Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP025488 Staphylococcus aureus subsp. aureus strain 2148.C01 plasmid p2148.C01_A, complete sequence 0 crisprs NA 0 0 0 0
CP017095 Staphylococcus aureus subsp. aureus strain 2148.C01 plasmid p2148.CO1_B, complete sequence 0 crisprs WYL,csa3 0 0 1 0
CP017094 Staphylococcus aureus subsp. aureus strain 2148.C01 chromosome, complete genome 9 crisprs csa3,cas3,DinG,DEDDh,WYL 11 4 9 1

Results visualization

1. CP017094
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP017094_1 41702-41780 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP017094_2 1117213-1117521 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP017094_3 1180224-1180305 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP017094_4 1216192-1216284 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP017094_6 1399352-1399444 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP017094_7 1643688-1643789 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP017094_8 2095983-2096156 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP017094_9 2538852-2539045 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP017094_10 2662812-2662962 Orphan NA
2 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP017094_3 3.1|1180248|34|CP017094|CRISPRCasFinder 1180248-1180281 34 CP017094.2 602096-602129 0 1.0
CP017094_3 3.1|1180248|34|CP017094|CRISPRCasFinder 1180248-1180281 34 CP017094.2 691289-691322 0 1.0
CP017094_8 8.1|2096036|17|CP017094|PILER-CR 2096036-2096052 17 CP017094.2 1228973-1228989 0 1.0
CP017094_8 8.1|2096036|17|CP017094|PILER-CR 2096036-2096052 17 CP017094.2 1229028-1229044 0 1.0
CP017094_8 8.1|2096036|17|CP017094|PILER-CR 2096036-2096052 17 CP017094.2 1764185-1764201 0 1.0
CP017094_8 8.2|2096106|16|CP017094|PILER-CR 2096106-2096121 16 CP017094.2 30820-30835 0 1.0
CP017094_8 8.2|2096106|16|CP017094|PILER-CR 2096106-2096121 16 CP017094.2 30878-30893 0 1.0
CP017094_8 8.2|2096106|16|CP017094|PILER-CR 2096106-2096121 16 CP017094.2 602068-602083 0 1.0
CP017094_8 8.2|2096106|16|CP017094|PILER-CR 2096106-2096121 16 CP017094.2 686938-686953 0 1.0
CP017094_8 8.2|2096106|16|CP017094|PILER-CR 2096106-2096121 16 CP017094.2 691335-691350 0 1.0
CP017094_8 8.2|2096106|16|CP017094|PILER-CR 2096106-2096121 16 CP017094.2 899460-899475 0 1.0
CP017094_8 8.2|2096106|16|CP017094|PILER-CR 2096106-2096121 16 CP017094.2 1000088-1000103 0 1.0
CP017094_8 8.2|2096106|16|CP017094|PILER-CR 2096106-2096121 16 CP017094.2 1179951-1179966 0 1.0
CP017094_8 8.2|2096106|16|CP017094|PILER-CR 2096106-2096121 16 CP017094.2 1682410-1682425 0 1.0
CP017094_8 8.2|2096106|16|CP017094|PILER-CR 2096106-2096121 16 CP017094.2 2261512-2261527 0 1.0
CP017094_9 9.2|2538931|36|CP017094|CRT 2538931-2538966 36 CP017094.2 899513-899548 0 1.0
CP017094_1 1.1|41725|33|CP017094|CRISPRCasFinder 41725-41757 33 CP017094.2 376817-376849 1 0.97
CP017094_1 1.1|41725|33|CP017094|CRISPRCasFinder 41725-41757 33 CP017094.2 691335-691367 1 0.97
CP017094_1 1.1|41725|33|CP017094|CRISPRCasFinder 41725-41757 33 CP017094.2 899460-899492 1 0.97
CP017094_1 1.1|41725|33|CP017094|CRISPRCasFinder 41725-41757 33 CP017094.2 1223536-1223568 1 0.97
CP017094_1 1.1|41725|33|CP017094|CRISPRCasFinder 41725-41757 33 CP017094.2 2261495-2261527 1 0.97
CP017094_2 2.2|1117326|26|CP017094|CRT 1117326-1117351 26 CP017094.2 1223523-1223548 1 0.962
CP017094_5 5.1|1223579|26|CP017094|CRISPRCasFinder 1223579-1223604 26 CP017094.2 1260642-1260667 1 0.962
CP017094_8 8.2|2096106|16|CP017094|PILER-CR 2096106-2096121 16 CP017094.2 198257-198272 1 0.938
CP017094_8 8.2|2096106|16|CP017094|PILER-CR 2096106-2096121 16 CP017094.2 376834-376849 1 0.938
CP017094_8 8.2|2096106|16|CP017094|PILER-CR 2096106-2096121 16 CP017094.2 645281-645296 1 0.938
CP017094_8 8.2|2096106|16|CP017094|PILER-CR 2096106-2096121 16 CP017094.2 903428-903443 1 0.938
CP017094_8 8.2|2096106|16|CP017094|PILER-CR 2096106-2096121 16 CP017094.2 2448115-2448130 1 0.938
CP017094_9 9.2|2538931|36|CP017094|CRT 2538931-2538966 36 CP017094.2 198368-198403 1 0.972
CP017094_1 1.1|41725|33|CP017094|CRISPRCasFinder 41725-41757 33 CP017094.2 602051-602083 2 0.939
CP017094_2 2.2|1117326|26|CP017094|CRT 1117326-1117351 26 CP017094.2 1682430-1682455 2 0.923
CP017094_2 2.4|1117440|26|CP017094|CRT 1117440-1117465 26 CP017094.2 1260642-1260667 2 0.923
CP017094_2 2.5|1117466|33|CP017094|CRISPRCasFinder 1117466-1117498 33 CP017094.2 1179944-1179976 2 0.939
CP017094_5 5.1|1223579|26|CP017094|CRISPRCasFinder 1223579-1223604 26 CP017094.2 1260586-1260611 2 0.923
CP017094_8 8.1|2096036|17|CP017094|PILER-CR 2096036-2096052 17 CP017095.2 25884-25900 2 0.882
CP017094_9 9.1|2538875|33|CP017094|CRT 2538875-2538907 33 CP017094.2 691335-691367 2 0.939
CP017094_9 9.1|2538875|33|CP017094|CRT 2538875-2538907 33 CP017094.2 899460-899492 2 0.939
CP017094_9 9.1|2538875|33|CP017094|CRT 2538875-2538907 33 CP017094.2 1223536-1223568 2 0.939
CP017094_9 9.1|2538875|33|CP017094|CRT 2538875-2538907 33 CP017094.2 2261495-2261527 2 0.939
CP017094_9 9.2|2538931|36|CP017094|CRT 2538931-2538966 36 CP017094.2 30919-30954 2 0.944
CP017094_9 9.2|2538931|36|CP017094|CRT 2538931-2538966 36 CP017094.2 376875-376910 2 0.944
CP017094_9 9.3|2538990|33|CP017094|CRT 2538990-2539022 33 CP017094.2 602051-602083 2 0.939
CP017094_9 9.3|2538990|33|CP017094|CRT 2538990-2539022 33 CP017094.2 691335-691367 2 0.939
CP017094_9 9.3|2538990|33|CP017094|CRT 2538990-2539022 33 CP017094.2 899460-899492 2 0.939
CP017094_9 9.3|2538990|33|CP017094|CRT 2538990-2539022 33 CP017094.2 1223536-1223568 2 0.939
CP017094_9 9.3|2538990|33|CP017094|CRT 2538990-2539022 33 CP017094.2 2261495-2261527 2 0.939

1. spacer 3.1|1180248|34|CP017094|CRISPRCasFinder matches to position: 602096-602129, mismatch: 0, identity: 1.0

atgggccccaacaaagagaaattggattcccaat	CRISPR spacer
atgggccccaacaaagagaaattggattcccaat	Protospacer
**********************************

2. spacer 3.1|1180248|34|CP017094|CRISPRCasFinder matches to position: 691289-691322, mismatch: 0, identity: 1.0

atgggccccaacaaagagaaattggattcccaat	CRISPR spacer
atgggccccaacaaagagaaattggattcccaat	Protospacer
**********************************

3. spacer 8.1|2096036|17|CP017094|PILER-CR matches to position: 1228973-1228989, mismatch: 0, identity: 1.0

aagaatttcgaaaagaa	CRISPR spacer
aagaatttcgaaaagaa	Protospacer
*****************

4. spacer 8.1|2096036|17|CP017094|PILER-CR matches to position: 1229028-1229044, mismatch: 0, identity: 1.0

aagaatttcgaaaagaa	CRISPR spacer
aagaatttcgaaaagaa	Protospacer
*****************

5. spacer 8.1|2096036|17|CP017094|PILER-CR matches to position: 1764185-1764201, mismatch: 0, identity: 1.0

aagaatttcgaaaagaa	CRISPR spacer
aagaatttcgaaaagaa	Protospacer
*****************

6. spacer 8.2|2096106|16|CP017094|PILER-CR matches to position: 30820-30835, mismatch: 0, identity: 1.0

tcagcttacaataatg	CRISPR spacer
tcagcttacaataatg	Protospacer
****************

7. spacer 8.2|2096106|16|CP017094|PILER-CR matches to position: 30878-30893, mismatch: 0, identity: 1.0

tcagcttacaataatg	CRISPR spacer
tcagcttacaataatg	Protospacer
****************

8. spacer 8.2|2096106|16|CP017094|PILER-CR matches to position: 602068-602083, mismatch: 0, identity: 1.0

tcagcttacaataatg	CRISPR spacer
tcagcttacaataatg	Protospacer
****************

9. spacer 8.2|2096106|16|CP017094|PILER-CR matches to position: 686938-686953, mismatch: 0, identity: 1.0

tcagcttacaataatg	CRISPR spacer
tcagcttacaataatg	Protospacer
****************

10. spacer 8.2|2096106|16|CP017094|PILER-CR matches to position: 691335-691350, mismatch: 0, identity: 1.0

tcagcttacaataatg	CRISPR spacer
tcagcttacaataatg	Protospacer
****************

11. spacer 8.2|2096106|16|CP017094|PILER-CR matches to position: 899460-899475, mismatch: 0, identity: 1.0

tcagcttacaataatg	CRISPR spacer
tcagcttacaataatg	Protospacer
****************

12. spacer 8.2|2096106|16|CP017094|PILER-CR matches to position: 1000088-1000103, mismatch: 0, identity: 1.0

tcagcttacaataatg	CRISPR spacer
tcagcttacaataatg	Protospacer
****************

13. spacer 8.2|2096106|16|CP017094|PILER-CR matches to position: 1179951-1179966, mismatch: 0, identity: 1.0

tcagcttacaataatg	CRISPR spacer
tcagcttacaataatg	Protospacer
****************

14. spacer 8.2|2096106|16|CP017094|PILER-CR matches to position: 1682410-1682425, mismatch: 0, identity: 1.0

tcagcttacaataatg	CRISPR spacer
tcagcttacaataatg	Protospacer
****************

15. spacer 8.2|2096106|16|CP017094|PILER-CR matches to position: 2261512-2261527, mismatch: 0, identity: 1.0

tcagcttacaataatg	CRISPR spacer
tcagcttacaataatg	Protospacer
****************

16. spacer 9.2|2538931|36|CP017094|CRT matches to position: 899513-899548, mismatch: 0, identity: 1.0

tagagaatttcaaaaagaaattctacagacaatgca	CRISPR spacer
tagagaatttcaaaaagaaattctacagacaatgca	Protospacer
************************************

17. spacer 1.1|41725|33|CP017094|CRISPRCasFinder matches to position: 376817-376849, mismatch: 1, identity: 0.97

cagaagctgacgaaaagtcagcttacgataatg	CRISPR spacer
cagaagctgacgaaaagtcagcttactataatg	Protospacer
************************** ******

18. spacer 1.1|41725|33|CP017094|CRISPRCasFinder matches to position: 691335-691367, mismatch: 1, identity: 0.97

cagaagctgacgaaaagtcagcttacgataatg	CRISPR spacer
cagaagctgacgaaaagtcagcttacaataatg	Protospacer
**************************.******

19. spacer 1.1|41725|33|CP017094|CRISPRCasFinder matches to position: 899460-899492, mismatch: 1, identity: 0.97

cagaagctgacgaaaagtcagcttacgataatg	CRISPR spacer
cagaagctgacgaaaagtcagcttacaataatg	Protospacer
**************************.******

20. spacer 1.1|41725|33|CP017094|CRISPRCasFinder matches to position: 1223536-1223568, mismatch: 1, identity: 0.97

cagaagctgacgaaaagtcagcttacgataatg	CRISPR spacer
cagaagctgacgaaaagtcagcttacaataatg	Protospacer
**************************.******

21. spacer 1.1|41725|33|CP017094|CRISPRCasFinder matches to position: 2261495-2261527, mismatch: 1, identity: 0.97

cagaagctgacgaaaagtcagcttacgataatg	CRISPR spacer
cagaagctgacgaaaagtcagcttacaataatg	Protospacer
**************************.******

22. spacer 2.2|1117326|26|CP017094|CRT matches to position: 1223523-1223548, mismatch: 1, identity: 0.962

tcgccagcttctgtgttggggccccg	CRISPR spacer
tcgtcagcttctgtgttggggccccg	Protospacer
***.**********************

23. spacer 5.1|1223579|26|CP017094|CRISPRCasFinder matches to position: 1260642-1260667, mismatch: 1, identity: 0.962

cggggccccaacacagaagctggcgg	CRISPR spacer
cggggccccaacacagaagcaggcgg	Protospacer
******************** *****

24. spacer 8.2|2096106|16|CP017094|PILER-CR matches to position: 198257-198272, mismatch: 1, identity: 0.938

tcagcttacaataatg	CRISPR spacer
tcagctttcaataatg	Protospacer
******* ********

25. spacer 8.2|2096106|16|CP017094|PILER-CR matches to position: 376834-376849, mismatch: 1, identity: 0.938

tcagcttacaataatg	CRISPR spacer
tcagcttactataatg	Protospacer
********* ******

26. spacer 8.2|2096106|16|CP017094|PILER-CR matches to position: 645281-645296, mismatch: 1, identity: 0.938

tcagcttacaataatg	CRISPR spacer
tcagcttacaacaatg	Protospacer
***********.****

27. spacer 8.2|2096106|16|CP017094|PILER-CR matches to position: 903428-903443, mismatch: 1, identity: 0.938

tcagcttacaataatg	CRISPR spacer
tcagcttacaaaaatg	Protospacer
*********** ****

28. spacer 8.2|2096106|16|CP017094|PILER-CR matches to position: 2448115-2448130, mismatch: 1, identity: 0.938

tcagcttacaataatg	CRISPR spacer
tcagcttacaacaatg	Protospacer
***********.****

29. spacer 9.2|2538931|36|CP017094|CRT matches to position: 198368-198403, mismatch: 1, identity: 0.972

tagagaatttcaaaaagaaattctacagacaatgca	CRISPR spacer
tagagaatttcgaaaagaaattctacagacaatgca	Protospacer
***********.************************

30. spacer 1.1|41725|33|CP017094|CRISPRCasFinder matches to position: 602051-602083, mismatch: 2, identity: 0.939

cagaagctgacgaaaagtcagcttacgataatg	CRISPR spacer
cagaagatgacgaaaagtcagcttacaataatg	Protospacer
****** *******************.******

31. spacer 2.2|1117326|26|CP017094|CRT matches to position: 1682430-1682455, mismatch: 2, identity: 0.923

tcgccagcttctgtgttggggccccg	CRISPR spacer
tcgtcagcttctttgttggggccccg	Protospacer
***.******** *************

32. spacer 2.4|1117440|26|CP017094|CRT matches to position: 1260642-1260667, mismatch: 2, identity: 0.923

ccgccagcctctgtgttggggccccg	CRISPR spacer
ccgcctgcttctgtgttggggccccg	Protospacer
***** **.*****************

33. spacer 2.5|1117466|33|CP017094|CRISPRCasFinder matches to position: 1179944-1179976, mismatch: 2, identity: 0.939

ccaacttgcacactattgtaagctgactttcca	CRISPR spacer
ccaacttgcacattattgtaagctgacttacca	Protospacer
************.**************** ***

