Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP034956 Escherichia coli strain SCEC020026 plasmid pCTXM15_020026, complete sequence 0 crisprs NA 0 0 2 0
CP034955 Escherichia coli strain SCEC020026 plasmid p2_020026, complete sequence 0 crisprs NA 0 0 0 0
CP034957 Escherichia coli strain SCEC020026 plasmid pNDM5_020026, complete sequence 0 crisprs NA 0 0 4 0
CP034958 Escherichia coli strain SCEC020026 chromosome, complete genome 10 crisprs RT,csa3,PD-DExK,cas5,cas6e,cas1,cas2,cas3,DEDDh,c2c9_V-U4,DinG 1 21 10 0
CP034954 Escherichia coli strain SCEC020026 plasmid p1_020026, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. CP034956
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 8609 : 57113 48 Escherichia_phage(50.0%) protease,integrase,transposase NA
DBSCAN-SWA_2 89835 : 97265 7 Escherichia_phage(57.14%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP034957
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 11827 12 Bacillus_phage(33.33%) transposase NA
DBSCAN-SWA_2 15089 : 19542 6 Escherichia_phage(40.0%) transposase NA
DBSCAN-SWA_3 24142 : 24658 1 Tupanvirus(100.0%) NA NA
DBSCAN-SWA_4 43289 : 45129 2 Moraxella_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. CP034958
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034958_1 635311-635450 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034958_2 663705-663956 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034958_3 678537-678654 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034958_4 1051987-1052442 Orphan I-E
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034958_5 1074827-1075405 Unclear I-E
9 spacers
cas2,cas1,cas6e,cas5

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034958_6 1580575-1580692 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034958_7 2185231-2185354 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034958_10 3211186-3211330 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034958_11 3721999-3722152 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034958_12 3935446-3935578 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP034958_9 9.2|3199854|26|CP034958|PILER-CR 3199854-3199879 26 CP034958.1 2700064-2700089 0 1.0

1. spacer 9.2|3199854|26|CP034958|PILER-CR matches to position: 2700064-2700089, mismatch: 0, identity: 1.0

atttacctctttcaggtaaactttat	CRISPR spacer
atttacctctttcaggtaaactttat	Protospacer
**************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP034958_8 8.1|2906369|40|CP034958|CRISPRCasFinder 2906369-2906408 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 0 1.0
CP034958_9 9.1|3199807|25|CP034958|PILER-CR 3199807-3199831 25 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 44572-44596 0 1.0
CP034958_9 9.2|3199854|26|CP034958|PILER-CR 3199854-3199879 26 NC_049946 Escherichia virus Lambda_4A7 genome assembly, chromosome: 1 37604-37629 0 1.0
CP034958_9 9.2|3199854|26|CP034958|PILER-CR 3199854-3199879 26 LR595861 Escherichia virus Lambda_4C10 genome assembly, chromosome: 1 37887-37912 0 1.0
CP034958_12 12.1|3935463|42|CP034958|PILER-CR 3935463-3935504 42 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141085-141126 0 1.0
CP034958_9 9.2|3199854|26|CP034958|PILER-CR 3199854-3199879 26 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 44524-44549 1 0.962
CP034958_12 12.2|3935522|40|CP034958|PILER-CR 3935522-3935561 40 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141028-141067 1 0.975
CP034958_7 7.1|2185274|38|CP034958|CRISPRCasFinder 2185274-2185311 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
CP034958_9 9.1|3199807|25|CP034958|PILER-CR 3199807-3199831 25 NC_049946 Escherichia virus Lambda_4A7 genome assembly, chromosome: 1 37652-37676 2 0.92
CP034958_9 9.1|3199807|25|CP034958|PILER-CR 3199807-3199831 25 LR595861 Escherichia virus Lambda_4C10 genome assembly, chromosome: 1 37935-37959 2 0.92
CP034958_11 11.1|3722052|48|CP034958|CRISPRCasFinder 3722052-3722099 48 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4089-4136 3 0.938
CP034958_11 11.1|3722052|48|CP034958|CRISPRCasFinder 3722052-3722099 48 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4088-4135 3 0.938
CP034958_11 11.1|3722052|48|CP034958|CRISPRCasFinder 3722052-3722099 48 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4088-4135 3 0.938
CP034958_11 11.1|3722052|48|CP034958|CRISPRCasFinder 3722052-3722099 48 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4088-4135 3 0.938
CP034958_9 9.2|3199854|26|CP034958|PILER-CR 3199854-3199879 26 NZ_CP015341 Lactobacillus brevis strain 100D8 plasmid unnamed3, complete sequence 35661-35686 4 0.846
CP034958_1 1.1|635360|42|CP034958|CRISPRCasFinder 635360-635401 42 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 30214-30255 7 0.833
CP034958_4 4.6|1052321|32|CP034958|PILER-CR,CRISPRCasFinder,CRT 1052321-1052352 32 NZ_MG299151 Shigella sonnei strain SH287-2 plasmid pSH287-2, complete sequence 51276-51307 7 0.781
CP034958_4 4.6|1052321|32|CP034958|PILER-CR,CRISPRCasFinder,CRT 1052321-1052352 32 NZ_KY471628 Shigella sonnei strain SH15sh99 plasmid pSH15sh99, complete sequence 45716-45747 7 0.781
CP034958_4 4.6|1052321|32|CP034958|PILER-CR,CRISPRCasFinder,CRT 1052321-1052352 32 NZ_MG299131 Shigella sonnei strain SH271-2 plasmid pSH271-2, complete sequence 51276-51307 7 0.781
CP034958_4 4.6|1052321|32|CP034958|PILER-CR,CRISPRCasFinder,CRT 1052321-1052352 32 NZ_KY471629 Shigella sonnei strain SH15sh105 plasmid pSH15sh104, complete sequence 45716-45747 7 0.781
CP034958_4 4.6|1052321|32|CP034958|PILER-CR,CRISPRCasFinder,CRT 1052321-1052352 32 NZ_MG299133 Shigella sonnei strain SH272-2 plasmid pSH272-2, complete sequence 51276-51307 7 0.781
CP034958_4 4.6|1052321|32|CP034958|PILER-CR,CRISPRCasFinder,CRT 1052321-1052352 32 NZ_MG299128 Shigella sonnei strain SH262-2 plasmid pSH262-2, complete sequence 51276-51307 7 0.781
CP034958_4 4.6|1052321|32|CP034958|PILER-CR,CRISPRCasFinder,CRT 1052321-1052352 32 NZ_MG299147 Shigella sonnei strain SH284-2 plasmid pSH284-2, complete sequence 51276-51307 7 0.781
CP034958_4 4.6|1052321|32|CP034958|PILER-CR,CRISPRCasFinder,CRT 1052321-1052352 32 NC_018995 Escherichia coli plasmid pHUSEC41-1, complete sequence 29015-29046 7 0.781
CP034958_4 4.6|1052321|32|CP034958|PILER-CR,CRISPRCasFinder,CRT 1052321-1052352 32 NZ_CP053235 Escherichia coli strain SCU-106 plasmid pSCU-106-1, complete sequence 78292-78323 7 0.781
CP034958_4 4.6|1052321|32|CP034958|PILER-CR,CRISPRCasFinder,CRT 1052321-1052352 32 NZ_CP005999 Escherichia coli B7A plasmid pEB1, complete sequence 39563-39594 7 0.781
CP034958_4 4.6|1052321|32|CP034958|PILER-CR,CRISPRCasFinder,CRT 1052321-1052352 32 KU932021 Escherichia coli plasmid pEC3I, complete sequence 51902-51933 7 0.781
CP034958_4 4.6|1052321|32|CP034958|PILER-CR,CRISPRCasFinder,CRT 1052321-1052352 32 NZ_CP024154 Escherichia coli strain 14EC033 plasmid p14EC033g, complete sequence 18560-18591 7 0.781
CP034958_4 4.6|1052321|32|CP034958|PILER-CR,CRISPRCasFinder,CRT 1052321-1052352 32 NC_011754 Escherichia coli ED1a plasmid pECOED, complete sequence 49240-49271 7 0.781
CP034958_4 4.6|1052321|32|CP034958|PILER-CR,CRISPRCasFinder,CRT 1052321-1052352 32 NZ_CP015141 Escherichia coli strain Ecol_732 plasmid pEC732_3, complete sequence 81434-81465 7 0.781
CP034958_4 4.6|1052321|32|CP034958|PILER-CR,CRISPRCasFinder,CRT 1052321-1052352 32 NZ_LR213460 Shigella sonnei strain AUSMDU00008333 isolate AUSMDU00008333 plasmid 3 28916-28947 7 0.781
CP034958_4 4.6|1052321|32|CP034958|PILER-CR,CRISPRCasFinder,CRT 1052321-1052352 32 NZ_MH287044 Escherichia coli strain 5.1-R1 plasmid pCERC6, complete sequence 36182-36213 7 0.781
CP034958_4 4.6|1052321|32|CP034958|PILER-CR,CRISPRCasFinder,CRT 1052321-1052352 32 NZ_MH618673 Escherichia coli strain 838B plasmid p838B-R, complete sequence 32230-32261 7 0.781
CP034958_5 5.1|1074857|31|CP034958|CRISPRCasFinder 1074857-1074887 31 NC_007336 Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence 62682-62712 7 0.774
CP034958_5 5.1|1074857|31|CP034958|CRISPRCasFinder 1074857-1074887 31 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 1222106-1222136 7 0.774
CP034958_5 5.1|1074857|31|CP034958|CRISPRCasFinder 1074857-1074887 31 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 2467672-2467702 7 0.774
CP034958_5 5.4|1075040|31|CP034958|CRISPRCasFinder 1075040-1075070 31 NZ_CP034185 Deinococcus sp. S14-83 strain S14-83T plasmid unnamed1, complete sequence 17977-18007 7 0.774
CP034958_5 5.7|1075223|31|CP034958|CRISPRCasFinder 1075223-1075253 31 NC_007336 Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence 530641-530671 7 0.774
CP034958_1 1.1|635360|42|CP034958|CRISPRCasFinder 635360-635401 42 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 24899-24940 8 0.81
CP034958_4 4.5|1052260|32|CP034958|PILER-CR,CRISPRCasFinder,CRT 1052260-1052291 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1417960-1417991 8 0.75
CP034958_5 5.4|1075040|31|CP034958|CRISPRCasFinder 1075040-1075070 31 NZ_CP017753 Cupriavidus sp. USMAHM13 plasmid unnamed1, complete sequence 97498-97528 8 0.742
CP034958_5 5.7|1075223|31|CP034958|CRISPRCasFinder 1075223-1075253 31 NZ_CP036297 Planctomycetes bacterium Pla86 plasmid pPla86_1, complete sequence 14953-14983 8 0.742
CP034958_5 5.7|1075223|31|CP034958|CRISPRCasFinder 1075223-1075253 31 NZ_CP036288 Planctomycetes bacterium Pla133 plasmid pPla133_1, complete sequence 14983-15013 8 0.742
CP034958_5 5.7|1075223|31|CP034958|CRISPRCasFinder 1075223-1075253 31 NZ_CP015882 Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence 3454-3484 8 0.742
CP034958_5 5.7|1075223|31|CP034958|CRISPRCasFinder 1075223-1075253 31 NZ_CP017750 Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence 148992-149022 8 0.742
CP034958_5 5.10|1074857|32|CP034958|PILER-CR,CRT 1074857-1074888 32 NC_007336 Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence 62682-62713 8 0.75
CP034958_5 5.10|1074857|32|CP034958|PILER-CR,CRT 1074857-1074888 32 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 1222106-1222137 8 0.75
CP034958_5 5.10|1074857|32|CP034958|PILER-CR,CRT 1074857-1074888 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 2467671-2467702 8 0.75
CP034958_5 5.10|1074857|32|CP034958|PILER-CR,CRT 1074857-1074888 32 NC_008759 Polaromonas naphthalenivorans CJ2 plasmid pPNAP03, complete sequence 12670-12701 8 0.75
CP034958_5 5.13|1075040|32|CP034958|PILER-CR,CRT 1075040-1075071 32 NZ_CP034185 Deinococcus sp. S14-83 strain S14-83T plasmid unnamed1, complete sequence 17977-18008 8 0.75
CP034958_5 5.13|1075040|32|CP034958|PILER-CR,CRT 1075040-1075071 32 NZ_CP017753 Cupriavidus sp. USMAHM13 plasmid unnamed1, complete sequence 97497-97528 8 0.75
CP034958_5 5.16|1075223|32|CP034958|PILER-CR,CRT 1075223-1075254 32 NZ_CP017750 Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence 148991-149022 8 0.75
CP034958_5 5.16|1075223|32|CP034958|PILER-CR,CRT 1075223-1075254 32 NC_007336 Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence 530640-530671 8 0.75
CP034958_5 5.17|1075284|32|CP034958|PILER-CR,CRT 1075284-1075315 32 NZ_CP006991 Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence 532343-532374 8 0.75
CP034958_1 1.1|635360|42|CP034958|CRISPRCasFinder 635360-635401 42 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 24786-24827 9 0.786
CP034958_5 5.1|1074857|31|CP034958|CRISPRCasFinder 1074857-1074887 31 NC_011987 Agrobacterium radiobacter K84 plasmid pAtK84c, complete sequence 86182-86212 9 0.71
CP034958_5 5.2|1074918|31|CP034958|CRISPRCasFinder 1074918-1074948 31 CP011075 Brevibacillus laterosporus strain B9 plasmid unnamed1, complete sequence 244686-244716 9 0.71
CP034958_5 5.2|1074918|31|CP034958|CRISPRCasFinder 1074918-1074948 31 GU075905 Prochlorococcus phage P-HM2, complete genome 78536-78566 9 0.71
CP034958_5 5.4|1075040|31|CP034958|CRISPRCasFinder 1075040-1075070 31 NZ_CP017750 Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence 405875-405905 9 0.71
CP034958_5 5.4|1075040|31|CP034958|CRISPRCasFinder 1075040-1075070 31 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2248363-2248393 9 0.71
CP034958_5 5.8|1075284|31|CP034958|CRISPRCasFinder 1075284-1075314 31 NZ_CP040723 Rhodococcus pyridinivorans strain YF3 plasmid unnamed4, complete sequence 35740-35770 9 0.71
CP034958_5 5.13|1075040|32|CP034958|PILER-CR,CRT 1075040-1075071 32 NZ_CP017750 Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence 405875-405906 9 0.719
CP034958_5 5.16|1075223|32|CP034958|PILER-CR,CRT 1075223-1075254 32 NZ_CP036297 Planctomycetes bacterium Pla86 plasmid pPla86_1, complete sequence 14953-14984 9 0.719
CP034958_5 5.16|1075223|32|CP034958|PILER-CR,CRT 1075223-1075254 32 NZ_CP036288 Planctomycetes bacterium Pla133 plasmid pPla133_1, complete sequence 14983-15014 9 0.719
CP034958_5 5.16|1075223|32|CP034958|PILER-CR,CRT 1075223-1075254 32 NZ_CP015882 Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence 3454-3485 9 0.719
CP034958_5 5.17|1075284|32|CP034958|PILER-CR,CRT 1075284-1075315 32 NZ_CP040723 Rhodococcus pyridinivorans strain YF3 plasmid unnamed4, complete sequence 35740-35771 9 0.719
CP034958_4 4.1|1052016|32|CP034958|PILER-CR,CRISPRCasFinder,CRT 1052016-1052047 32 NZ_CP030933 Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence 51062-51093 10 0.688
CP034958_5 5.10|1074857|32|CP034958|PILER-CR,CRT 1074857-1074888 32 NC_011987 Agrobacterium radiobacter K84 plasmid pAtK84c, complete sequence 86181-86212 10 0.688
CP034958_5 5.11|1074918|32|CP034958|PILER-CR,CRT 1074918-1074949 32 CP011075 Brevibacillus laterosporus strain B9 plasmid unnamed1, complete sequence 244686-244717 10 0.688
CP034958_5 5.11|1074918|32|CP034958|PILER-CR,CRT 1074918-1074949 32 GU075905 Prochlorococcus phage P-HM2, complete genome 78536-78567 10 0.688
CP034958_5 5.13|1075040|32|CP034958|PILER-CR,CRT 1075040-1075071 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2248362-2248393 10 0.688

1. spacer 8.1|2906369|40|CP034958|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgctgcgggtcattcttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
****************************************

2. spacer 9.1|3199807|25|CP034958|PILER-CR matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcctttacctgatttgggtaaac	CRISPR spacer
gtgcctttacctgatttgggtaaac	Protospacer
*************************

3. spacer 9.2|3199854|26|CP034958|PILER-CR matches to NC_049946 (Escherichia virus Lambda_4A7 genome assembly, chromosome: 1) position: , mismatch: 0, identity: 1.0

atttacctctttcaggtaaactttat	CRISPR spacer
atttacctctttcaggtaaactttat	Protospacer
**************************

4. spacer 9.2|3199854|26|CP034958|PILER-CR matches to LR595861 (Escherichia virus Lambda_4C10 genome assembly, chromosome: 1) position: , mismatch: 0, identity: 1.0

atttacctctttcaggtaaactttat	CRISPR spacer
atttacctctttcaggtaaactttat	Protospacer
**************************

5. spacer 12.1|3935463|42|CP034958|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 0, identity: 1.0

tgtcacacgcagataaatccaactttcaatattgttaagttc	CRISPR spacer
tgtcacacgcagataaatccaactttcaatattgttaagttc	Protospacer
******************************************

6. spacer 9.2|3199854|26|CP034958|PILER-CR matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 1, identity: 0.962

atttacctctttcaggtaaactttat	CRISPR spacer
atttacctctttaaggtaaactttat	Protospacer
************ *************

7. spacer 12.2|3935522|40|CP034958|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 1, identity: 0.975

catggcgtagcaaaaagaaattttcaatattgctttatgg	CRISPR spacer
catggcgtagaaaaaagaaattttcaatattgctttatgg	Protospacer
********** *****************************

8. spacer 7.1|2185274|38|CP034958|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

9. spacer 9.1|3199807|25|CP034958|PILER-CR matches to NC_049946 (Escherichia virus Lambda_4A7 genome assembly, chromosome: 1) position: , mismatch: 2, identity: 0.92

gtgcctttacctgatttgggtaaac	CRISPR spacer
acgcctttacctgatttgggtaaac	Protospacer
..***********************

10. spacer 9.1|3199807|25|CP034958|PILER-CR matches to LR595861 (Escherichia virus Lambda_4C10 genome assembly, chromosome: 1) position: , mismatch: 2, identity: 0.92

gtgcctttacctgatttgggtaaac	CRISPR spacer
acgcctttacctgatttgggtaaac	Protospacer
..***********************

11. spacer 11.1|3722052|48|CP034958|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 3, identity: 0.938

tcagcgtcgcatcaggcatctgcgcataaccgccggatgcggcgtaaa	CRISPR spacer
ccagcgtcgcatcaggcatctgcgcataactgccggatgcggcataaa	Protospacer
.*****************************.************.****

12. spacer 11.1|3722052|48|CP034958|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 3, identity: 0.938

tcagcgtcgcatcaggcatctgcgcataaccgccggatgcggcgtaaa	CRISPR spacer
ccagcgtcgcatcaggcatctgcgcataactgccggatgcggcataaa	Protospacer
.*****************************.************.****

13. spacer 11.1|3722052|48|CP034958|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 3, identity: 0.938

tcagcgtcgcatcaggcatctgcgcataaccgccggatgcggcgtaaa	CRISPR spacer
ccagcgtcgcatcaggcatctgcgcataactgccggatgcggcataaa	Protospacer
.*****************************.************.****

14. spacer 11.1|3722052|48|CP034958|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 3, identity: 0.938

tcagcgtcgcatcaggcatctgcgcataaccgccggatgcggcgtaaa	CRISPR spacer
ccagcgtcgcatcaggcatctgcgcataactgccggatgcggcataaa	Protospacer
.*****************************.************.****

15. spacer 9.2|3199854|26|CP034958|PILER-CR matches to NZ_CP015341 (Lactobacillus brevis strain 100D8 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.846

atttacctctttcaggtaaactttat	CRISPR spacer
aggtatctcattcaggtaaactttat	Protospacer
*  **.*** ****************

16. spacer 1.1|635360|42|CP034958|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 7, identity: 0.833

acagcagtcggatgcggcgtaaacaccttatctgacctacgt	CRISPR spacer
acaaatgccggatgcggcgtaaacgccttatctggcctacgc	Protospacer
***.  *.****************.*********.******.

17. spacer 4.6|1052321|32|CP034958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG299151 (Shigella sonnei strain SH287-2 plasmid pSH287-2, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

18. spacer 4.6|1052321|32|CP034958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY471628 (Shigella sonnei strain SH15sh99 plasmid pSH15sh99, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

19. spacer 4.6|1052321|32|CP034958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG299131 (Shigella sonnei strain SH271-2 plasmid pSH271-2, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

20. spacer 4.6|1052321|32|CP034958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY471629 (Shigella sonnei strain SH15sh105 plasmid pSH15sh104, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

21. spacer 4.6|1052321|32|CP034958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG299133 (Shigella sonnei strain SH272-2 plasmid pSH272-2, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

22. spacer 4.6|1052321|32|CP034958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG299128 (Shigella sonnei strain SH262-2 plasmid pSH262-2, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

23. spacer 4.6|1052321|32|CP034958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG299147 (Shigella sonnei strain SH284-2 plasmid pSH284-2, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

24. spacer 4.6|1052321|32|CP034958|PILER-CR,CRISPRCasFinder,CRT matches to NC_018995 (Escherichia coli plasmid pHUSEC41-1, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

25. spacer 4.6|1052321|32|CP034958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053235 (Escherichia coli strain SCU-106 plasmid pSCU-106-1, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

26. spacer 4.6|1052321|32|CP034958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP005999 (Escherichia coli B7A plasmid pEB1, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

27. spacer 4.6|1052321|32|CP034958|PILER-CR,CRISPRCasFinder,CRT matches to KU932021 (Escherichia coli plasmid pEC3I, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

28. spacer 4.6|1052321|32|CP034958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024154 (Escherichia coli strain 14EC033 plasmid p14EC033g, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

29. spacer 4.6|1052321|32|CP034958|PILER-CR,CRISPRCasFinder,CRT matches to NC_011754 (Escherichia coli ED1a plasmid pECOED, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

30. spacer 4.6|1052321|32|CP034958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015141 (Escherichia coli strain Ecol_732 plasmid pEC732_3, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

31. spacer 4.6|1052321|32|CP034958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR213460 (Shigella sonnei strain AUSMDU00008333 isolate AUSMDU00008333 plasmid 3) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

32. spacer 4.6|1052321|32|CP034958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH287044 (Escherichia coli strain 5.1-R1 plasmid pCERC6, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

33. spacer 4.6|1052321|32|CP034958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH618673 (Escherichia coli strain 838B plasmid p838B-R, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

34. spacer 5.1|1074857|31|CP034958|CRISPRCasFinder matches to NC_007336 (Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.774

ttgcccgcgcaattccgggagcatccgcaat	CRISPR spacer
tccctatcgcaatgccggcagcatccgcaat	Protospacer
*. *.  ****** **** ************

35. spacer 5.1|1074857|31|CP034958|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.774

ttgcccgcgcaattccgggagcatccgcaat	CRISPR spacer
ttgcgcgcgcaattccgtgagcagcgccatc	Protospacer
**** ************ ***** *  ** .

36. spacer 5.1|1074857|31|CP034958|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774

ttgcccgcgcaattccgggagcatccgcaat	CRISPR spacer
ttgcgcgcgcaattccgtgagcagcgccatc	Protospacer
**** ************ ***** *  ** .

37. spacer 5.4|1075040|31|CP034958|CRISPRCasFinder matches to NZ_CP034185 (Deinococcus sp. S14-83 strain S14-83T plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774

cccgtcaccgacgcgcagtggcgctaccgtg	CRISPR spacer
agcgtcaccgacgcgcagggccgctaccaac	Protospacer
  **************** * *******.  

38. spacer 5.7|1075223|31|CP034958|CRISPRCasFinder matches to NC_007336 (Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.774

ccgaacggctggcgaagcaggtggctggcgt	CRISPR spacer
ccgaacaggtggcgaagcaggtgatgggcca	Protospacer
******.* **************.. ***  

39. spacer 1.1|635360|42|CP034958|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 8, identity: 0.81

acagcagtcggatgcggcgtaaacaccttatctgacctacgt	CRISPR spacer
attgatgtcggatgcggcgtaaacgccttatccgacctacaa	Protospacer
*. *  ******************.*******.*******. 

40. spacer 4.5|1052260|32|CP034958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tcaacgcgctcagacgttgcgtgagtgaacca	CRISPR spacer
acaacgcggtcggacgttgcgtgattaccccg	Protospacer
 ******* **.************ *.  **.

41. spacer 5.4|1075040|31|CP034958|CRISPRCasFinder matches to NZ_CP017753 (Cupriavidus sp. USMAHM13 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

cccgtcaccgacgcgcagtggcgctaccgtg	CRISPR spacer
gacgtcaccgacgcgcagtcgcgcttcttca	Protospacer
  ***************** ***** *. ..

42. spacer 5.7|1075223|31|CP034958|CRISPRCasFinder matches to NZ_CP036297 (Planctomycetes bacterium Pla86 plasmid pPla86_1, complete sequence) position: , mismatch: 8, identity: 0.742

ccgaacggctggcgaagcaggtggctggcgt	CRISPR spacer
agcggcagctggcgatgcaggtggcttgcgt	Protospacer
   ..*.******** ********** ****

43. spacer 5.7|1075223|31|CP034958|CRISPRCasFinder matches to NZ_CP036288 (Planctomycetes bacterium Pla133 plasmid pPla133_1, complete sequence) position: , mismatch: 8, identity: 0.742

ccgaacggctggcgaagcaggtggctggcgt	CRISPR spacer
agcggcagctggcgatgcaggtggcttgcgt	Protospacer
   ..*.******** ********** ****

44. spacer 5.7|1075223|31|CP034958|CRISPRCasFinder matches to NZ_CP015882 (Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence) position: , mismatch: 8, identity: 0.742

ccgaacggctggcgaagcaggtggctggcgt	CRISPR spacer
ttgcgcagctggcgcagcaggtggctgccga	Protospacer
..* .*.******* ************ ** 

45. spacer 5.7|1075223|31|CP034958|CRISPRCasFinder matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

ccgaacggctggcgaagcaggtggctggcgt	CRISPR spacer
gggtacggctggcgaaggaggcggctgcgga	Protospacer
  * ************* ***.*****  * 

46. spacer 5.10|1074857|32|CP034958|PILER-CR,CRT matches to NC_007336 (Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75

ttgcccgcgcaattccgggagcatccgcaatt	CRISPR spacer
tccctatcgcaatgccggcagcatccgcaatc	Protospacer
*. *.  ****** **** ************.

47. spacer 5.10|1074857|32|CP034958|PILER-CR,CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75

ttgcccgcgcaattccgggagcatccgcaatt	CRISPR spacer
ttgcgcgcgcaattccgtgagcagcgccatca	Protospacer
**** ************ ***** *  ** . 

48. spacer 5.10|1074857|32|CP034958|PILER-CR,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

ttgcccgcgcaattccgggagcatccgcaatt	CRISPR spacer
ttgcgcgcgcaattccgtgagcagcgccatca	Protospacer
**** ************ ***** *  ** . 

49. spacer 5.10|1074857|32|CP034958|PILER-CR,CRT matches to NC_008759 (Polaromonas naphthalenivorans CJ2 plasmid pPNAP03, complete sequence) position: , mismatch: 8, identity: 0.75

ttgcccgcg-----caattccgggagcatccgcaatt	CRISPR spacer
-----cgtgaaactcatttccgggagcatccgcattt	Protospacer
     **.*     ** ***************** **

50. spacer 5.13|1075040|32|CP034958|PILER-CR,CRT matches to NZ_CP034185 (Deinococcus sp. S14-83 strain S14-83T plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

cccgtcaccgacgcgcagtggcgctaccgtga	CRISPR spacer
agcgtcaccgacgcgcagggccgctaccaact	Protospacer
  **************** * *******.   

51. spacer 5.13|1075040|32|CP034958|PILER-CR,CRT matches to NZ_CP017753 (Cupriavidus sp. USMAHM13 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

cccgtcaccgacgcgcagtggcgctaccgtga	CRISPR spacer
gacgtcaccgacgcgcagtcgcgcttcttcaa	Protospacer
  ***************** ***** *. ..*

52. spacer 5.16|1075223|32|CP034958|PILER-CR,CRT matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

ccgaacggctggcgaagcaggtggctggcgta	CRISPR spacer
gggtacggctggcgaaggaggcggctgcggaa	Protospacer
  * ************* ***.*****  * *

53. spacer 5.16|1075223|32|CP034958|PILER-CR,CRT matches to NC_007336 (Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75

ccgaacggctggcgaagcaggtggctggcgta	CRISPR spacer
ccgaacaggtggcgaagcaggtgatgggccag	Protospacer
******.* **************.. ***  .

54. spacer 5.17|1075284|32|CP034958|PILER-CR,CRT matches to NZ_CP006991 (Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence) position: , mismatch: 8, identity: 0.75

gtttaccgccccgcagaggcgctggcagatcc	CRISPR spacer
catcatcctcccgcagatgcgctggccgatcc	Protospacer
  *.*.* .******** ******** *****

55. spacer 1.1|635360|42|CP034958|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 9, identity: 0.786

acagcagtcggatgcggcgtaaacaccttatctgacctacgt	CRISPR spacer
gttgatgtcggatgcggcgtaaacgccttatccgacctacaa	Protospacer
.. *  ******************.*******.*******. 

56. spacer 5.1|1074857|31|CP034958|CRISPRCasFinder matches to NC_011987 (Agrobacterium radiobacter K84 plasmid pAtK84c, complete sequence) position: , mismatch: 9, identity: 0.71

ttgcccgcgcaattccgggagcatccgcaat	CRISPR spacer
gctaccgcgcaattcgaggagcatccgctgg	Protospacer
 .  *********** .*********** . 

57. spacer 5.2|1074918|31|CP034958|CRISPRCasFinder matches to CP011075 (Brevibacillus laterosporus strain B9 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71

acggacaaaatatatattgatttgcgaatta	CRISPR spacer
tgaggcaaaatatagattgatttccgaaaat	Protospacer
  .*.********* ******** ****   

58. spacer 5.2|1074918|31|CP034958|CRISPRCasFinder matches to GU075905 (Prochlorococcus phage P-HM2, complete genome) position: , mismatch: 9, identity: 0.71

acggacaaaatatatattgatttgcgaatta	CRISPR spacer
acggaaaaattatatattgattttacttctg	Protospacer
***** *** *************     .*.

59. spacer 5.4|1075040|31|CP034958|CRISPRCasFinder matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71

cccgtcaccgacgcgcagtggcgctaccgtg	CRISPR spacer
gacgtcactgacgcgcagtcgcgcttcttca	Protospacer
  ******.********** ***** *. ..

60. spacer 5.4|1075040|31|CP034958|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.71

cccgtcaccgacgcgcagtggcgctaccgtg	CRISPR spacer
gacatcaccgacgcccagtggcgcgacgtcc	Protospacer
  *.********** ********* **  . 

61. spacer 5.8|1075284|31|CP034958|CRISPRCasFinder matches to NZ_CP040723 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.71

gtttaccgccccgcagaggcgctggcagatc	CRISPR spacer
cgagaccgcctcgccgaggcgctggcagcga	Protospacer
    ******.*** *************   

62. spacer 5.13|1075040|32|CP034958|PILER-CR,CRT matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

cccgtcaccgacgcgcagtggcgctaccgtga	CRISPR spacer
gacgtcactgacgcgcagtcgcgcttcttcaa	Protospacer
  ******.********** ***** *. ..*

63. spacer 5.16|1075223|32|CP034958|PILER-CR,CRT matches to NZ_CP036297 (Planctomycetes bacterium Pla86 plasmid pPla86_1, complete sequence) position: , mismatch: 9, identity: 0.719

ccgaacggctggcgaagcaggtggctggcgta	CRISPR spacer
agcggcagctggcgatgcaggtggcttgcgtg	Protospacer
   ..*.******** ********** ****.

64. spacer 5.16|1075223|32|CP034958|PILER-CR,CRT matches to NZ_CP036288 (Planctomycetes bacterium Pla133 plasmid pPla133_1, complete sequence) position: , mismatch: 9, identity: 0.719

ccgaacggctggcgaagcaggtggctggcgta	CRISPR spacer
agcggcagctggcgatgcaggtggcttgcgtg	Protospacer
   ..*.******** ********** ****.

65. spacer 5.16|1075223|32|CP034958|PILER-CR,CRT matches to NZ_CP015882 (Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence) position: , mismatch: 9, identity: 0.719

ccgaacggctggcgaagcaggtggctggcgta	CRISPR spacer
ttgcgcagctggcgcagcaggtggctgccgag	Protospacer
..* .*.******* ************ ** .

66. spacer 5.17|1075284|32|CP034958|PILER-CR,CRT matches to NZ_CP040723 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719

gtttaccgccccgcagaggcgctggcagatcc	CRISPR spacer
cgagaccgcctcgccgaggcgctggcagcgac	Protospacer
    ******.*** *************   *

67. spacer 4.1|1052016|32|CP034958|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030933 (Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence) position: , mismatch: 10, identity: 0.688

tccacgctgtaacggccatcattaagtttagt	CRISPR spacer
ccgctgctgtgacgcccatcattaagttactc	Protospacer
.*  .*****.*** *************   .

68. spacer 5.10|1074857|32|CP034958|PILER-CR,CRT matches to NC_011987 (Agrobacterium radiobacter K84 plasmid pAtK84c, complete sequence) position: , mismatch: 10, identity: 0.688

ttgcccgcgcaattccgggagcatccgcaatt	CRISPR spacer
gctaccgcgcaattcgaggagcatccgctggg	Protospacer
 .  *********** .*********** .  

69. spacer 5.11|1074918|32|CP034958|PILER-CR,CRT matches to CP011075 (Brevibacillus laterosporus strain B9 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

acggacaaaatatatattgatttgcgaattat	CRISPR spacer
tgaggcaaaatatagattgatttccgaaaata	Protospacer
  .*.********* ******** ****    

70. spacer 5.11|1074918|32|CP034958|PILER-CR,CRT matches to GU075905 (Prochlorococcus phage P-HM2, complete genome) position: , mismatch: 10, identity: 0.688

acggacaaaatatatattgatttgcgaattat	CRISPR spacer
acggaaaaattatatattgattttacttctgg	Protospacer
***** *** *************     .*. 

71. spacer 5.13|1075040|32|CP034958|PILER-CR,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.688

cccgtcaccgacgcgcagtggcgctaccgtga	CRISPR spacer
gacatcaccgacgcccagtggcgcgacgtccc	Protospacer
  *.********** ********* **  .  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1082830 : 1096013 12 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_2 1708661 : 1718103 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_3 2270978 : 2293545 27 Escherichia_phage(26.67%) tail,integrase attL 2268190:2268203|attR 2294805:2294818
DBSCAN-SWA_4 2696228 : 2707006 11 Enterobacteria_phage(40.0%) integrase attL 2694201:2694224|attR 2705709:2705732
DBSCAN-SWA_5 2835813 : 2880466 38 Stx2-converting_phage(33.33%) transposase NA
DBSCAN-SWA_6 3094145 : 3102915 12 Salmonella_phage(90.0%) integrase attL 3093815:3093828|attR 3102957:3102970
DBSCAN-SWA_7 3186473 : 3209702 45 Enterobacteria_phage(50.0%) tail,integrase,capsid,lysis attL 3184414:3184428|attR 3209776:3209790
DBSCAN-SWA_8 3697192 : 3712880 17 Shigella_phage(33.33%) tail,integrase attL 3694296:3694355|attR 3708965:3709024
DBSCAN-SWA_9 4098759 : 4105318 7 uncultured_Caudovirales_phage(16.67%) transposase NA
DBSCAN-SWA_10 4505967 : 4540540 41 Escherichia_virus(26.09%) tail,integrase,protease,lysis attL 4521864:4521910|attR 4537752:4537798
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage