Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP026075 Staphylococcus aureus strain HPV107 plasmid unnamed 0 crisprs csa3 0 0 0 0
CP026074 Staphylococcus aureus strain HPV107 chromosome, complete genome 9 crisprs csa3,DEDDh,RT,WYL,cas3,DinG 9 3 11 1

Results visualization

1. CP026074
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026074_1 110608-110692 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026074_2 581034-581115 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026074_3 708256-708336 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026074_5 873999-874079 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026074_6 1772718-1772819 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026074_7 2124957-2125039 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026074_8 2165906-2165984 Unclear NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026074_9 2171361-2171630 Unclear NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026074_10 2214784-2214865 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP026074_2 2.1|581058|34|CP026074|CRISPRCasFinder 581058-581091 34 CP026074.1 2165905-2165938 0 1.0
CP026074_2 2.1|581058|34|CP026074|CRISPRCasFinder 581058-581091 34 CP026074.1 2480983-2481016 0 1.0
CP026074_8 8.1|2165930|31|CP026074|CRISPRCasFinder 2165930-2165960 31 CP026074.1 1641015-1641045 0 1.0
CP026074_9 9.1|2171397|22|CP026074|CRT 2171397-2171418 22 CP026074.1 110684-110705 0 1.0
CP026074_9 9.1|2171397|22|CP026074|CRT 2171397-2171418 22 CP026074.1 125218-125239 0 1.0
CP026074_9 9.1|2171397|22|CP026074|CRT 2171397-2171418 22 CP026074.1 479246-479267 0 1.0
CP026074_9 9.1|2171397|22|CP026074|CRT 2171397-2171418 22 CP026074.1 1517687-1517708 0 1.0
CP026074_9 9.1|2171397|22|CP026074|CRT 2171397-2171418 22 CP026074.1 1517745-1517766 0 1.0
CP026074_9 9.1|2171397|22|CP026074|CRT 2171397-2171418 22 CP026074.1 1517803-1517824 0 1.0
CP026074_9 9.1|2171397|22|CP026074|CRT 2171397-2171418 22 CP026074.1 1640940-1640961 0 1.0
CP026074_9 9.1|2171397|22|CP026074|CRT 2171397-2171418 22 CP026074.1 2001144-2001165 0 1.0
CP026074_9 9.1|2171397|22|CP026074|CRT 2171397-2171418 22 CP026074.1 2123998-2124019 0 1.0
CP026074_9 9.1|2171397|22|CP026074|CRT 2171397-2171418 22 CP026074.1 2214857-2214878 0 1.0
CP026074_9 9.1|2171397|22|CP026074|CRT 2171397-2171418 22 CP026074.1 2694090-2694111 0 1.0
CP026074_9 9.3|2171514|22|CP026074|CRT 2171514-2171535 22 CP026074.1 110684-110705 0 1.0
CP026074_9 9.3|2171514|22|CP026074|CRT 2171514-2171535 22 CP026074.1 125218-125239 0 1.0
CP026074_9 9.3|2171514|22|CP026074|CRT 2171514-2171535 22 CP026074.1 479246-479267 0 1.0
CP026074_9 9.3|2171514|22|CP026074|CRT 2171514-2171535 22 CP026074.1 1517687-1517708 0 1.0
CP026074_9 9.3|2171514|22|CP026074|CRT 2171514-2171535 22 CP026074.1 1517745-1517766 0 1.0
CP026074_9 9.3|2171514|22|CP026074|CRT 2171514-2171535 22 CP026074.1 1517803-1517824 0 1.0
CP026074_9 9.3|2171514|22|CP026074|CRT 2171514-2171535 22 CP026074.1 1640940-1640961 0 1.0
CP026074_9 9.3|2171514|22|CP026074|CRT 2171514-2171535 22 CP026074.1 2001144-2001165 0 1.0
CP026074_9 9.3|2171514|22|CP026074|CRT 2171514-2171535 22 CP026074.1 2123998-2124019 0 1.0
CP026074_9 9.3|2171514|22|CP026074|CRT 2171514-2171535 22 CP026074.1 2214857-2214878 0 1.0
CP026074_9 9.3|2171514|22|CP026074|CRT 2171514-2171535 22 CP026074.1 2694090-2694111 0 1.0
CP026074_1 1.1|110634|33|CP026074|CRISPRCasFinder 110634-110666 33 CP026074.1 1517842-1517874 1 0.97
CP026074_1 1.1|110634|33|CP026074|CRISPRCasFinder 110634-110666 33 CP026074.1 2694187-2694219 1 0.97
CP026074_2 2.1|581058|34|CP026074|CRISPRCasFinder 581058-581091 34 CP026074.1 230631-230664 1 0.971
CP026074_5 5.1|874024|31|CP026074|CRISPRCasFinder 874024-874054 31 CP026074.1 2178649-2178679 1 0.968
CP026074_8 8.1|2165930|31|CP026074|CRISPRCasFinder 2165930-2165960 31 CP026074.1 145090-145120 1 0.968
CP026074_8 8.1|2165930|31|CP026074|CRISPRCasFinder 2165930-2165960 31 CP026074.1 1640960-1640990 1 0.968
CP026074_9 9.1|2171397|22|CP026074|CRT 2171397-2171418 22 CP026074.1 144945-144966 1 0.955
CP026074_9 9.1|2171397|22|CP026074|CRT 2171397-2171418 22 CP026074.1 145178-145199 1 0.955
CP026074_9 9.1|2171397|22|CP026074|CRT 2171397-2171418 22 CP026074.1 2285089-2285110 1 0.955
CP026074_9 9.2|2171455|23|CP026074|CRT 2171455-2171477 23 CP026074.1 479304-479326 1 0.957
CP026074_9 9.2|2171455|23|CP026074|CRT 2171455-2171477 23 CP026074.1 863170-863192 1 0.957
CP026074_9 9.2|2171455|23|CP026074|CRT 2171455-2171477 23 CP026074.1 1517861-1517883 1 0.957
CP026074_9 9.2|2171455|23|CP026074|CRT 2171455-2171477 23 CP026074.1 2124948-2124970 1 0.957
CP026074_9 9.2|2171455|23|CP026074|CRT 2171455-2171477 23 CP026074.1 2125226-2125248 1 0.957
CP026074_9 9.2|2171455|23|CP026074|CRT 2171455-2171477 23 CP026074.1 2694206-2694228 1 0.957
CP026074_9 9.3|2171514|22|CP026074|CRT 2171514-2171535 22 CP026074.1 144945-144966 1 0.955
CP026074_9 9.3|2171514|22|CP026074|CRT 2171514-2171535 22 CP026074.1 145178-145199 1 0.955
CP026074_9 9.3|2171514|22|CP026074|CRT 2171514-2171535 22 CP026074.1 2285089-2285110 1 0.955
CP026074_9 9.4|2171572|23|CP026074|CRT 2171572-2171594 23 CP026074.1 479304-479326 1 0.957
CP026074_9 9.4|2171572|23|CP026074|CRT 2171572-2171594 23 CP026074.1 863170-863192 1 0.957
CP026074_9 9.4|2171572|23|CP026074|CRT 2171572-2171594 23 CP026074.1 1517861-1517883 1 0.957
CP026074_9 9.4|2171572|23|CP026074|CRT 2171572-2171594 23 CP026074.1 2124948-2124970 1 0.957
CP026074_9 9.4|2171572|23|CP026074|CRT 2171572-2171594 23 CP026074.1 2125226-2125248 1 0.957
CP026074_9 9.4|2171572|23|CP026074|CRT 2171572-2171594 23 CP026074.1 2694206-2694228 1 0.957
CP026074_10 10.1|2214808|34|CP026074|CRISPRCasFinder 2214808-2214841 34 CP026074.1 2694186-2694219 1 0.971
CP026074_2 2.1|581058|34|CP026074|CRISPRCasFinder 581058-581091 34 CP026074.1 1313915-1313948 2 0.941
CP026074_2 2.1|581058|34|CP026074|CRISPRCasFinder 581058-581091 34 CP026074.1 2698560-2698593 2 0.941
CP026074_5 5.1|874024|31|CP026074|CRISPRCasFinder 874024-874054 31 CP026074.1 125272-125302 2 0.935
CP026074_5 5.1|874024|31|CP026074|CRISPRCasFinder 874024-874054 31 CP026074.1 477898-477928 2 0.935
CP026074_5 5.1|874024|31|CP026074|CRISPRCasFinder 874024-874054 31 CP026074.1 863223-863253 2 0.935
CP026074_5 5.1|874024|31|CP026074|CRISPRCasFinder 874024-874054 31 CP026074.1 1038693-1038723 2 0.935
CP026074_5 5.1|874024|31|CP026074|CRISPRCasFinder 874024-874054 31 CP026074.1 1419038-1419068 2 0.935
CP026074_5 5.1|874024|31|CP026074|CRISPRCasFinder 874024-874054 31 CP026074.1 1717349-1717379 2 0.935
CP026074_5 5.1|874024|31|CP026074|CRISPRCasFinder 874024-874054 31 CP026074.1 2001199-2001229 2 0.935
CP026074_5 5.1|874024|31|CP026074|CRISPRCasFinder 874024-874054 31 CP026074.1 2215120-2215150 2 0.935
CP026074_5 5.1|874024|31|CP026074|CRISPRCasFinder 874024-874054 31 CP026074.1 2382607-2382637 2 0.935
CP026074_5 5.1|874024|31|CP026074|CRISPRCasFinder 874024-874054 31 CP026074.1 2486528-2486558 2 0.935
CP026074_5 5.1|874024|31|CP026074|CRISPRCasFinder 874024-874054 31 CP026074.1 2694145-2694175 2 0.935
CP026074_5 5.1|874024|31|CP026074|CRISPRCasFinder 874024-874054 31 CP026074.1 2782580-2782610 2 0.935
CP026074_9 9.2|2171455|23|CP026074|CRT 2171455-2171477 23 CP026074.1 581115-581137 2 0.913
CP026074_9 9.2|2171455|23|CP026074|CRT 2171455-2171477 23 CP026074.1 2782527-2782549 2 0.913
CP026074_9 9.4|2171572|23|CP026074|CRT 2171572-2171594 23 CP026074.1 581115-581137 2 0.913
CP026074_9 9.4|2171572|23|CP026074|CRT 2171572-2171594 23 CP026074.1 2782527-2782549 2 0.913

1. spacer 2.1|581058|34|CP026074|CRISPRCasFinder matches to position: 2165905-2165938, mismatch: 0, identity: 1.0

ttgtagaatttcttttcgaaattctctgtgttgg	CRISPR spacer
ttgtagaatttcttttcgaaattctctgtgttgg	Protospacer
**********************************

2. spacer 2.1|581058|34|CP026074|CRISPRCasFinder matches to position: 2480983-2481016, mismatch: 0, identity: 1.0

ttgtagaatttcttttcgaaattctctgtgttgg	CRISPR spacer
ttgtagaatttcttttcgaaattctctgtgttgg	Protospacer
**********************************

3. spacer 8.1|2165930|31|CP026074|CRISPRCasFinder matches to position: 1641015-1641045, mismatch: 0, identity: 1.0

ctgtgttggggccccgccaacttgcattgcc	CRISPR spacer
ctgtgttggggccccgccaacttgcattgcc	Protospacer
*******************************

4. spacer 9.1|2171397|22|CP026074|CRT matches to position: 110684-110705, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

5. spacer 9.1|2171397|22|CP026074|CRT matches to position: 125218-125239, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

6. spacer 9.1|2171397|22|CP026074|CRT matches to position: 479246-479267, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

7. spacer 9.1|2171397|22|CP026074|CRT matches to position: 1517687-1517708, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

8. spacer 9.1|2171397|22|CP026074|CRT matches to position: 1517745-1517766, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

9. spacer 9.1|2171397|22|CP026074|CRT matches to position: 1517803-1517824, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

10. spacer 9.1|2171397|22|CP026074|CRT matches to position: 1640940-1640961, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

11. spacer 9.1|2171397|22|CP026074|CRT matches to position: 2001144-2001165, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

12. spacer 9.1|2171397|22|CP026074|CRT matches to position: 2123998-2124019, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

13. spacer 9.1|2171397|22|CP026074|CRT matches to position: 2214857-2214878, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

14. spacer 9.1|2171397|22|CP026074|CRT matches to position: 2694090-2694111, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

15. spacer 9.3|2171514|22|CP026074|CRT matches to position: 110684-110705, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

16. spacer 9.3|2171514|22|CP026074|CRT matches to position: 125218-125239, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

17. spacer 9.3|2171514|22|CP026074|CRT matches to position: 479246-479267, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

18. spacer 9.3|2171514|22|CP026074|CRT matches to position: 1517687-1517708, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

19. spacer 9.3|2171514|22|CP026074|CRT matches to position: 1517745-1517766, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

20. spacer 9.3|2171514|22|CP026074|CRT matches to position: 1517803-1517824, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

21. spacer 9.3|2171514|22|CP026074|CRT matches to position: 1640940-1640961, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

22. spacer 9.3|2171514|22|CP026074|CRT matches to position: 2001144-2001165, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

23. spacer 9.3|2171514|22|CP026074|CRT matches to position: 2123998-2124019, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

24. spacer 9.3|2171514|22|CP026074|CRT matches to position: 2214857-2214878, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

25. spacer 9.3|2171514|22|CP026074|CRT matches to position: 2694090-2694111, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

26. spacer 1.1|110634|33|CP026074|CRISPRCasFinder matches to position: 1517842-1517874, mismatch: 1, identity: 0.97

attgggaatccaatttctctgtgttggggccca	CRISPR spacer
attgggaatccaatttctctttgttggggccca	Protospacer
******************** ************

27. spacer 1.1|110634|33|CP026074|CRISPRCasFinder matches to position: 2694187-2694219, mismatch: 1, identity: 0.97

attgggaatccaatttctctgtgttggggccca	CRISPR spacer
attgggaatccaatttctctttgttggggccca	Protospacer
******************** ************

28. spacer 2.1|581058|34|CP026074|CRISPRCasFinder matches to position: 230631-230664, mismatch: 1, identity: 0.971

ttgtagaatttcttttcgaaattctctgtgttgg	CRISPR spacer
ttgtagaatttcttttcgaaattctttgtgttgg	Protospacer
*************************.********

29. spacer 5.1|874024|31|CP026074|CRISPRCasFinder matches to position: 2178649-2178679, mismatch: 1, identity: 0.968

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgtcagct	Protospacer
***********************.*******

30. spacer 8.1|2165930|31|CP026074|CRISPRCasFinder matches to position: 145090-145120, mismatch: 1, identity: 0.968

ctgtgttggggccccgccaacttgcattgcc	CRISPR spacer
ctgtgttggggccccgccaacttccattgcc	Protospacer
*********************** *******

31. spacer 8.1|2165930|31|CP026074|CRISPRCasFinder matches to position: 1640960-1640990, mismatch: 1, identity: 0.968

ctgtgttggggccccgccaacttgcattgcc	CRISPR spacer
ctgtgttggggccccgccaacttgcattacc	Protospacer
****************************.**

32. spacer 9.1|2171397|22|CP026074|CRT matches to position: 144945-144966, mismatch: 1, identity: 0.955

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttctttacgaaa	Protospacer
**************** *****

33. spacer 9.1|2171397|22|CP026074|CRT matches to position: 145178-145199, mismatch: 1, identity: 0.955

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttctttacgaaa	Protospacer
**************** *****

34. spacer 9.1|2171397|22|CP026074|CRT matches to position: 2285089-2285110, mismatch: 1, identity: 0.955

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttagaaa	Protospacer
***************** ****

35. spacer 9.2|2171455|23|CP026074|CRT matches to position: 479304-479326, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

36. spacer 9.2|2171455|23|CP026074|CRT matches to position: 863170-863192, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

37. spacer 9.2|2171455|23|CP026074|CRT matches to position: 1517861-1517883, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

38. spacer 9.2|2171455|23|CP026074|CRT matches to position: 2124948-2124970, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

39. spacer 9.2|2171455|23|CP026074|CRT matches to position: 2125226-2125248, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

40. spacer 9.2|2171455|23|CP026074|CRT matches to position: 2694206-2694228, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

41. spacer 9.3|2171514|22|CP026074|CRT matches to position: 144945-144966, mismatch: 1, identity: 0.955

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttctttacgaaa	Protospacer
**************** *****

42. spacer 9.3|2171514|22|CP026074|CRT matches to position: 145178-145199, mismatch: 1, identity: 0.955

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttctttacgaaa	Protospacer
**************** *****

43. spacer 9.3|2171514|22|CP026074|CRT matches to position: 2285089-2285110, mismatch: 1, identity: 0.955

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttagaaa	Protospacer
***************** ****

44. spacer 9.4|2171572|23|CP026074|CRT matches to position: 479304-479326, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

45. spacer 9.4|2171572|23|CP026074|CRT matches to position: 863170-863192, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

46. spacer 9.4|2171572|23|CP026074|CRT matches to position: 1517861-1517883, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

47. spacer 9.4|2171572|23|CP026074|CRT matches to position: 2124948-2124970, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

48. spacer 9.4|2171572|23|CP026074|CRT matches to position: 2125226-2125248, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

49. spacer 9.4|2171572|23|CP026074|CRT matches to position: 2694206-2694228, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

50. spacer 10.1|2214808|34|CP026074|CRISPRCasFinder matches to position: 2694186-2694219, mismatch: 1, identity: 0.971

attgagaatccaatttctctttgttggggcccat	CRISPR spacer
attgggaatccaatttctctttgttggggcccat	Protospacer
****.*****************************

51. spacer 2.1|581058|34|CP026074|CRISPRCasFinder matches to position: 1313915-1313948, mismatch: 2, identity: 0.941

ttgtagaatttcttttcgaaattctctgtgttgg	CRISPR spacer
ttgtagaatttcttttcgaaattctttttgttgg	Protospacer
*************************.* ******

52. spacer 2.1|581058|34|CP026074|CRISPRCasFinder matches to position: 2698560-2698593, mismatch: 2, identity: 0.941

ttgtagaatttcttttcgaaattctctgtgttgg	CRISPR spacer
ttgtggaatttcttatcgaaattctctgtgttgg	Protospacer
****.********* *******************

53. spacer 5.1|874024|31|CP026074|CRISPRCasFinder matches to position: 125272-125302, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgccagct	Protospacer
***********************.*.*****

54. spacer 5.1|874024|31|CP026074|CRISPRCasFinder matches to position: 477898-477928, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

55. spacer 5.1|874024|31|CP026074|CRISPRCasFinder matches to position: 863223-863253, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

56. spacer 5.1|874024|31|CP026074|CRISPRCasFinder matches to position: 1038693-1038723, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgccagct	Protospacer
***********************.*.*****

57. spacer 5.1|874024|31|CP026074|CRISPRCasFinder matches to position: 1419038-1419068, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgccagct	Protospacer
***********************.*.*****

58. spacer 5.1|874024|31|CP026074|CRISPRCasFinder matches to position: 1717349-1717379, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

59. spacer 5.1|874024|31|CP026074|CRISPRCasFinder matches to position: 2001199-2001229, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

60. spacer 5.1|874024|31|CP026074|CRISPRCasFinder matches to position: 2215120-2215150, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgccagct	Protospacer
***********************.*.*****

61. spacer 5.1|874024|31|CP026074|CRISPRCasFinder matches to position: 2382607-2382637, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

62. spacer 5.1|874024|31|CP026074|CRISPRCasFinder matches to position: 2486528-2486558, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

63. spacer 5.1|874024|31|CP026074|CRISPRCasFinder matches to position: 2694145-2694175, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

64. spacer 5.1|874024|31|CP026074|CRISPRCasFinder matches to position: 2782580-2782610, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

65. spacer 9.2|2171455|23|CP026074|CRT matches to position: 581115-581137, mismatch: 2, identity: 0.913

tctgtagaaattggaaatccaat	CRISPR spacer
tctgttgaaattgggaatccaat	Protospacer
***** ********.********

66. spacer 9.2|2171455|23|CP026074|CRT matches to position: 2782527-2782549, mismatch: 2, identity: 0.913

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatacaat	Protospacer
**************.*** ****

67. spacer 9.4|2171572|23|CP026074|CRT matches to position: 581115-581137, mismatch: 2, identity: 0.913

tctgtagaaattggaaatccaat	CRISPR spacer
tctgttgaaattgggaatccaat	Protospacer
***** ********.********

68. spacer 9.4|2171572|23|CP026074|CRT matches to position: 2782527-2782549, mismatch: 2, identity: 0.913

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatacaat	Protospacer
**************.*** ****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP026074_9 9.2|2171455|23|CP026074|CRT 2171455-2171477 23 AP014226 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S44-C3, *** SEQUENCING IN PROGRESS *** 28490-28512 3 0.87
CP026074_9 9.2|2171455|23|CP026074|CRT 2171455-2171477 23 AP014225 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S41-C89, *** SEQUENCING IN PROGRESS *** 24653-24675 3 0.87
CP026074_9 9.4|2171572|23|CP026074|CRT 2171572-2171594 23 AP014226 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S44-C3, *** SEQUENCING IN PROGRESS *** 28490-28512 3 0.87
CP026074_9 9.4|2171572|23|CP026074|CRT 2171572-2171594 23 AP014225 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S41-C89, *** SEQUENCING IN PROGRESS *** 24653-24675 3 0.87
CP026074_4 4.1|720603|34|CP026074|CRISPRCasFinder 720603-720636 34 JN882286 Cronobacter phage vB_CsaP_GAP52, complete genome 23034-23067 8 0.765
CP026074_4 4.1|720603|34|CP026074|CRISPRCasFinder 720603-720636 34 CP030544 Staphylococcus aureus strain ER04166.3 plasmid unnamed2, complete sequence 7567-7600 8 0.765

1. spacer 9.2|2171455|23|CP026074|CRT matches to AP014226 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S44-C3, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.87

tctgtagaaattggaaatccaat	CRISPR spacer
actgtagaaaatggaaatccaac	Protospacer
 ********* ***********.

2. spacer 9.2|2171455|23|CP026074|CRT matches to AP014225 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S41-C89, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.87

tctgtagaaattggaaatccaat	CRISPR spacer
actgtagaaaatggaaatccaac	Protospacer
 ********* ***********.

3. spacer 9.4|2171572|23|CP026074|CRT matches to AP014226 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S44-C3, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.87

tctgtagaaattggaaatccaat	CRISPR spacer
actgtagaaaatggaaatccaac	Protospacer
 ********* ***********.

4. spacer 9.4|2171572|23|CP026074|CRT matches to AP014225 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S41-C89, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.87

tctgtagaaattggaaatccaat	CRISPR spacer
actgtagaaaatggaaatccaac	Protospacer
 ********* ***********.

5. spacer 4.1|720603|34|CP026074|CRISPRCasFinder matches to JN882286 (Cronobacter phage vB_CsaP_GAP52, complete genome) position: , mismatch: 8, identity: 0.765

ttgcatatctttagctttattgtttgcaactggg	CRISPR spacer
ttgcatatctttagctttatagcttttatatgct	Protospacer
******************** *.** .*  **  

6. spacer 4.1|720603|34|CP026074|CRISPRCasFinder matches to CP030544 (Staphylococcus aureus strain ER04166.3 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.765

ttgcatatctttagctttattgtttgcaactggg	CRISPR spacer
ttgaataactttagctttattgttataaacagta	Protospacer
*** *** ****************   *** * .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 819 : 25320 41 Staphylococcus_phage(80.0%) integrase attL 3395:3411|attR 30451:30467
DBSCAN-SWA_2 160277 : 169320 7 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_3 283348 : 354961 67 Staphylococcus_phage(95.74%) protease,tRNA NA
DBSCAN-SWA_4 361161 : 408941 74 Staphylococcus_phage(60.81%) tail,holin,head,terminase,portal,capsid,integrase,plate attL 365639:365654|attR 409003:409018
DBSCAN-SWA_5 503277 : 585998 103 Staphylococcus_phage(87.84%) tail,holin,head,terminase,protease,portal,capsid,integrase attL 552925:552942|attR 577138:577155
DBSCAN-SWA_6 709455 : 810965 103 Staphylococcus_phage(74.29%) tail,holin,head,terminase,protease,portal,capsid,integrase attL 771545:771560|attR 812732:812747
DBSCAN-SWA_7 1740833 : 1754556 23 Staphylococcus_phage(88.89%) integrase,terminase,coat attL 1733925:1733940|attR 1755722:1755737
DBSCAN-SWA_8 2103076 : 2110897 10 Hokovirus(16.67%) NA NA
DBSCAN-SWA_9 2122868 : 2137511 17 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_10 2310545 : 2364079 55 Streptococcus_phage(33.33%) bacteriocin,transposase,holin,protease,tRNA NA
DBSCAN-SWA_11 2384117 : 2392590 9 Synechococcus_phage(33.33%) NA NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
CP026074.1|AUU70826.1|2126694_2126796_+|hypothetical-protein 2126694_2126796_+ 33 aa aa NA NA NA 2122868-2137511 yes