34. spacer 5.1|1223579|26|CP017094|CRISPRCasFinder matches to position: 1260586-1260611, mismatch: 2, identity: 0.923

cggggccccaacacagaagctggcgg	CRISPR spacer
cggggccccaacatagaagcaggcgg	Protospacer
*************.****** *****

35. spacer 8.1|2096036|17|CP017094|PILER-CR matches to position: 25884-25900, mismatch: 2, identity: 0.882

aagaatttcgaaaagaa	CRISPR spacer
aagaattttcaaaagaa	Protospacer
********. *******

36. spacer 9.1|2538875|33|CP017094|CRT matches to position: 691335-691367, mismatch: 2, identity: 0.939

cagaagctgacagaaagtcagcttacaataatg	CRISPR spacer
cagaagctgacgaaaagtcagcttacaataatg	Protospacer
***********..********************

37. spacer 9.1|2538875|33|CP017094|CRT matches to position: 899460-899492, mismatch: 2, identity: 0.939

cagaagctgacagaaagtcagcttacaataatg	CRISPR spacer
cagaagctgacgaaaagtcagcttacaataatg	Protospacer
***********..********************

38. spacer 9.1|2538875|33|CP017094|CRT matches to position: 1223536-1223568, mismatch: 2, identity: 0.939

cagaagctgacagaaagtcagcttacaataatg	CRISPR spacer
cagaagctgacgaaaagtcagcttacaataatg	Protospacer
***********..********************

39. spacer 9.1|2538875|33|CP017094|CRT matches to position: 2261495-2261527, mismatch: 2, identity: 0.939

cagaagctgacagaaagtcagcttacaataatg	CRISPR spacer
cagaagctgacgaaaagtcagcttacaataatg	Protospacer
***********..********************

40. spacer 9.2|2538931|36|CP017094|CRT matches to position: 30919-30954, mismatch: 2, identity: 0.944

tagagaatttcaaaaagaaattctacagacaatgca	CRISPR spacer
tagagaatttcgaaaggaaattctacagacaatgca	Protospacer
***********.***.********************

41. spacer 9.2|2538931|36|CP017094|CRT matches to position: 376875-376910, mismatch: 2, identity: 0.944

tagagaatttcaaaaagaaattctacagacaatgca	CRISPR spacer
tagagaatttcgaaaagaaattctacaggcaatgca	Protospacer
***********.****************.*******

42. spacer 9.3|2538990|33|CP017094|CRT matches to position: 602051-602083, mismatch: 2, identity: 0.939

cagaaggtgacgaaaagtcagcatacaataatg	CRISPR spacer
cagaagatgacgaaaagtcagcttacaataatg	Protospacer
******.*************** **********

43. spacer 9.3|2538990|33|CP017094|CRT matches to position: 691335-691367, mismatch: 2, identity: 0.939

cagaaggtgacgaaaagtcagcatacaataatg	CRISPR spacer
cagaagctgacgaaaagtcagcttacaataatg	Protospacer
****** *************** **********

44. spacer 9.3|2538990|33|CP017094|CRT matches to position: 899460-899492, mismatch: 2, identity: 0.939

cagaaggtgacgaaaagtcagcatacaataatg	CRISPR spacer
cagaagctgacgaaaagtcagcttacaataatg	Protospacer
****** *************** **********

45. spacer 9.3|2538990|33|CP017094|CRT matches to position: 1223536-1223568, mismatch: 2, identity: 0.939

cagaaggtgacgaaaagtcagcatacaataatg	CRISPR spacer
cagaagctgacgaaaagtcagcttacaataatg	Protospacer
****** *************** **********

46. spacer 9.3|2538990|33|CP017094|CRT matches to position: 2261495-2261527, mismatch: 2, identity: 0.939

cagaaggtgacgaaaagtcagcatacaataatg	CRISPR spacer
cagaagctgacgaaaagtcagcttacaataatg	Protospacer
****** *************** **********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP017094_2 2.1|1117243|53|CP017094|CRT 1117243-1117295 53 MG543995 Staphylococcus phage UPMK_1, partial genome 76246-76298 4 0.925
CP017094_2 2.2|1117326|26|CP017094|CRT 1117326-1117351 26 NZ_CP022541 Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence 333735-333760 5 0.808
CP017094_5 5.1|1223579|26|CP017094|CRISPRCasFinder 1223579-1223604 26 NZ_CP022541 Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence 333735-333760 5 0.808
CP017094_5 5.1|1223579|26|CP017094|CRISPRCasFinder 1223579-1223604 26 NZ_CP034332 Tabrizicola piscis strain K13M18 plasmid unnamed4, complete sequence 3359-3384 5 0.808
CP017094_5 5.1|1223579|26|CP017094|CRISPRCasFinder 1223579-1223604 26 NZ_CP022605 Ochrobactrum quorumnocens strain A44 plasmid unnamed1, complete sequence 715511-715536 5 0.808
CP017094_1 1.1|41725|33|CP017094|CRISPRCasFinder 41725-41757 33 NC_021536 Synechococcus phage S-IOM18 genomic sequence 159745-159777 10 0.697

1. spacer 2.1|1117243|53|CP017094|CRT matches to MG543995 (Staphylococcus phage UPMK_1, partial genome) position: , mismatch: 4, identity: 0.925

ttgggagtgggacagaaatgatattttcgcaaaatttatttcgtcgtcccacc	CRISPR spacer
aagggagtgggacagaaatgatagtttctcaaaatttatttcgtcgtcccacc	Protospacer
  ********************* **** ************************

2. spacer 2.2|1117326|26|CP017094|CRT matches to NZ_CP022541 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence) position: , mismatch: 5, identity: 0.808

tcgccagcttctgtgttggggccccg	CRISPR spacer
acgccagcttctgtgttgaggcctta	Protospacer
 *****************.****...

3. spacer 5.1|1223579|26|CP017094|CRISPRCasFinder matches to NZ_CP022541 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence) position: , mismatch: 5, identity: 0.808

cggggccccaacacagaagctggcgg	CRISPR spacer
taaggcctcaacacagaagctggcgt	Protospacer
...****.***************** 

4. spacer 5.1|1223579|26|CP017094|CRISPRCasFinder matches to NZ_CP034332 (Tabrizicola piscis strain K13M18 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.808

cggggccccaacacagaagctggcgg	CRISPR spacer
gtaggcccagacacagaagctggcgg	Protospacer
  .***** .****************

5. spacer 5.1|1223579|26|CP017094|CRISPRCasFinder matches to NZ_CP022605 (Ochrobactrum quorumnocens strain A44 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808

cggggccccaacacagaagctggcgg	CRISPR spacer
tcagggccaaacacagaagctggcgg	Protospacer
. .** ** *****************

6. spacer 1.1|41725|33|CP017094|CRISPRCasFinder matches to NC_021536 (Synechococcus phage S-IOM18 genomic sequence) position: , mismatch: 10, identity: 0.697

cagaagctgacgaaaagtcagcttacgataatg	CRISPR spacer
aggtgcttgacgaaaactcaccttacgataaaa	Protospacer
 .* . .********* *** ********** .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 76235 : 177450 104 Staphylococcus_phage(89.66%) protease,bacteriocin,transposase,tRNA NA
DBSCAN-SWA_2 318794 : 327837 7 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_3 396974 : 405286 7 Caulobacter_phage(16.67%) tRNA NA
DBSCAN-SWA_4 461117 : 512307 69 Staphylococcus_phage(97.01%) head,tail,protease,terminase,portal,holin,capsid NA
DBSCAN-SWA_5 990125 : 998598 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_6 1159513 : 1178742 25 Staphylococcus_phage(63.16%) capsid,integrase,terminase,protease attL 1162234:1162250|attR 1176190:1176206
DBSCAN-SWA_7 1257452 : 1272183 18 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_8 1284155 : 1291975 10 Pandoravirus(16.67%) NA NA
DBSCAN-SWA_9 2784749 : 2842979 82 Staphylococcus_phage(97.26%) head,integrase,tail,protease,terminase,portal,holin,capsid attL 2798605:2798622|attR 2823535:2823552
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
CP017094.2|AUM83983.1|1268498_1268600_-|hypothetical-protein 1268498_1268600_- 33 aa aa NA NA NA 1257452-1272183 yes
2. CP017095
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1014 : 8714 9 Staphylococcus_phage(42.86%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage