Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP031884 Klebsiella pneumoniae strain WCHKP095845 plasmid pNDM1_095845, complete sequence 0 crisprs cas3 0 0 1 0
CP031883 Klebsiella pneumoniae strain WCHKP095845 plasmid pMCR8_095845, complete sequence 0 crisprs NA 0 0 2 0
CP031885 Klebsiella pneumoniae strain WCHKP095845 chromosome, complete genome 2 crisprs WYL,csa3,RT,cas3,DEDDh,DinG 0 1 8 0
CP031882 Klebsiella pneumoniae strain WCHKP095845 plasmid p1_095845, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. CP031883
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 5114 : 50402 45 Escherichia_phage(46.15%) integrase,transposase NA
DBSCAN-SWA_2 70542 : 77617 7 Escherichia_phage(50.0%) integrase attL 68938:68950|attR 75722:75734
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP031884
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 50768 : 103274 60 Escherichia_phage(18.18%) bacteriocin,transposase,coat NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. CP031885
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031885_2 4136605-4136733 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031885_3 4353572-4353666 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP031885_1 1.1|1913670|30|CP031885|CRISPRCasFinder 1913670-1913699 30 NZ_CP022925 Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01B 21741-21770 0 1.0

1. spacer 1.1|1913670|30|CP031885|CRISPRCasFinder matches to NZ_CP022925 (Klebsiella pneumoniae strain ST307PT01 plasmid pJYC01B) position: , mismatch: 0, identity: 1.0

gcattcggcataaacgccatatccaggatt	CRISPR spacer
gcattcggcataaacgccatatccaggatt	Protospacer
******************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1190460 : 1247072 70 Salmonella_phage(74.0%) capsid,head,integrase,plate,tRNA,portal,tail,lysis attL 1200092:1200136|attR 1235700:1235744
DBSCAN-SWA_2 1351820 : 1395036 54 Salmonella_phage(33.33%) transposase,holin,integrase,tail,terminase attL 1349247:1349262|attR 1376655:1376670
DBSCAN-SWA_3 1737542 : 1744449 6 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_4 1786013 : 1794409 7 Enterobacteria_phage(28.57%) NA NA
DBSCAN-SWA_5 1899951 : 1984416 100 Enterobacteria_phage(21.05%) capsid,holin,head,tRNA,portal,tail,protease,terminase NA
DBSCAN-SWA_6 2743058 : 2753946 9 Escherichia_phage(87.5%) NA NA
DBSCAN-SWA_7 3407765 : 3417229 9 Brazilian_cedratvirus(16.67%) tRNA,protease NA
DBSCAN-SWA_8 4594103 : 4606135 11 Enterobacteria_phage(71.43%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage