PILER-CR 2202053-2202084 32 NC_031245 Bacillus phage SP-15, complete genome 100676-100707 9 0.719
CP032143_2 2.88|2202293|32|CP032143|PILER-CR 2202293-2202324 32 NZ_CP053657 Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence 168072-168103 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 MT585306 Flavobacterium phage FCOV-F43, complete genome 39234-39265 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 MT585275 Flavobacterium phage FCOV-F4, complete genome 39229-39260 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 MT585280 Flavobacterium phage FCOV-F12, complete genome 39234-39265 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 MK756088 Flavobacterium phage FCOV-F25, complete genome 39229-39260 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 KY951963 Flavobacterium phage FCV-3, complete genome 39261-39292 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 MT585285 Flavobacterium phage FCOV-F19, complete genome 39234-39265 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 MK756089 Flavobacterium phage FCOV-F27, complete genome 39280-39311 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 MT585297 Flavobacterium phage FCOV-F33, complete genome 39234-39265 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 MT585274 Flavobacterium phage FCOV-F3, complete genome 39231-39262 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 MT585315 Flavobacterium phage V189, complete genome 39234-39265 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 MT585277 Flavobacterium phage FCOV-F8, complete genome 39232-39263 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 MT585300 Flavobacterium phage FCOV-F36, complete genome 39232-39263 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 KY979242 Flavobacterium phage V182, complete genome 39247-39278 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 MK756084 Flavobacterium phage FCOV-F6, complete genome 39272-39303 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 KY979243 Flavobacterium phage VK20, complete genome 39261-39292 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 MT585273 Flavobacterium phage FCOV-F1, complete genome 39231-39262 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 MT585298 Flavobacterium phage FCOV-F34, complete genome 39232-39263 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 MT585286 Flavobacterium phage FCOV-F20, complete genome 39234-39265 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 MT585296 Flavobacterium phage FCOV-F32, complete genome 39231-39262 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 KY979246 Flavobacterium phage VK52, complete genome 39261-39292 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 MT585314 Flavobacterium phage V188, complete genome 39234-39265 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 MT585287 Flavobacterium phage FCOV-F21, complete genome 39234-39265 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 KY992519 Flavobacterium phage V175, complete genome 39252-39283 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 MT585299 Flavobacterium phage FCOV-F35, complete genome 39232-39263 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 MT585279 Flavobacterium phage FCOV-F11, complete genome 39231-39262 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 MT585295 Flavobacterium phage FCOV-F31, complete genome 39231-39262 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 MT585304 Flavobacterium phage FCOV-F41, complete genome 39234-39265 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 MT585288 Flavobacterium phage FCOV-F22, complete genome 39232-39263 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 MT585309 Flavobacterium phage FCOV-F48, complete genome 39232-39263 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 MT585293 Flavobacterium phage FCOV-F29, complete genome 39231-39262 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 MT585291 Flavobacterium phage FCOV-F26, complete genome 39231-39262 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 MT585302 Flavobacterium phage FCOV-F39, complete genome 39234-39265 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 MT585284 Flavobacterium phage FCOV-F18, complete genome 39234-39265 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 MT585305 Flavobacterium phage FCOV-F42, complete genome 39234-39265 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 MT585290 Flavobacterium phage FCOV-F24, complete genome 39231-39262 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 MT585311 Flavobacterium phage V183, complete genome 39234-39265 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 MT585278 Flavobacterium phage FCOV-F10, complete genome 39231-39262 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 MT585294 Flavobacterium phage FCOV-F30, complete genome 39234-39265 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 KY951964 Flavobacterium phage FCV-11, complete genome 39261-39292 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 MT585283 Flavobacterium phage FCOV-F17, complete genome 39234-39265 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 MT585301 Flavobacterium phage FCOV-F38, complete genome 39232-39263 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 KY979236 Flavobacterium phage FCV-10, complete genome 39261-39292 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 KY979237 Flavobacterium phage FCV-16, complete genome 39261-39292 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 MT585303 Flavobacterium phage FCOV-F40, complete genome 39232-39263 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 KY979241 Flavobacterium phage V165, complete genome 39249-39280 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 KY979238 Flavoibacterium phage FCV-20, complete genome 39261-39292 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 MK756083 Flavobacterium phage FCOV-F2, complete genome 39231-39262 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 MK756085 Flavobacterium phage FCOV-F9, complete genome 39275-39306 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 KY992520 Flavobacterium phage V181, complete genome 39249-39280 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 MT585308 Flavobacterium phage FCOV-F47, complete genome 39234-39265 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 MT431535 Flavobacterium phage FCV-1.01, complete genome 39166-39197 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 KY979244 Flavobacterium phage VK42, complete genome 39261-39292 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 MT585292 Flavobacterium phage FCOV-F28, complete genome 39234-39265 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 NC_041845 Flavobacterium phage FCV-1, complete genome 39259-39290 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 MT585276 Flavobacterium phage FCOV-F7, complete genome 39231-39262 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 MT585289 Flavobacterium phage FCOV-F23, complete genome 39234-39265 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 MK756090 Flavobacterium phage FCOV-F37, complete genome 39247-39278 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 MT585312 Flavobacterium phage V184, complete genome 39234-39265 9 0.719
CP032143_2 2.89|2202353|32|CP032143|PILER-CR 2202353-2202384 32 MT585307 Flavobacterium phage FCOV-F44, complete genome 39234-39265 9 0.719
CP032143_2 2.92|2202533|32|CP032143|PILER-CR 2202533-2202564 32 NZ_CP011375 Moraxella bovoculi strain 58069 plasmid unnamed, complete sequence 334-365 9 0.719
CP032143_2 2.92|2202533|32|CP032143|PILER-CR 2202533-2202564 32 LC494302 Escherichia phage SP27 DNA, complete genome 553-584 9 0.719
CP032143_2 2.92|2202533|32|CP032143|PILER-CR 2202533-2202564 32 MK817115 Escherichia phage vB_EcoM_phAPEC6, complete genome 128833-128864 9 0.719
CP032143_2 2.92|2202533|32|CP032143|PILER-CR 2202533-2202564 32 NC_027364 Escherichia phage PBECO 4, complete genome 284104-284135 9 0.719
CP032143_2 2.92|2202533|32|CP032143|PILER-CR 2202533-2202564 32 MH383160 Escherichia phage UB, complete genome 349172-349203 9 0.719
CP032143_2 2.92|2202533|32|CP032143|PILER-CR 2202533-2202564 32 MK327931 Escherichia phage vB_EcoM_G17, complete genome 154319-154350 9 0.719
CP032143_2 2.92|2202533|32|CP032143|PILER-CR 2202533-2202564 32 LT603033 Escherichia phage vB_Eco_slurp01 genome assembly, chromosome: I 289036-289067 9 0.719
CP032143_2 2.92|2202533|32|CP032143|PILER-CR 2202533-2202564 32 KM507819 Escherichia phage 121Q, complete genome 553-584 9 0.719
CP032143_2 2.92|2202533|32|CP032143|PILER-CR 2202533-2202564 32 MK250021 Prevotella phage Lak-B2, complete genome 541985-542016 9 0.719
CP032143_2 2.92|2202533|32|CP032143|PILER-CR 2202533-2202564 32 MK250024 Prevotella phage Lak-B5, complete genome 535676-535707 9 0.719
CP032143_2 2.92|2202533|32|CP032143|PILER-CR 2202533-2202564 32 MK250028 Prevotella phage Lak-B9, complete genome 542184-542215 9 0.719
CP032143_2 2.92|2202533|32|CP032143|PILER-CR 2202533-2202564 32 MK250023 Prevotella phage Lak-B4, complete genome 542699-542730 9 0.719
CP032143_2 2.92|2202533|32|CP032143|PILER-CR 2202533-2202564 32 MK250025 Prevotella phage Lak-B6, complete genome 538787-538818 9 0.719
CP032143_2 2.92|2202533|32|CP032143|PILER-CR 2202533-2202564 32 MK250022 Prevotella phage Lak-B3, complete genome 538877-538908 9 0.719
CP032143_2 2.92|2202533|32|CP032143|PILER-CR 2202533-2202564 32 MK250027 Prevotella phage Lak-B8, complete genome 543809-543840 9 0.719
CP032143_2 2.92|2202533|32|CP032143|PILER-CR 2202533-2202564 32 MK250026 Prevotella phage Lak-B7, complete genome 542839-542870 9 0.719
CP032143_2 2.92|2202533|32|CP032143|PILER-CR 2202533-2202564 32 MK250020 Prevotella phage Lak-B1, complete genome 540102-540133 9 0.719
CP032143_1 1.5|2046562|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046562-2046593 32 NZ_CP036456 Streptomonospora sp. M2 plasmid phiM2, complete sequence 34844-34875 10 0.688
CP032143_1 1.9|2046802|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046802-2046833 32 AJ630128 Bacteriophage S-PM2 complete genome 33364-33395 10 0.688
CP032143_1 1.9|2046802|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046802-2046833 32 NC_006820 Synechococcus phage S-PM2, complete genome 33364-33395 10 0.688
CP032143_1 1.9|2046802|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2046802-2046833 32 LN828717 Synechococcus phage S-PM2 spontaneous deletion mutant, complete genome 23822-23853 10 0.688
CP032143_1 1.25|2047762|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2047762-2047793 32 KP696448 Bacillus phage Stills, complete genome 53785-53816 10 0.688
CP032143_1 1.28|2047942|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2047942-2047973 32 KY670595 Acinetobacter phage WCHABP12, complete genome 40604-40635 10 0.688
CP032143_1 1.28|2047942|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2047942-2047973 32 MF346584 Acinetobacter phage AbP2, complete genome 25741-25772 10 0.688
CP032143_1 1.28|2047942|32|CP032143|CRISPRCasFinder,CRT,PILER-CR 2047942-2047973 32 MN166083 Acinetobacter phage Abp9, complete genome 13622-13653 10 0.688
CP032143_2 2.2|2199949|32|CP032143|CRISPRCasFinder,CRT 2199949-2199980 32 MK721192 Enterococcus phage vB_EfaM_Ef2.3, complete genome 93203-93234 10 0.688
CP032143_2 2.2|2199949|32|CP032143|CRISPRCasFinder,CRT 2199949-2199980 32 MN694760 Marine virus AFVG_250M661, complete genome 46761-46792 10 0.688
CP032143_2 2.2|2199949|32|CP032143|CRISPRCasFinder,CRT 2199949-2199980 32 NC_009904 Enterococcus phage phiEF24C, complete genome 51510-51541 10 0.688
CP032143_2 2.2|2199949|32|CP032143|CRISPRCasFinder,CRT 2199949-2199980 32 AP009390 Enterococcus phage phiEF24C DNA, complete genome 51510-51541 10 0.688
CP032143_2 2.2|2199949|32|CP032143|CRISPRCasFinder,CRT 2199949-2199980 32 AB609718 Enterococcus phage phiEF24C-P2 DNA, complete genome 51510-51541 10 0.688
CP032143_2 2.6|2200189|32|CP032143|CRISPRCasFinder,CRT 2200189-2200220 32 MN693005 Marine virus AFVG_117M50, complete genome 31912-31943 10 0.688
CP032143_2 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT 2200791-2200822 32 NZ_CP017672 Providencia rettgeri strain RB151 plasmid pRB151-NDM, complete sequence 20736-20767 10 0.688
CP032143_2 2.25|2201331|32|CP032143|CRISPRCasFinder,CRT 2201331-2201362 32 MN865127 Vibrio alginolyticus strain C1579 plasmid pC1579, complete sequence 128989-129020 10 0.688
CP032143_2 2.28|2201511|32|CP032143|CRISPRCasFinder,CRT 2201511-2201542 32 NC_041966 Acinetobacter phage WCHABP1, complete genome 24546-24577 10 0.688
CP032143_2 2.28|2201511|32|CP032143|CRISPRCasFinder,CRT 2201511-2201542 32 KY670595 Acinetobacter phage WCHABP12, complete genome 36318-36349 10 0.688
CP032143_2 2.29|2201571|32|CP032143|CRISPRCasFinder,CRT 2201571-2201602 32 NZ_CP011490 Staphylococcus pseudintermedius strain 222 plasmid p222, complete sequence 2947-2978 10 0.688
CP032143_2 2.30|2201631|32|CP032143|CRISPRCasFinder,CRT 2201631-2201662 32 NC_020292 Clostridium saccharoperbutylacetonicum N1-4(HMT) plasmid Csp_135p, complete sequence 27897-27928 10 0.688
CP032143_2 2.31|2201691|32|CP032143|CRISPRCasFinder,CRT 2201691-2201722 32 NZ_CP051207 Dolichospermum flos-aquae CCAP 1403/13F plasmid pAfl69, complete sequence 25916-25947 10 0.688
CP032143_2 2.31|2201691|32|CP032143|CRISPRCasFinder,CRT 2201691-2201722 32 MH333064 Klebsiella phage Mineola, complete genome 9042-9073 10 0.688
CP032143_2 2.31|2201691|32|CP032143|CRISPRCasFinder,CRT 2201691-2201722 32 MN101226 Klebsiella phage KPN2 HKu-2019, complete genome 55852-55883 10 0.688
CP032143_2 2.31|2201691|32|CP032143|CRISPRCasFinder,CRT 2201691-2201722 32 NC_031095 Klebsiella phage PKO111, complete genome 99668-99699 10 0.688
CP032143_2 2.31|2201691|32|CP032143|CRISPRCasFinder,CRT 2201691-2201722 32 MN434095 Klebsiella pneumoniae phage JIPh_Kp122, complete genome 165028-165059 10 0.688
CP032143_2 2.31|2201691|32|CP032143|CRISPRCasFinder,CRT 2201691-2201722 32 MN101230 Klebsiella phage KPN6, complete genome 80640-80671 10 0.688
CP032143_2 2.31|2201691|32|CP032143|CRISPRCasFinder,CRT 2201691-2201722 32 KY000080 Klebsiella phage KPV15, complete genome 18563-18594 10 0.688
CP032143_2 2.31|2201691|32|CP032143|CRISPRCasFinder,CRT 2201691-2201722 32 MG751100 Klebsiella phage KP1, complete genome 166586-166617 10 0.688
CP032143_2 2.31|2201691|32|CP032143|CRISPRCasFinder,CRT 2201691-2201722 32 NC_028686 Klebsiella phage JD18, complete genome 164823-164854 10 0.688
CP032143_2 2.31|2201691|32|CP032143|CRISPRCasFinder,CRT 2201691-2201722 32 MK421971 Klebsiella phage vB_KpnM_GF, partial genome 160325-160356 10 0.688
CP032143_2 2.31|2201691|32|CP032143|CRISPRCasFinder,CRT 2201691-2201722 32 NC_031087 Klebsiella phage vB_KpnM_KpV477, complete genome 8716-8747 10 0.688
CP032143_2 2.32|2201751|32|CP032143|CRISPRCasFinder,CRT 2201751-2201782 32 MN694417 Marine virus AFVG_250M100, complete genome 28715-28746 10 0.688
CP032143_2 2.36|2201991|32|CP032143|CRISPRCasFinder,CRT 2201991-2202022 32 MN478483 Klebsiella virus UPM 2146, complete genome 107081-107112 10 0.688
CP032143_2 2.46|2202591|32|CP032143|CRISPRCasFinder,CRT 2202591-2202622 32 CP013734 Campylobacter coli strain OR12 plasmid pOR12Vir, complete sequence 13777-13808 10 0.688
CP032143_2 2.49|2199951|32|CP032143|PILER-CR 2199951-2199982 32 MK721192 Enterococcus phage vB_EfaM_Ef2.3, complete genome 93203-93234 10 0.688
CP032143_2 2.49|2199951|32|CP032143|PILER-CR 2199951-2199982 32 MN694760 Marine virus AFVG_250M661, complete genome 46761-46792 10 0.688
CP032143_2 2.49|2199951|32|CP032143|PILER-CR 2199951-2199982 32 NC_009904 Enterococcus phage phiEF24C, complete genome 51510-51541 10 0.688
CP032143_2 2.49|2199951|32|CP032143|PILER-CR 2199951-2199982 32 AP009390 Enterococcus phage phiEF24C DNA, complete genome 51510-51541 10 0.688
CP032143_2 2.49|2199951|32|CP032143|PILER-CR 2199951-2199982 32 AB609718 Enterococcus phage phiEF24C-P2 DNA, complete genome 51510-51541 10 0.688
CP032143_2 2.53|2200191|32|CP032143|PILER-CR 2200191-2200222 32 MN693005 Marine virus AFVG_117M50, complete genome 31912-31943 10 0.688
CP032143_2 2.63|2200793|32|CP032143|PILER-CR 2200793-2200824 32 NZ_CP017672 Providencia rettgeri strain RB151 plasmid pRB151-NDM, complete sequence 20736-20767 10 0.688
CP032143_2 2.72|2201333|32|CP032143|PILER-CR 2201333-2201364 32 MN865127 Vibrio alginolyticus strain C1579 plasmid pC1579, complete sequence 128989-129020 10 0.688
CP032143_2 2.75|2201513|32|CP032143|PILER-CR 2201513-2201544 32 NC_041966 Acinetobacter phage WCHABP1, complete genome 24546-24577 10 0.688
CP032143_2 2.75|2201513|32|CP032143|PILER-CR 2201513-2201544 32 KY670595 Acinetobacter phage WCHABP12, complete genome 36318-36349 10 0.688
CP032143_2 2.76|2201573|32|CP032143|PILER-CR 2201573-2201604 32 NZ_CP011490 Staphylococcus pseudintermedius strain 222 plasmid p222, complete sequence 2947-2978 10 0.688
CP032143_2 2.77|2201633|32|CP032143|PILER-CR 2201633-2201664 32 NC_020292 Clostridium saccharoperbutylacetonicum N1-4(HMT) plasmid Csp_135p, complete sequence 27897-27928 10 0.688
CP032143_2 2.78|2201693|32|CP032143|PILER-CR 2201693-2201724 32 NZ_CP051207 Dolichospermum flos-aquae CCAP 1403/13F plasmid pAfl69, complete sequence 25916-25947 10 0.688
CP032143_2 2.78|2201693|32|CP032143|PILER-CR 2201693-2201724 32 MH333064 Klebsiella phage Mineola, complete genome 9042-9073 10 0.688
CP032143_2 2.78|2201693|32|CP032143|PILER-CR 2201693-2201724 32 MN101226 Klebsiella phage KPN2 HKu-2019, complete genome 55852-55883 10 0.688
CP032143_2 2.78|2201693|32|CP032143|PILER-CR 2201693-2201724 32 NC_031095 Klebsiella phage PKO111, complete genome 99668-99699 10 0.688
CP032143_2 2.78|2201693|32|CP032143|PILER-CR 2201693-2201724 32 MN434095 Klebsiella pneumoniae phage JIPh_Kp122, complete genome 165028-165059 10 0.688
CP032143_2 2.78|2201693|32|CP032143|PILER-CR 2201693-2201724 32 MN101230 Klebsiella phage KPN6, complete genome 80640-80671 10 0.688
CP032143_2 2.78|2201693|32|CP032143|PILER-CR 2201693-2201724 32 KY000080 Klebsiella phage KPV15, complete genome 18563-18594 10 0.688
CP032143_2 2.78|2201693|32|CP032143|PILER-CR 2201693-2201724 32 MG751100 Klebsiella phage KP1, complete genome 166586-166617 10 0.688
CP032143_2 2.78|2201693|32|CP032143|PILER-CR 2201693-2201724 32 NC_028686 Klebsiella phage JD18, complete genome 164823-164854 10 0.688
CP032143_2 2.78|2201693|32|CP032143|PILER-CR 2201693-2201724 32 MK421971 Klebsiella phage vB_KpnM_GF, partial genome 160325-160356 10 0.688
CP032143_2 2.78|2201693|32|CP032143|PILER-CR 2201693-2201724 32 NC_031087 Klebsiella phage vB_KpnM_KpV477, complete genome 8716-8747 10 0.688
CP032143_2 2.79|2201753|32|CP032143|PILER-CR 2201753-2201784 32 MN694417 Marine virus AFVG_250M100, complete genome 28715-28746 10 0.688
CP032143_2 2.83|2201993|32|CP032143|PILER-CR 2201993-2202024 32 MN478483 Klebsiella virus UPM 2146, complete genome 107081-107112 10 0.688
CP032143_2 2.93|2202593|32|CP032143|PILER-CR 2202593-2202624 32 CP013734 Campylobacter coli strain OR12 plasmid pOR12Vir, complete sequence 13777-13808 10 0.688
CP032143_2 2.25|2201331|32|CP032143|CRISPRCasFinder,CRT 2201331-2201362 32 NC_027341 Lactococcus phage WRP3, complete genome 40101-40132 11 0.656
CP032143_2 2.44|2202471|32|CP032143|CRISPRCasFinder,CRT 2202471-2202502 32 MN692986 Marine virus AFVG_117M62, complete genome 22282-22313 11 0.656
CP032143_2 2.72|2201333|32|CP032143|PILER-CR 2201333-2201364 32 NC_027341 Lactococcus phage WRP3, complete genome 40101-40132 11 0.656
CP032143_2 2.91|2202473|32|CP032143|PILER-CR 2202473-2202504 32 MN692986 Marine virus AFVG_117M62, complete genome 22282-22313 11 0.656

1. spacer 1.15|2047162|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MH617262 (Inoviridae sp. isolate ctcg5, complete genome) position: , mismatch: 1, identity: 0.969

tcttcctcttcatctctaagtctaactgtcgt	CRISPR spacer
tcttcctcttcatctctaagtctaactgtggt	Protospacer
***************************** **

2. spacer 2.6|2200189|32|CP032143|CRISPRCasFinder,CRT matches to NZ_MK715471 (Arcobacter cryaerophilus strain M830MA plasmid pM830MA, complete sequence) position: , mismatch: 4, identity: 0.875

tttacaa-atatttacaattattttcataaatt	CRISPR spacer
-ttataatatatttacaattctttttataaatt	Protospacer
 ***.** ************ ****.*******

3. spacer 2.53|2200191|32|CP032143|PILER-CR matches to NZ_MK715471 (Arcobacter cryaerophilus strain M830MA plasmid pM830MA, complete sequence) position: , mismatch: 4, identity: 0.875

tttacaa-atatttacaattattttcataaatt	CRISPR spacer
-ttataatatatttacaattctttttataaatt	Protospacer
 ***.** ************ ****.*******

4. spacer 1.31|2048122|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

aaatatctaactgaaaaatacggtgaaattca--	CRISPR spacer
aaatatctaaaggaaaaatacg--gaaatccgct	Protospacer
**********  **********  *****.*.  

5. spacer 2.6|2200189|32|CP032143|CRISPRCasFinder,CRT matches to NZ_CP026551 (Citrobacter sp. SL156 plasmid unnamed2) position: , mismatch: 6, identity: 0.812

tttacaa-atatttacaattattttcataaatt	CRISPR spacer
-tgataataaatttacatttatttacataaatt	Protospacer
 * *.** * ******* ****** ********

6. spacer 2.6|2200189|32|CP032143|CRISPRCasFinder,CRT matches to NZ_CP017222 (Escherichia coli strain FAM21845 plasmid pFAM21845_2, complete sequence) position: , mismatch: 6, identity: 0.812

tttacaa-atatttacaattattttcataaatt	CRISPR spacer
-tgataataaatttacatttatttacataaatt	Protospacer
 * *.** * ******* ****** ********

7. spacer 2.6|2200189|32|CP032143|CRISPRCasFinder,CRT matches to NC_019013 (Escherichia coli strain G3/10 plasmid pSYM1, complete sequence) position: , mismatch: 6, identity: 0.812

tttacaa-atatttacaattattttcataaatt	CRISPR spacer
-tgataataaatttacatttatttacataaatt	Protospacer
 * *.** * ******* ****** ********

8. spacer 2.6|2200189|32|CP032143|CRISPRCasFinder,CRT matches to CP052139 (Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-1, complete sequence) position: , mismatch: 6, identity: 0.812

tttacaa-atatttacaattattttcataaatt	CRISPR spacer
-tgataataaatttacatttatttacataaatt	Protospacer
 * *.** * ******* ****** ********

9. spacer 2.6|2200189|32|CP032143|CRISPRCasFinder,CRT matches to NC_019254 (Shigella sp. MO17 plasmid pMO17_54, complete sequence) position: , mismatch: 6, identity: 0.812

tttacaa-atatttacaattattttcataaatt	CRISPR spacer
-tgataataaatttacatttatttacataaatt	Protospacer
 * *.** * ******* ****** ********

10. spacer 2.6|2200189|32|CP032143|CRISPRCasFinder,CRT matches to MN699848 (Citrobacter pasteurii strain 175G8 plasmid pCfr-OXA-198, complete sequence) position: , mismatch: 6, identity: 0.812

tttacaa-atatttacaattattttcataaatt	CRISPR spacer
-tgataataaatttacatttatttacataaatt	Protospacer
 * *.** * ******* ****** ********

11. spacer 2.6|2200189|32|CP032143|CRISPRCasFinder,CRT matches to NZ_CP049048 (Enterobacter hormaechei strain Y233 plasmid p233-142, complete sequence) position: , mismatch: 6, identity: 0.812

tttacaa-atatttacaattattttcataaatt	CRISPR spacer
-tgataataaatttacatttatttacataaatt	Protospacer
 * *.** * ******* ****** ********

12. spacer 2.26|2201391|32|CP032143|CRISPRCasFinder,CRT matches to NZ_CP031069 (Bacillus sp. JAS24-2 plasmid pl626, complete sequence) position: , mismatch: 6, identity: 0.812

atcagcagaatagaatagaaacaattgaaata	CRISPR spacer
atctataaaatagaaaagaaacaattgaaatg	Protospacer
*** ..*.******* ***************.

13. spacer 2.26|2201391|32|CP032143|CRISPRCasFinder,CRT matches to NZ_CP014283 (Bacillus thuringiensis strain Bt185 plasmid pBT1850636, complete sequence) position: , mismatch: 6, identity: 0.812

atcagcagaatagaatagaaacaattgaaata	CRISPR spacer
atctataaaatagaaatgaaacaattgaaata	Protospacer
*** ..*.*******  ***************

14. spacer 2.26|2201391|32|CP032143|CRISPRCasFinder,CRT matches to NZ_CP032614 (Bacillus thuringiensis strain QZL38 plasmid p.1, complete sequence) position: , mismatch: 6, identity: 0.812

atcagcagaatagaatagaaacaattgaaata	CRISPR spacer
atctataaaatagaaatgaaacaattgaaata	Protospacer
*** ..*.*******  ***************

15. spacer 2.26|2201391|32|CP032143|CRISPRCasFinder,CRT matches to NZ_CP053657 (Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence) position: , mismatch: 6, identity: 0.812

atcagcagaatagaatagaaacaattgaaata	CRISPR spacer
atctataaaatagaaatgaaacaattgaaata	Protospacer
*** ..*.*******  ***************

16. spacer 2.31|2201691|32|CP032143|CRISPRCasFinder,CRT matches to AP014070 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C2-MedDCM-OCT-S42-C71, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.812

caaatatacttaacagtaaaattgatatagtt	CRISPR spacer
caaatatacttaacagtaaaattgctgatgga	Protospacer
************************ *.  *  

17. spacer 2.31|2201691|32|CP032143|CRISPRCasFinder,CRT matches to AP014069 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C2-MedDCM-OCT-S40-C35, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.812

caaatatacttaacagtaaaattgatatagtt	CRISPR spacer
caaatatacttaacagtaaaattgctgatgga	Protospacer
************************ *.  *  

18. spacer 2.53|2200191|32|CP032143|PILER-CR matches to NZ_CP026551 (Citrobacter sp. SL156 plasmid unnamed2) position: , mismatch: 6, identity: 0.812

tttacaa-atatttacaattattttcataaatt	CRISPR spacer
-tgataataaatttacatttatttacataaatt	Protospacer
 * *.** * ******* ****** ********

19. spacer 2.53|2200191|32|CP032143|PILER-CR matches to NZ_CP017222 (Escherichia coli strain FAM21845 plasmid pFAM21845_2, complete sequence) position: , mismatch: 6, identity: 0.812

tttacaa-atatttacaattattttcataaatt	CRISPR spacer
-tgataataaatttacatttatttacataaatt	Protospacer
 * *.** * ******* ****** ********

20. spacer 2.53|2200191|32|CP032143|PILER-CR matches to NC_019013 (Escherichia coli strain G3/10 plasmid pSYM1, complete sequence) position: , mismatch: 6, identity: 0.812

tttacaa-atatttacaattattttcataaatt	CRISPR spacer
-tgataataaatttacatttatttacataaatt	Protospacer
 * *.** * ******* ****** ********

21. spacer 2.53|2200191|32|CP032143|PILER-CR matches to CP052139 (Klebsiella pneumoniae strain F17KP0040 plasmid pF17KP0040-1, complete sequence) position: , mismatch: 6, identity: 0.812

tttacaa-atatttacaattattttcataaatt	CRISPR spacer
-tgataataaatttacatttatttacataaatt	Protospacer
 * *.** * ******* ****** ********

22. spacer 2.53|2200191|32|CP032143|PILER-CR matches to NC_019254 (Shigella sp. MO17 plasmid pMO17_54, complete sequence) position: , mismatch: 6, identity: 0.812

tttacaa-atatttacaattattttcataaatt	CRISPR spacer
-tgataataaatttacatttatttacataaatt	Protospacer
 * *.** * ******* ****** ********

23. spacer 2.53|2200191|32|CP032143|PILER-CR matches to MN699848 (Citrobacter pasteurii strain 175G8 plasmid pCfr-OXA-198, complete sequence) position: , mismatch: 6, identity: 0.812

tttacaa-atatttacaattattttcataaatt	CRISPR spacer
-tgataataaatttacatttatttacataaatt	Protospacer
 * *.** * ******* ****** ********

24. spacer 2.53|2200191|32|CP032143|PILER-CR matches to NZ_CP049048 (Enterobacter hormaechei strain Y233 plasmid p233-142, complete sequence) position: , mismatch: 6, identity: 0.812

tttacaa-atatttacaattattttcataaatt	CRISPR spacer
-tgataataaatttacatttatttacataaatt	Protospacer
 * *.** * ******* ****** ********

25. spacer 2.73|2201393|32|CP032143|PILER-CR matches to NZ_CP031069 (Bacillus sp. JAS24-2 plasmid pl626, complete sequence) position: , mismatch: 6, identity: 0.812

atcagcagaatagaatagaaacaattgaaata	CRISPR spacer
atctataaaatagaaaagaaacaattgaaatg	Protospacer
*** ..*.******* ***************.

26. spacer 2.73|2201393|32|CP032143|PILER-CR matches to NZ_CP014283 (Bacillus thuringiensis strain Bt185 plasmid pBT1850636, complete sequence) position: , mismatch: 6, identity: 0.812

atcagcagaatagaatagaaacaattgaaata	CRISPR spacer
atctataaaatagaaatgaaacaattgaaata	Protospacer
*** ..*.*******  ***************

27. spacer 2.73|2201393|32|CP032143|PILER-CR matches to NZ_CP032614 (Bacillus thuringiensis strain QZL38 plasmid p.1, complete sequence) position: , mismatch: 6, identity: 0.812

atcagcagaatagaatagaaacaattgaaata	CRISPR spacer
atctataaaatagaaatgaaacaattgaaata	Protospacer
*** ..*.*******  ***************

28. spacer 2.73|2201393|32|CP032143|PILER-CR matches to NZ_CP053657 (Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence) position: , mismatch: 6, identity: 0.812

atcagcagaatagaatagaaacaattgaaata	CRISPR spacer
atctataaaatagaaatgaaacaattgaaata	Protospacer
*** ..*.*******  ***************

29. spacer 2.78|2201693|32|CP032143|PILER-CR matches to AP014070 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C2-MedDCM-OCT-S42-C71, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.812

caaatatacttaacagtaaaattgatatagtt	CRISPR spacer
caaatatacttaacagtaaaattgctgatgga	Protospacer
************************ *.  *  

30. spacer 2.78|2201693|32|CP032143|PILER-CR matches to AP014069 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C2-MedDCM-OCT-S40-C35, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.812

caaatatacttaacagtaaaattgatatagtt	CRISPR spacer
caaatatacttaacagtaaaattgctgatgga	Protospacer
************************ *.  *  

31. spacer 1.11|2046922|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050185 (Bacillus thuringiensis strain HER1410 plasmid pLUSID2, complete sequence) position: , mismatch: 7, identity: 0.781

atttaaaattcaaatagttcaaattgagggaa	CRISPR spacer
aatgcaccttcaaatacttcaaattgaaggaa	Protospacer
* *  *  ******** **********.****

32. spacer 1.21|2047522|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030128 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

gtttaccgcgccaaccgcccgcagctttaata	CRISPR spacer
gatcaccgcgccgaccgcccgcagccttgcga	Protospacer
* *.********.************.**.  *

33. spacer 1.35|2048362|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012423 (Spiroplasma kunkelii CR2-3x plasmid pSKU226, complete sequence) position: , mismatch: 7, identity: 0.781

--tcaactcagataatattgatataagttttgat	CRISPR spacer
ttttaaat--aataatattgctattagttttgat	Protospacer
  *.** *  .********* *** *********

34. spacer 2.6|2200189|32|CP032143|CRISPRCasFinder,CRT matches to AP013427 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G16, isolate: uvMED-CGR-C57A-MedDCM-OCT-S25-C28) position: , mismatch: 7, identity: 0.781

---tttacaaatatttacaattattttcataaatt	CRISPR spacer
aactttgt---tatttacttttattttcataaatt	Protospacer
   ***..   *******  ***************

35. spacer 2.6|2200189|32|CP032143|CRISPRCasFinder,CRT matches to NC_021803 (Cellulophaga phage phi13:2, complete genome) position: , mismatch: 7, identity: 0.781

tttacaaatatttacaattattttcataaatt	CRISPR spacer
tttacaaatatttacatatatttgaactcatt	Protospacer
****************  *****  *.  ***

36. spacer 2.6|2200189|32|CP032143|CRISPRCasFinder,CRT matches to AP013428 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G16, isolate: uvMED-CGR-C57A-MedDCM-OCT-S39-C32) position: , mismatch: 7, identity: 0.781

---tttacaaatatttacaattattttcataaatt	CRISPR spacer
aactttgt---tatttacttttattttcataaatt	Protospacer
   ***..   *******  ***************

37. spacer 2.46|2202591|32|CP032143|CRISPRCasFinder,CRT matches to KX912252 (Pseudoalteromonas phage PHS3, complete genome) position: , mismatch: 7, identity: 0.781

attaaaatgaacgaattaagaaagaagtttga	CRISPR spacer
tttaaaatgaatgaattaaaaaaggaatctaa	Protospacer
 **********.*******.****.*.*.*.*

38. spacer 2.53|2200191|32|CP032143|PILER-CR matches to AP013427 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G16, isolate: uvMED-CGR-C57A-MedDCM-OCT-S25-C28) position: , mismatch: 7, identity: 0.781

---tttacaaatatttacaattattttcataaatt	CRISPR spacer
aactttgt---tatttacttttattttcataaatt	Protospacer
   ***..   *******  ***************

39. spacer 2.53|2200191|32|CP032143|PILER-CR matches to NC_021803 (Cellulophaga phage phi13:2, complete genome) position: , mismatch: 7, identity: 0.781

tttacaaatatttacaattattttcataaatt	CRISPR spacer
tttacaaatatttacatatatttgaactcatt	Protospacer
****************  *****  *.  ***

40. spacer 2.53|2200191|32|CP032143|PILER-CR matches to AP013428 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G16, isolate: uvMED-CGR-C57A-MedDCM-OCT-S39-C32) position: , mismatch: 7, identity: 0.781

---tttacaaatatttacaattattttcataaatt	CRISPR spacer
aactttgt---tatttacttttattttcataaatt	Protospacer
   ***..   *******  ***************

41. spacer 2.93|2202593|32|CP032143|PILER-CR matches to KX912252 (Pseudoalteromonas phage PHS3, complete genome) position: , mismatch: 7, identity: 0.781

attaaaatgaacgaattaagaaagaagtttga	CRISPR spacer
tttaaaatgaatgaattaaaaaaggaatctaa	Protospacer
 **********.*******.****.*.*.*.*

42. spacer 1.3|2046441|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030854 (Runella sp. HYN0085 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75

tatcctgtatctctttttggctgtgttcaaaa	CRISPR spacer
tttcctgtatgtttttttggctgtgtcattag	Protospacer
* ******** *.*************.   *.

43. spacer 1.5|2046562|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to NC_010627 (Paraburkholderia phymatum STM815 plasmid pBPHY02, complete sequence) position: , mismatch: 8, identity: 0.75

gaccaacggcacagcagggtcgccgtggtaaa	CRISPR spacer
gcaagaccgcccagcagggtcgccgtggtcac	Protospacer
*   .** ** ****************** * 

44. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MK719709 (Rheinheimera phage vB_RspM_Barba5A, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

45. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MK719748 (Rheinheimera phage vB_RspM_Barba29S, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

46. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497264 (Rheinheimera phage vB_RspM_barba12-8G, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

47. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MK719716 (Rheinheimera phage vB_RspM_Barba10A, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

48. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497235 (Rheinheimera phage vB_RspM_barba10-9H, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

49. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497268 (Rheinheimera phage vB_RspM_barba12-9B, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

50. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497226 (Rheinheimera phage vB_RspM_barba10-8B, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

51. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MK719713 (Rheinheimera phage vB_RspM_Barba8A, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

52. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497239 (Rheinheimera phage vB_RspM_barba12-6A, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

53. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497232 (Rheinheimera phage vB_RspM_barba10-9E, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

54. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MK719753 (Rheinheimera phage vB_RspM_Barba34A, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

55. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497261 (Rheinheimera phage vB_RspM_barba12-8C, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

56. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497273 (Rheinheimera phage vB_RspM_barba12-9G, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

57. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MK719746 (Rheinheimera phage vB_RspM_Barba28S, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

58. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497255 (Rheinheimera phage vB_RspM_barba12-7G, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

59. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MK719734 (Rheinheimera phage vB_RspM_Barba21S, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

60. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497254 (Rheinheimera phage vB_RspM_barba12-7F, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

61. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497238 (Rheinheimera phage vB_RspM_barba11-8A, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

62. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MK719744 (Rheinheimera phage vB_RspM_Barba27S, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

63. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MK719717 (Rheinheimera phage vB_RspM_Barba10S, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

64. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497256 (Rheinheimera phage vB_RspM_barba12-7H, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

65. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MK719732 (Rheinheimera phage vB_RspM_Barba20S, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

66. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497247 (Rheinheimera phage vB_RspM_barba12-6I, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

67. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497263 (Rheinheimera phage vB_RspM_barba12-8F, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

68. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497242 (Rheinheimera phage vB_RspM_barba12-6D, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

69. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497246 (Rheinheimera phage vB_RspM_barba12-6H, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

70. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MK719711 (Rheinheimera phage vB_RspM_Barba6A, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

71. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497260 (Rheinheimera phage vB_RspM_barba12-8B, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

72. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497278 (Rheinheimera phage vB_RspM_barba13-8A, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

73. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497250 (Rheinheimera phage vB_RspM_barba12-7B, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

74. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MK719750 (Rheinheimera phage vB_RspM_Barba31A, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

75. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MK719727 (Rheinheimera phage vB_RspM_Barba17A, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

76. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MK719743 (Rheinheimera phage vB_RspM_Barba26S, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

77. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MK719724 (Rheinheimera phage vB_RspM_Barba15A, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

78. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497276 (Rheinheimera phage vB_RspM_barba13-4A, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

79. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497234 (Rheinheimera phage vB_RspM_barba10-9G, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

80. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MK719708 (Rheinheimera phage vB_RspM_Barba4S, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

81. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497249 (Rheinheimera phage vB_RspM_barba12-7A, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

82. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to NC_048191 (Rheinheimera phage vB_RspM_Barba21A, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

83. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497269 (Rheinheimera phage vB_RspM_barba12-9C, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

84. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497272 (Rheinheimera phage vB_RspM_barba12-9F, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

85. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497248 (Rheinheimera phage vB_RspM_barba12-6J, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

86. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497225 (Rheinheimera phage vB_RspM_barba10-8A, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

87. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MK719725 (Rheinheimera phage vB_RspM_Barba15S, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

88. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MK719712 (Rheinheimera phage vB_RspM_Barba7A, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

89. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497274 (Rheinheimera phage vB_RspM_barba12-9I, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

90. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497228 (Rheinheimera phage vB_RspM_barba10-9A, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

91. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497271 (Rheinheimera phage vB_RspM_barba12-9E, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

92. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MK719704 (Rheinheimera phage vB_RspM_Barba2S, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

93. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497244 (Rheinheimera phage vB_RspM_barba12-6F, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

94. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MK719705 (Rheinheimera phage vB_RspM_Barba3A, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

95. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MK719706 (Rheinheimera phage vB_RspM_Barba3S, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

96. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to NC_048188 (Rheinheimera phage vB_RspM_Barba8S, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

97. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MK719735 (Rheinheimera phage vB_RspM_Barba22A, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

98. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MK719751 (Rheinheimera phage vB_RspM_Barba32A, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

99. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to NC_048189 (Rheinheimera phage vB_RspM_Barba18A, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

100. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MK719707 (Rheinheimera phage vB_RspM_Barba4A, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

101. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497277 (Rheinheimera phage vB_RspM_barba13-6A, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

102. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MK719721 (Rheinheimera phage vB_RspM_Barba13A, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

103. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497233 (Rheinheimera phage vB_RspM_barba10-9F, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

104. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497257 (Rheinheimera phage vB_RspM_barba12-7I, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

105. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MK719701 (Rheinheimera phage vB_RspM_Barba1A, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

106. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MK719722 (Rheinheimera phage vB_RspM_Barba14A, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

107. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497241 (Rheinheimera phage vB_RspM_barba12-6C, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

108. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497252 (Rheinheimera phage vB_RspM_barba12-7D, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

109. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497227 (Rheinheimera phage vB_RspM_barba10-8D, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

110. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MK719738 (Rheinheimera phage vB_RspM_Barba23S, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

111. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MK719737 (Rheinheimera phage vB_RspM_Barba23A, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

112. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MK719703 (Rheinheimera phage vB_RspM_Barba2A, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

113. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497266 (Rheinheimera phage vB_RspM_barba12-8I, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

114. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MK719739 (Rheinheimera phage vB_RspM_Barba24S, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

115. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497270 (Rheinheimera phage vB_RspM_barba12-9D, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

116. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MK719715 (Rheinheimera phage vB_RspM_Barba9A, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

117. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MK719741 (Rheinheimera phage vB_RspM_Barba25S, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

118. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497240 (Rheinheimera phage vB_RspM_barba12-6B, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

119. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MK719754 (Rheinheimera phage vB_RspM_Barba35A, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

120. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MK719720 (Rheinheimera phage vB_RspM_Barba12S, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

121. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MK719749 (Rheinheimera phage vB_RspM_Barba30A, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

122. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MK719752 (Rheinheimera phage vB_RspM_Barba33A, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

123. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MK719728 (Rheinheimera phage vB_RspM_Barba17S, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

124. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497253 (Rheinheimera phage vB_RspM_barba12-7E, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

125. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497258 (Rheinheimera phage vB_RspM_barba12-7J, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

126. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MK719702 (Rheinheimera phage vB_RspM_Barba1S, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

127. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497229 (Rheinheimera phage vB_RspM_barba10-9B, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

128. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to NC_048190 (Rheinheimera phage vB_RspM_Barba19A, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

129. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MK719718 (Rheinheimera phage vB_RspM_Barba11S, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

130. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MK719719 (Rheinheimera phage vB_RspM_Barba12A, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

131. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MK719745 (Rheinheimera phage vB_RspM_Barba28A, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

132. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497230 (Rheinheimera phage vB_RspM_barba10-9C, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

133. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497251 (Rheinheimera phage vB_RspM_barba12-7C, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

134. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MK719740 (Rheinheimera phage vB_RspM_Barba25A, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

135. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to NC_048187 (Rheinheimera phage vB_RspM_Barba5S, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

136. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MK719726 (Rheinheimera phage vB_RspM_Barba16S, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

137. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497259 (Rheinheimera phage vB_RspM_barba12-8A, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

138. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497267 (Rheinheimera phage vB_RspM_barba12-9A, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

139. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497237 (Rheinheimera phage vB_RspM_barba10-9J, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

140. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MK719742 (Rheinheimera phage vB_RspM_Barba26A, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

141. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497275 (Rheinheimera phage vB_RspM_barba12-9J, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

142. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MK719736 (Rheinheimera phage vB_RspM_Barba22S, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

143. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497224 (Rheinheimera phage vB_RspM_barba1-3A, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

144. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497236 (Rheinheimera phage vB_RspM_barba10-9I, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

145. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497245 (Rheinheimera phage vB_RspM_barba12-6G, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

146. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497262 (Rheinheimera phage vB_RspM_barba12-8E, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

147. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497243 (Rheinheimera phage vB_RspM_barba12-6E, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

148. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MK719747 (Rheinheimera phage vB_RspM_Barba29A, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

149. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497265 (Rheinheimera phage vB_RspM_barba12-8H, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

150. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497279 (Rheinheimera phage vB_RspM_barba5-7A, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

151. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MK719723 (Rheinheimera phage vB_RspM_Barba14S, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

152. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MT497231 (Rheinheimera phage vB_RspM_barba10-9D, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

153. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MK719731 (Rheinheimera phage vB_RspM_Barba20A, complete genome) position: , mismatch: 8, identity: 0.75

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
tcatcaatctcacttactaaaaaatcatccat	Protospacer
 . ***   *** *************** ***

154. spacer 1.11|2046922|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP017918 (Candidatus Azobacteroides pseudotrichonymphae plasmid pAPPJ4 DNA, complete sequence, phylotype ProJPt-1) position: , mismatch: 8, identity: 0.75

atttaaaattcaaatagttcaaattgagggaa	CRISPR spacer
ttttaaatttcaaataattcaaattgttttac	Protospacer
 ****** ********.*********    * 

155. spacer 1.11|2046922|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MK448940 (Streptococcus phage Javan444, complete genome) position: , mismatch: 8, identity: 0.75

atttaaaattcaaatagttcaaattgagggaa	CRISPR spacer
aagtattgttcaaatatttcaaattgacggat	Protospacer
*  **  .******** ********** *** 

156. spacer 1.26|2047822|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MN855763 (Myoviridae sp. isolate 210, complete genome) position: , mismatch: 8, identity: 0.75

atcagatgagaaatgcaatcggtcaggctaaa	CRISPR spacer
agcaaatgataaatgcaatcggtcaacaaaat	Protospacer
* **.**** ***************.   ** 

157. spacer 1.31|2048122|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to JQ680349 (Unidentified phage clone 1013_scaffold24 genomic sequence) position: , mismatch: 8, identity: 0.75

aaatatctaactgaaaaatacggtgaaattca	CRISPR spacer
aaatatctaattgaaaaatccgggaagaattg	Protospacer
**********.******** *** .*.* *..

158. spacer 1.36|2048422|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to NC_031922 (Synechococcus phage S-CAM9 isolate 1109NB16, complete genome) position: , mismatch: 8, identity: 0.75

gcacaccgtgtttccgtggctcattttcaact	CRISPR spacer
gaccatgaagtttccatggctcattctcaact	Protospacer
*  **. . ******.*********.******

159. spacer 1.36|2048422|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to KU686204 (Synechococcus phage S-CAM9 isolate 0808SB05, complete genome) position: , mismatch: 8, identity: 0.75

gcacaccgtgtttccgtggctcattttcaact	CRISPR spacer
gaccatgaagtttccatggctcattctcaact	Protospacer
*  **. . ******.*********.******

160. spacer 1.36|2048422|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to KU686205 (Synechococcus phage S-CAM9 isolate 0908SB82, complete genome) position: , mismatch: 8, identity: 0.75

gcacaccgtgtttccgtggctcattttcaact	CRISPR spacer
gaccatgaagtttccatggctcattctcaact	Protospacer
*  **. . ******.*********.******

161. spacer 1.37|2048482|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020948 (Rhizobium sp. CIAT894 plasmid pRheCIAT894a, complete sequence) position: , mismatch: 8, identity: 0.75

tcacaaacaatcttgaggctatctactgtatt	CRISPR spacer
ccagaaacgatcttgaggctatctccggaagc	Protospacer
.** ****.*************** * * * .

162. spacer 1.39|2048602|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MN480762 (Streptococcus salivarius strain NU10 plasmid pSsal-NU10, complete sequence) position: , mismatch: 8, identity: 0.75

ggtggtgtgtctggttacattgatattcataa	CRISPR spacer
gtaaatttatctggttccattgatattgataa	Protospacer
*  ..* *.******* ********** ****

163. spacer 2.5|2200129|32|CP032143|CRISPRCasFinder,CRT matches to NC_047805 (Yersinia phage fHe-Yen3-01, complete genome) position: , mismatch: 8, identity: 0.75

ggaatattaactaaatcagagcaaaagaaaca	CRISPR spacer
cgtgccttaactaaatcagaggtaaagaaata	Protospacer
 * .. ***************  *******.*

164. spacer 2.6|2200189|32|CP032143|CRISPRCasFinder,CRT matches to AY766464 (Lactococcus phage TP712, complete sequence) position: , mismatch: 8, identity: 0.75

tttacaaatatttacaattattttcataaatt	CRISPR spacer
tttagaaatatttacaaatatttttaaagcgg	Protospacer
**** ************ ******.* *.   

165. spacer 2.6|2200189|32|CP032143|CRISPRCasFinder,CRT matches to KC821622 (Cellulophaga phage phi46:3, complete genome) position: , mismatch: 8, identity: 0.75

tttacaaatatttacaattattttcataaatt	CRISPR spacer
tttacaaatatttacatatatttgaactcaat	Protospacer
****************  *****  *.  * *

166. spacer 2.6|2200189|32|CP032143|CRISPRCasFinder,CRT matches to NC_021794 (Cellulophaga phage phi18:3, complete genome) position: , mismatch: 8, identity: 0.75

tttacaaatatttacaattattttcataaatt	CRISPR spacer
tttacaaatatttacatatatttgaactcaat	Protospacer
****************  *****  *.  * *

167. spacer 2.6|2200189|32|CP032143|CRISPRCasFinder,CRT matches to NC_005006 (Staphylococcus epidermidis ATCC 12228 plasmid pSE-12228-03, complete sequence) position: , mismatch: 8, identity: 0.75

tttacaaat---atttacaattattttcataaatt	CRISPR spacer
---ataggttgaatttacaagtattttcattaatt	Protospacer
   *.*..*   ******** ********* ****

168. spacer 2.6|2200189|32|CP032143|CRISPRCasFinder,CRT matches to MN693193 (Marine virus AFVG_25M440, complete genome) position: , mismatch: 8, identity: 0.75

tttacaaatatttacaattattttcataaatt	CRISPR spacer
gttacaaatatttataagtattttagtatggt	Protospacer
 *************.** ****** .** . *

169. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to LN881734 (Escherichia phage slur11, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

170. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to AP018814 (Enterobacteria phage T6 DNA, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

171. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MN895435 (Escherichia phage teqhal, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

172. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MG781191 (Escherichia phage vB_EcoM-fHoEco02, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

173. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MT764206 (Escherichia phage JEP6, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

174. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MN895437 (Escherichia phage teqskov, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

175. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MH837626 (Escherichia phage vB_vPM_PD112, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

176. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MN716856 (Yersinia phage vB_YepM_ZN18, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

177. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to KY290975 (Escherichia phage YUEEL01, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

178. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to NC_019399 (Enterobacteria phage vB_EcoM_ACG-C40, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

179. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to KM606997 (Enterobacteria phage RB7, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

180. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to LN881736 (Escherichia phage slur14, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

181. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to KU925172 (Escherichia phage PE37, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

182. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MH051915 (Enterobacteria phage vB_EcoM_IME339, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

183. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to LR215722 (Yersinia phage fPS-2 genome assembly, chromosome: I) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

184. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to NC_025449 (Escherichia phage ECML-134, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

185. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MH751506 (Escherichia phage T2, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

186. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to X00769 (Bacteriophage T4 genes 45, 44, 62, regA, 43 (5' end)) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

187. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to NC_042129 (Escherichia phage slur03, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

188. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MH809535 (Yersinia phage PYPS2T, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

189. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to NC_042077 (Shigella phage Sf21, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

190. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to LN881732 (Escherichia phage slur07, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

191. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MN508618 (UNVERIFIED: Escherichia phage ES26, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

192. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to KM607002 (Enterobacteria phage RB55, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

193. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to KY608967 (UNVERIFIED: Escherichia phage CF2, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

194. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MF001354 (Salmonella phage SG1, partial genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

195. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MT176425 (Citrobacter phage PhiZZ23, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

196. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to NC_042039 (Shigella phage Sf22, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

197. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MF327009 (Shigella phage Sf25, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

198. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to AP018813 (Enterobacteria phage T2 DNA, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

199. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MN580668 (Salmonella phage pSe_SNUABM_01, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

200. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MK373781 (Escherichia phage vB_EcoM_KAW1E185, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

201. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to NC_025829 (Shigella phage pSs-1, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

202. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to LN881737 (Escherichia phage slur13, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

203. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to LR597657 (Escherichia phage T4_ev240 genome assembly, chromosome: 1) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

204. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to NC_030953 (Shigella phage SHFML-11, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

205. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MN508614 (UNVERIFIED: Escherichia phage ES12, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

206. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to KJ477684 (Enterobacteria phage T4 strain wild, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

207. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MG781190 (Escherichia phage vB_EcoM-fFiEco06, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

208. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to LR215723 (Yersinia phage fPS-90 genome assembly, chromosome: I) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

209. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MH550421 (Enterobacteria phage T6, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

210. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to KM606996 (Enterobacteria phage RB6, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

211. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to AP018932 (Escherichia phage KIT03 DNA, complete sequence) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

212. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to NC_025448 (Enterobacteria phage RB27, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

213. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to KJ668714 (Escherichia phage e11/2, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

214. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to HM137666 (Enterobacteria phage T4T, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

215. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MN895438 (Escherichia phage teqdroes, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

216. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to KP869105 (Escherichia coli O157 typing phage 7, partial genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

217. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MF158046 (Shigella phage Sf23, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

218. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MN022785 (Escherichia virus VEc20, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

219. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MT682709 (Escherichia phage vB_EcoM_SP1, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

220. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to NC_000866 (Enterobacteria phage T4, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

221. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MT682714 (Escherichia phage vB_EcoM_Lutter, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

222. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to LR746311 (Shigella phage vB_SsoM_113 genome assembly, chromosome: 1) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

223. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MK962750 (Shigella phage CM8, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

224. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MH553563 (Enterobacteria phage RB18, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

225. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MN895436 (Escherichia phage teqsoen, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

226. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to KM606995 (Enterobacteria phage RB5, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

227. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MT682710 (Escherichia phage vB_EcoM_FT, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

228. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MG775043 (Citrobacter phage vB_CroM_CrRp10, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

229. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MN781580 (Shigella virus KRT47, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

230. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to LN881726 (Escherichia phage slur02, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

231. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MK373785 (Escherichia phage vB_EcoM_OE5505, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

232. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to NC_042078 (Shigella phage Sf24, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

233. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MH992121 (UNVERIFIED: Escherichia phage MLF4, partial genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

234. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MT682712 (Escherichia phage vB_EcoM_F1, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

235. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MK373779 (Escherichia phage vB_EcoM_G9062, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

236. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MT179807 (Escherichia phage vB_EcoM_IME537, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

237. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to KX828711 (Shigella phage SH7, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

238. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MN508616 (UNVERIFIED: Escherichia phage ES19, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

239. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to KJ477686 (Enterobacteria phage T4 strain GT7, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

240. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MT446387 (UNVERIFIED: Escherichia virus TH09, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

241. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MK327946 (Escherichia phage vB_EcoM_G4507, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

242. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MK327944 (Escherichia phage vB_EcoM_G2540-3, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

243. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to FJ839692 (Enterobacteria phage RB14, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

244. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to KX452694 (UNVERIFIED: Escherichia phage KPN1 genomic sequence) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

245. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MH355584 (Escherichia phage vB_EcoM_JB75, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

246. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to KM606994 (Enterobacteria phage RB3, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

247. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to M15080 (Bacteriophage T4 genes 45.1 (encoding RNA polymerase-binding protein) and 45.2) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

248. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to M10160 (Bacteriophage T4 genes 55, alpha-gt, 47, 46, 45, 44, 62, regA, and 43) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

249. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MK977694 (Escherichia phage vB_EcoM-Sa45lw, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

250. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to LR877332 (Shigella phage vB_SsoM_JK08 genome assembly, chromosome: 1) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

251. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to KX130862 (Shigella phage SHFML-26, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

252. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to KU867876 (Escherichia phage vB_EcoM-UFV13, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

253. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MK327929 (Escherichia phage D5505, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

254. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MK327936 (Escherichia phage vB_EcoM_G2540, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

255. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MK327939 (Escherichia phage vB_EcoM_G4498, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

256. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to NC_031030 (Escherichia phage UFV-AREG1, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

257. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MN508617 (UNVERIFIED: Escherichia phage ES21, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

258. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to FJ839693 (Enterobacteria phage RB51, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

259. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to KM607004 (Enterobacteria phage RB68, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

260. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MN994497 (Phage NBEco003, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

261. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MK962755 (Shigella phage JK38, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

262. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MH243439 (Escherichia phage vB_EcoM_NBG2, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

263. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MK327945 (Escherichia phage vB_EcoM_G4500, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

264. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MF001360 (Escherichia phage ECO4, partial genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

265. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to KJ477685 (Enterobacteria phage T4 strain 147, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

266. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MK886800 (Escherichia phage EcNP1, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

267. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to LR215724 (Yersinia phage fPS-65 genome assembly, chromosome: I) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

268. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MK327940 (Escherichia phage vB_EcoM_G29, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

269. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to LN881733 (Escherichia phage slur08, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

270. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to AP011113 (Enterobacteria phage AR1 DNA, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

271. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MK373786 (Escherichia phage vB_EcoM_R5505, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

272. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to LC348380 (Escherichia phage T2 DNA, complete sequence) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

273. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MT176424 (Citrobacter phage PhiZZ6, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

274. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to NC_027404 (Yersinia phage PST, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

275. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to NC_008515 (Bacteriophage RB32, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

276. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MK962752 (Shigella phage JK23, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

277. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to KT184312 (Enterobacteria phage Kha5h, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

278. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to HE956711 (Yersinia phage phiD1 complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

279. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MG867727 (Escherichia phage vB_EcoM-G28, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

280. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to KF925357 (Escherichia phage HY01, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

281. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to KR233165 (Escherichia phage PEC04, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

282. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to NC_015457 (Shigella phage Shfl2, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

283. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to KM607001 (Enterobacteria phage RB33, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

284. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to LC348379 (Escherichia phage PP01 DNA, complete sequence) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

285. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MK327942 (Escherichia phage vB_EcoM_G50, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

286. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MK327928 (Escherichia phage vB_EcoM_G2133, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

287. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MT176426 (Serratia phage PhiZZ30, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

288. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to KX452698 (UNVERIFIED: Shigella phage KPN5 genomic sequence) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

289. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to KT184308 (Enterobacteria phage Aplg8, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

290. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MK373787 (Escherichia phage vB_EcoM_G8, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

291. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to LR597660 (Escherichia phage T4_ev151 genome assembly, chromosome: 1) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

292. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MN895434 (Escherichia phage teqhad, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

293. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MH992510 (Escherichia phage vB_EcoM_DalCa, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

294. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to KM607003 (Enterobacteria phage RB59, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

295. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to LN881729 (Escherichia phage slur04, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

296. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to HM997020 (Escherichia phage wV7, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

297. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MH051916 (Enterobacteria phage vB_EcoM_IME340, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

298. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to MT932213 (Escherichia phage VEc74, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

299. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to JN202312 (Enterobacteria phage ime09, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

300. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to KM606999 (Enterobacteria phage RB10, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

301. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to KM606998 (Enterobacteria phage RB9, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

302. spacer 2.18|2200911|32|CP032143|CRISPRCasFinder,CRT matches to AP014358 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S39-C94, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.75

attctgtgcctgatagtgggattaaatatcca	CRISPR spacer
gttctgtgcctgattgtgtgattaataaactt	Protospacer
.************* *** ******  * *. 

303. spacer 2.28|2201511|32|CP032143|CRISPRCasFinder,CRT matches to NC_042028 (Acinetobacter phage AB1, complete genome) position: , mismatch: 8, identity: 0.75

gtgggtatgaccgcccgaaagtgggcaatttt	CRISPR spacer
aaaccgatgaccgcccgaaagtgggcaactta	Protospacer
. .   **********************.** 

304. spacer 2.33|2201811|32|CP032143|CRISPRCasFinder,CRT matches to KJ019135 (Synechococcus phage ACG-2014a isolate Syn7803C101, complete genome) position: , mismatch: 8, identity: 0.75

taaagatgctccaccacgcccaccaacataca	CRISPR spacer
ccaagatgctccaccacctccaccaatagaag	Protospacer
. *************** .*******.* * .

305. spacer 2.33|2201811|32|CP032143|CRISPRCasFinder,CRT matches to KJ019114 (Synechococcus phage ACG-2014a isolate Syn7803US60, complete genome) position: , mismatch: 8, identity: 0.75

taaagatgctccaccacgcccaccaacataca	CRISPR spacer
ccaagatgctccaccacctccaccaatagaag	Protospacer
. *************** .*******.* * .

306. spacer 2.33|2201811|32|CP032143|CRISPRCasFinder,CRT matches to KJ019138 (Synechococcus phage ACG-2014a isolate Syn7803C107, complete genome) position: , mismatch: 8, identity: 0.75

taaagatgctccaccacgcccaccaacataca	CRISPR spacer
ccaagatgctccaccacctccaccaatagaag	Protospacer
. *************** .*******.* * .

307. spacer 2.33|2201811|32|CP032143|CRISPRCasFinder,CRT matches to KJ019122 (Synechococcus phage ACG-2014a isolate Syn7803US79, complete genome) position: , mismatch: 8, identity: 0.75

taaagatgctccaccacgcccaccaacataca	CRISPR spacer
ccaagatgctccaccacctccaccaatagaag	Protospacer
. *************** .*******.* * .

308. spacer 2.33|2201811|32|CP032143|CRISPRCasFinder,CRT matches to KJ019055 (Synechococcus phage ACG-2014a isolate Syn7803C86, complete genome) position: , mismatch: 8, identity: 0.75

taaagatgctccaccacgcccaccaacataca	CRISPR spacer
ccaagatgctccaccacctccaccaatagaag	Protospacer
. *************** .*******.* * .

309. spacer 2.33|2201811|32|CP032143|CRISPRCasFinder,CRT matches to KJ019038 (Synechococcus phage ACG-2014a isolate Syn7803C59, complete genome) position: , mismatch: 8, identity: 0.75

taaagatgctccaccacgcccaccaacataca	CRISPR spacer
ccaagatgctccaccacctccaccaatagaag	Protospacer
. *************** .*******.* * .

310. spacer 2.33|2201811|32|CP032143|CRISPRCasFinder,CRT matches to KJ019068 (Synechococcus phage ACG-2014a isolate Syn7803US102, complete genome) position: , mismatch: 8, identity: 0.75

taaagatgctccaccacgcccaccaacataca	CRISPR spacer
ccaagatgctccaccacctccaccaatagaag	Protospacer
. *************** .*******.* * .

311. spacer 2.33|2201811|32|CP032143|CRISPRCasFinder,CRT matches to KJ019137 (Synechococcus phage ACG-2014a isolate Syn7803C104, complete genome) position: , mismatch: 8, identity: 0.75

taaagatgctccaccacgcccaccaacataca	CRISPR spacer
ccaagatgctccaccacctccaccaatagaag	Protospacer
. *************** .*******.* * .

312. spacer 2.33|2201811|32|CP032143|CRISPRCasFinder,CRT matches to KJ019157 (Synechococcus phage ACG-2014a isolate Syn7803C31, complete genome) position: , mismatch: 8, identity: 0.75

taaagatgctccaccacgcccaccaacataca	CRISPR spacer
ccaagatgctccaccacctccaccaatagaag	Protospacer
. *************** .*******.* * .

313. spacer 2.33|2201811|32|CP032143|CRISPRCasFinder,CRT matches to KJ019087 (Synechococcus phage ACG-2014a isolate Syn7803US19, complete genome) position: , mismatch: 8, identity: 0.75

taaagatgctccaccacgcccaccaacataca	CRISPR spacer
ccaagatgctccaccacctccaccaatagaag	Protospacer
. *************** .*******.* * .

314. spacer 2.33|2201811|32|CP032143|CRISPRCasFinder,CRT matches to KJ019076 (Synechococcus phage ACG-2014a isolate Syn7803US112, complete genome) position: , mismatch: 8, identity: 0.75

taaagatgctccaccacgcccaccaacataca	CRISPR spacer
ccaagatgctccaccacctccaccaatagaag	Protospacer
. *************** .*******.* * .

315. spacer 2.33|2201811|32|CP032143|CRISPRCasFinder,CRT matches to KJ019065 (Synechococcus phage ACG-2014a isolate Syn7803C99, complete genome) position: , mismatch: 8, identity: 0.75

taaagatgctccaccacgcccaccaacataca	CRISPR spacer
ccaagatgctccaccacctccaccaatagaag	Protospacer
. *************** .*******.* * .

316. spacer 2.33|2201811|32|CP032143|CRISPRCasFinder,CRT matches to KJ019026 (Synechococcus phage ACG-2014a isolate Syn7803C42, complete genome) position: , mismatch: 8, identity: 0.75

taaagatgctccaccacgcccaccaacataca	CRISPR spacer
ccaagatgctccaccacctccaccaatagaag	Protospacer
. *************** .*******.* * .

317. spacer 2.33|2201811|32|CP032143|CRISPRCasFinder,CRT matches to KJ019081 (Synechococcus phage ACG-2014a isolate Syn7803US117, complete genome) position: , mismatch: 8, identity: 0.75

taaagatgctccaccacgcccaccaacataca	CRISPR spacer
ccaagatgctccaccacctccaccaatagaag	Protospacer
. *************** .*******.* * .

318. spacer 2.33|2201811|32|CP032143|CRISPRCasFinder,CRT matches to KJ019033 (Synechococcus phage ACG-2014a isolate Syn7803C53, complete genome) position: , mismatch: 8, identity: 0.75

taaagatgctccaccacgcccaccaacataca	CRISPR spacer
ccaagatgctccaccacctccaccaatagaag	Protospacer
. *************** .*******.* * .

319. spacer 2.33|2201811|32|CP032143|CRISPRCasFinder,CRT matches to NC_023584 (Synechococcus phage S-MbCM100, complete genome) position: , mismatch: 8, identity: 0.75

taaagatgctccaccacgcccaccaacataca	CRISPR spacer
ccaagatgctccaccacctccaccaatagaag	Protospacer
. *************** .*******.* * .

320. spacer 2.33|2201811|32|CP032143|CRISPRCasFinder,CRT matches to KJ019153 (Synechococcus phage ACG-2014a isolate Syn7803C26, complete genome) position: , mismatch: 8, identity: 0.75

taaagatgctccaccacgcccaccaacataca	CRISPR spacer
ccaagatgctccaccacctccaccaatagaag	Protospacer
. *************** .*******.* * .

321. spacer 2.33|2201811|32|CP032143|CRISPRCasFinder,CRT matches to KJ019158 (Synechococcus phage ACG-2014a isolate Syn7803C33, complete genome) position: , mismatch: 8, identity: 0.75

taaagatgctccaccacgcccaccaacataca	CRISPR spacer
ccaagatgctccaccacctccaccaatagaag	Protospacer
. *************** .*******.* * .

322. spacer 2.33|2201811|32|CP032143|CRISPRCasFinder,CRT matches to KJ019067 (Synechococcus phage ACG-2014a isolate Syn7803US101, complete genome) position: , mismatch: 8, identity: 0.75

taaagatgctccaccacgcccaccaacataca	CRISPR spacer
ccaagatgctccaccacctccaccaatagaag	Protospacer
. *************** .*******.* * .

323. spacer 2.33|2201811|32|CP032143|CRISPRCasFinder,CRT matches to KJ019039 (Synechococcus phage ACG-2014a isolate Syn7803C60, complete genome) position: , mismatch: 8, identity: 0.75

taaagatgctccaccacgcccaccaacataca	CRISPR spacer
ccaagatgctccaccacctccaccaatagaag	Protospacer
. *************** .*******.* * .

324. spacer 2.33|2201811|32|CP032143|CRISPRCasFinder,CRT matches to KJ019030 (Synechococcus phage ACG-2014a isolate Syn7803C47, complete genome) position: , mismatch: 8, identity: 0.75

taaagatgctccaccacgcccaccaacataca	CRISPR spacer
ccaagatgctccaccacctccaccaatagaag	Protospacer
. *************** .*******.* * .

325. spacer 2.33|2201811|32|CP032143|CRISPRCasFinder,CRT matches to KJ019163 (Synechococcus phage ACG-2014a isolate Syn7803C38, complete genome) position: , mismatch: 8, identity: 0.75

taaagatgctccaccacgcccaccaacataca	CRISPR spacer
ccaagatgctccaccacctccaccaatagaag	Protospacer
. *************** .*******.* * .

326. spacer 2.33|2201811|32|CP032143|CRISPRCasFinder,CRT matches to KJ019116 (Synechococcus phage ACG-2014a isolate Syn7803US62, complete genome) position: , mismatch: 8, identity: 0.75

taaagatgctccaccacgcccaccaacataca	CRISPR spacer
ccaagatgctccaccacctccaccaatagaag	Protospacer
. *************** .*******.* * .

327. spacer 2.33|2201811|32|CP032143|CRISPRCasFinder,CRT matches to KJ019088 (Synechococcus phage ACG-2014a isolate Syn7803US1, complete genome) position: , mismatch: 8, identity: 0.75

taaagatgctccaccacgcccaccaacataca	CRISPR spacer
ccaagatgctccaccacctccaccaatagaag	Protospacer
. *************** .*******.* * .

328. spacer 2.33|2201811|32|CP032143|CRISPRCasFinder,CRT matches to KJ019084 (Synechococcus phage ACG-2014a isolate Syn7803US123, complete genome) position: , mismatch: 8, identity: 0.75

taaagatgctccaccacgcccaccaacataca	CRISPR spacer
ccaagatgctccaccacctccaccaatagaag	Protospacer
. *************** .*******.* * .

329. spacer 2.33|2201811|32|CP032143|CRISPRCasFinder,CRT matches to NZ_CP030933 (Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence) position: , mismatch: 8, identity: 0.75

taaagatgctccaccacgcccaccaacataca	CRISPR spacer
taaagctgctccaccacgccaacaacaatgtt	Protospacer
***** ************** ** *  **.. 

330. spacer 2.37|2202051|32|CP032143|CRISPRCasFinder,CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 8, identity: 0.75

---agggttcatttgctgttcagtctgagttatca	CRISPR spacer
tttaaag---atttgctgttcagtctgggtaatct	Protospacer
   *..*   *****************.** *** 

331. spacer 2.52|2200131|32|CP032143|PILER-CR matches to NC_047805 (Yersinia phage fHe-Yen3-01, complete genome) position: , mismatch: 8, identity: 0.75

ggaatattaactaaatcagagcaaaagaaaca	CRISPR spacer
cgtgccttaactaaatcagaggtaaagaaata	Protospacer
 * .. ***************  *******.*

332. spacer 2.53|2200191|32|CP032143|PILER-CR matches to AY766464 (Lactococcus phage TP712, complete sequence) position: , mismatch: 8, identity: 0.75

tttacaaatatttacaattattttcataaatt	CRISPR spacer
tttagaaatatttacaaatatttttaaagcgg	Protospacer
**** ************ ******.* *.   

333. spacer 2.53|2200191|32|CP032143|PILER-CR matches to KC821622 (Cellulophaga phage phi46:3, complete genome) position: , mismatch: 8, identity: 0.75

tttacaaatatttacaattattttcataaatt	CRISPR spacer
tttacaaatatttacatatatttgaactcaat	Protospacer
****************  *****  *.  * *

334. spacer 2.53|2200191|32|CP032143|PILER-CR matches to NC_021794 (Cellulophaga phage phi18:3, complete genome) position: , mismatch: 8, identity: 0.75

tttacaaatatttacaattattttcataaatt	CRISPR spacer
tttacaaatatttacatatatttgaactcaat	Protospacer
****************  *****  *.  * *

335. spacer 2.53|2200191|32|CP032143|PILER-CR matches to NC_005006 (Staphylococcus epidermidis ATCC 12228 plasmid pSE-12228-03, complete sequence) position: , mismatch: 8, identity: 0.75

tttacaaat---atttacaattattttcataaatt	CRISPR spacer
---ataggttgaatttacaagtattttcattaatt	Protospacer
   *.*..*   ******** ********* ****

336. spacer 2.53|2200191|32|CP032143|PILER-CR matches to MN693193 (Marine virus AFVG_25M440, complete genome) position: , mismatch: 8, identity: 0.75

tttacaaatatttacaattattttcataaatt	CRISPR spacer
gttacaaatatttataagtattttagtatggt	Protospacer
 *************.** ****** .** . *

337. spacer 2.63|2200793|32|CP032143|PILER-CR matches to LN881734 (Escherichia phage slur11, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

338. spacer 2.63|2200793|32|CP032143|PILER-CR matches to AP018814 (Enterobacteria phage T6 DNA, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

339. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MN895435 (Escherichia phage teqhal, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

340. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MG781191 (Escherichia phage vB_EcoM-fHoEco02, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

341. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MT764206 (Escherichia phage JEP6, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

342. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MN895437 (Escherichia phage teqskov, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

343. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MH837626 (Escherichia phage vB_vPM_PD112, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

344. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MN716856 (Yersinia phage vB_YepM_ZN18, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

345. spacer 2.63|2200793|32|CP032143|PILER-CR matches to KY290975 (Escherichia phage YUEEL01, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

346. spacer 2.63|2200793|32|CP032143|PILER-CR matches to NC_019399 (Enterobacteria phage vB_EcoM_ACG-C40, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

347. spacer 2.63|2200793|32|CP032143|PILER-CR matches to KM606997 (Enterobacteria phage RB7, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

348. spacer 2.63|2200793|32|CP032143|PILER-CR matches to LN881736 (Escherichia phage slur14, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

349. spacer 2.63|2200793|32|CP032143|PILER-CR matches to KU925172 (Escherichia phage PE37, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

350. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MH051915 (Enterobacteria phage vB_EcoM_IME339, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

351. spacer 2.63|2200793|32|CP032143|PILER-CR matches to LR215722 (Yersinia phage fPS-2 genome assembly, chromosome: I) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

352. spacer 2.63|2200793|32|CP032143|PILER-CR matches to NC_025449 (Escherichia phage ECML-134, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

353. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MH751506 (Escherichia phage T2, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

354. spacer 2.63|2200793|32|CP032143|PILER-CR matches to X00769 (Bacteriophage T4 genes 45, 44, 62, regA, 43 (5' end)) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

355. spacer 2.63|2200793|32|CP032143|PILER-CR matches to NC_042129 (Escherichia phage slur03, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

356. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MH809535 (Yersinia phage PYPS2T, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

357. spacer 2.63|2200793|32|CP032143|PILER-CR matches to NC_042077 (Shigella phage Sf21, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

358. spacer 2.63|2200793|32|CP032143|PILER-CR matches to LN881732 (Escherichia phage slur07, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

359. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MN508618 (UNVERIFIED: Escherichia phage ES26, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

360. spacer 2.63|2200793|32|CP032143|PILER-CR matches to KM607002 (Enterobacteria phage RB55, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

361. spacer 2.63|2200793|32|CP032143|PILER-CR matches to KY608967 (UNVERIFIED: Escherichia phage CF2, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

362. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MF001354 (Salmonella phage SG1, partial genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

363. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MT176425 (Citrobacter phage PhiZZ23, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

364. spacer 2.63|2200793|32|CP032143|PILER-CR matches to NC_042039 (Shigella phage Sf22, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

365. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MF327009 (Shigella phage Sf25, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

366. spacer 2.63|2200793|32|CP032143|PILER-CR matches to AP018813 (Enterobacteria phage T2 DNA, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

367. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MN580668 (Salmonella phage pSe_SNUABM_01, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

368. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MK373781 (Escherichia phage vB_EcoM_KAW1E185, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

369. spacer 2.63|2200793|32|CP032143|PILER-CR matches to NC_025829 (Shigella phage pSs-1, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

370. spacer 2.63|2200793|32|CP032143|PILER-CR matches to LN881737 (Escherichia phage slur13, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

371. spacer 2.63|2200793|32|CP032143|PILER-CR matches to LR597657 (Escherichia phage T4_ev240 genome assembly, chromosome: 1) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

372. spacer 2.63|2200793|32|CP032143|PILER-CR matches to NC_030953 (Shigella phage SHFML-11, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

373. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MN508614 (UNVERIFIED: Escherichia phage ES12, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

374. spacer 2.63|2200793|32|CP032143|PILER-CR matches to KJ477684 (Enterobacteria phage T4 strain wild, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

375. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MG781190 (Escherichia phage vB_EcoM-fFiEco06, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

376. spacer 2.63|2200793|32|CP032143|PILER-CR matches to LR215723 (Yersinia phage fPS-90 genome assembly, chromosome: I) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

377. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MH550421 (Enterobacteria phage T6, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

378. spacer 2.63|2200793|32|CP032143|PILER-CR matches to KM606996 (Enterobacteria phage RB6, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

379. spacer 2.63|2200793|32|CP032143|PILER-CR matches to AP018932 (Escherichia phage KIT03 DNA, complete sequence) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

380. spacer 2.63|2200793|32|CP032143|PILER-CR matches to NC_025448 (Enterobacteria phage RB27, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

381. spacer 2.63|2200793|32|CP032143|PILER-CR matches to KJ668714 (Escherichia phage e11/2, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

382. spacer 2.63|2200793|32|CP032143|PILER-CR matches to HM137666 (Enterobacteria phage T4T, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

383. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MN895438 (Escherichia phage teqdroes, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

384. spacer 2.63|2200793|32|CP032143|PILER-CR matches to KP869105 (Escherichia coli O157 typing phage 7, partial genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

385. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MF158046 (Shigella phage Sf23, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

386. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MN022785 (Escherichia virus VEc20, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

387. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MT682709 (Escherichia phage vB_EcoM_SP1, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

388. spacer 2.63|2200793|32|CP032143|PILER-CR matches to NC_000866 (Enterobacteria phage T4, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

389. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MT682714 (Escherichia phage vB_EcoM_Lutter, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

390. spacer 2.63|2200793|32|CP032143|PILER-CR matches to LR746311 (Shigella phage vB_SsoM_113 genome assembly, chromosome: 1) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

391. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MK962750 (Shigella phage CM8, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

392. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MH553563 (Enterobacteria phage RB18, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

393. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MN895436 (Escherichia phage teqsoen, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

394. spacer 2.63|2200793|32|CP032143|PILER-CR matches to KM606995 (Enterobacteria phage RB5, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

395. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MT682710 (Escherichia phage vB_EcoM_FT, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

396. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MG775043 (Citrobacter phage vB_CroM_CrRp10, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

397. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MN781580 (Shigella virus KRT47, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

398. spacer 2.63|2200793|32|CP032143|PILER-CR matches to LN881726 (Escherichia phage slur02, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

399. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MK373785 (Escherichia phage vB_EcoM_OE5505, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

400. spacer 2.63|2200793|32|CP032143|PILER-CR matches to NC_042078 (Shigella phage Sf24, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

401. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MH992121 (UNVERIFIED: Escherichia phage MLF4, partial genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

402. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MT682712 (Escherichia phage vB_EcoM_F1, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

403. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MK373779 (Escherichia phage vB_EcoM_G9062, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

404. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MT179807 (Escherichia phage vB_EcoM_IME537, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

405. spacer 2.63|2200793|32|CP032143|PILER-CR matches to KX828711 (Shigella phage SH7, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

406. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MN508616 (UNVERIFIED: Escherichia phage ES19, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

407. spacer 2.63|2200793|32|CP032143|PILER-CR matches to KJ477686 (Enterobacteria phage T4 strain GT7, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

408. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MT446387 (UNVERIFIED: Escherichia virus TH09, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

409. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MK327946 (Escherichia phage vB_EcoM_G4507, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

410. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MK327944 (Escherichia phage vB_EcoM_G2540-3, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

411. spacer 2.63|2200793|32|CP032143|PILER-CR matches to FJ839692 (Enterobacteria phage RB14, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

412. spacer 2.63|2200793|32|CP032143|PILER-CR matches to KX452694 (UNVERIFIED: Escherichia phage KPN1 genomic sequence) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

413. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MH355584 (Escherichia phage vB_EcoM_JB75, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

414. spacer 2.63|2200793|32|CP032143|PILER-CR matches to KM606994 (Enterobacteria phage RB3, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

415. spacer 2.63|2200793|32|CP032143|PILER-CR matches to M15080 (Bacteriophage T4 genes 45.1 (encoding RNA polymerase-binding protein) and 45.2) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

416. spacer 2.63|2200793|32|CP032143|PILER-CR matches to M10160 (Bacteriophage T4 genes 55, alpha-gt, 47, 46, 45, 44, 62, regA, and 43) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

417. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MK977694 (Escherichia phage vB_EcoM-Sa45lw, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

418. spacer 2.63|2200793|32|CP032143|PILER-CR matches to LR877332 (Shigella phage vB_SsoM_JK08 genome assembly, chromosome: 1) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

419. spacer 2.63|2200793|32|CP032143|PILER-CR matches to KX130862 (Shigella phage SHFML-26, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

420. spacer 2.63|2200793|32|CP032143|PILER-CR matches to KU867876 (Escherichia phage vB_EcoM-UFV13, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

421. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MK327929 (Escherichia phage D5505, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

422. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MK327936 (Escherichia phage vB_EcoM_G2540, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

423. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MK327939 (Escherichia phage vB_EcoM_G4498, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

424. spacer 2.63|2200793|32|CP032143|PILER-CR matches to NC_031030 (Escherichia phage UFV-AREG1, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

425. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MN508617 (UNVERIFIED: Escherichia phage ES21, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

426. spacer 2.63|2200793|32|CP032143|PILER-CR matches to FJ839693 (Enterobacteria phage RB51, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

427. spacer 2.63|2200793|32|CP032143|PILER-CR matches to KM607004 (Enterobacteria phage RB68, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

428. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MN994497 (Phage NBEco003, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

429. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MK962755 (Shigella phage JK38, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

430. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MH243439 (Escherichia phage vB_EcoM_NBG2, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

431. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MK327945 (Escherichia phage vB_EcoM_G4500, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

432. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MF001360 (Escherichia phage ECO4, partial genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

433. spacer 2.63|2200793|32|CP032143|PILER-CR matches to KJ477685 (Enterobacteria phage T4 strain 147, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

434. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MK886800 (Escherichia phage EcNP1, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

435. spacer 2.63|2200793|32|CP032143|PILER-CR matches to LR215724 (Yersinia phage fPS-65 genome assembly, chromosome: I) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

436. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MK327940 (Escherichia phage vB_EcoM_G29, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

437. spacer 2.63|2200793|32|CP032143|PILER-CR matches to LN881733 (Escherichia phage slur08, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

438. spacer 2.63|2200793|32|CP032143|PILER-CR matches to AP011113 (Enterobacteria phage AR1 DNA, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

439. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MK373786 (Escherichia phage vB_EcoM_R5505, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

440. spacer 2.63|2200793|32|CP032143|PILER-CR matches to LC348380 (Escherichia phage T2 DNA, complete sequence) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

441. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MT176424 (Citrobacter phage PhiZZ6, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

442. spacer 2.63|2200793|32|CP032143|PILER-CR matches to NC_027404 (Yersinia phage PST, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

443. spacer 2.63|2200793|32|CP032143|PILER-CR matches to NC_008515 (Bacteriophage RB32, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

444. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MK962752 (Shigella phage JK23, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

445. spacer 2.63|2200793|32|CP032143|PILER-CR matches to KT184312 (Enterobacteria phage Kha5h, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

446. spacer 2.63|2200793|32|CP032143|PILER-CR matches to HE956711 (Yersinia phage phiD1 complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

447. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MG867727 (Escherichia phage vB_EcoM-G28, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

448. spacer 2.63|2200793|32|CP032143|PILER-CR matches to KF925357 (Escherichia phage HY01, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

449. spacer 2.63|2200793|32|CP032143|PILER-CR matches to KR233165 (Escherichia phage PEC04, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

450. spacer 2.63|2200793|32|CP032143|PILER-CR matches to NC_015457 (Shigella phage Shfl2, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

451. spacer 2.63|2200793|32|CP032143|PILER-CR matches to KM607001 (Enterobacteria phage RB33, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

452. spacer 2.63|2200793|32|CP032143|PILER-CR matches to LC348379 (Escherichia phage PP01 DNA, complete sequence) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

453. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MK327942 (Escherichia phage vB_EcoM_G50, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

454. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MK327928 (Escherichia phage vB_EcoM_G2133, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

455. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MT176426 (Serratia phage PhiZZ30, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

456. spacer 2.63|2200793|32|CP032143|PILER-CR matches to KX452698 (UNVERIFIED: Shigella phage KPN5 genomic sequence) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

457. spacer 2.63|2200793|32|CP032143|PILER-CR matches to KT184308 (Enterobacteria phage Aplg8, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

458. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MK373787 (Escherichia phage vB_EcoM_G8, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

459. spacer 2.63|2200793|32|CP032143|PILER-CR matches to LR597660 (Escherichia phage T4_ev151 genome assembly, chromosome: 1) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

460. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MN895434 (Escherichia phage teqhad, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

461. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MH992510 (Escherichia phage vB_EcoM_DalCa, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

462. spacer 2.63|2200793|32|CP032143|PILER-CR matches to KM607003 (Enterobacteria phage RB59, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

463. spacer 2.63|2200793|32|CP032143|PILER-CR matches to LN881729 (Escherichia phage slur04, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

464. spacer 2.63|2200793|32|CP032143|PILER-CR matches to HM997020 (Escherichia phage wV7, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

465. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MH051916 (Enterobacteria phage vB_EcoM_IME340, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

466. spacer 2.63|2200793|32|CP032143|PILER-CR matches to MT932213 (Escherichia phage VEc74, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

467. spacer 2.63|2200793|32|CP032143|PILER-CR matches to JN202312 (Enterobacteria phage ime09, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

468. spacer 2.63|2200793|32|CP032143|PILER-CR matches to KM606999 (Enterobacteria phage RB10, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

469. spacer 2.63|2200793|32|CP032143|PILER-CR matches to KM606998 (Enterobacteria phage RB9, complete genome) position: , mismatch: 8, identity: 0.75

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
tccttcaattcaaatgagatttaattttataa	Protospacer
. * .*.* ************* **** ****

470. spacer 2.65|2200913|32|CP032143|PILER-CR matches to AP014358 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S39-C94, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.75

attctgtgcctgatagtgggattaaatatcca	CRISPR spacer
gttctgtgcctgattgtgtgattaataaactt	Protospacer
.************* *** ******  * *. 

471. spacer 2.75|2201513|32|CP032143|PILER-CR matches to NC_042028 (Acinetobacter phage AB1, complete genome) position: , mismatch: 8, identity: 0.75

gtgggtatgaccgcccgaaagtgggcaatttt	CRISPR spacer
aaaccgatgaccgcccgaaagtgggcaactta	Protospacer
. .   **********************.** 

472. spacer 2.80|2201813|32|CP032143|PILER-CR matches to KJ019135 (Synechococcus phage ACG-2014a isolate Syn7803C101, complete genome) position: , mismatch: 8, identity: 0.75

taaagatgctccaccacgcccaccaacataca	CRISPR spacer
ccaagatgctccaccacctccaccaatagaag	Protospacer
. *************** .*******.* * .

473. spacer 2.80|2201813|32|CP032143|PILER-CR matches to KJ019114 (Synechococcus phage ACG-2014a isolate Syn7803US60, complete genome) position: , mismatch: 8, identity: 0.75

taaagatgctccaccacgcccaccaacataca	CRISPR spacer
ccaagatgctccaccacctccaccaatagaag	Protospacer
. *************** .*******.* * .

474. spacer 2.80|2201813|32|CP032143|PILER-CR matches to KJ019138 (Synechococcus phage ACG-2014a isolate Syn7803C107, complete genome) position: , mismatch: 8, identity: 0.75

taaagatgctccaccacgcccaccaacataca	CRISPR spacer
ccaagatgctccaccacctccaccaatagaag	Protospacer
. *************** .*******.* * .

475. spacer 2.80|2201813|32|CP032143|PILER-CR matches to KJ019122 (Synechococcus phage ACG-2014a isolate Syn7803US79, complete genome) position: , mismatch: 8, identity: 0.75

taaagatgctccaccacgcccaccaacataca	CRISPR spacer
ccaagatgctccaccacctccaccaatagaag	Protospacer
. *************** .*******.* * .

476. spacer 2.80|2201813|32|CP032143|PILER-CR matches to KJ019055 (Synechococcus phage ACG-2014a isolate Syn7803C86, complete genome) position: , mismatch: 8, identity: 0.75

taaagatgctccaccacgcccaccaacataca	CRISPR spacer
ccaagatgctccaccacctccaccaatagaag	Protospacer
. *************** .*******.* * .

477. spacer 2.80|2201813|32|CP032143|PILER-CR matches to KJ019038 (Synechococcus phage ACG-2014a isolate Syn7803C59, complete genome) position: , mismatch: 8, identity: 0.75

taaagatgctccaccacgcccaccaacataca	CRISPR spacer
ccaagatgctccaccacctccaccaatagaag	Protospacer
. *************** .*******.* * .

478. spacer 2.80|2201813|32|CP032143|PILER-CR matches to KJ019068 (Synechococcus phage ACG-2014a isolate Syn7803US102, complete genome) position: , mismatch: 8, identity: 0.75

taaagatgctccaccacgcccaccaacataca	CRISPR spacer
ccaagatgctccaccacctccaccaatagaag	Protospacer
. *************** .*******.* * .

479. spacer 2.80|2201813|32|CP032143|PILER-CR matches to KJ019137 (Synechococcus phage ACG-2014a isolate Syn7803C104, complete genome) position: , mismatch: 8, identity: 0.75

taaagatgctccaccacgcccaccaacataca	CRISPR spacer
ccaagatgctccaccacctccaccaatagaag	Protospacer
. *************** .*******.* * .

480. spacer 2.80|2201813|32|CP032143|PILER-CR matches to KJ019157 (Synechococcus phage ACG-2014a isolate Syn7803C31, complete genome) position: , mismatch: 8, identity: 0.75

taaagatgctccaccacgcccaccaacataca	CRISPR spacer
ccaagatgctccaccacctccaccaatagaag	Protospacer
. *************** .*******.* * .

481. spacer 2.80|2201813|32|CP032143|PILER-CR matches to KJ019087 (Synechococcus phage ACG-2014a isolate Syn7803US19, complete genome) position: , mismatch: 8, identity: 0.75

taaagatgctccaccacgcccaccaacataca	CRISPR spacer
ccaagatgctccaccacctccaccaatagaag	Protospacer
. *************** .*******.* * .

482. spacer 2.80|2201813|32|CP032143|PILER-CR matches to KJ019076 (Synechococcus phage ACG-2014a isolate Syn7803US112, complete genome) position: , mismatch: 8, identity: 0.75

taaagatgctccaccacgcccaccaacataca	CRISPR spacer
ccaagatgctccaccacctccaccaatagaag	Protospacer
. *************** .*******.* * .

483. spacer 2.80|2201813|32|CP032143|PILER-CR matches to KJ019065 (Synechococcus phage ACG-2014a isolate Syn7803C99, complete genome) position: , mismatch: 8, identity: 0.75

taaagatgctccaccacgcccaccaacataca	CRISPR spacer
ccaagatgctccaccacctccaccaatagaag	Protospacer
. *************** .*******.* * .

484. spacer 2.80|2201813|32|CP032143|PILER-CR matches to KJ019026 (Synechococcus phage ACG-2014a isolate Syn7803C42, complete genome) position: , mismatch: 8, identity: 0.75

taaagatgctccaccacgcccaccaacataca	CRISPR spacer
ccaagatgctccaccacctccaccaatagaag	Protospacer
. *************** .*******.* * .

485. spacer 2.80|2201813|32|CP032143|PILER-CR matches to KJ019081 (Synechococcus phage ACG-2014a isolate Syn7803US117, complete genome) position: , mismatch: 8, identity: 0.75

taaagatgctccaccacgcccaccaacataca	CRISPR spacer
ccaagatgctccaccacctccaccaatagaag	Protospacer
. *************** .*******.* * .

486. spacer 2.80|2201813|32|CP032143|PILER-CR matches to KJ019033 (Synechococcus phage ACG-2014a isolate Syn7803C53, complete genome) position: , mismatch: 8, identity: 0.75

taaagatgctccaccacgcccaccaacataca	CRISPR spacer
ccaagatgctccaccacctccaccaatagaag	Protospacer
. *************** .*******.* * .

487. spacer 2.80|2201813|32|CP032143|PILER-CR matches to NC_023584 (Synechococcus phage S-MbCM100, complete genome) position: , mismatch: 8, identity: 0.75

taaagatgctccaccacgcccaccaacataca	CRISPR spacer
ccaagatgctccaccacctccaccaatagaag	Protospacer
. *************** .*******.* * .

488. spacer 2.80|2201813|32|CP032143|PILER-CR matches to KJ019153 (Synechococcus phage ACG-2014a isolate Syn7803C26, complete genome) position: , mismatch: 8, identity: 0.75

taaagatgctccaccacgcccaccaacataca	CRISPR spacer
ccaagatgctccaccacctccaccaatagaag	Protospacer
. *************** .*******.* * .

489. spacer 2.80|2201813|32|CP032143|PILER-CR matches to KJ019158 (Synechococcus phage ACG-2014a isolate Syn7803C33, complete genome) position: , mismatch: 8, identity: 0.75

taaagatgctccaccacgcccaccaacataca	CRISPR spacer
ccaagatgctccaccacctccaccaatagaag	Protospacer
. *************** .*******.* * .

490. spacer 2.80|2201813|32|CP032143|PILER-CR matches to KJ019067 (Synechococcus phage ACG-2014a isolate Syn7803US101, complete genome) position: , mismatch: 8, identity: 0.75

taaagatgctccaccacgcccaccaacataca	CRISPR spacer
ccaagatgctccaccacctccaccaatagaag	Protospacer
. *************** .*******.* * .

491. spacer 2.80|2201813|32|CP032143|PILER-CR matches to KJ019039 (Synechococcus phage ACG-2014a isolate Syn7803C60, complete genome) position: , mismatch: 8, identity: 0.75

taaagatgctccaccacgcccaccaacataca	CRISPR spacer
ccaagatgctccaccacctccaccaatagaag	Protospacer
. *************** .*******.* * .

492. spacer 2.80|2201813|32|CP032143|PILER-CR matches to KJ019030 (Synechococcus phage ACG-2014a isolate Syn7803C47, complete genome) position: , mismatch: 8, identity: 0.75

taaagatgctccaccacgcccaccaacataca	CRISPR spacer
ccaagatgctccaccacctccaccaatagaag	Protospacer
. *************** .*******.* * .

493. spacer 2.80|2201813|32|CP032143|PILER-CR matches to KJ019163 (Synechococcus phage ACG-2014a isolate Syn7803C38, complete genome) position: , mismatch: 8, identity: 0.75

taaagatgctccaccacgcccaccaacataca	CRISPR spacer
ccaagatgctccaccacctccaccaatagaag	Protospacer
. *************** .*******.* * .

494. spacer 2.80|2201813|32|CP032143|PILER-CR matches to KJ019116 (Synechococcus phage ACG-2014a isolate Syn7803US62, complete genome) position: , mismatch: 8, identity: 0.75

taaagatgctccaccacgcccaccaacataca	CRISPR spacer
ccaagatgctccaccacctccaccaatagaag	Protospacer
. *************** .*******.* * .

495. spacer 2.80|2201813|32|CP032143|PILER-CR matches to KJ019088 (Synechococcus phage ACG-2014a isolate Syn7803US1, complete genome) position: , mismatch: 8, identity: 0.75

taaagatgctccaccacgcccaccaacataca	CRISPR spacer
ccaagatgctccaccacctccaccaatagaag	Protospacer
. *************** .*******.* * .

496. spacer 2.80|2201813|32|CP032143|PILER-CR matches to KJ019084 (Synechococcus phage ACG-2014a isolate Syn7803US123, complete genome) position: , mismatch: 8, identity: 0.75

taaagatgctccaccacgcccaccaacataca	CRISPR spacer
ccaagatgctccaccacctccaccaatagaag	Protospacer
. *************** .*******.* * .

497. spacer 2.80|2201813|32|CP032143|PILER-CR matches to NZ_CP030933 (Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence) position: , mismatch: 8, identity: 0.75

taaagatgctccaccacgcccaccaacataca	CRISPR spacer
taaagctgctccaccacgccaacaacaatgtt	Protospacer
***** ************** ** *  **.. 

498. spacer 2.84|2202053|32|CP032143|PILER-CR matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 8, identity: 0.75

---agggttcatttgctgttcagtctgagttatca	CRISPR spacer
tttaaag---atttgctgttcagtctgggtaatct	Protospacer
   *..*   *****************.** *** 

499. spacer 1.7|2046682|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011513 (Paenibacillus peoriae strain HS311 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

atttcatggtcaattactaaaaaatcatgcat	CRISPR spacer
atttcatggtctattcctaaaaagttagctcc	Protospacer
*********** *** *******.*.*  . .

500. spacer 1.11|2046922|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to KU686209 (Synechococcus phage S-CAM22 isolate 1209TA19, complete genome) position: , mismatch: 9, identity: 0.719

atttaaaattcaaatagttcaaattgagggaa	CRISPR spacer
tagaaaaattgaaagagttcaaattgaagaac	Protospacer
    ****** *** ************.*.* 

501. spacer 1.11|2046922|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to KU686208 (Synechococcus phage S-CAM22 isolate 0310NB44, complete genome) position: , mismatch: 9, identity: 0.719

atttaaaattcaaatagttcaaattgagggaa	CRISPR spacer
tagaaaaattgaaagagttcaaattgaagaac	Protospacer
    ****** *** ************.*.* 

502. spacer 1.11|2046922|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to KU686207 (Synechococcus phage S-CAM22 isolate 0210CC35, complete genome) position: , mismatch: 9, identity: 0.719

atttaaaattcaaatagttcaaattgagggaa	CRISPR spacer
tagaaaaattgaaagagttcaaattgaagaac	Protospacer
    ****** *** ************.*.* 

503. spacer 1.15|2047162|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MN693441 (Marine virus AFVG_25M481, complete genome) position: , mismatch: 9, identity: 0.719

tcttcctcttcatctctaagtctaactgtcgt	CRISPR spacer
tctttctcttcatctgtaagtcttatatatct	Protospacer
****.********** ******* *.   . *

504. spacer 1.15|2047162|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MN693170 (Marine virus AFVG_25M480, complete genome) position: , mismatch: 9, identity: 0.719

tcttcctcttcatctctaagtctaactgtcgt	CRISPR spacer
tctttctcttcatctgtaagtcttatatatct	Protospacer
****.********** ******* *.   . *

505. spacer 1.24|2047702|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MH356730 (Staphylococcus phage VB-SauS-SA2, complete genome) position: , mismatch: 9, identity: 0.719

gaattatatgcacaagttcactttcttttatt	CRISPR spacer
ctgtcccaagcacaagttctatttcttttatt	Protospacer
  .*. .* **********  ***********

506. spacer 1.35|2048362|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039706 (Clostridium butyricum strain 4-1 plasmid p-butyl_plas_4-1, complete sequence) position: , mismatch: 9, identity: 0.719

tcaactcagataatattgatataagttttgat	CRISPR spacer
atataaaaaataattttgatatatgttttgat	Protospacer
 .*    *.***** ******** ********

507. spacer 1.35|2048362|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033246 (Clostridium butyricum strain CFSA3987 plasmid pCFSA3987, complete sequence) position: , mismatch: 9, identity: 0.719

tcaactcagataatattgatataagttttgat	CRISPR spacer
atataaaaaataattttgatatatgttttgat	Protospacer
 .*    *.***** ******** ********

508. spacer 1.35|2048362|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033248 (Clostridium butyricum strain CFSA3989 plasmid pCFSA3989, complete sequence) position: , mismatch: 9, identity: 0.719

tcaactcagataatattgatataagttttgat	CRISPR spacer
atataaaaaataattttgatatatgttttgat	Protospacer
 .*    *.***** ******** ********

509. spacer 1.35|2048362|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013238 (Clostridium butyricum strain CDC_51208 plasmid pNPD4_2, complete sequence) position: , mismatch: 9, identity: 0.719

tcaactcagataatattgatataagttttgat	CRISPR spacer
atataaaaaataattttgatatatgttttgat	Protospacer
 .*    *.***** ******** ********

510. spacer 1.35|2048362|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MF360958 (Salicola phage SCTP-2, complete genome) position: , mismatch: 9, identity: 0.719

tcaactcagataatattgatataagttttgat	CRISPR spacer
ttgatatgcataatcttaatataagttttgat	Protospacer
*..*. .. ***** **.**************

511. spacer 1.36|2048422|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to NC_004719 (Streptomyces avermitilis MA-4680 = NBRC 14893 plasmid SAP1, complete sequence) position: , mismatch: 9, identity: 0.719

gcacaccgtgtttccgtggctcattttcaact	CRISPR spacer
tgtgagcgcgtttccgtggctcattgtcatcc	Protospacer
    * **.**************** *** *.

512. spacer 2.5|2200129|32|CP032143|CRISPRCasFinder,CRT matches to MH412654 (Synechococcus phage S-T4, complete genome) position: , mismatch: 9, identity: 0.719

ggaatattaactaaatcagagcaaaagaaaca	CRISPR spacer
tcaatattagctaaatcagagtaaaaattaat	Protospacer
  *******.***********.****.  *  

513. spacer 2.6|2200189|32|CP032143|CRISPRCasFinder,CRT matches to NC_021789 (Cellulophaga phage phi19:3, complete genome) position: , mismatch: 9, identity: 0.719

tttacaaatatttacaattattttcataaatt	CRISPR spacer
tttacaaatatttacatatatttgaactcgat	Protospacer
****************  *****  *.  . *

514. spacer 2.6|2200189|32|CP032143|CRISPRCasFinder,CRT matches to NZ_CP044979 (Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence) position: , mismatch: 9, identity: 0.719

tttacaaatatttacaattattttcataaatt	CRISPR spacer
tttacaaatattttcaattagttcttacatct	Protospacer
************* ****** **..   * .*

515. spacer 2.8|2200309|32|CP032143|CRISPRCasFinder,CRT matches to NZ_CP046537 (Acinetobacter baumannii strain XL380 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gtagtcctaaaatccattcatttaagctcaat	CRISPR spacer
atagtcctaaaatccatacacttatccttgtc	Protospacer
.**************** **.***  **.. .

516. spacer 2.20|2201031|32|CP032143|CRISPRCasFinder,CRT matches to MG945171 (UNVERIFIED: Microviridae sp. isolate 430-1801, partial genome) position: , mismatch: 9, identity: 0.719

attttaatgctactcaggctgcaattagagct	CRISPR spacer
cttttaatgcttctcaggctgctatcgatcgt	Protospacer
 ********** ********** **...   *

517. spacer 2.29|2201571|32|CP032143|CRISPRCasFinder,CRT matches to MN871446 (UNVERIFIED: Serratia phage KpLz-2_45, complete genome) position: , mismatch: 9, identity: 0.719

ttatcgcaattgacccggaagcagagaccgaa	CRISPR spacer
aattcggtattgacccggaagcagagcacgcg	Protospacer
   ***  ******************  ** .

518. spacer 2.29|2201571|32|CP032143|CRISPRCasFinder,CRT matches to MN871452 (UNVERIFIED: Serratia phage KpZh_1, complete genome) position: , mismatch: 9, identity: 0.719

ttatcgcaattgacccggaagcagagaccgaa	CRISPR spacer
aattcggtattgacccggaagcagagcacgcg	Protospacer
   ***  ******************  ** .

519. spacer 2.29|2201571|32|CP032143|CRISPRCasFinder,CRT matches to MN871447 (UNVERIFIED: Serratia phage KpLz_1_41, complete genome) position: , mismatch: 9, identity: 0.719

ttatcgcaattgacccggaagcagagaccgaa	CRISPR spacer
aattcggtattgacccggaagcagagcacgcg	Protospacer
   ***  ******************  ** .

520. spacer 2.29|2201571|32|CP032143|CRISPRCasFinder,CRT matches to MN871449 (UNVERIFIED: Serratia phage KpXa_1, complete genome) position: , mismatch: 9, identity: 0.719

ttatcgcaattgacccggaagcagagaccgaa	CRISPR spacer
aattcggtattgacccggaagcagagcacgcg	Protospacer
   ***  ******************  ** .

521. spacer 2.29|2201571|32|CP032143|CRISPRCasFinder,CRT matches to MN871453 (UNVERIFIED: Serratia phage KpZh_LPS_45, complete genome) position: , mismatch: 9, identity: 0.719

ttatcgcaattgacccggaagcagagaccgaa	CRISPR spacer
aattcggtattgacccggaagcagagcacgcg	Protospacer
   ***  ******************  ** .

522. spacer 2.29|2201571|32|CP032143|CRISPRCasFinder,CRT matches to MN871451 (UNVERIFIED: Serratia phage KpYy_2_45, complete genome) position: , mismatch: 9, identity: 0.719

ttatcgcaattgacccggaagcagagaccgaa	CRISPR spacer
aattcggtattgacccggaagcagagcacgcg	Protospacer
   ***  ******************  ** .

523. spacer 2.29|2201571|32|CP032143|CRISPRCasFinder,CRT matches to MN871448 (UNVERIFIED: Serratia phage KpSz_1, complete genome) position: , mismatch: 9, identity: 0.719

ttatcgcaattgacccggaagcagagaccgaa	CRISPR spacer
aattcggtattgacccggaagcagagcacgcg	Protospacer
   ***  ******************  ** .

524. spacer 2.36|2201991|32|CP032143|CRISPRCasFinder,CRT matches to AB797215 (Klebsiella phage 0507-KN2-1 DNA, complete genome) position: , mismatch: 9, identity: 0.719

cgcaagaggaaagtctgcagatggttcagcaa	CRISPR spacer
tcctgtaggatagtctgcagctggttcagctc	Protospacer
. * . **** ********* *********  

525. spacer 2.36|2201991|32|CP032143|CRISPRCasFinder,CRT matches to MG428990 (Klebsiella phage Menlow, complete genome) position: , mismatch: 9, identity: 0.719

cgcaagaggaaagtctgcagatggttcagcaa	CRISPR spacer
tcctgtaggatagtctgcagctggttcagctc	Protospacer
. * . **** ********* *********  

526. spacer 2.36|2201991|32|CP032143|CRISPRCasFinder,CRT matches to MN045230 (Klebsiella phage Magnus, complete genome) position: , mismatch: 9, identity: 0.719

cgcaagaggaaagtctgcagatggttcagcaa	CRISPR spacer
tcctgtaggatagtctgcagctggttcagctc	Protospacer
. * . **** ********* *********  

527. spacer 2.36|2201991|32|CP032143|CRISPRCasFinder,CRT matches to MK373783 (Escherichia phage vB_EcoM_KWBSE43-6, complete genome) position: , mismatch: 9, identity: 0.719

cgcaagaggaaagtctgcagatggttcagcaa	CRISPR spacer
tcctgtaggatagtctgcagctggttcagctc	Protospacer
. * . **** ********* *********  

528. spacer 2.36|2201991|32|CP032143|CRISPRCasFinder,CRT matches to NC_042047 (Serratia phage vB_Sru_IME250, complete genome) position: , mismatch: 9, identity: 0.719

cgcaagaggaaagtctgcagatggttcagcaa	CRISPR spacer
tcctgtaggatagtctgcagctggttcagctc	Protospacer
. * . **** ********* *********  

529. spacer 2.37|2202051|32|CP032143|CRISPRCasFinder,CRT matches to NC_031245 (Bacillus phage SP-15, complete genome) position: , mismatch: 9, identity: 0.719

agggtt----catttgctgttcagtctgagttatca	CRISPR spacer
----ttttaccatttgctgttcattcttagttagtt	Protospacer
    **    ************* *** ***** . 

530. spacer 2.41|2202291|32|CP032143|CRISPRCasFinder,CRT matches to NZ_CP053657 (Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence) position: , mismatch: 9, identity: 0.719

gtgatgttgaatctcagaagaaattcgcagaa	CRISPR spacer
atcttgtagaatgtcagaagaaattcgtatgc	Protospacer
.*  *** **** **************.* . 

531. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to MT585306 (Flavobacterium phage FCOV-F43, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

532. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to MT585275 (Flavobacterium phage FCOV-F4, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

533. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to MT585280 (Flavobacterium phage FCOV-F12, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

534. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to MK756088 (Flavobacterium phage FCOV-F25, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

535. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to KY951963 (Flavobacterium phage FCV-3, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

536. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to MT585285 (Flavobacterium phage FCOV-F19, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

537. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to MK756089 (Flavobacterium phage FCOV-F27, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

538. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to MT585297 (Flavobacterium phage FCOV-F33, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

539. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to MT585274 (Flavobacterium phage FCOV-F3, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

540. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to MT585315 (Flavobacterium phage V189, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

541. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to MT585277 (Flavobacterium phage FCOV-F8, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

542. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to MT585300 (Flavobacterium phage FCOV-F36, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

543. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to KY979242 (Flavobacterium phage V182, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

544. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to MK756084 (Flavobacterium phage FCOV-F6, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

545. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to KY979243 (Flavobacterium phage VK20, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

546. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to MT585273 (Flavobacterium phage FCOV-F1, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

547. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to MT585298 (Flavobacterium phage FCOV-F34, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

548. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to MT585286 (Flavobacterium phage FCOV-F20, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

549. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to MT585296 (Flavobacterium phage FCOV-F32, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

550. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to KY979246 (Flavobacterium phage VK52, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

551. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to MT585314 (Flavobacterium phage V188, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

552. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to MT585287 (Flavobacterium phage FCOV-F21, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

553. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to KY992519 (Flavobacterium phage V175, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

554. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to MT585299 (Flavobacterium phage FCOV-F35, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

555. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to MT585279 (Flavobacterium phage FCOV-F11, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

556. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to MT585295 (Flavobacterium phage FCOV-F31, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

557. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to MT585304 (Flavobacterium phage FCOV-F41, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

558. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to MT585288 (Flavobacterium phage FCOV-F22, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

559. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to MT585309 (Flavobacterium phage FCOV-F48, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

560. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to MT585293 (Flavobacterium phage FCOV-F29, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

561. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to MT585291 (Flavobacterium phage FCOV-F26, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

562. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to MT585302 (Flavobacterium phage FCOV-F39, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

563. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to MT585284 (Flavobacterium phage FCOV-F18, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

564. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to MT585305 (Flavobacterium phage FCOV-F42, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

565. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to MT585290 (Flavobacterium phage FCOV-F24, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

566. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to MT585311 (Flavobacterium phage V183, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

567. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to MT585278 (Flavobacterium phage FCOV-F10, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

568. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to MT585294 (Flavobacterium phage FCOV-F30, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

569. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to KY951964 (Flavobacterium phage FCV-11, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

570. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to MT585283 (Flavobacterium phage FCOV-F17, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

571. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to MT585301 (Flavobacterium phage FCOV-F38, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

572. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to KY979236 (Flavobacterium phage FCV-10, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

573. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to KY979237 (Flavobacterium phage FCV-16, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

574. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to MT585303 (Flavobacterium phage FCOV-F40, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

575. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to KY979241 (Flavobacterium phage V165, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

576. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to KY979238 (Flavoibacterium phage FCV-20, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

577. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to MK756083 (Flavobacterium phage FCOV-F2, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

578. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to MK756085 (Flavobacterium phage FCOV-F9, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

579. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to KY992520 (Flavobacterium phage V181, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

580. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to MT585308 (Flavobacterium phage FCOV-F47, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

581. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to MT431535 (Flavobacterium phage FCV-1.01, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

582. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to KY979244 (Flavobacterium phage VK42, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

583. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to MT585292 (Flavobacterium phage FCOV-F28, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

584. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to NC_041845 (Flavobacterium phage FCV-1, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

585. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to MT585276 (Flavobacterium phage FCOV-F7, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

586. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to MT585289 (Flavobacterium phage FCOV-F23, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

587. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to MK756090 (Flavobacterium phage FCOV-F37, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

588. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to MT585312 (Flavobacterium phage V184, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

589. spacer 2.42|2202351|32|CP032143|CRISPRCasFinder,CRT matches to MT585307 (Flavobacterium phage FCOV-F44, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

590. spacer 2.45|2202531|32|CP032143|CRISPRCasFinder,CRT matches to NZ_CP011375 (Moraxella bovoculi strain 58069 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cctgtttttgatgaaaataatgatcctgtcat	CRISPR spacer
gaatttattgataaaaataatgatcctgagtt	Protospacer
    ** *****.***************   *

591. spacer 2.45|2202531|32|CP032143|CRISPRCasFinder,CRT matches to LC494302 (Escherichia phage SP27 DNA, complete genome) position: , mismatch: 9, identity: 0.719

cctgtttttgatgaaaataatgatcctgtcat	CRISPR spacer
ggtgtttttgataaaaataatgaaccagcaca	Protospacer
  **********.********** ** *.   

592. spacer 2.45|2202531|32|CP032143|CRISPRCasFinder,CRT matches to MK817115 (Escherichia phage vB_EcoM_phAPEC6, complete genome) position: , mismatch: 9, identity: 0.719

cctgtttttgatgaaaataatgatcctgtcat	CRISPR spacer
ggtgtttttgataaaaataatgaaccagcaca	Protospacer
  **********.********** ** *.   

593. spacer 2.45|2202531|32|CP032143|CRISPRCasFinder,CRT matches to NC_027364 (Escherichia phage PBECO 4, complete genome) position: , mismatch: 9, identity: 0.719

cctgtttttgatgaaaataatgatcctgtcat	CRISPR spacer
ggtgtttttgataaaaataatgaaccagcaca	Protospacer
  **********.********** ** *.   

594. spacer 2.45|2202531|32|CP032143|CRISPRCasFinder,CRT matches to MH383160 (Escherichia phage UB, complete genome) position: , mismatch: 9, identity: 0.719

cctgtttttgatgaaaataatgatcctgtcat	CRISPR spacer
ggtgtttttgataaaaataatgaaccagcaca	Protospacer
  **********.********** ** *.   

595. spacer 2.45|2202531|32|CP032143|CRISPRCasFinder,CRT matches to MK327931 (Escherichia phage vB_EcoM_G17, complete genome) position: , mismatch: 9, identity: 0.719

cctgtttttgatgaaaataatgatcctgtcat	CRISPR spacer
ggtgtttttgataaaaataatgaaccagcaca	Protospacer
  **********.********** ** *.   

596. spacer 2.45|2202531|32|CP032143|CRISPRCasFinder,CRT matches to LT603033 (Escherichia phage vB_Eco_slurp01 genome assembly, chromosome: I) position: , mismatch: 9, identity: 0.719

cctgtttttgatgaaaataatgatcctgtcat	CRISPR spacer
ggtgtttttgataaaaataatgaaccagcaca	Protospacer
  **********.********** ** *.   

597. spacer 2.45|2202531|32|CP032143|CRISPRCasFinder,CRT matches to KM507819 (Escherichia phage 121Q, complete genome) position: , mismatch: 9, identity: 0.719

cctgtttttgatgaaaataatgatcctgtcat	CRISPR spacer
ggtgtttttgataaaaataatgaaccagcaca	Protospacer
  **********.********** ** *.   

598. spacer 2.45|2202531|32|CP032143|CRISPRCasFinder,CRT matches to MK250021 (Prevotella phage Lak-B2, complete genome) position: , mismatch: 9, identity: 0.719

cctgtttttgatgaaaataatgatcctgtcat	CRISPR spacer
aagatgtttgatgaaaataataatccagtatt	Protospacer
   .* ***************.**** **  *

599. spacer 2.45|2202531|32|CP032143|CRISPRCasFinder,CRT matches to MK250024 (Prevotella phage Lak-B5, complete genome) position: , mismatch: 9, identity: 0.719

cctgtttttgatgaaaataatgatcctgtcat	CRISPR spacer
aagatgtttgatgaaaataataatccagtatt	Protospacer
   .* ***************.**** **  *

600. spacer 2.45|2202531|32|CP032143|CRISPRCasFinder,CRT matches to MK250028 (Prevotella phage Lak-B9, complete genome) position: , mismatch: 9, identity: 0.719

cctgtttttgatgaaaataatgatcctgtcat	CRISPR spacer
aagatgtttgatgaaaataataatccagtatt	Protospacer
   .* ***************.**** **  *

601. spacer 2.45|2202531|32|CP032143|CRISPRCasFinder,CRT matches to MK250023 (Prevotella phage Lak-B4, complete genome) position: , mismatch: 9, identity: 0.719

cctgtttttgatgaaaataatgatcctgtcat	CRISPR spacer
aagatgtttgatgaaaataataatccagtatt	Protospacer
   .* ***************.**** **  *

602. spacer 2.45|2202531|32|CP032143|CRISPRCasFinder,CRT matches to MK250025 (Prevotella phage Lak-B6, complete genome) position: , mismatch: 9, identity: 0.719

cctgtttttgatgaaaataatgatcctgtcat	CRISPR spacer
aagatgtttgatgaaaataataatccagtatt	Protospacer
   .* ***************.**** **  *

603. spacer 2.45|2202531|32|CP032143|CRISPRCasFinder,CRT matches to MK250022 (Prevotella phage Lak-B3, complete genome) position: , mismatch: 9, identity: 0.719

cctgtttttgatgaaaataatgatcctgtcat	CRISPR spacer
aagatgtttgatgaaaataataatccagtatt	Protospacer
   .* ***************.**** **  *

604. spacer 2.45|2202531|32|CP032143|CRISPRCasFinder,CRT matches to MK250027 (Prevotella phage Lak-B8, complete genome) position: , mismatch: 9, identity: 0.719

cctgtttttgatgaaaataatgatcctgtcat	CRISPR spacer
aagatgtttgatgaaaataataatccagtatt	Protospacer
   .* ***************.**** **  *

605. spacer 2.45|2202531|32|CP032143|CRISPRCasFinder,CRT matches to MK250026 (Prevotella phage Lak-B7, complete genome) position: , mismatch: 9, identity: 0.719

cctgtttttgatgaaaataatgatcctgtcat	CRISPR spacer
aagatgtttgatgaaaataataatccagtatt	Protospacer
   .* ***************.**** **  *

606. spacer 2.45|2202531|32|CP032143|CRISPRCasFinder,CRT matches to MK250020 (Prevotella phage Lak-B1, complete genome) position: , mismatch: 9, identity: 0.719

cctgtttttgatgaaaataatgatcctgtcat	CRISPR spacer
aagatgtttgatgaaaataataatccagtatt	Protospacer
   .* ***************.**** **  *

607. spacer 2.52|2200131|32|CP032143|PILER-CR matches to MH412654 (Synechococcus phage S-T4, complete genome) position: , mismatch: 9, identity: 0.719

ggaatattaactaaatcagagcaaaagaaaca	CRISPR spacer
tcaatattagctaaatcagagtaaaaattaat	Protospacer
  *******.***********.****.  *  

608. spacer 2.53|2200191|32|CP032143|PILER-CR matches to NC_021789 (Cellulophaga phage phi19:3, complete genome) position: , mismatch: 9, identity: 0.719

tttacaaatatttacaattattttcataaatt	CRISPR spacer
tttacaaatatttacatatatttgaactcgat	Protospacer
****************  *****  *.  . *

609. spacer 2.53|2200191|32|CP032143|PILER-CR matches to NZ_CP044979 (Bacillus thuringiensis strain BT62 plasmid pBT62A, complete sequence) position: , mismatch: 9, identity: 0.719

tttacaaatatttacaattattttcataaatt	CRISPR spacer
tttacaaatattttcaattagttcttacatct	Protospacer
************* ****** **..   * .*

610. spacer 2.55|2200311|32|CP032143|PILER-CR matches to NZ_CP046537 (Acinetobacter baumannii strain XL380 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gtagtcctaaaatccattcatttaagctcaat	CRISPR spacer
atagtcctaaaatccatacacttatccttgtc	Protospacer
.**************** **.***  **.. .

611. spacer 2.67|2201033|32|CP032143|PILER-CR matches to MG945171 (UNVERIFIED: Microviridae sp. isolate 430-1801, partial genome) position: , mismatch: 9, identity: 0.719

attttaatgctactcaggctgcaattagagct	CRISPR spacer
cttttaatgcttctcaggctgctatcgatcgt	Protospacer
 ********** ********** **...   *

612. spacer 2.76|2201573|32|CP032143|PILER-CR matches to MN871446 (UNVERIFIED: Serratia phage KpLz-2_45, complete genome) position: , mismatch: 9, identity: 0.719

ttatcgcaattgacccggaagcagagaccgaa	CRISPR spacer
aattcggtattgacccggaagcagagcacgcg	Protospacer
   ***  ******************  ** .

613. spacer 2.76|2201573|32|CP032143|PILER-CR matches to MN871452 (UNVERIFIED: Serratia phage KpZh_1, complete genome) position: , mismatch: 9, identity: 0.719

ttatcgcaattgacccggaagcagagaccgaa	CRISPR spacer
aattcggtattgacccggaagcagagcacgcg	Protospacer
   ***  ******************  ** .

614. spacer 2.76|2201573|32|CP032143|PILER-CR matches to MN871447 (UNVERIFIED: Serratia phage KpLz_1_41, complete genome) position: , mismatch: 9, identity: 0.719

ttatcgcaattgacccggaagcagagaccgaa	CRISPR spacer
aattcggtattgacccggaagcagagcacgcg	Protospacer
   ***  ******************  ** .

615. spacer 2.76|2201573|32|CP032143|PILER-CR matches to MN871449 (UNVERIFIED: Serratia phage KpXa_1, complete genome) position: , mismatch: 9, identity: 0.719

ttatcgcaattgacccggaagcagagaccgaa	CRISPR spacer
aattcggtattgacccggaagcagagcacgcg	Protospacer
   ***  ******************  ** .

616. spacer 2.76|2201573|32|CP032143|PILER-CR matches to MN871453 (UNVERIFIED: Serratia phage KpZh_LPS_45, complete genome) position: , mismatch: 9, identity: 0.719

ttatcgcaattgacccggaagcagagaccgaa	CRISPR spacer
aattcggtattgacccggaagcagagcacgcg	Protospacer
   ***  ******************  ** .

617. spacer 2.76|2201573|32|CP032143|PILER-CR matches to MN871451 (UNVERIFIED: Serratia phage KpYy_2_45, complete genome) position: , mismatch: 9, identity: 0.719

ttatcgcaattgacccggaagcagagaccgaa	CRISPR spacer
aattcggtattgacccggaagcagagcacgcg	Protospacer
   ***  ******************  ** .

618. spacer 2.76|2201573|32|CP032143|PILER-CR matches to MN871448 (UNVERIFIED: Serratia phage KpSz_1, complete genome) position: , mismatch: 9, identity: 0.719

ttatcgcaattgacccggaagcagagaccgaa	CRISPR spacer
aattcggtattgacccggaagcagagcacgcg	Protospacer
   ***  ******************  ** .

619. spacer 2.83|2201993|32|CP032143|PILER-CR matches to AB797215 (Klebsiella phage 0507-KN2-1 DNA, complete genome) position: , mismatch: 9, identity: 0.719

cgcaagaggaaagtctgcagatggttcagcaa	CRISPR spacer
tcctgtaggatagtctgcagctggttcagctc	Protospacer
. * . **** ********* *********  

620. spacer 2.83|2201993|32|CP032143|PILER-CR matches to MG428990 (Klebsiella phage Menlow, complete genome) position: , mismatch: 9, identity: 0.719

cgcaagaggaaagtctgcagatggttcagcaa	CRISPR spacer
tcctgtaggatagtctgcagctggttcagctc	Protospacer
. * . **** ********* *********  

621. spacer 2.83|2201993|32|CP032143|PILER-CR matches to MN045230 (Klebsiella phage Magnus, complete genome) position: , mismatch: 9, identity: 0.719

cgcaagaggaaagtctgcagatggttcagcaa	CRISPR spacer
tcctgtaggatagtctgcagctggttcagctc	Protospacer
. * . **** ********* *********  

622. spacer 2.83|2201993|32|CP032143|PILER-CR matches to MK373783 (Escherichia phage vB_EcoM_KWBSE43-6, complete genome) position: , mismatch: 9, identity: 0.719

cgcaagaggaaagtctgcagatggttcagcaa	CRISPR spacer
tcctgtaggatagtctgcagctggttcagctc	Protospacer
. * . **** ********* *********  

623. spacer 2.83|2201993|32|CP032143|PILER-CR matches to NC_042047 (Serratia phage vB_Sru_IME250, complete genome) position: , mismatch: 9, identity: 0.719

cgcaagaggaaagtctgcagatggttcagcaa	CRISPR spacer
tcctgtaggatagtctgcagctggttcagctc	Protospacer
. * . **** ********* *********  

624. spacer 2.84|2202053|32|CP032143|PILER-CR matches to NC_031245 (Bacillus phage SP-15, complete genome) position: , mismatch: 9, identity: 0.719

agggtt----catttgctgttcagtctgagttatca	CRISPR spacer
----ttttaccatttgctgttcattcttagttagtt	Protospacer
    **    ************* *** ***** . 

625. spacer 2.88|2202293|32|CP032143|PILER-CR matches to NZ_CP053657 (Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence) position: , mismatch: 9, identity: 0.719

gtgatgttgaatctcagaagaaattcgcagaa	CRISPR spacer
atcttgtagaatgtcagaagaaattcgtatgc	Protospacer
.*  *** **** **************.* . 

626. spacer 2.89|2202353|32|CP032143|PILER-CR matches to MT585306 (Flavobacterium phage FCOV-F43, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

627. spacer 2.89|2202353|32|CP032143|PILER-CR matches to MT585275 (Flavobacterium phage FCOV-F4, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

628. spacer 2.89|2202353|32|CP032143|PILER-CR matches to MT585280 (Flavobacterium phage FCOV-F12, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

629. spacer 2.89|2202353|32|CP032143|PILER-CR matches to MK756088 (Flavobacterium phage FCOV-F25, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

630. spacer 2.89|2202353|32|CP032143|PILER-CR matches to KY951963 (Flavobacterium phage FCV-3, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

631. spacer 2.89|2202353|32|CP032143|PILER-CR matches to MT585285 (Flavobacterium phage FCOV-F19, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

632. spacer 2.89|2202353|32|CP032143|PILER-CR matches to MK756089 (Flavobacterium phage FCOV-F27, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

633. spacer 2.89|2202353|32|CP032143|PILER-CR matches to MT585297 (Flavobacterium phage FCOV-F33, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

634. spacer 2.89|2202353|32|CP032143|PILER-CR matches to MT585274 (Flavobacterium phage FCOV-F3, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

635. spacer 2.89|2202353|32|CP032143|PILER-CR matches to MT585315 (Flavobacterium phage V189, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

636. spacer 2.89|2202353|32|CP032143|PILER-CR matches to MT585277 (Flavobacterium phage FCOV-F8, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

637. spacer 2.89|2202353|32|CP032143|PILER-CR matches to MT585300 (Flavobacterium phage FCOV-F36, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

638. spacer 2.89|2202353|32|CP032143|PILER-CR matches to KY979242 (Flavobacterium phage V182, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

639. spacer 2.89|2202353|32|CP032143|PILER-CR matches to MK756084 (Flavobacterium phage FCOV-F6, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

640. spacer 2.89|2202353|32|CP032143|PILER-CR matches to KY979243 (Flavobacterium phage VK20, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

641. spacer 2.89|2202353|32|CP032143|PILER-CR matches to MT585273 (Flavobacterium phage FCOV-F1, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

642. spacer 2.89|2202353|32|CP032143|PILER-CR matches to MT585298 (Flavobacterium phage FCOV-F34, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

643. spacer 2.89|2202353|32|CP032143|PILER-CR matches to MT585286 (Flavobacterium phage FCOV-F20, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

644. spacer 2.89|2202353|32|CP032143|PILER-CR matches to MT585296 (Flavobacterium phage FCOV-F32, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

645. spacer 2.89|2202353|32|CP032143|PILER-CR matches to KY979246 (Flavobacterium phage VK52, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

646. spacer 2.89|2202353|32|CP032143|PILER-CR matches to MT585314 (Flavobacterium phage V188, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

647. spacer 2.89|2202353|32|CP032143|PILER-CR matches to MT585287 (Flavobacterium phage FCOV-F21, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

648. spacer 2.89|2202353|32|CP032143|PILER-CR matches to KY992519 (Flavobacterium phage V175, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

649. spacer 2.89|2202353|32|CP032143|PILER-CR matches to MT585299 (Flavobacterium phage FCOV-F35, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

650. spacer 2.89|2202353|32|CP032143|PILER-CR matches to MT585279 (Flavobacterium phage FCOV-F11, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

651. spacer 2.89|2202353|32|CP032143|PILER-CR matches to MT585295 (Flavobacterium phage FCOV-F31, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

652. spacer 2.89|2202353|32|CP032143|PILER-CR matches to MT585304 (Flavobacterium phage FCOV-F41, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

653. spacer 2.89|2202353|32|CP032143|PILER-CR matches to MT585288 (Flavobacterium phage FCOV-F22, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

654. spacer 2.89|2202353|32|CP032143|PILER-CR matches to MT585309 (Flavobacterium phage FCOV-F48, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

655. spacer 2.89|2202353|32|CP032143|PILER-CR matches to MT585293 (Flavobacterium phage FCOV-F29, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

656. spacer 2.89|2202353|32|CP032143|PILER-CR matches to MT585291 (Flavobacterium phage FCOV-F26, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

657. spacer 2.89|2202353|32|CP032143|PILER-CR matches to MT585302 (Flavobacterium phage FCOV-F39, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

658. spacer 2.89|2202353|32|CP032143|PILER-CR matches to MT585284 (Flavobacterium phage FCOV-F18, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

659. spacer 2.89|2202353|32|CP032143|PILER-CR matches to MT585305 (Flavobacterium phage FCOV-F42, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

660. spacer 2.89|2202353|32|CP032143|PILER-CR matches to MT585290 (Flavobacterium phage FCOV-F24, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

661. spacer 2.89|2202353|32|CP032143|PILER-CR matches to MT585311 (Flavobacterium phage V183, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

662. spacer 2.89|2202353|32|CP032143|PILER-CR matches to MT585278 (Flavobacterium phage FCOV-F10, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

663. spacer 2.89|2202353|32|CP032143|PILER-CR matches to MT585294 (Flavobacterium phage FCOV-F30, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

664. spacer 2.89|2202353|32|CP032143|PILER-CR matches to KY951964 (Flavobacterium phage FCV-11, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

665. spacer 2.89|2202353|32|CP032143|PILER-CR matches to MT585283 (Flavobacterium phage FCOV-F17, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

666. spacer 2.89|2202353|32|CP032143|PILER-CR matches to MT585301 (Flavobacterium phage FCOV-F38, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

667. spacer 2.89|2202353|32|CP032143|PILER-CR matches to KY979236 (Flavobacterium phage FCV-10, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

668. spacer 2.89|2202353|32|CP032143|PILER-CR matches to KY979237 (Flavobacterium phage FCV-16, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

669. spacer 2.89|2202353|32|CP032143|PILER-CR matches to MT585303 (Flavobacterium phage FCOV-F40, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

670. spacer 2.89|2202353|32|CP032143|PILER-CR matches to KY979241 (Flavobacterium phage V165, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

671. spacer 2.89|2202353|32|CP032143|PILER-CR matches to KY979238 (Flavoibacterium phage FCV-20, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

672. spacer 2.89|2202353|32|CP032143|PILER-CR matches to MK756083 (Flavobacterium phage FCOV-F2, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

673. spacer 2.89|2202353|32|CP032143|PILER-CR matches to MK756085 (Flavobacterium phage FCOV-F9, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

674. spacer 2.89|2202353|32|CP032143|PILER-CR matches to KY992520 (Flavobacterium phage V181, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

675. spacer 2.89|2202353|32|CP032143|PILER-CR matches to MT585308 (Flavobacterium phage FCOV-F47, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

676. spacer 2.89|2202353|32|CP032143|PILER-CR matches to MT431535 (Flavobacterium phage FCV-1.01, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

677. spacer 2.89|2202353|32|CP032143|PILER-CR matches to KY979244 (Flavobacterium phage VK42, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

678. spacer 2.89|2202353|32|CP032143|PILER-CR matches to MT585292 (Flavobacterium phage FCOV-F28, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

679. spacer 2.89|2202353|32|CP032143|PILER-CR matches to NC_041845 (Flavobacterium phage FCV-1, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

680. spacer 2.89|2202353|32|CP032143|PILER-CR matches to MT585276 (Flavobacterium phage FCOV-F7, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

681. spacer 2.89|2202353|32|CP032143|PILER-CR matches to MT585289 (Flavobacterium phage FCOV-F23, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

682. spacer 2.89|2202353|32|CP032143|PILER-CR matches to MK756090 (Flavobacterium phage FCOV-F37, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

683. spacer 2.89|2202353|32|CP032143|PILER-CR matches to MT585312 (Flavobacterium phage V184, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

684. spacer 2.89|2202353|32|CP032143|PILER-CR matches to MT585307 (Flavobacterium phage FCOV-F44, complete genome) position: , mismatch: 9, identity: 0.719

tggcttggagcaacaaagtataaactatacaa	CRISPR spacer
ttacttggagcaacaaagaaaaaactttgagt	Protospacer
* .*************** * ***** *. . 

685. spacer 2.92|2202533|32|CP032143|PILER-CR matches to NZ_CP011375 (Moraxella bovoculi strain 58069 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

cctgtttttgatgaaaataatgatcctgtcat	CRISPR spacer
gaatttattgataaaaataatgatcctgagtt	Protospacer
    ** *****.***************   *

686. spacer 2.92|2202533|32|CP032143|PILER-CR matches to LC494302 (Escherichia phage SP27 DNA, complete genome) position: , mismatch: 9, identity: 0.719

cctgtttttgatgaaaataatgatcctgtcat	CRISPR spacer
ggtgtttttgataaaaataatgaaccagcaca	Protospacer
  **********.********** ** *.   

687. spacer 2.92|2202533|32|CP032143|PILER-CR matches to MK817115 (Escherichia phage vB_EcoM_phAPEC6, complete genome) position: , mismatch: 9, identity: 0.719

cctgtttttgatgaaaataatgatcctgtcat	CRISPR spacer
ggtgtttttgataaaaataatgaaccagcaca	Protospacer
  **********.********** ** *.   

688. spacer 2.92|2202533|32|CP032143|PILER-CR matches to NC_027364 (Escherichia phage PBECO 4, complete genome) position: , mismatch: 9, identity: 0.719

cctgtttttgatgaaaataatgatcctgtcat	CRISPR spacer
ggtgtttttgataaaaataatgaaccagcaca	Protospacer
  **********.********** ** *.   

689. spacer 2.92|2202533|32|CP032143|PILER-CR matches to MH383160 (Escherichia phage UB, complete genome) position: , mismatch: 9, identity: 0.719

cctgtttttgatgaaaataatgatcctgtcat	CRISPR spacer
ggtgtttttgataaaaataatgaaccagcaca	Protospacer
  **********.********** ** *.   

690. spacer 2.92|2202533|32|CP032143|PILER-CR matches to MK327931 (Escherichia phage vB_EcoM_G17, complete genome) position: , mismatch: 9, identity: 0.719

cctgtttttgatgaaaataatgatcctgtcat	CRISPR spacer
ggtgtttttgataaaaataatgaaccagcaca	Protospacer
  **********.********** ** *.   

691. spacer 2.92|2202533|32|CP032143|PILER-CR matches to LT603033 (Escherichia phage vB_Eco_slurp01 genome assembly, chromosome: I) position: , mismatch: 9, identity: 0.719

cctgtttttgatgaaaataatgatcctgtcat	CRISPR spacer
ggtgtttttgataaaaataatgaaccagcaca	Protospacer
  **********.********** ** *.   

692. spacer 2.92|2202533|32|CP032143|PILER-CR matches to KM507819 (Escherichia phage 121Q, complete genome) position: , mismatch: 9, identity: 0.719

cctgtttttgatgaaaataatgatcctgtcat	CRISPR spacer
ggtgtttttgataaaaataatgaaccagcaca	Protospacer
  **********.********** ** *.   

693. spacer 2.92|2202533|32|CP032143|PILER-CR matches to MK250021 (Prevotella phage Lak-B2, complete genome) position: , mismatch: 9, identity: 0.719

cctgtttttgatgaaaataatgatcctgtcat	CRISPR spacer
aagatgtttgatgaaaataataatccagtatt	Protospacer
   .* ***************.**** **  *

694. spacer 2.92|2202533|32|CP032143|PILER-CR matches to MK250024 (Prevotella phage Lak-B5, complete genome) position: , mismatch: 9, identity: 0.719

cctgtttttgatgaaaataatgatcctgtcat	CRISPR spacer
aagatgtttgatgaaaataataatccagtatt	Protospacer
   .* ***************.**** **  *

695. spacer 2.92|2202533|32|CP032143|PILER-CR matches to MK250028 (Prevotella phage Lak-B9, complete genome) position: , mismatch: 9, identity: 0.719

cctgtttttgatgaaaataatgatcctgtcat	CRISPR spacer
aagatgtttgatgaaaataataatccagtatt	Protospacer
   .* ***************.**** **  *

696. spacer 2.92|2202533|32|CP032143|PILER-CR matches to MK250023 (Prevotella phage Lak-B4, complete genome) position: , mismatch: 9, identity: 0.719

cctgtttttgatgaaaataatgatcctgtcat	CRISPR spacer
aagatgtttgatgaaaataataatccagtatt	Protospacer
   .* ***************.**** **  *

697. spacer 2.92|2202533|32|CP032143|PILER-CR matches to MK250025 (Prevotella phage Lak-B6, complete genome) position: , mismatch: 9, identity: 0.719

cctgtttttgatgaaaataatgatcctgtcat	CRISPR spacer
aagatgtttgatgaaaataataatccagtatt	Protospacer
   .* ***************.**** **  *

698. spacer 2.92|2202533|32|CP032143|PILER-CR matches to MK250022 (Prevotella phage Lak-B3, complete genome) position: , mismatch: 9, identity: 0.719

cctgtttttgatgaaaataatgatcctgtcat	CRISPR spacer
aagatgtttgatgaaaataataatccagtatt	Protospacer
   .* ***************.**** **  *

699. spacer 2.92|2202533|32|CP032143|PILER-CR matches to MK250027 (Prevotella phage Lak-B8, complete genome) position: , mismatch: 9, identity: 0.719

cctgtttttgatgaaaataatgatcctgtcat	CRISPR spacer
aagatgtttgatgaaaataataatccagtatt	Protospacer
   .* ***************.**** **  *

700. spacer 2.92|2202533|32|CP032143|PILER-CR matches to MK250026 (Prevotella phage Lak-B7, complete genome) position: , mismatch: 9, identity: 0.719

cctgtttttgatgaaaataatgatcctgtcat	CRISPR spacer
aagatgtttgatgaaaataataatccagtatt	Protospacer
   .* ***************.**** **  *

701. spacer 2.92|2202533|32|CP032143|PILER-CR matches to MK250020 (Prevotella phage Lak-B1, complete genome) position: , mismatch: 9, identity: 0.719

cctgtttttgatgaaaataatgatcctgtcat	CRISPR spacer
aagatgtttgatgaaaataataatccagtatt	Protospacer
   .* ***************.**** **  *

702. spacer 1.5|2046562|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP036456 (Streptomonospora sp. M2 plasmid phiM2, complete sequence) position: , mismatch: 10, identity: 0.688

gaccaacggcacagcagggtcgccgtggtaaa	CRISPR spacer
ctggtacggcatggcagggtcgccgtggtgcg	Protospacer
     ******..****************. .

703. spacer 1.9|2046802|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to AJ630128 (Bacteriophage S-PM2 complete genome) position: , mismatch: 10, identity: 0.688

aaagctaccagtagtatttttgatgccttgag	CRISPR spacer
aaagatacctgtagtatttttgaatacgaata	Protospacer
**** **** *************   *  . .

704. spacer 1.9|2046802|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to NC_006820 (Synechococcus phage S-PM2, complete genome) position: , mismatch: 10, identity: 0.688

aaagctaccagtagtatttttgatgccttgag	CRISPR spacer
aaagatacctgtagtatttttgaatacgaata	Protospacer
**** **** *************   *  . .

705. spacer 1.9|2046802|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to LN828717 (Synechococcus phage S-PM2 spontaneous deletion mutant, complete genome) position: , mismatch: 10, identity: 0.688

aaagctaccagtagtatttttgatgccttgag	CRISPR spacer
aaagatacctgtagtatttttgaatacgaata	Protospacer
**** **** *************   *  . .

706. spacer 1.25|2047762|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to KP696448 (Bacillus phage Stills, complete genome) position: , mismatch: 10, identity: 0.688

ttgaacatatcaaccccatttaatttctttac	CRISPR spacer
tcttctgtatcaagccaatttaatttcttttt	Protospacer
*.   ..****** ** ************* .

707. spacer 1.28|2047942|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to KY670595 (Acinetobacter phage WCHABP12, complete genome) position: , mismatch: 10, identity: 0.688

tactttgcagatgatatcgaaagcaaggcatt	CRISPR spacer
gaagggattgattatatcgaaagcaaggcgtt	Protospacer
 *    .. *** ****************.**

708. spacer 1.28|2047942|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MF346584 (Acinetobacter phage AbP2, complete genome) position: , mismatch: 10, identity: 0.688

tactttgcagatgatatcgaaagcaaggcatt	CRISPR spacer
gaagggattgattatatcgaaagcaaggcgtt	Protospacer
 *    .. *** ****************.**

709. spacer 1.28|2047942|32|CP032143|CRISPRCasFinder,CRT,PILER-CR matches to MN166083 (Acinetobacter phage Abp9, complete genome) position: , mismatch: 10, identity: 0.688

tactttgcagatgatatcgaaagcaaggcatt	CRISPR spacer
gaagggattgattatatcgaaagcaaggcgtt	Protospacer
 *    .. *** ****************.**

710. spacer 2.2|2199949|32|CP032143|CRISPRCasFinder,CRT matches to MK721192 (Enterococcus phage vB_EfaM_Ef2.3, complete genome) position: , mismatch: 10, identity: 0.688

aaaacttataagaatgttaaagatgcttatga	CRISPR spacer
acgttaaataagattgttaaagatgattatac	Protospacer
* . .  ****** *********** ****. 

711. spacer 2.2|2199949|32|CP032143|CRISPRCasFinder,CRT matches to MN694760 (Marine virus AFVG_250M661, complete genome) position: , mismatch: 10, identity: 0.688

aaaacttataagaatgttaaagatgcttatga	CRISPR spacer
aggttacgcaagaatgttaaagataattatga	Protospacer
*.. . ...***************. ******

712. spacer 2.2|2199949|32|CP032143|CRISPRCasFinder,CRT matches to NC_009904 (Enterococcus phage phiEF24C, complete genome) position: , mismatch: 10, identity: 0.688

aaaacttataagaatgttaaagatgcttatga	CRISPR spacer
acgttaaataagattgttaaagatgattatac	Protospacer
* . .  ****** *********** ****. 

713. spacer 2.2|2199949|32|CP032143|CRISPRCasFinder,CRT matches to AP009390 (Enterococcus phage phiEF24C DNA, complete genome) position: , mismatch: 10, identity: 0.688

aaaacttataagaatgttaaagatgcttatga	CRISPR spacer
acgttaaataagattgttaaagatgattatac	Protospacer
* . .  ****** *********** ****. 

714. spacer 2.2|2199949|32|CP032143|CRISPRCasFinder,CRT matches to AB609718 (Enterococcus phage phiEF24C-P2 DNA, complete genome) position: , mismatch: 10, identity: 0.688

aaaacttataagaatgttaaagatgcttatga	CRISPR spacer
acgttaaataagattgttaaagatgattatac	Protospacer
* . .  ****** *********** ****. 

715. spacer 2.6|2200189|32|CP032143|CRISPRCasFinder,CRT matches to MN693005 (Marine virus AFVG_117M50, complete genome) position: , mismatch: 10, identity: 0.688

tttacaaatatttacaattattttcataaatt	CRISPR spacer
tggtaaaaaattttcaattattttcatattaa	Protospacer
*    *** **** **************    

716. spacer 2.16|2200791|32|CP032143|CRISPRCasFinder,CRT matches to NZ_CP017672 (Providencia rettgeri strain RB151 plasmid pRB151-NDM, complete sequence) position: , mismatch: 10, identity: 0.688

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
taattaacatcaaataagattttatttaatac	Protospacer
.*  . . *******.***********.*** 

717. spacer 2.25|2201331|32|CP032143|CRISPRCasFinder,CRT matches to MN865127 (Vibrio alginolyticus strain C1579 plasmid pC1579, complete sequence) position: , mismatch: 10, identity: 0.688

gggcagtttgtaagtggtgcttatcatgagca	CRISPR spacer
acacaatttgtgagtggtgcttatcacataaa	Protospacer
. .**.*****.**************.. . *

718. spacer 2.28|2201511|32|CP032143|CRISPRCasFinder,CRT matches to NC_041966 (Acinetobacter phage WCHABP1, complete genome) position: , mismatch: 10, identity: 0.688

gtgggtatgaccgcccgaaagtgggcaatttt	CRISPR spacer
agtaacctgaccgcctgaaagtaggcaattta	Protospacer
.  ... ********.******.******** 

719. spacer 2.28|2201511|32|CP032143|CRISPRCasFinder,CRT matches to KY670595 (Acinetobacter phage WCHABP12, complete genome) position: , mismatch: 10, identity: 0.688

gtgggtatgaccgcccgaaagtgggcaatttt	CRISPR spacer
agtaacctgaccgcctgaaagtaggcaattta	Protospacer
.  ... ********.******.******** 

720. spacer 2.29|2201571|32|CP032143|CRISPRCasFinder,CRT matches to NZ_CP011490 (Staphylococcus pseudintermedius strain 222 plasmid p222, complete sequence) position: , mismatch: 10, identity: 0.688

ttatcgcaattgacccggaagcagagaccgaa	CRISPR spacer
ttatcgcaattgatccgaaagcaaactatttt	Protospacer
*************.***.*****.*   .   

721. spacer 2.30|2201631|32|CP032143|CRISPRCasFinder,CRT matches to NC_020292 (Clostridium saccharoperbutylacetonicum N1-4(HMT) plasmid Csp_135p, complete sequence) position: , mismatch: 10, identity: 0.688

gaacagcagaaatgctgaaattgtgtctcagt	CRISPR spacer
ctgtggcagcaatgctgaaattgtatctttat	Protospacer
  ...**** **************.***. .*

722. spacer 2.31|2201691|32|CP032143|CRISPRCasFinder,CRT matches to NZ_CP051207 (Dolichospermum flos-aquae CCAP 1403/13F plasmid pAfl69, complete sequence) position: , mismatch: 10, identity: 0.688

caaatatacttaacagtaaaattgatatagtt	CRISPR spacer
gctttatactaaacagtaatattgatagtcat	Protospacer
    ****** ******** *******    *

723. spacer 2.31|2201691|32|CP032143|CRISPRCasFinder,CRT matches to MH333064 (Klebsiella phage Mineola, complete genome) position: , mismatch: 10, identity: 0.688

caaatatacttaacagtaaaattgatatagtt	CRISPR spacer
agcgtgctattaacattaaaattgatacagtt	Protospacer
 . .*..  ****** ***********.****

724. spacer 2.31|2201691|32|CP032143|CRISPRCasFinder,CRT matches to MN101226 (Klebsiella phage KPN2 HKu-2019, complete genome) position: , mismatch: 10, identity: 0.688

caaatatacttaacagtaaaattgatatagtt	CRISPR spacer
agcgtgctattaacattaaaattgatacagtt	Protospacer
 . .*..  ****** ***********.****

725. spacer 2.31|2201691|32|CP032143|CRISPRCasFinder,CRT matches to NC_031095 (Klebsiella phage PKO111, complete genome) position: , mismatch: 10, identity: 0.688

caaatatacttaacagtaaaattgatatagtt	CRISPR spacer
agcgtgctattaacattaaaattgatacagtt	Protospacer
 . .*..  ****** ***********.****

726. spacer 2.31|2201691|32|CP032143|CRISPRCasFinder,CRT matches to MN434095 (Klebsiella pneumoniae phage JIPh_Kp122, complete genome) position: , mismatch: 10, identity: 0.688

caaatatacttaacagtaaaattgatatagtt	CRISPR spacer
agcgtgctattaacattaaaattgatacagtt	Protospacer
 . .*..  ****** ***********.****

727. spacer 2.31|2201691|32|CP032143|CRISPRCasFinder,CRT matches to MN101230 (Klebsiella phage KPN6, complete genome) position: , mismatch: 10, identity: 0.688

caaatatacttaacagtaaaattgatatagtt	CRISPR spacer
agcgtgctattaacattaaaattgatacagtt	Protospacer
 . .*..  ****** ***********.****

728. spacer 2.31|2201691|32|CP032143|CRISPRCasFinder,CRT matches to KY000080 (Klebsiella phage KPV15, complete genome) position: , mismatch: 10, identity: 0.688

caaatatacttaacagtaaaattgatatagtt	CRISPR spacer
agcgtgctattaacattaaaattgatacagtt	Protospacer
 . .*..  ****** ***********.****

729. spacer 2.31|2201691|32|CP032143|CRISPRCasFinder,CRT matches to MG751100 (Klebsiella phage KP1, complete genome) position: , mismatch: 10, identity: 0.688

caaatatacttaacagtaaaattgatatagtt	CRISPR spacer
agcgtgctattaacattaaaattgatacagtt	Protospacer
 . .*..  ****** ***********.****

730. spacer 2.31|2201691|32|CP032143|CRISPRCasFinder,CRT matches to NC_028686 (Klebsiella phage JD18, complete genome) position: , mismatch: 10, identity: 0.688

caaatatacttaacagtaaaattgatatagtt	CRISPR spacer
agcgtgctattaacattaaaattgatacagtt	Protospacer
 . .*..  ****** ***********.****

731. spacer 2.31|2201691|32|CP032143|CRISPRCasFinder,CRT matches to MK421971 (Klebsiella phage vB_KpnM_GF, partial genome) position: , mismatch: 10, identity: 0.688

caaatatacttaacagtaaaattgatatagtt	CRISPR spacer
agcgtgctattaacattaaaattgatacagtt	Protospacer
 . .*..  ****** ***********.****

732. spacer 2.31|2201691|32|CP032143|CRISPRCasFinder,CRT matches to NC_031087 (Klebsiella phage vB_KpnM_KpV477, complete genome) position: , mismatch: 10, identity: 0.688

caaatatacttaacagtaaaattgatatagtt	CRISPR spacer
agcgtgctattaacattaaaattgatacagtt	Protospacer
 . .*..  ****** ***********.****

733. spacer 2.32|2201751|32|CP032143|CRISPRCasFinder,CRT matches to MN694417 (Marine virus AFVG_250M100, complete genome) position: , mismatch: 10, identity: 0.688

aactgttaaacaggatttaagcaaatgagcaa	CRISPR spacer
gggtcggaaagaggatttaggcaaatgagccc	Protospacer
.. *   *** ********.**********  

734. spacer 2.36|2201991|32|CP032143|CRISPRCasFinder,CRT matches to MN478483 (Klebsiella virus UPM 2146, complete genome) position: , mismatch: 10, identity: 0.688

cgcaagaggaaagtctgcagatggttcagcaa	CRISPR spacer
tcctgtaggatagtctgcagctggttcagttc	Protospacer
. * . **** ********* ********.  

735. spacer 2.46|2202591|32|CP032143|CRISPRCasFinder,CRT matches to CP013734 (Campylobacter coli strain OR12 plasmid pOR12Vir, complete sequence) position: , mismatch: 10, identity: 0.688

attaaaatgaacgaattaagaaagaagtttga	CRISPR spacer
gagaaaatgaaagaattaagaaaaaaataaac	Protospacer
.  ******** ***********.**.*  . 

736. spacer 2.49|2199951|32|CP032143|PILER-CR matches to MK721192 (Enterococcus phage vB_EfaM_Ef2.3, complete genome) position: , mismatch: 10, identity: 0.688

aaaacttataagaatgttaaagatgcttatga	CRISPR spacer
acgttaaataagattgttaaagatgattatac	Protospacer
* . .  ****** *********** ****. 

737. spacer 2.49|2199951|32|CP032143|PILER-CR matches to MN694760 (Marine virus AFVG_250M661, complete genome) position: , mismatch: 10, identity: 0.688

aaaacttataagaatgttaaagatgcttatga	CRISPR spacer
aggttacgcaagaatgttaaagataattatga	Protospacer
*.. . ...***************. ******

738. spacer 2.49|2199951|32|CP032143|PILER-CR matches to NC_009904 (Enterococcus phage phiEF24C, complete genome) position: , mismatch: 10, identity: 0.688

aaaacttataagaatgttaaagatgcttatga	CRISPR spacer
acgttaaataagattgttaaagatgattatac	Protospacer
* . .  ****** *********** ****. 

739. spacer 2.49|2199951|32|CP032143|PILER-CR matches to AP009390 (Enterococcus phage phiEF24C DNA, complete genome) position: , mismatch: 10, identity: 0.688

aaaacttataagaatgttaaagatgcttatga	CRISPR spacer
acgttaaataagattgttaaagatgattatac	Protospacer
* . .  ****** *********** ****. 

740. spacer 2.49|2199951|32|CP032143|PILER-CR matches to AB609718 (Enterococcus phage phiEF24C-P2 DNA, complete genome) position: , mismatch: 10, identity: 0.688

aaaacttataagaatgttaaagatgcttatga	CRISPR spacer
acgttaaataagattgttaaagatgattatac	Protospacer
* . .  ****** *********** ****. 

741. spacer 2.53|2200191|32|CP032143|PILER-CR matches to MN693005 (Marine virus AFVG_117M50, complete genome) position: , mismatch: 10, identity: 0.688

tttacaaatatttacaattattttcataaatt	CRISPR spacer
tggtaaaaaattttcaattattttcatattaa	Protospacer
*    *** **** **************    

742. spacer 2.63|2200793|32|CP032143|PILER-CR matches to NZ_CP017672 (Providencia rettgeri strain RB151 plasmid pRB151-NDM, complete sequence) position: , mismatch: 10, identity: 0.688

cacaccgaatcaaatgagattttatttgataa	CRISPR spacer
taattaacatcaaataagattttatttaatac	Protospacer
.*  . . *******.***********.*** 

743. spacer 2.72|2201333|32|CP032143|PILER-CR matches to MN865127 (Vibrio alginolyticus strain C1579 plasmid pC1579, complete sequence) position: , mismatch: 10, identity: 0.688

gggcagtttgtaagtggtgcttatcatgagca	CRISPR spacer
acacaatttgtgagtggtgcttatcacataaa	Protospacer
. .**.*****.**************.. . *

744. spacer 2.75|2201513|32|CP032143|PILER-CR matches to NC_041966 (Acinetobacter phage WCHABP1, complete genome) position: , mismatch: 10, identity: 0.688

gtgggtatgaccgcccgaaagtgggcaatttt	CRISPR spacer
agtaacctgaccgcctgaaagtaggcaattta	Protospacer
.  ... ********.******.******** 

745. spacer 2.75|2201513|32|CP032143|PILER-CR matches to KY670595 (Acinetobacter phage WCHABP12, complete genome) position: , mismatch: 10, identity: 0.688

gtgggtatgaccgcccgaaagtgggcaatttt	CRISPR spacer
agtaacctgaccgcctgaaagtaggcaattta	Protospacer
.  ... ********.******.******** 

746. spacer 2.76|2201573|32|CP032143|PILER-CR matches to NZ_CP011490 (Staphylococcus pseudintermedius strain 222 plasmid p222, complete sequence) position: , mismatch: 10, identity: 0.688

ttatcgcaattgacccggaagcagagaccgaa	CRISPR spacer
ttatcgcaattgatccgaaagcaaactatttt	Protospacer
*************.***.*****.*   .   

747. spacer 2.77|2201633|32|CP032143|PILER-CR matches to NC_020292 (Clostridium saccharoperbutylacetonicum N1-4(HMT) plasmid Csp_135p, complete sequence) position: , mismatch: 10, identity: 0.688

gaacagcagaaatgctgaaattgtgtctcagt	CRISPR spacer
ctgtggcagcaatgctgaaattgtatctttat	Protospacer
  ...**** **************.***. .*

748. spacer 2.78|2201693|32|CP032143|PILER-CR matches to NZ_CP051207 (Dolichospermum flos-aquae CCAP 1403/13F plasmid pAfl69, complete sequence) position: , mismatch: 10, identity: 0.688

caaatatacttaacagtaaaattgatatagtt	CRISPR spacer
gctttatactaaacagtaatattgatagtcat	Protospacer
    ****** ******** *******    *

749. spacer 2.78|2201693|32|CP032143|PILER-CR matches to MH333064 (Klebsiella phage Mineola, complete genome) position: , mismatch: 10, identity: 0.688

caaatatacttaacagtaaaattgatatagtt	CRISPR spacer
agcgtgctattaacattaaaattgatacagtt	Protospacer
 . .*..  ****** ***********.****

750. spacer 2.78|2201693|32|CP032143|PILER-CR matches to MN101226 (Klebsiella phage KPN2 HKu-2019, complete genome) position: , mismatch: 10, identity: 0.688

caaatatacttaacagtaaaattgatatagtt	CRISPR spacer
agcgtgctattaacattaaaattgatacagtt	Protospacer
 . .*..  ****** ***********.****

751. spacer 2.78|2201693|32|CP032143|PILER-CR matches to NC_031095 (Klebsiella phage PKO111, complete genome) position: , mismatch: 10, identity: 0.688

caaatatacttaacagtaaaattgatatagtt	CRISPR spacer
agcgtgctattaacattaaaattgatacagtt	Protospacer
 . .*..  ****** ***********.****

752. spacer 2.78|2201693|32|CP032143|PILER-CR matches to MN434095 (Klebsiella pneumoniae phage JIPh_Kp122, complete genome) position: , mismatch: 10, identity: 0.688

caaatatacttaacagtaaaattgatatagtt	CRISPR spacer
agcgtgctattaacattaaaattgatacagtt	Protospacer
 . .*..  ****** ***********.****

753. spacer 2.78|2201693|32|CP032143|PILER-CR matches to MN101230 (Klebsiella phage KPN6, complete genome) position: , mismatch: 10, identity: 0.688

caaatatacttaacagtaaaattgatatagtt	CRISPR spacer
agcgtgctattaacattaaaattgatacagtt	Protospacer
 . .*..  ****** ***********.****

754. spacer 2.78|2201693|32|CP032143|PILER-CR matches to KY000080 (Klebsiella phage KPV15, complete genome) position: , mismatch: 10, identity: 0.688

caaatatacttaacagtaaaattgatatagtt	CRISPR spacer
agcgtgctattaacattaaaattgatacagtt	Protospacer
 . .*..  ****** ***********.****

755. spacer 2.78|2201693|32|CP032143|PILER-CR matches to MG751100 (Klebsiella phage KP1, complete genome) position: , mismatch: 10, identity: 0.688

caaatatacttaacagtaaaattgatatagtt	CRISPR spacer
agcgtgctattaacattaaaattgatacagtt	Protospacer
 . .*..  ****** ***********.****

756. spacer 2.78|2201693|32|CP032143|PILER-CR matches to NC_028686 (Klebsiella phage JD18, complete genome) position: , mismatch: 10, identity: 0.688

caaatatacttaacagtaaaattgatatagtt	CRISPR spacer
agcgtgctattaacattaaaattgatacagtt	Protospacer
 . .*..  ****** ***********.****

757. spacer 2.78|2201693|32|CP032143|PILER-CR matches to MK421971 (Klebsiella phage vB_KpnM_GF, partial genome) position: , mismatch: 10, identity: 0.688

caaatatacttaacagtaaaattgatatagtt	CRISPR spacer
agcgtgctattaacattaaaattgatacagtt	Protospacer
 . .*..  ****** ***********.****

758. spacer 2.78|2201693|32|CP032143|PILER-CR matches to NC_031087 (Klebsiella phage vB_KpnM_KpV477, complete genome) position: , mismatch: 10, identity: 0.688

caaatatacttaacagtaaaattgatatagtt	CRISPR spacer
agcgtgctattaacattaaaattgatacagtt	Protospacer
 . .*..  ****** ***********.****

759. spacer 2.79|2201753|32|CP032143|PILER-CR matches to MN694417 (Marine virus AFVG_250M100, complete genome) position: , mismatch: 10, identity: 0.688

aactgttaaacaggatttaagcaaatgagcaa	CRISPR spacer
gggtcggaaagaggatttaggcaaatgagccc	Protospacer
.. *   *** ********.**********  

760. spacer 2.83|2201993|32|CP032143|PILER-CR matches to MN478483 (Klebsiella virus UPM 2146, complete genome) position: , mismatch: 10, identity: 0.688

cgcaagaggaaagtctgcagatggttcagcaa	CRISPR spacer
tcctgtaggatagtctgcagctggttcagttc	Protospacer
. * . **** ********* ********.  

761. spacer 2.93|2202593|32|CP032143|PILER-CR matches to CP013734 (Campylobacter coli strain OR12 plasmid pOR12Vir, complete sequence) position: , mismatch: 10, identity: 0.688

attaaaatgaacgaattaagaaagaagtttga	CRISPR spacer
gagaaaatgaaagaattaagaaaaaaataaac	Protospacer
.  ******** ***********.**.*  . 

762. spacer 2.25|2201331|32|CP032143|CRISPRCasFinder,CRT matches to NC_027341 (Lactococcus phage WRP3, complete genome) position: , mismatch: 11, identity: 0.656

gggcagtttgtaagtggtgcttatcatgagca	CRISPR spacer
ttaagatttgtaagtagtgattatcatgatat	Protospacer
  . ..*********.*** *********   

763. spacer 2.44|2202471|32|CP032143|CRISPRCasFinder,CRT matches to MN692986 (Marine virus AFVG_117M62, complete genome) position: , mismatch: 11, identity: 0.656

tattcgtggtaatgcccataactcaaatacat	CRISPR spacer
atggggtggtagtgcccataactctaatggtc	Protospacer
     ******.************ ***.  .

764. spacer 2.72|2201333|32|CP032143|PILER-CR matches to NC_027341 (Lactococcus phage WRP3, complete genome) position: , mismatch: 11, identity: 0.656

gggcagtttgtaagtggtgcttatcatgagca	CRISPR spacer
ttaagatttgtaagtagtgattatcatgatat	Protospacer
  . ..*********.*** *********   

765. spacer 2.91|2202473|32|CP032143|PILER-CR matches to MN692986 (Marine virus AFVG_117M62, complete genome) position: , mismatch: 11, identity: 0.656

tattcgtggtaatgcccataactcaaatacat	CRISPR spacer
atggggtggtagtgcccataactctaatggtc	Protospacer
     ******.************ ***.  .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1631401 : 1671609 58 Acinetobacter_phage(27.59%) tail,head,portal,integrase,terminase,protease,transposase,capsid attL 1630903:1630919|attR 1644255:1644271
DBSCAN-SWA_2 1859211 : 1881168 35 Acinetobacter_phage(50.0%) head NA
DBSCAN-SWA_3 2180922 : 2191618 9 Indivirus(16.67%) NA NA
DBSCAN-SWA_4 3003105 : 3008306 7 uncultured_Caudovirales_phage(83.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP032139
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032139_1 2341-2450 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP032139_1 1.1|2376|40|CP032139|CRISPRCasFinder 2376-2415 40 NC_010401 Acinetobacter baumannii AYE plasmid p1ABAYE, complete sequence 464-503 0 1.0
CP032139_1 1.1|2376|40|CP032139|CRISPRCasFinder 2376-2415 40 NZ_CP042368 Acinetobacter pittii strain C54 plasmid pC54_004, complete sequence 2569-2608 0 1.0
CP032139_1 1.1|2376|40|CP032139|CRISPRCasFinder 2376-2415 40 NZ_CP032139 Acinetobacter sp. WCHAc010052 plasmid p2_010052, complete sequence 2376-2415 0 1.0
CP032139_1 1.1|2376|40|CP032139|CRISPRCasFinder 2376-2415 40 NZ_KP890934 Acinetobacter baumannii strain BM2686 plasmid pIP1858, complete sequence 465-504 0 1.0
CP032139_1 1.1|2376|40|CP032139|CRISPRCasFinder 2376-2415 40 NZ_CP032121 Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.6, complete sequence 5001-5040 0 1.0
CP032139_1 1.1|2376|40|CP032139|CRISPRCasFinder 2376-2415 40 NZ_CP044490 Acinetobacter schindleri strain HZE30-1 plasmid pHZE30-1-7, complete sequence 2772-2811 0 1.0
CP032139_1 1.1|2376|40|CP032139|CRISPRCasFinder 2376-2415 40 NZ_CP033127 Acinetobacter wuhouensis strain WCHAW010062 plasmid p7_010062, complete sequence 1958-1997 0 1.0
CP032139_1 1.1|2376|40|CP032139|CRISPRCasFinder 2376-2415 40 NZ_CP032272 Acinetobacter sp. WCHAc010034 plasmid p4_010034, complete sequence 4655-4694 0 1.0
CP032139_1 1.1|2376|40|CP032139|CRISPRCasFinder 2376-2415 40 NZ_CP042561 Acinetobacter baumannii strain E47 plasmid pE47_005, complete sequence 2442-2481 0 1.0
CP032139_1 1.1|2376|40|CP032139|CRISPRCasFinder 2376-2415 40 NZ_CP029390 Acinetobacter defluvii strain WCHA30 plasmid p2_010030, complete sequence 2493-2532 0 1.0
CP032139_1 1.1|2376|40|CP032139|CRISPRCasFinder 2376-2415 40 NZ_CP031712 Acinetobacter wuhouensis strain WCHA60 plasmid p4_010060, complete sequence 4290-4329 0 1.0
CP032139_1 1.1|2376|40|CP032139|CRISPRCasFinder 2376-2415 40 NZ_CP032103 Acinetobacter lwoffii strain EK30A plasmid pALWEK1.10, complete sequence 6993-7032 0 1.0

1. spacer 1.1|2376|40|CP032139|CRISPRCasFinder matches to NC_010401 (Acinetobacter baumannii AYE plasmid p1ABAYE, complete sequence) position: , mismatch: 0, identity: 1.0

gcatgattttatcgtttaaaagggtacaaatagcatgatt	CRISPR spacer
gcatgattttatcgtttaaaagggtacaaatagcatgatt	Protospacer
****************************************

2. spacer 1.1|2376|40|CP032139|CRISPRCasFinder matches to NZ_CP042368 (Acinetobacter pittii strain C54 plasmid pC54_004, complete sequence) position: , mismatch: 0, identity: 1.0

gcatgattttatcgtttaaaagggtacaaatagcatgatt	CRISPR spacer
gcatgattttatcgtttaaaagggtacaaatagcatgatt	Protospacer
****************************************

3. spacer 1.1|2376|40|CP032139|CRISPRCasFinder matches to NZ_CP032139 (Acinetobacter sp. WCHAc010052 plasmid p2_010052, complete sequence) position: , mismatch: 0, identity: 1.0

gcatgattttatcgtttaaaagggtacaaatagcatgatt	CRISPR spacer
gcatgattttatcgtttaaaagggtacaaatagcatgatt	Protospacer
****************************************

4. spacer 1.1|2376|40|CP032139|CRISPRCasFinder matches to NZ_KP890934 (Acinetobacter baumannii strain BM2686 plasmid pIP1858, complete sequence) position: , mismatch: 0, identity: 1.0

gcatgattttatcgtttaaaagggtacaaatagcatgatt	CRISPR spacer
gcatgattttatcgtttaaaagggtacaaatagcatgatt	Protospacer
****************************************

5. spacer 1.1|2376|40|CP032139|CRISPRCasFinder matches to NZ_CP032121 (Acinetobacter lwoffii strain ED45-23 plasmid pALWED2.6, complete sequence) position: , mismatch: 0, identity: 1.0

gcatgattttatcgtttaaaagggtacaaatagcatgatt	CRISPR spacer
gcatgattttatcgtttaaaagggtacaaatagcatgatt	Protospacer
****************************************

6. spacer 1.1|2376|40|CP032139|CRISPRCasFinder matches to NZ_CP044490 (Acinetobacter schindleri strain HZE30-1 plasmid pHZE30-1-7, complete sequence) position: , mismatch: 0, identity: 1.0

gcatgattttatcgtttaaaagggtacaaatagcatgatt	CRISPR spacer
gcatgattttatcgtttaaaagggtacaaatagcatgatt	Protospacer
****************************************

7. spacer 1.1|2376|40|CP032139|CRISPRCasFinder matches to NZ_CP033127 (Acinetobacter wuhouensis strain WCHAW010062 plasmid p7_010062, complete sequence) position: , mismatch: 0, identity: 1.0

gcatgattttatcgtttaaaagggtacaaatagcatgatt	CRISPR spacer
gcatgattttatcgtttaaaagggtacaaatagcatgatt	Protospacer
****************************************

8. spacer 1.1|2376|40|CP032139|CRISPRCasFinder matches to NZ_CP032272 (Acinetobacter sp. WCHAc010034 plasmid p4_010034, complete sequence) position: , mismatch: 0, identity: 1.0

gcatgattttatcgtttaaaagggtacaaatagcatgatt	CRISPR spacer
gcatgattttatcgtttaaaagggtacaaatagcatgatt	Protospacer
****************************************

9. spacer 1.1|2376|40|CP032139|CRISPRCasFinder matches to NZ_CP042561 (Acinetobacter baumannii strain E47 plasmid pE47_005, complete sequence) position: , mismatch: 0, identity: 1.0

gcatgattttatcgtttaaaagggtacaaatagcatgatt	CRISPR spacer
gcatgattttatcgtttaaaagggtacaaatagcatgatt	Protospacer
****************************************

10. spacer 1.1|2376|40|CP032139|CRISPRCasFinder matches to NZ_CP029390 (Acinetobacter defluvii strain WCHA30 plasmid p2_010030, complete sequence) position: , mismatch: 0, identity: 1.0

gcatgattttatcgtttaaaagggtacaaatagcatgatt	CRISPR spacer
gcatgattttatcgtttaaaagggtacaaatagcatgatt	Protospacer
****************************************

11. spacer 1.1|2376|40|CP032139|CRISPRCasFinder matches to NZ_CP031712 (Acinetobacter wuhouensis strain WCHA60 plasmid p4_010060, complete sequence) position: , mismatch: 0, identity: 1.0

gcatgattttatcgtttaaaagggtacaaatagcatgatt	CRISPR spacer
gcatgattttatcgtttaaaagggtacaaatagcatgatt	Protospacer
****************************************

12. spacer 1.1|2376|40|CP032139|CRISPRCasFinder matches to NZ_CP032103 (Acinetobacter lwoffii strain EK30A plasmid pALWEK1.10, complete sequence) position: , mismatch: 0, identity: 1.0

gcatgattttatcgtttaaaagggtacaaatagcatgatt	CRISPR spacer
gcatgattttatcgtttaaaagggtacaaatagcatgatt	Protospacer
****************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage